rowid,run.accession,experiment.accession,sample.accession,study.accession,bioproject,study.title,study.alias,study.type,study.abstract,study.attributes,study.PMIDs,sample.description,sample.title,sample.alias,sample.centername,sample.attributes,GEOsample.title,GEOsample.dataprocessing,GEOsample.source,GEOsample.treatmentprotocol,GEOsample.extractprotocol,GEOsample.growthprotocol,GEOsample.characteristics,GEOsample.accession,experiment.title,experiment.alias,experiment.library_name,experiment.design_description,experiment.library_construction_protocol,experiment.attributes,experiment.library_strategy,experiment.library_source,experiment.library_selection,experiment.library_layout,experiment.platform,experiment.instrument_model,experiment.spot_descriptor,experiment.study_ref,run.title,run.attributes,run.filename,run.semantic_name,run.total_bases,run.total_spots,run.alias,run.read_lengths,run.base_counts,run.r1_length,run.r2_length,run.r3_length,run.r4_length,run.Acount,run.Ccount,run.Gcount,run.Tcount,run.Ncount,run.experiment,run.pool_member,submission.accession,submission.srasource,submission.bioprojectsource,seqdetective.n_mates,seqdetective.mapping_rate.mate1,seqdetective.mapping_rate.mate2,seqdetective.nofeature_rate.mate1,seqdetective.nofeature_rate.mate2,seqdetective.sparsity.mate1,seqdetective.sparsity.mate2,seqdetective.pos_strand_rate.mate1,seqdetective.pos_strand_rate.mate2,seqdetective.readlen.mate1,seqdetective.readlen.mate2,seqdetective.judgement.mate1,seqdetective.judgement.mate2,seqdetective.judgement.reason,platform_family,instrument_generation,read_bias,selection_class,prep_kit,sc_or_bulk,tech_class,technology,tech_variant,submission.bioprojectsource.country,earliest_date,devstage_curation,devstage_curation_coarse,tissue_curation,tissue_curation_coarse 62,DRR032762,DRX029568,DRS049967,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 50 individuals,Dr prime5 6 3,SAMD00028159,,sample name:Dr prime5 6 3|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:prime5 6|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028159,DRX029568,Dr prime5 6 3,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028159,,,,3903332800.0,39033328.0,DRR032762,0:100 1:0,A:1050045822;C:908538410;G:900588661;T:1044116537;N:43370,100,0,,,1050045822,908538410,900588661,1044116537,43370,DRX029568,DRS049967,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.92761,,0.07976,,0.69126,,0.46568,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Undetermined,Embryo,Whole Organism,All anatomical structures 63,DRR032761,DRX029567,DRS049966,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 50 individuals,Dr prime5 6 2,SAMD00028158,,sample name:Dr prime5 6 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:prime5 6|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028158,DRX029567,Dr prime5 6 2,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028158,,,,3678549700.0,36785497.0,DRR032761,0:100 1:0,A:986526644;C:857762765;G:853417738;T:980801764;N:40789,100,0,,,986526644,857762765,853417738,980801764,40789,DRX029567,DRS049966,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.92689,,0.07872,,0.6928,,0.46577,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Undetermined,Embryo,Whole Organism,All anatomical structures 64,DRR032760,DRX029566,DRS049965,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 50 individuals,Dr prime5 6 1,SAMD00028157,,sample name:Dr prime5 6 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:prime5 6|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028157,DRX029566,Dr prime5 6 1,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028157,,,,3863129500.0,38631295.0,DRR032760,0:100 1:0,A:1035240477;C:901625010;G:895370149;T:1030851937;N:41927,100,0,,,1035240477,901625010,895370149,1030851937,41927,DRX029566,DRS049965,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.92337,,0.07522,,0.69315,,0.46516,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Undetermined,Embryo,Whole Organism,All anatomical structures 65,DRR032759,DRX029565,DRS049964,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 50 individuals,Dr prime25 2,SAMD00028156,,sample name:Dr prime25 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:prime25|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028156,DRX029565,Dr prime25 2,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028156,,,,3750136100.0,37501361.0,DRR032759,0:100 1:0,A:1013528040;C:866734984;G:862431819;T:1007403208;N:38049,100,0,,,1013528040,866734984,862431819,1007403208,38049,DRX029565,DRS049964,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.92019,,0.09079,,0.68304,,0.47083,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Undetermined,Embryo,Whole Organism,All anatomical structures 66,DRR032758,DRX029564,DRS049963,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 50 individuals,Dr prime25 1,SAMD00028155,,sample name:Dr prime25 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:prime25|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028155,DRX029564,Dr prime25 1,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028155,,,,3544862700.0,35448627.0,DRR032758,0:100 1:0,A:952135895;C:825841753;G:821757889;T:945087927;N:39236,100,0,,,952135895,825841753,821757889,945087927,39236,DRX029564,DRS049963,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.92229,,0.08344,,0.68525,,0.466,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Undetermined,Embryo,Whole Organism,All anatomical structures 67,DRR032757,DRX029563,DRS049962,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 97 individuals,Dr bud 2,SAMD00028154,,sample name:Dr bud 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:bud|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028154,DRX029563,Dr bud 2,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028154,,,,4104778200.0,41047782.0,DRR032757,0:100 1:0,A:1116316188;C:944738800;G:936257056;T:1107423486;N:42670,100,0,,,1116316188,944738800,936257056,1107423486,42670,DRX029563,DRS049962,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.92945,,0.10493,,0.73407,,0.47824,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Undetermined,Embryo,Whole Organism,All anatomical structures 68,DRR032756,DRX029562,DRS049961,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 100 individuals,Dr bud 1,SAMD00028153,,sample name:Dr bud 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:bud|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028153,DRX029562,Dr bud 1,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028153,,,,4540291000.0,45402910.0,DRR032756,0:100 1:0,A:1237914068;C:1042346110;G:1033172731;T:1226799791;N:58300,100,0,,,1237914068,1042346110,1033172731,1226799791,58300,DRX029562,DRS049961,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.92628,,0.10478,,0.7391,,0.46461,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Undetermined,Embryo,Whole Organism,All anatomical structures 9337,ERR2865439,ERX2871399,ERS2871019,ERP111778,PRJEB29472,RNAseq analysis of slbp mutants in Zebrafish,ena-STUDY-Department of Cell and Developmental Biology-01-11-2018-15:10:58:144-14,Other,Through forward genetic screening for mutations affecting visual system development we identified prominent coloboma and cell autonomous retinal neuron differentiation lamination and retinal axon projection defects in eisspalte ele mutant zebrafish. Additional axonal deficits were present most notably at midline axon commissures. Genetic mapping and cloning of the ele mutation showed that the affected gene is slbp which encodes a conserved RNA stem loop binding protein involved in replication dependent histone mRNA metabolism. Cells throughout the central nervous system remained in the cell cycle in ele mutant embryos at stages when and locations where post mitotic cells have differentiated in wild type siblings. Indeed RNAseq analysis showed down regulation of many genes associated with neuronal differentiation. This was coincident with changes in the levels and spatial localisation of expression of various genes implicated for instance in axon guidance that likely underlie specific ele phenotypes. These results suggest that many of the cell and tissue specific phenotypes in ele mutant embryos are secondary to altered expression of modules of developmental regulatory genes that characterise or promote transitions in cell state and require the correct function of Slbp dependent histone and chromatin regulatory genes.,ENA FIRST PUBLIC:2018 11 02|ENA LAST UPDATE:2018 11 01,,,sibling 3,SAMEA5059848,Department of Cell and Developmental Biology,ENA FIRST PUBLIC:2018 11 02T17:01:55Z|ENA LAST UPDATE:2018 11 01T15:11:02Z|External Id:SAMEA5059848|INSDC center name:Department of Cell and Developmental Biology|INSDC first public:2018 11 02T17:01:55Z|INSDC last update:2018 11 01T15:11:02Z|INSDC status:public|Submitter Id:ele sibling3|common name:zebrafish|sample name:ele sibling3|scientific name:Danio rerio,,,,,,,,,Illumina HiSeq 3000 paired end sequencing,ena EXPERIMENT Department of Cell and Developmental Biology 01 11 2018 15:10:57:717 6,unspecified,1,,,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 3000,,ERP111778,Illumina HiSeq 3000 paired end sequencing,ENA FIRST PUBLIC:2018 11 02|ENA LAST UPDATE:2018 11 16,ele_sib_F_CTTGTA_L004_R2_001.fastq.gz ele_sib_F_CTTGTA_L004_R1_001.fastq.gz,fastq fastq,2823621200.0,14118106.0,ena RUN Department of Cell and Developmental Biology 01 11 2018 15:10:57:717 6,0:100 1:100,A:752781583;C:663838191;G:656422705;T:750213027;N:365694,100,100,,,752781583,663838191,656422705,750213027,365694,ERX2871399,ERS2871019,ERA1643817,Department of Cell and Developmental Biology|European Nucleotide Archive,Department of Cell and Developmental Biology,2,0.95595,0.95486,0.09407,0.09431,0.67529,0.67673,0.45173,0.44515,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2018-11-01,Undetermined,Embryo,Undetermined,Embryo Imprecise 9338,ERR2865438,ERX2871398,ERS2871018,ERP111778,PRJEB29472,RNAseq analysis of slbp mutants in Zebrafish,ena-STUDY-Department of Cell and Developmental Biology-01-11-2018-15:10:58:144-14,Other,Through forward genetic screening for mutations affecting visual system development we identified prominent coloboma and cell autonomous retinal neuron differentiation lamination and retinal axon projection defects in eisspalte ele mutant zebrafish. Additional axonal deficits were present most notably at midline axon commissures. Genetic mapping and cloning of the ele mutation showed that the affected gene is slbp which encodes a conserved RNA stem loop binding protein involved in replication dependent histone mRNA metabolism. Cells throughout the central nervous system remained in the cell cycle in ele mutant embryos at stages when and locations where post mitotic cells have differentiated in wild type siblings. Indeed RNAseq analysis showed down regulation of many genes associated with neuronal differentiation. This was coincident with changes in the levels and spatial localisation of expression of various genes implicated for instance in axon guidance that likely underlie specific ele phenotypes. These results suggest that many of the cell and tissue specific phenotypes in ele mutant embryos are secondary to altered expression of modules of developmental regulatory genes that characterise or promote transitions in cell state and require the correct function of Slbp dependent histone and chromatin regulatory genes.,ENA FIRST PUBLIC:2018 11 02|ENA LAST UPDATE:2018 11 01,,,sibling 2,SAMEA5059847,Department of Cell and Developmental Biology,ENA FIRST PUBLIC:2018 11 02T17:01:55Z|ENA LAST UPDATE:2018 11 01T15:11:02Z|External Id:SAMEA5059847|INSDC center name:Department of Cell and Developmental Biology|INSDC first public:2018 11 02T17:01:55Z|INSDC last update:2018 11 01T15:11:02Z|INSDC status:public|Submitter Id:ele sibling2|common name:zebrafish|sample name:ele sibling2|scientific name:Danio rerio,,,,,,,,,Illumina HiSeq 3000 paired end sequencing,ena EXPERIMENT Department of Cell and Developmental Biology 01 11 2018 15:10:57:717 5,unspecified,1,,,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 3000,,ERP111778,Illumina HiSeq 3000 paired end sequencing,ENA FIRST PUBLIC:2018 11 02|ENA LAST UPDATE:2018 11 16,ele_sib_D_GCCAAT_L004_R1_001.fastq.gz ele_sib_D_GCCAAT_L004_R2_001.fastq.gz,fastq fastq,4217962600.0,21089813.0,ena RUN Department of Cell and Developmental Biology 01 11 2018 15:10:57:717 5,0:100 1:100,A:1119324653;C:996982862;G:984906708;T:1116209552;N:538825,100,100,,,1119324653,996982862,984906708,1116209552,538825,ERX2871398,ERS2871018,ERA1643817,Department of Cell and Developmental Biology|European Nucleotide Archive,Department of Cell and Developmental Biology,2,0.95341,0.95274,0.09215,0.09238,0.67296,0.67493,0.46185,0.4648,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2018-11-01,Undetermined,Embryo,Undetermined,Embryo Imprecise 9339,ERR2865437,ERX2871397,ERS2871017,ERP111778,PRJEB29472,RNAseq analysis of slbp mutants in Zebrafish,ena-STUDY-Department of Cell and Developmental Biology-01-11-2018-15:10:58:144-14,Other,Through forward genetic screening for mutations affecting visual system development we identified prominent coloboma and cell autonomous retinal neuron differentiation lamination and retinal axon projection defects in eisspalte ele mutant zebrafish. Additional axonal deficits were present most notably at midline axon commissures. Genetic mapping and cloning of the ele mutation showed that the affected gene is slbp which encodes a conserved RNA stem loop binding protein involved in replication dependent histone mRNA metabolism. Cells throughout the central nervous system remained in the cell cycle in ele mutant embryos at stages when and locations where post mitotic cells have differentiated in wild type siblings. Indeed RNAseq analysis showed down regulation of many genes associated with neuronal differentiation. This was coincident with changes in the levels and spatial localisation of expression of various genes implicated for instance in axon guidance that likely underlie specific ele phenotypes. These results suggest that many of the cell and tissue specific phenotypes in ele mutant embryos are secondary to altered expression of modules of developmental regulatory genes that characterise or promote transitions in cell state and require the correct function of Slbp dependent histone and chromatin regulatory genes.,ENA FIRST PUBLIC:2018 11 02|ENA LAST UPDATE:2018 11 01,,,sibling 1,SAMEA5059846,Department of Cell and Developmental Biology,ENA FIRST PUBLIC:2018 11 02T17:01:55Z|ENA LAST UPDATE:2018 11 01T15:11:02Z|External Id:SAMEA5059846|INSDC center name:Department of Cell and Developmental Biology|INSDC first public:2018 11 02T17:01:55Z|INSDC last update:2018 11 01T15:11:02Z|INSDC status:public|Submitter Id:ele sibling1|common name:zebrafish|sample name:ele sibling1|scientific name:Danio rerio,,,,,,,,,Illumina HiSeq 3000 paired end sequencing,ena EXPERIMENT Department of Cell and Developmental Biology 01 11 2018 15:10:57:717 4,unspecified,1,,,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 3000,,ERP111778,Illumina HiSeq 3000 paired end sequencing,ENA FIRST PUBLIC:2018 11 02|ENA LAST UPDATE:2018 11 16,ele_sib_B_TGACCA_L004_R1_001.fastq.gz ele_sib_B_TGACCA_L004_R2_001.fastq.gz,fastq fastq,5241628000.0,26208140.0,ena RUN Department of Cell and Developmental Biology 01 11 2018 15:10:57:717 4,0:100 1:100,A:1393802799;C:1235804455;G:1219328189;T:1392021956;N:670601,100,100,,,1393802799,1235804455,1219328189,1392021956,670601,ERX2871397,ERS2871017,ERA1643817,Department of Cell and Developmental Biology|European Nucleotide Archive,Department of Cell and Developmental Biology,2,0.95296,0.95133,0.10275,0.1028,0.67018,0.67146,0.46488,0.46482,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2018-11-01,Undetermined,Embryo,Undetermined,Embryo Imprecise 9340,ERR2865436,ERX2871396,ERS2871016,ERP111778,PRJEB29472,RNAseq analysis of slbp mutants in Zebrafish,ena-STUDY-Department of Cell and Developmental Biology-01-11-2018-15:10:58:144-14,Other,Through forward genetic screening for mutations affecting visual system development we identified prominent coloboma and cell autonomous retinal neuron differentiation lamination and retinal axon projection defects in eisspalte ele mutant zebrafish. Additional axonal deficits were present most notably at midline axon commissures. Genetic mapping and cloning of the ele mutation showed that the affected gene is slbp which encodes a conserved RNA stem loop binding protein involved in replication dependent histone mRNA metabolism. Cells throughout the central nervous system remained in the cell cycle in ele mutant embryos at stages when and locations where post mitotic cells have differentiated in wild type siblings. Indeed RNAseq analysis showed down regulation of many genes associated with neuronal differentiation. This was coincident with changes in the levels and spatial localisation of expression of various genes implicated for instance in axon guidance that likely underlie specific ele phenotypes. These results suggest that many of the cell and tissue specific phenotypes in ele mutant embryos are secondary to altered expression of modules of developmental regulatory genes that characterise or promote transitions in cell state and require the correct function of Slbp dependent histone and chromatin regulatory genes.,ENA FIRST PUBLIC:2018 11 02|ENA LAST UPDATE:2018 11 01,,,mutant3,SAMEA5059845,Department of Cell and Developmental Biology,ENA FIRST PUBLIC:2018 11 02T17:01:55Z|ENA LAST UPDATE:2018 11 01T15:11:02Z|External Id:SAMEA5059845|INSDC center name:Department of Cell and Developmental Biology|INSDC first public:2018 11 02T17:01:55Z|INSDC last update:2018 11 01T15:11:02Z|INSDC status:public|Submitter Id:ele mutant3|common name:zebrafish|sample name:ele mutant3|scientific name:Danio rerio,,,,,,,,,Illumina HiSeq 3000 paired end sequencing,ena EXPERIMENT Department of Cell and Developmental Biology 01 11 2018 15:10:57:717 3,unspecified,1,,,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 3000,,ERP111778,Illumina HiSeq 3000 paired end sequencing,ENA FIRST PUBLIC:2018 11 02|ENA LAST UPDATE:2018 11 16,ele_E_CAGATC_L004_R1_001.fastq.gz ele_E_CAGATC_L004_R2_001.fastq.gz,fastq fastq,3529752000.0,17648760.0,ena RUN Department of Cell and Developmental Biology 01 11 2018 15:10:57:717 3,0:100 1:100,A:933354224;C:837396695;G:828677816;T:929860782;N:462483,100,100,,,933354224,837396695,828677816,929860782,462483,ERX2871396,ERS2871016,ERA1643817,Department of Cell and Developmental Biology|European Nucleotide Archive,Department of Cell and Developmental Biology,2,0.95621,0.95302,0.08584,0.08536,0.67048,0.67146,0.46615,0.46682,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2018-11-01,Undetermined,Embryo,Undetermined,Embryo Imprecise 9341,ERR2865435,ERX2871395,ERS2871015,ERP111778,PRJEB29472,RNAseq analysis of slbp mutants in Zebrafish,ena-STUDY-Department of Cell and Developmental Biology-01-11-2018-15:10:58:144-14,Other,Through forward genetic screening for mutations affecting visual system development we identified prominent coloboma and cell autonomous retinal neuron differentiation lamination and retinal axon projection defects in eisspalte ele mutant zebrafish. Additional axonal deficits were present most notably at midline axon commissures. Genetic mapping and cloning of the ele mutation showed that the affected gene is slbp which encodes a conserved RNA stem loop binding protein involved in replication dependent histone mRNA metabolism. Cells throughout the central nervous system remained in the cell cycle in ele mutant embryos at stages when and locations where post mitotic cells have differentiated in wild type siblings. Indeed RNAseq analysis showed down regulation of many genes associated with neuronal differentiation. This was coincident with changes in the levels and spatial localisation of expression of various genes implicated for instance in axon guidance that likely underlie specific ele phenotypes. These results suggest that many of the cell and tissue specific phenotypes in ele mutant embryos are secondary to altered expression of modules of developmental regulatory genes that characterise or promote transitions in cell state and require the correct function of Slbp dependent histone and chromatin regulatory genes.,ENA FIRST PUBLIC:2018 11 02|ENA LAST UPDATE:2018 11 01,,,mutant2,SAMEA5059844,Department of Cell and Developmental Biology,ENA FIRST PUBLIC:2018 11 02T17:01:55Z|ENA LAST UPDATE:2018 11 01T15:11:02Z|External Id:SAMEA5059844|INSDC center name:Department of Cell and Developmental Biology|INSDC first public:2018 11 02T17:01:55Z|INSDC last update:2018 11 01T15:11:02Z|INSDC status:public|Submitter Id:ele mutant2|common name:zebrafish|sample name:ele mutant2|scientific name:Danio rerio,,,,,,,,,Illumina HiSeq 3000 paired end sequencing,ena EXPERIMENT Department of Cell and Developmental Biology 01 11 2018 15:10:57:717 2,unspecified,1,,,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 3000,,ERP111778,Illumina HiSeq 3000 paired end sequencing,ENA FIRST PUBLIC:2018 11 02|ENA LAST UPDATE:2018 11 16,ele_C_ACAGTG_L004_R1_001.fastq.gz ele_C_ACAGTG_L004_R2_001.fastq.gz,fastq fastq,3119723800.0,15598619.0,ena RUN Department of Cell and Developmental Biology 01 11 2018 15:10:57:717 2,0:100 1:100,A:828335602;C:736691663;G:727853394;T:826449133;N:394008,100,100,,,828335602,736691663,727853394,826449133,394008,ERX2871395,ERS2871015,ERA1643817,Department of Cell and Developmental Biology|European Nucleotide Archive,Department of Cell and Developmental Biology,2,0.94967,0.94864,0.0992,0.09955,0.65928,0.66014,0.47042,0.46835,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2018-11-01,Undetermined,Embryo,Undetermined,Embryo Imprecise 9342,ERR2865434,ERX2871394,ERS2871014,ERP111778,PRJEB29472,RNAseq analysis of slbp mutants in Zebrafish,ena-STUDY-Department of Cell and Developmental Biology-01-11-2018-15:10:58:144-14,Other,Through forward genetic screening for mutations affecting visual system development we identified prominent coloboma and cell autonomous retinal neuron differentiation lamination and retinal axon projection defects in eisspalte ele mutant zebrafish. Additional axonal deficits were present most notably at midline axon commissures. Genetic mapping and cloning of the ele mutation showed that the affected gene is slbp which encodes a conserved RNA stem loop binding protein involved in replication dependent histone mRNA metabolism. Cells throughout the central nervous system remained in the cell cycle in ele mutant embryos at stages when and locations where post mitotic cells have differentiated in wild type siblings. Indeed RNAseq analysis showed down regulation of many genes associated with neuronal differentiation. This was coincident with changes in the levels and spatial localisation of expression of various genes implicated for instance in axon guidance that likely underlie specific ele phenotypes. These results suggest that many of the cell and tissue specific phenotypes in ele mutant embryos are secondary to altered expression of modules of developmental regulatory genes that characterise or promote transitions in cell state and require the correct function of Slbp dependent histone and chromatin regulatory genes.,ENA FIRST PUBLIC:2018 11 02|ENA LAST UPDATE:2018 11 01,,,mutant1,SAMEA5059843,Department of Cell and Developmental Biology,ENA FIRST PUBLIC:2018 11 02T17:01:55Z|ENA LAST UPDATE:2018 11 01T15:11:02Z|External Id:SAMEA5059843|INSDC center name:Department of Cell and Developmental Biology|INSDC first public:2018 11 02T17:01:55Z|INSDC last update:2018 11 01T15:11:02Z|INSDC status:public|Submitter Id:ele mutant1|common name:zebrafish|sample name:ele mutant1|scientific name:Danio rerio,,,,,,,,,Illumina HiSeq 3000 paired end sequencing,ena EXPERIMENT Department of Cell and Developmental Biology 01 11 2018 15:10:57:716 1,unspecified,1,,,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 3000,,ERP111778,Illumina HiSeq 3000 paired end sequencing,ENA FIRST PUBLIC:2018 11 02|ENA LAST UPDATE:2018 11 16,ele_A_CGATGT_L004_R1_001.fastq.gz ele_A_CGATGT_L004_R2_001.fastq.gz,fastq fastq,2181939600.0,10909698.0,ena RUN Department of Cell and Developmental Biology 01 11 2018 15:10:57:717 1,0:100 1:100,A:578028200;C:516249107;G:510965740;T:576417363;N:279190,100,100,,,578028200,516249107,510965740,576417363,279190,ERX2871394,ERS2871014,ERA1643817,Department of Cell and Developmental Biology|European Nucleotide Archive,Department of Cell and Developmental Biology,2,0.94968,0.94939,0.1131,0.11293,0.66245,0.66251,0.46654,0.47475,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2018-11-01,Undetermined,Embryo,Undetermined,Embryo Imprecise 10206,ERR6474244,ERX6101519,ERS7377049,ERP131171,PRJEB46937,RNA Affinity Purification followed by sequencing RAP seq allows identification of transcriptome wide RBP binding sites using recombinant RBPs and total purified cellular RNA,E-MTAB-10834,Other,RAP seq is a new method that provides in vitro derived RNA Interactomes for any given RBP. In RAP seq a recombinant RBP is produced as fusion with a HaloTag which is used to recover and purify the RBP of interest. The RBP Halo fusion is then incubated with fragmented total RNA derived from any given sample of interest. The bound RNA fragments are subsequently eluted and cloned using a small RNA library preparation protocol for sequencing the pool of bound molecules on an Illumina NGS platform. In this study RAP seq was used to identify RNA Interactomes of 26 novel RBPs aka non canonical RBPs newly discovered in proteome wide studies as RNA binders. RAP seq was also used to profile vertebrate HuR orthologs and described the biochemical evolutionary differences and similarities of the 6 orthologs profiled. Cancer associated IGF2BP1 IGF2BP2 and IGF2BP3 variants were also profiled and transcriptome wide changes in their RNA Interactomes with respect to the wild type IGF2BPs were reported. Also a transcriptome wide cooperative binding assay was perfomed to evaluate the cooperative roles of HuR and PTBP1 in binding to their native RNA targets. In addition a typical RAP seq substrate fragmented total RNA if reverse transcribed into cDNA and than in vitro transcribed again using a T7 RNA Polymerase can be depleted of any native endogenous RNA modifications and RAP seq assyas perfomed in parallel with the native substrate and the T7 RNAP produced one allowed us to discern the m6A dependency in transcriptome wide binding events for YTHDF1 hence with RAP seq we also report T7 RAP seq.,ENA FIRST PUBLIC:2023 08 11|ENA LAST UPDATE:2023 08 11,,Protocols: HepG2 were obtained from American Type Culture Collection ATCC Rockville MD. The cell line was mycoplasma free when periodically tested with Mycoplasmacheck Eurofins Genomics. HepG2 were cultured in T75 flasks at 37 °C and 5 % CO2 atmosphere using Dulbecco's Modified Eagle Medium DMEM supplemented with 1/100 Penicillin/Streptomycin P/S Sigma and 10 % fetal bovine serum Hyclone GE healthcare. HepG2 cells were maintained by splitting 1/6 three times a week done by aspirating the medium gently washing the cells with phosphate buffered saline PBS without xxx+ Sigma and detaching them with 2 mL of a trypsin EDTA solution 0.05% Sigma for 3 5 min. Trypsin EDTA was inactivated with a minimum of 10 fold surplus of culture medium before a cell fraction was passaged Substrate preparation: DNAse treated and column cleaned total RNA was fragmeted at 95 degrees celsius in Tris HCl 80 mM and MgCl2 8 mM final concentrations for 4 minutes and 30 seconds. post fragmentation the RNA was cleaned using 1 volume of RNA CleanXP Ampure beads and 1 volume of isopropanol; post 2 80% Ethanol washes the RNA was eluted in half the volume of AMPure beads used. three prime dephosphorylation was then performed with T4PNK in TAM buffer Tris Acetate 50 mM Magnesium Chloride 10 mM pH8.5 at room temperature for 4 hours followed by AMPure clean up and subsequently five prime phosphorylated with T4PNK in T4PNK buffer with addition of ATP at 37 degreees celsius for 1 hour according to NEB manufacturer instructions then AMPure cleaned and aliquoted and stored at 80 degrees celsius until further used. Binding Assay: RBP Halo fusions are in vitro transcribed and then translated with MegaScript T7 in vitro transcription kit ThermoFisher and Wheat Germ extract according to manufacturers instructions 50 ul in vitro translation reaction. The in vitro translated proteins are recovered using 25 ul Magne Halo Ligand beads Promega washed and resuspended in PBSN 1X PBS 0 005% NP 40 with added RNAse A and Turbo DNAse Thermo. post 1 hour of incubation the beads are washed 4 times twice with high salt PBSN + 1M MgCl2 and twice with normal salt PBSN. Beads are ruspended in 50 ul of PBSN and mixed with one aliquote of substrate RNA 150 ng in total brought to room temperature and diluted to a final volume of 50 ul of PBSN. The binding reaction occurs at room temperature for one hour rotating end over end subsequently 3 washes in PBSN are performed to remove unbound molecules and elution is perfomed in 15 ul of RNAse free water at 70 degrees celsius for 8 minutes resuspending the beads by pipeting up and down whilst the tube is in the thermocycler for a total of 3 times during the 8 minutes at 70 degrees. 11 ul of the eluted RNA are used to prepare an illumina compatible next generation sequencing library. Upon cell harvest 700 µL Qiazol QIAGEN was directly added onto the cells on ice and mixed. The cell extract was either stored at 80 °C or RNA extraction was continued immediately by adding 140 µL chloroform. This Qiazol/chloroform mixture was shaken for 30 sec and incubated at RT for 3 min before centrifugation at 9.000 g for 5 min at 4 °C. The upper aqueous phase was transferred to a new tube and an equal volume of isopropanol was added. The tube was inverted 5 times followed by 10 min incubation at RT. The mixture was centrifuged at 9.000 g and 4 °C for 10 min and the supernatant discarded. The pellet was washed in 700 µL cold 70% ethanol and centrifuged at 15.000 g for 5 min at 4 °C. The supernatant was discarded entirely and the pellet air dried for 5 minutes before resuspension in nuclease free water. RNA concentration was determined by nanodrop Nanodrop 2000c. RNA was DNase treated using the Turbo DNase Kit Thermo Fisher for 30 min at 37 °C and the reaction was column purified using RNA Clean&Concentrator kit Zymo Research. The library preparation was carried out using the NEXTFLEX small RNA library preparation kit v3 PerkinElmer catalog # NOVA 5132 06 according to manufacturer instructions. The quality of every cDNA library was determined on an Agilent Bioanalyzer instrument according to the manufacturer's protocol.,InputFISH,E MTAB 10834:InputFISH,,isolate:not applicable|disease:normal|ENA FIRST PUBLIC:2023 08 11T00:23:05Z|organism:Danio rerio|organism:Danio rerio|ENA LAST UPDATE:2023 08 11T00:23:05Z|cell line:1|scientific name:Danio rerio|common name:zebrafish|organism part:liver|cell type:hepatocyte|genotype:wild type genotype|ENA FIRST PUBLIC:2023 08 11|ENA LAST UPDATE:2023 08 11,,,,,,,,,NextSeq 550 paired end sequencing; RNA Affinity Purification followed by sequencing RAP seq allows identification of transcriptome wide RBP binding sites using recombinant RBPs and total purified cellular RNA,E MTAB 10834:InputFISH p,InputFISH p,RNA Affinity Purification followed by sequencing RAP seq allows identification of transcriptome wide RBP binding sites using recombinant RBPs and total purified cellular RNA,HepG2 were obtained from American Type Culture Collection ATCC Rockville MD. The cell line was mycoplasma free when periodically tested with Mycoplasmacheck Eurofins Genomics. HepG2 were cultured in T75 flasks at 37 °C and 5 % CO2 atmosphere using Dulbecco's Modified Eagle Medium DMEM supplemented with 1/100 Penicillin/Streptomycin P/S Sigma and 10 % fetal bovine serum Hyclone GE healthcare. HepG2 cells were maintained by splitting 1/6 three times a week done by aspirating the medium gently washing the cells with phosphate buffered saline PBS without xxx+ Sigma and detaching them with 2 mL of a trypsin EDTA solution 0.05% Sigma for 3 5 min. Trypsin EDTA was inactivated with a minimum of 10 fold surplus of culture medium before a cell fraction was passaged Substrate preparation: DNAse treated and column cleaned total RNA was fragmeted at 95 degrees celsius in Tris HCl 80 mM and MgCl2 8 mM final concentrations for 4 minutes and 30 seconds. post fragmentation the RNA was cleaned using 1 volume of RNA CleanXP Ampure beads and 1 volume of isopropanol; post 2 80% Ethanol washes the RNA was eluted in half the volume of AMPure beads used. three prime dephosphorylation was then performed with T4PNK in TAM buffer Tris Acetate 50 mM Magnesium Chloride 10 mM pH8.5 at room temperature for 4 hours followed by AMPure clean up and subsequently five prime phosphorylated with T4PNK in T4PNK buffer with addition of ATP at 37 degreees celsius for 1 hour according to NEB manufacturer instructions then AMPure cleaned and aliquoted and stored at 80 degrees celsius until further used. Binding Assay: RBP Halo fusions are in vitro transcribed and then translated with MegaScript T7 in vitro transcription kit ThermoFisher and Wheat Germ extract according to manufacturers instructions 50 ul in vitro translation reaction. The in vitro translated proteins are recovered using 25 ul Magne Halo Ligand beads Promega washed and resuspended in PBSN 1X PBS 0 005% NP 40 with added RNAse A and Turbo DNAse Thermo. post 1 hour of incubation the beads are washed 4 times twice with high salt PBSN + 1M MgCl2 and twice with normal salt PBSN. Beads are ruspended in 50 ul of PBSN and mixed with one aliquote of substrate RNA 150 ng in total brought to room temperature and diluted to a final volume of 50 ul of PBSN. The binding reaction occurs at room temperature for one hour rotating end over end subsequently 3 washes in PBSN are performed to remove unbound molecules and elution is perfomed in 15 ul of RNAse free water at 70 degrees celsius for 8 minutes resuspending the beads by pipeting up and down whilst the tube is in the thermocycler for a total of 3 times during the 8 minutes at 70 degrees. 11 ul of the eluted RNA are used to prepare an illumina compatible next generation sequencing library. Upon cell harvest 700 µL Qiazol QIAGEN was directly added onto the cells on ice and mixed. The cell extract was either stored at 80 °C or RNA extraction was continued immediately by adding 140 µL chloroform. This Qiazol/chloroform mixture was shaken for 30 sec and incubated at RT for 3 min before centrifugation at 9.000 g for 5 min at 4 °C. The upper aqueous phase was transferred to a new tube and an equal volume of isopropanol was added. The tube was inverted 5 times followed by 10 min incubation at RT. The mixture was centrifuged at 9.000 g and 4 °C for 10 min and the supernatant discarded. The pellet was washed in 700 µL cold 70% ethanol and centrifuged at 15.000 g for 5 min at 4 °C. The supernatant was discarded entirely and the pellet air dried for 5 minutes before resuspension in nuclease free water. RNA concentration was determined by nanodrop Nanodrop 2000c. RNA was DNase treated using the Turbo DNase Kit Thermo Fisher for 30 min at 37 °C and the reaction was column purified using RNA Clean&Concentrator kit Zymo Research. The library preparation was carried out using the NEXTFLEX small RNA library preparation kit v3 PerkinElmer catalog # NOVA 5132 06 according to manufacturer instructions. The quality of every cDNA library was determined on an Agilent Bioanalyzer instrument according to the manufacturer's protocol.,Experimental Factor: immunoprecipitate:input DNA|Experimental Factor: organism:Danio rerio,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,NextSeq 550,,ERP131171,NextSeq 550 paired end sequencing; RNA Affinity Purification followed by sequencing RAP seq allows identification of transcriptome wide RBP binding sites using recombinant RBPs and total purified cellular RNA,ENA FIRST PUBLIC:2023 08 11|ENA LAST UPDATE:2023 08 11,InputFISH.R1.fastq.gz InputFISH.R2.fastq.gz,fastq fastq,2014534500.0,24271500.0,E MTAB 10834:InputFISH.R,0:40 1:43,A:435725523;C:539145149;G:601092466;T:438298953;N:272409,40,43,,,435725523,539145149,601092466,438298953,272409,ERX6101519,ERS7377049,ERA5607540,"Department of Microbiology, Tumor, and Cell Biology, Karolinska Institute, Science for Life Laboratory, Sweden|European Nucleotide Archive","Department of Microbiology, Tumor, and Cell Biology, Karolinska Institute, Science for Life Laboratory, Sweden|European Nucleotide Archive",2,0.394,0.34957,0.09053,0.09378,0.96485,0.97323,0.73467,0.62676,40,43,B,B,biological fallback assumption,illumina,nextseq,unknown,small_rna,unknown,bulk,unknown,unknown,,Sweden,2023-08-11,Undetermined,Undetermined,Multi-tissue,Multi-system 10207,ERR6474223,ERX6101498,ERS7377028,ERP131171,PRJEB46937,RNA Affinity Purification followed by sequencing RAP seq allows identification of transcriptome wide RBP binding sites using recombinant RBPs and total purified cellular RNA,E-MTAB-10834,Other,RAP seq is a new method that provides in vitro derived RNA Interactomes for any given RBP. In RAP seq a recombinant RBP is produced as fusion with a HaloTag which is used to recover and purify the RBP of interest. The RBP Halo fusion is then incubated with fragmented total RNA derived from any given sample of interest. The bound RNA fragments are subsequently eluted and cloned using a small RNA library preparation protocol for sequencing the pool of bound molecules on an Illumina NGS platform. In this study RAP seq was used to identify RNA Interactomes of 26 novel RBPs aka non canonical RBPs newly discovered in proteome wide studies as RNA binders. RAP seq was also used to profile vertebrate HuR orthologs and described the biochemical evolutionary differences and similarities of the 6 orthologs profiled. Cancer associated IGF2BP1 IGF2BP2 and IGF2BP3 variants were also profiled and transcriptome wide changes in their RNA Interactomes with respect to the wild type IGF2BPs were reported. Also a transcriptome wide cooperative binding assay was perfomed to evaluate the cooperative roles of HuR and PTBP1 in binding to their native RNA targets. In addition a typical RAP seq substrate fragmented total RNA if reverse transcribed into cDNA and than in vitro transcribed again using a T7 RNA Polymerase can be depleted of any native endogenous RNA modifications and RAP seq assyas perfomed in parallel with the native substrate and the T7 RNAP produced one allowed us to discern the m6A dependency in transcriptome wide binding events for YTHDF1 hence with RAP seq we also report T7 RAP seq.,ENA FIRST PUBLIC:2023 08 11|ENA LAST UPDATE:2023 08 11,,Protocols: HepG2 were obtained from American Type Culture Collection ATCC Rockville MD. The cell line was mycoplasma free when periodically tested with Mycoplasmacheck Eurofins Genomics. HepG2 were cultured in T75 flasks at 37 °C and 5 % CO2 atmosphere using Dulbecco's Modified Eagle Medium DMEM supplemented with 1/100 Penicillin/Streptomycin P/S Sigma and 10 % fetal bovine serum Hyclone GE healthcare. HepG2 cells were maintained by splitting 1/6 three times a week done by aspirating the medium gently washing the cells with phosphate buffered saline PBS without xxx+ Sigma and detaching them with 2 mL of a trypsin EDTA solution 0.05% Sigma for 3 5 min. Trypsin EDTA was inactivated with a minimum of 10 fold surplus of culture medium before a cell fraction was passaged Substrate preparation: DNAse treated and column cleaned total RNA was fragmeted at 95 degrees celsius in Tris HCl 80 mM and MgCl2 8 mM final concentrations for 4 minutes and 30 seconds. post fragmentation the RNA was cleaned using 1 volume of RNA CleanXP Ampure beads and 1 volume of isopropanol; post 2 80% Ethanol washes the RNA was eluted in half the volume of AMPure beads used. three prime dephosphorylation was then performed with T4PNK in TAM buffer Tris Acetate 50 mM Magnesium Chloride 10 mM pH8.5 at room temperature for 4 hours followed by AMPure clean up and subsequently five prime phosphorylated with T4PNK in T4PNK buffer with addition of ATP at 37 degreees celsius for 1 hour according to NEB manufacturer instructions then AMPure cleaned and aliquoted and stored at 80 degrees celsius until further used. Binding Assay: RBP Halo fusions are in vitro transcribed and then translated with MegaScript T7 in vitro transcription kit ThermoFisher and Wheat Germ extract according to manufacturers instructions 50 ul in vitro translation reaction. The in vitro translated proteins are recovered using 25 ul Magne Halo Ligand beads Promega washed and resuspended in PBSN 1X PBS 0 005% NP 40 with added RNAse A and Turbo DNAse Thermo. post 1 hour of incubation the beads are washed 4 times twice with high salt PBSN + 1M MgCl2 and twice with normal salt PBSN. Beads are ruspended in 50 ul of PBSN and mixed with one aliquote of substrate RNA 150 ng in total brought to room temperature and diluted to a final volume of 50 ul of PBSN. The binding reaction occurs at room temperature for one hour rotating end over end subsequently 3 washes in PBSN are performed to remove unbound molecules and elution is perfomed in 15 ul of RNAse free water at 70 degrees celsius for 8 minutes resuspending the beads by pipeting up and down whilst the tube is in the thermocycler for a total of 3 times during the 8 minutes at 70 degrees. 11 ul of the eluted RNA are used to prepare an illumina compatible next generation sequencing library. Upon cell harvest 700 µL Qiazol QIAGEN was directly added onto the cells on ice and mixed. The cell extract was either stored at 80 °C or RNA extraction was continued immediately by adding 140 µL chloroform. This Qiazol/chloroform mixture was shaken for 30 sec and incubated at RT for 3 min before centrifugation at 9.000 g for 5 min at 4 °C. The upper aqueous phase was transferred to a new tube and an equal volume of isopropanol was added. The tube was inverted 5 times followed by 10 min incubation at RT. The mixture was centrifuged at 9.000 g and 4 °C for 10 min and the supernatant discarded. The pellet was washed in 700 µL cold 70% ethanol and centrifuged at 15.000 g for 5 min at 4 °C. The supernatant was discarded entirely and the pellet air dried for 5 minutes before resuspension in nuclease free water. RNA concentration was determined by nanodrop Nanodrop 2000c. RNA was DNase treated using the Turbo DNase Kit Thermo Fisher for 30 min at 37 °C and the reaction was column purified using RNA Clean&Concentrator kit Zymo Research. The library preparation was carried out using the NEXTFLEX small RNA library preparation kit v3 PerkinElmer catalog # NOVA 5132 06 according to manufacturer instructions. The quality of every cDNA library was determined on an Agilent Bioanalyzer instrument according to the manufacturer's protocol.,hsHuRFISH rep2,E MTAB 10834:hsHuRFISH rep2,,isolate:not applicable|disease:normal|ENA FIRST PUBLIC:2023 08 11T00:23:05Z|organism:Danio rerio|organism:Danio rerio|ENA LAST UPDATE:2023 08 11T00:23:05Z|cell line:1|scientific name:Danio rerio|common name:zebrafish|organism part:liver|cell type:hepatocyte|genotype:wild type genotype|ENA FIRST PUBLIC:2023 08 11|ENA LAST UPDATE:2023 08 11,,,,,,,,,NextSeq 550 paired end sequencing; RNA Affinity Purification followed by sequencing RAP seq allows identification of transcriptome wide RBP binding sites using recombinant RBPs and total purified cellular RNA,E MTAB 10834:hsHuRFISH rep2 p,hsHuRFISH rep2 p,RNA Affinity Purification followed by sequencing RAP seq allows identification of transcriptome wide RBP binding sites using recombinant RBPs and total purified cellular RNA,HepG2 were obtained from American Type Culture Collection ATCC Rockville MD. The cell line was mycoplasma free when periodically tested with Mycoplasmacheck Eurofins Genomics. HepG2 were cultured in T75 flasks at 37 °C and 5 % CO2 atmosphere using Dulbecco's Modified Eagle Medium DMEM supplemented with 1/100 Penicillin/Streptomycin P/S Sigma and 10 % fetal bovine serum Hyclone GE healthcare. HepG2 cells were maintained by splitting 1/6 three times a week done by aspirating the medium gently washing the cells with phosphate buffered saline PBS without xxx+ Sigma and detaching them with 2 mL of a trypsin EDTA solution 0.05% Sigma for 3 5 min. Trypsin EDTA was inactivated with a minimum of 10 fold surplus of culture medium before a cell fraction was passaged Substrate preparation: DNAse treated and column cleaned total RNA was fragmeted at 95 degrees celsius in Tris HCl 80 mM and MgCl2 8 mM final concentrations for 4 minutes and 30 seconds. post fragmentation the RNA was cleaned using 1 volume of RNA CleanXP Ampure beads and 1 volume of isopropanol; post 2 80% Ethanol washes the RNA was eluted in half the volume of AMPure beads used. three prime dephosphorylation was then performed with T4PNK in TAM buffer Tris Acetate 50 mM Magnesium Chloride 10 mM pH8.5 at room temperature for 4 hours followed by AMPure clean up and subsequently five prime phosphorylated with T4PNK in T4PNK buffer with addition of ATP at 37 degreees celsius for 1 hour according to NEB manufacturer instructions then AMPure cleaned and aliquoted and stored at 80 degrees celsius until further used. Binding Assay: RBP Halo fusions are in vitro transcribed and then translated with MegaScript T7 in vitro transcription kit ThermoFisher and Wheat Germ extract according to manufacturers instructions 50 ul in vitro translation reaction. The in vitro translated proteins are recovered using 25 ul Magne Halo Ligand beads Promega washed and resuspended in PBSN 1X PBS 0 005% NP 40 with added RNAse A and Turbo DNAse Thermo. post 1 hour of incubation the beads are washed 4 times twice with high salt PBSN + 1M MgCl2 and twice with normal salt PBSN. Beads are ruspended in 50 ul of PBSN and mixed with one aliquote of substrate RNA 150 ng in total brought to room temperature and diluted to a final volume of 50 ul of PBSN. The binding reaction occurs at room temperature for one hour rotating end over end subsequently 3 washes in PBSN are performed to remove unbound molecules and elution is perfomed in 15 ul of RNAse free water at 70 degrees celsius for 8 minutes resuspending the beads by pipeting up and down whilst the tube is in the thermocycler for a total of 3 times during the 8 minutes at 70 degrees. 11 ul of the eluted RNA are used to prepare an illumina compatible next generation sequencing library. Upon cell harvest 700 µL Qiazol QIAGEN was directly added onto the cells on ice and mixed. The cell extract was either stored at 80 °C or RNA extraction was continued immediately by adding 140 µL chloroform. This Qiazol/chloroform mixture was shaken for 30 sec and incubated at RT for 3 min before centrifugation at 9.000 g for 5 min at 4 °C. The upper aqueous phase was transferred to a new tube and an equal volume of isopropanol was added. The tube was inverted 5 times followed by 10 min incubation at RT. The mixture was centrifuged at 9.000 g and 4 °C for 10 min and the supernatant discarded. The pellet was washed in 700 µL cold 70% ethanol and centrifuged at 15.000 g for 5 min at 4 °C. The supernatant was discarded entirely and the pellet air dried for 5 minutes before resuspension in nuclease free water. RNA concentration was determined by nanodrop Nanodrop 2000c. RNA was DNase treated using the Turbo DNase Kit Thermo Fisher for 30 min at 37 °C and the reaction was column purified using RNA Clean&Concentrator kit Zymo Research. The library preparation was carried out using the NEXTFLEX small RNA library preparation kit v3 PerkinElmer catalog # NOVA 5132 06 according to manufacturer instructions. The quality of every cDNA library was determined on an Agilent Bioanalyzer instrument according to the manufacturer's protocol.,Experimental Factor: immunoprecipitate:anti hsHuR|Experimental Factor: organism:Danio rerio,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,NextSeq 550,,ERP131171,NextSeq 550 paired end sequencing; RNA Affinity Purification followed by sequencing RAP seq allows identification of transcriptome wide RBP binding sites using recombinant RBPs and total purified cellular RNA,ENA FIRST PUBLIC:2023 08 11|ENA LAST UPDATE:2023 08 11,hsHuRFISH_rep2.R2.fastq.gz hsHuRFISH_rep2.R1.fastq.gz,fastq fastq,2106598100.0,25380700.0,E MTAB 10834:hsHuRFISH rep2.R,0:40 1:43,A:503141361;C:548220448;G:569927989;T:485014455;N:293847,40,43,,,503141361,548220448,569927989,485014455,293847,ERX6101498,ERS7377028,ERA5607540,"Department of Microbiology, Tumor, and Cell Biology, Karolinska Institute, Science for Life Laboratory, Sweden|European Nucleotide Archive","Department of Microbiology, Tumor, and Cell Biology, Karolinska Institute, Science for Life Laboratory, Sweden|European Nucleotide Archive",2,0.76055,0.70626,0.18785,0.18742,0.92387,0.93533,0.72831,0.65481,40,43,B,B,biological fallback assumption,illumina,nextseq,unknown,small_rna,unknown,bulk,unknown,unknown,,Sweden,2023-08-11,Undetermined,Undetermined,Multi-tissue,Multi-system 10208,ERR6474222,ERX6101497,ERS7377027,ERP131171,PRJEB46937,RNA Affinity Purification followed by sequencing RAP seq allows identification of transcriptome wide RBP binding sites using recombinant RBPs and total purified cellular RNA,E-MTAB-10834,Other,RAP seq is a new method that provides in vitro derived RNA Interactomes for any given RBP. In RAP seq a recombinant RBP is produced as fusion with a HaloTag which is used to recover and purify the RBP of interest. The RBP Halo fusion is then incubated with fragmented total RNA derived from any given sample of interest. The bound RNA fragments are subsequently eluted and cloned using a small RNA library preparation protocol for sequencing the pool of bound molecules on an Illumina NGS platform. In this study RAP seq was used to identify RNA Interactomes of 26 novel RBPs aka non canonical RBPs newly discovered in proteome wide studies as RNA binders. RAP seq was also used to profile vertebrate HuR orthologs and described the biochemical evolutionary differences and similarities of the 6 orthologs profiled. Cancer associated IGF2BP1 IGF2BP2 and IGF2BP3 variants were also profiled and transcriptome wide changes in their RNA Interactomes with respect to the wild type IGF2BPs were reported. Also a transcriptome wide cooperative binding assay was perfomed to evaluate the cooperative roles of HuR and PTBP1 in binding to their native RNA targets. In addition a typical RAP seq substrate fragmented total RNA if reverse transcribed into cDNA and than in vitro transcribed again using a T7 RNA Polymerase can be depleted of any native endogenous RNA modifications and RAP seq assyas perfomed in parallel with the native substrate and the T7 RNAP produced one allowed us to discern the m6A dependency in transcriptome wide binding events for YTHDF1 hence with RAP seq we also report T7 RAP seq.,ENA FIRST PUBLIC:2023 08 11|ENA LAST UPDATE:2023 08 11,,Protocols: HepG2 were obtained from American Type Culture Collection ATCC Rockville MD. The cell line was mycoplasma free when periodically tested with Mycoplasmacheck Eurofins Genomics. HepG2 were cultured in T75 flasks at 37 °C and 5 % CO2 atmosphere using Dulbecco's Modified Eagle Medium DMEM supplemented with 1/100 Penicillin/Streptomycin P/S Sigma and 10 % fetal bovine serum Hyclone GE healthcare. HepG2 cells were maintained by splitting 1/6 three times a week done by aspirating the medium gently washing the cells with phosphate buffered saline PBS without xxx+ Sigma and detaching them with 2 mL of a trypsin EDTA solution 0.05% Sigma for 3 5 min. Trypsin EDTA was inactivated with a minimum of 10 fold surplus of culture medium before a cell fraction was passaged Substrate preparation: DNAse treated and column cleaned total RNA was fragmeted at 95 degrees celsius in Tris HCl 80 mM and MgCl2 8 mM final concentrations for 4 minutes and 30 seconds. post fragmentation the RNA was cleaned using 1 volume of RNA CleanXP Ampure beads and 1 volume of isopropanol; post 2 80% Ethanol washes the RNA was eluted in half the volume of AMPure beads used. three prime dephosphorylation was then performed with T4PNK in TAM buffer Tris Acetate 50 mM Magnesium Chloride 10 mM pH8.5 at room temperature for 4 hours followed by AMPure clean up and subsequently five prime phosphorylated with T4PNK in T4PNK buffer with addition of ATP at 37 degreees celsius for 1 hour according to NEB manufacturer instructions then AMPure cleaned and aliquoted and stored at 80 degrees celsius until further used. Binding Assay: RBP Halo fusions are in vitro transcribed and then translated with MegaScript T7 in vitro transcription kit ThermoFisher and Wheat Germ extract according to manufacturers instructions 50 ul in vitro translation reaction. The in vitro translated proteins are recovered using 25 ul Magne Halo Ligand beads Promega washed and resuspended in PBSN 1X PBS 0 005% NP 40 with added RNAse A and Turbo DNAse Thermo. post 1 hour of incubation the beads are washed 4 times twice with high salt PBSN + 1M MgCl2 and twice with normal salt PBSN. Beads are ruspended in 50 ul of PBSN and mixed with one aliquote of substrate RNA 150 ng in total brought to room temperature and diluted to a final volume of 50 ul of PBSN. The binding reaction occurs at room temperature for one hour rotating end over end subsequently 3 washes in PBSN are performed to remove unbound molecules and elution is perfomed in 15 ul of RNAse free water at 70 degrees celsius for 8 minutes resuspending the beads by pipeting up and down whilst the tube is in the thermocycler for a total of 3 times during the 8 minutes at 70 degrees. 11 ul of the eluted RNA are used to prepare an illumina compatible next generation sequencing library. Upon cell harvest 700 µL Qiazol QIAGEN was directly added onto the cells on ice and mixed. The cell extract was either stored at 80 °C or RNA extraction was continued immediately by adding 140 µL chloroform. This Qiazol/chloroform mixture was shaken for 30 sec and incubated at RT for 3 min before centrifugation at 9.000 g for 5 min at 4 °C. The upper aqueous phase was transferred to a new tube and an equal volume of isopropanol was added. The tube was inverted 5 times followed by 10 min incubation at RT. The mixture was centrifuged at 9.000 g and 4 °C for 10 min and the supernatant discarded. The pellet was washed in 700 µL cold 70% ethanol and centrifuged at 15.000 g for 5 min at 4 °C. The supernatant was discarded entirely and the pellet air dried for 5 minutes before resuspension in nuclease free water. RNA concentration was determined by nanodrop Nanodrop 2000c. RNA was DNase treated using the Turbo DNase Kit Thermo Fisher for 30 min at 37 °C and the reaction was column purified using RNA Clean&Concentrator kit Zymo Research. The library preparation was carried out using the NEXTFLEX small RNA library preparation kit v3 PerkinElmer catalog # NOVA 5132 06 according to manufacturer instructions. The quality of every cDNA library was determined on an Agilent Bioanalyzer instrument according to the manufacturer's protocol.,hsHuRFISH rep1,E MTAB 10834:hsHuRFISH rep1,,isolate:not applicable|disease:normal|ENA FIRST PUBLIC:2023 08 11T00:23:05Z|organism:Danio rerio|organism:Danio rerio|ENA LAST UPDATE:2023 08 11T00:23:05Z|cell line:1|scientific name:Danio rerio|common name:zebrafish|organism part:liver|cell type:hepatocyte|genotype:wild type genotype|ENA FIRST PUBLIC:2023 08 11|ENA LAST UPDATE:2023 08 11,,,,,,,,,NextSeq 550 paired end sequencing; RNA Affinity Purification followed by sequencing RAP seq allows identification of transcriptome wide RBP binding sites using recombinant RBPs and total purified cellular RNA,E MTAB 10834:hsHuRFISH rep1 p,hsHuRFISH rep1 p,RNA Affinity Purification followed by sequencing RAP seq allows identification of transcriptome wide RBP binding sites using recombinant RBPs and total purified cellular RNA,HepG2 were obtained from American Type Culture Collection ATCC Rockville MD. The cell line was mycoplasma free when periodically tested with Mycoplasmacheck Eurofins Genomics. HepG2 were cultured in T75 flasks at 37 °C and 5 % CO2 atmosphere using Dulbecco's Modified Eagle Medium DMEM supplemented with 1/100 Penicillin/Streptomycin P/S Sigma and 10 % fetal bovine serum Hyclone GE healthcare. HepG2 cells were maintained by splitting 1/6 three times a week done by aspirating the medium gently washing the cells with phosphate buffered saline PBS without xxx+ Sigma and detaching them with 2 mL of a trypsin EDTA solution 0.05% Sigma for 3 5 min. Trypsin EDTA was inactivated with a minimum of 10 fold surplus of culture medium before a cell fraction was passaged Substrate preparation: DNAse treated and column cleaned total RNA was fragmeted at 95 degrees celsius in Tris HCl 80 mM and MgCl2 8 mM final concentrations for 4 minutes and 30 seconds. post fragmentation the RNA was cleaned using 1 volume of RNA CleanXP Ampure beads and 1 volume of isopropanol; post 2 80% Ethanol washes the RNA was eluted in half the volume of AMPure beads used. three prime dephosphorylation was then performed with T4PNK in TAM buffer Tris Acetate 50 mM Magnesium Chloride 10 mM pH8.5 at room temperature for 4 hours followed by AMPure clean up and subsequently five prime phosphorylated with T4PNK in T4PNK buffer with addition of ATP at 37 degreees celsius for 1 hour according to NEB manufacturer instructions then AMPure cleaned and aliquoted and stored at 80 degrees celsius until further used. Binding Assay: RBP Halo fusions are in vitro transcribed and then translated with MegaScript T7 in vitro transcription kit ThermoFisher and Wheat Germ extract according to manufacturers instructions 50 ul in vitro translation reaction. The in vitro translated proteins are recovered using 25 ul Magne Halo Ligand beads Promega washed and resuspended in PBSN 1X PBS 0 005% NP 40 with added RNAse A and Turbo DNAse Thermo. post 1 hour of incubation the beads are washed 4 times twice with high salt PBSN + 1M MgCl2 and twice with normal salt PBSN. Beads are ruspended in 50 ul of PBSN and mixed with one aliquote of substrate RNA 150 ng in total brought to room temperature and diluted to a final volume of 50 ul of PBSN. The binding reaction occurs at room temperature for one hour rotating end over end subsequently 3 washes in PBSN are performed to remove unbound molecules and elution is perfomed in 15 ul of RNAse free water at 70 degrees celsius for 8 minutes resuspending the beads by pipeting up and down whilst the tube is in the thermocycler for a total of 3 times during the 8 minutes at 70 degrees. 11 ul of the eluted RNA are used to prepare an illumina compatible next generation sequencing library. Upon cell harvest 700 µL Qiazol QIAGEN was directly added onto the cells on ice and mixed. The cell extract was either stored at 80 °C or RNA extraction was continued immediately by adding 140 µL chloroform. This Qiazol/chloroform mixture was shaken for 30 sec and incubated at RT for 3 min before centrifugation at 9.000 g for 5 min at 4 °C. The upper aqueous phase was transferred to a new tube and an equal volume of isopropanol was added. The tube was inverted 5 times followed by 10 min incubation at RT. The mixture was centrifuged at 9.000 g and 4 °C for 10 min and the supernatant discarded. The pellet was washed in 700 µL cold 70% ethanol and centrifuged at 15.000 g for 5 min at 4 °C. The supernatant was discarded entirely and the pellet air dried for 5 minutes before resuspension in nuclease free water. RNA concentration was determined by nanodrop Nanodrop 2000c. RNA was DNase treated using the Turbo DNase Kit Thermo Fisher for 30 min at 37 °C and the reaction was column purified using RNA Clean&Concentrator kit Zymo Research. The library preparation was carried out using the NEXTFLEX small RNA library preparation kit v3 PerkinElmer catalog # NOVA 5132 06 according to manufacturer instructions. The quality of every cDNA library was determined on an Agilent Bioanalyzer instrument according to the manufacturer's protocol.,Experimental Factor: immunoprecipitate:anti hsHuR|Experimental Factor: organism:Danio rerio,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,NextSeq 550,,ERP131171,NextSeq 550 paired end sequencing; RNA Affinity Purification followed by sequencing RAP seq allows identification of transcriptome wide RBP binding sites using recombinant RBPs and total purified cellular RNA,ENA FIRST PUBLIC:2023 08 11|ENA LAST UPDATE:2023 08 11,hsHuRFISH_rep1.R1.fastq.gz hsHuRFISH_rep1.R2.fastq.gz,fastq fastq,2520623431.0,30368957.0,E MTAB 10834:hsHuRFISH rep1.R,0:40 1:43,A:604086659;C:653262791;G:679919989;T:582992802;N:361190,40,43,,,604086659,653262791,679919989,582992802,361190,ERX6101497,ERS7377027,ERA5607540,"Department of Microbiology, Tumor, and Cell Biology, Karolinska Institute, Science for Life Laboratory, Sweden|European Nucleotide Archive","Department of Microbiology, Tumor, and Cell Biology, Karolinska Institute, Science for Life Laboratory, Sweden|European Nucleotide Archive",2,0.76096,0.70783,0.18844,0.18848,0.92101,0.93275,0.7333,0.62616,40,43,B,B,biological fallback assumption,illumina,nextseq,unknown,small_rna,unknown,bulk,unknown,unknown,,Sweden,2023-08-11,Undetermined,Undetermined,Multi-tissue,Multi-system 10209,ERR6474221,ERX6101496,ERS7377026,ERP131171,PRJEB46937,RNA Affinity Purification followed by sequencing RAP seq allows identification of transcriptome wide RBP binding sites using recombinant RBPs and total purified cellular RNA,E-MTAB-10834,Other,RAP seq is a new method that provides in vitro derived RNA Interactomes for any given RBP. In RAP seq a recombinant RBP is produced as fusion with a HaloTag which is used to recover and purify the RBP of interest. The RBP Halo fusion is then incubated with fragmented total RNA derived from any given sample of interest. The bound RNA fragments are subsequently eluted and cloned using a small RNA library preparation protocol for sequencing the pool of bound molecules on an Illumina NGS platform. In this study RAP seq was used to identify RNA Interactomes of 26 novel RBPs aka non canonical RBPs newly discovered in proteome wide studies as RNA binders. RAP seq was also used to profile vertebrate HuR orthologs and described the biochemical evolutionary differences and similarities of the 6 orthologs profiled. Cancer associated IGF2BP1 IGF2BP2 and IGF2BP3 variants were also profiled and transcriptome wide changes in their RNA Interactomes with respect to the wild type IGF2BPs were reported. Also a transcriptome wide cooperative binding assay was perfomed to evaluate the cooperative roles of HuR and PTBP1 in binding to their native RNA targets. In addition a typical RAP seq substrate fragmented total RNA if reverse transcribed into cDNA and than in vitro transcribed again using a T7 RNA Polymerase can be depleted of any native endogenous RNA modifications and RAP seq assyas perfomed in parallel with the native substrate and the T7 RNAP produced one allowed us to discern the m6A dependency in transcriptome wide binding events for YTHDF1 hence with RAP seq we also report T7 RAP seq.,ENA FIRST PUBLIC:2023 08 11|ENA LAST UPDATE:2023 08 11,,Protocols: HepG2 were obtained from American Type Culture Collection ATCC Rockville MD. The cell line was mycoplasma free when periodically tested with Mycoplasmacheck Eurofins Genomics. HepG2 were cultured in T75 flasks at 37 °C and 5 % CO2 atmosphere using Dulbecco's Modified Eagle Medium DMEM supplemented with 1/100 Penicillin/Streptomycin P/S Sigma and 10 % fetal bovine serum Hyclone GE healthcare. HepG2 cells were maintained by splitting 1/6 three times a week done by aspirating the medium gently washing the cells with phosphate buffered saline PBS without xxx+ Sigma and detaching them with 2 mL of a trypsin EDTA solution 0.05% Sigma for 3 5 min. Trypsin EDTA was inactivated with a minimum of 10 fold surplus of culture medium before a cell fraction was passaged Substrate preparation: DNAse treated and column cleaned total RNA was fragmeted at 95 degrees celsius in Tris HCl 80 mM and MgCl2 8 mM final concentrations for 4 minutes and 30 seconds. post fragmentation the RNA was cleaned using 1 volume of RNA CleanXP Ampure beads and 1 volume of isopropanol; post 2 80% Ethanol washes the RNA was eluted in half the volume of AMPure beads used. three prime dephosphorylation was then performed with T4PNK in TAM buffer Tris Acetate 50 mM Magnesium Chloride 10 mM pH8.5 at room temperature for 4 hours followed by AMPure clean up and subsequently five prime phosphorylated with T4PNK in T4PNK buffer with addition of ATP at 37 degreees celsius for 1 hour according to NEB manufacturer instructions then AMPure cleaned and aliquoted and stored at 80 degrees celsius until further used. Binding Assay: RBP Halo fusions are in vitro transcribed and then translated with MegaScript T7 in vitro transcription kit ThermoFisher and Wheat Germ extract according to manufacturers instructions 50 ul in vitro translation reaction. The in vitro translated proteins are recovered using 25 ul Magne Halo Ligand beads Promega washed and resuspended in PBSN 1X PBS 0 005% NP 40 with added RNAse A and Turbo DNAse Thermo. post 1 hour of incubation the beads are washed 4 times twice with high salt PBSN + 1M MgCl2 and twice with normal salt PBSN. Beads are ruspended in 50 ul of PBSN and mixed with one aliquote of substrate RNA 150 ng in total brought to room temperature and diluted to a final volume of 50 ul of PBSN. The binding reaction occurs at room temperature for one hour rotating end over end subsequently 3 washes in PBSN are performed to remove unbound molecules and elution is perfomed in 15 ul of RNAse free water at 70 degrees celsius for 8 minutes resuspending the beads by pipeting up and down whilst the tube is in the thermocycler for a total of 3 times during the 8 minutes at 70 degrees. 11 ul of the eluted RNA are used to prepare an illumina compatible next generation sequencing library. Upon cell harvest 700 µL Qiazol QIAGEN was directly added onto the cells on ice and mixed. The cell extract was either stored at 80 °C or RNA extraction was continued immediately by adding 140 µL chloroform. This Qiazol/chloroform mixture was shaken for 30 sec and incubated at RT for 3 min before centrifugation at 9.000 g for 5 min at 4 °C. The upper aqueous phase was transferred to a new tube and an equal volume of isopropanol was added. The tube was inverted 5 times followed by 10 min incubation at RT. The mixture was centrifuged at 9.000 g and 4 °C for 10 min and the supernatant discarded. The pellet was washed in 700 µL cold 70% ethanol and centrifuged at 15.000 g for 5 min at 4 °C. The supernatant was discarded entirely and the pellet air dried for 5 minutes before resuspension in nuclease free water. RNA concentration was determined by nanodrop Nanodrop 2000c. RNA was DNase treated using the Turbo DNase Kit Thermo Fisher for 30 min at 37 °C and the reaction was column purified using RNA Clean&Concentrator kit Zymo Research. The library preparation was carried out using the NEXTFLEX small RNA library preparation kit v3 PerkinElmer catalog # NOVA 5132 06 according to manufacturer instructions. The quality of every cDNA library was determined on an Agilent Bioanalyzer instrument according to the manufacturer's protocol.,HaloFISH,E MTAB 10834:HaloFISH,,isolate:not applicable|disease:normal|ENA FIRST PUBLIC:2023 08 11T00:23:05Z|organism:Danio rerio|organism:Danio rerio|ENA LAST UPDATE:2023 08 11T00:23:05Z|cell line:1|scientific name:Danio rerio|common name:zebrafish|organism part:liver|cell type:hepatocyte|genotype:wild type genotype|ENA FIRST PUBLIC:2023 08 11|ENA LAST UPDATE:2023 08 11,,,,,,,,,NextSeq 550 paired end sequencing; RNA Affinity Purification followed by sequencing RAP seq allows identification of transcriptome wide RBP binding sites using recombinant RBPs and total purified cellular RNA,E MTAB 10834:HaloFISH p,HaloFISH p,RNA Affinity Purification followed by sequencing RAP seq allows identification of transcriptome wide RBP binding sites using recombinant RBPs and total purified cellular RNA,HepG2 were obtained from American Type Culture Collection ATCC Rockville MD. The cell line was mycoplasma free when periodically tested with Mycoplasmacheck Eurofins Genomics. HepG2 were cultured in T75 flasks at 37 °C and 5 % CO2 atmosphere using Dulbecco's Modified Eagle Medium DMEM supplemented with 1/100 Penicillin/Streptomycin P/S Sigma and 10 % fetal bovine serum Hyclone GE healthcare. HepG2 cells were maintained by splitting 1/6 three times a week done by aspirating the medium gently washing the cells with phosphate buffered saline PBS without xxx+ Sigma and detaching them with 2 mL of a trypsin EDTA solution 0.05% Sigma for 3 5 min. Trypsin EDTA was inactivated with a minimum of 10 fold surplus of culture medium before a cell fraction was passaged Substrate preparation: DNAse treated and column cleaned total RNA was fragmeted at 95 degrees celsius in Tris HCl 80 mM and MgCl2 8 mM final concentrations for 4 minutes and 30 seconds. post fragmentation the RNA was cleaned using 1 volume of RNA CleanXP Ampure beads and 1 volume of isopropanol; post 2 80% Ethanol washes the RNA was eluted in half the volume of AMPure beads used. three prime dephosphorylation was then performed with T4PNK in TAM buffer Tris Acetate 50 mM Magnesium Chloride 10 mM pH8.5 at room temperature for 4 hours followed by AMPure clean up and subsequently five prime phosphorylated with T4PNK in T4PNK buffer with addition of ATP at 37 degreees celsius for 1 hour according to NEB manufacturer instructions then AMPure cleaned and aliquoted and stored at 80 degrees celsius until further used. Binding Assay: RBP Halo fusions are in vitro transcribed and then translated with MegaScript T7 in vitro transcription kit ThermoFisher and Wheat Germ extract according to manufacturers instructions 50 ul in vitro translation reaction. The in vitro translated proteins are recovered using 25 ul Magne Halo Ligand beads Promega washed and resuspended in PBSN 1X PBS 0 005% NP 40 with added RNAse A and Turbo DNAse Thermo. post 1 hour of incubation the beads are washed 4 times twice with high salt PBSN + 1M MgCl2 and twice with normal salt PBSN. Beads are ruspended in 50 ul of PBSN and mixed with one aliquote of substrate RNA 150 ng in total brought to room temperature and diluted to a final volume of 50 ul of PBSN. The binding reaction occurs at room temperature for one hour rotating end over end subsequently 3 washes in PBSN are performed to remove unbound molecules and elution is perfomed in 15 ul of RNAse free water at 70 degrees celsius for 8 minutes resuspending the beads by pipeting up and down whilst the tube is in the thermocycler for a total of 3 times during the 8 minutes at 70 degrees. 11 ul of the eluted RNA are used to prepare an illumina compatible next generation sequencing library. Upon cell harvest 700 µL Qiazol QIAGEN was directly added onto the cells on ice and mixed. The cell extract was either stored at 80 °C or RNA extraction was continued immediately by adding 140 µL chloroform. This Qiazol/chloroform mixture was shaken for 30 sec and incubated at RT for 3 min before centrifugation at 9.000 g for 5 min at 4 °C. The upper aqueous phase was transferred to a new tube and an equal volume of isopropanol was added. The tube was inverted 5 times followed by 10 min incubation at RT. The mixture was centrifuged at 9.000 g and 4 °C for 10 min and the supernatant discarded. The pellet was washed in 700 µL cold 70% ethanol and centrifuged at 15.000 g for 5 min at 4 °C. The supernatant was discarded entirely and the pellet air dried for 5 minutes before resuspension in nuclease free water. RNA concentration was determined by nanodrop Nanodrop 2000c. RNA was DNase treated using the Turbo DNase Kit Thermo Fisher for 30 min at 37 °C and the reaction was column purified using RNA Clean&Concentrator kit Zymo Research. The library preparation was carried out using the NEXTFLEX small RNA library preparation kit v3 PerkinElmer catalog # NOVA 5132 06 according to manufacturer instructions. The quality of every cDNA library was determined on an Agilent Bioanalyzer instrument according to the manufacturer's protocol.,Experimental Factor: immunoprecipitate:anti HaloTag|Experimental Factor: organism:Danio rerio,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,NextSeq 550,,ERP131171,NextSeq 550 paired end sequencing; RNA Affinity Purification followed by sequencing RAP seq allows identification of transcriptome wide RBP binding sites using recombinant RBPs and total purified cellular RNA,ENA FIRST PUBLIC:2023 08 11|ENA LAST UPDATE:2023 08 11,HaloFISH.R2.fastq.gz HaloFISH.R1.fastq.gz,fastq fastq,2353027590.0,28349730.0,E MTAB 10834:HaloFISH.R,0:40 1:43,A:522964401;C:650152942;G:677020220;T:502555313;N:334714,40,43,,,522964401,650152942,677020220,502555313,334714,ERX6101496,ERS7377026,ERA5607540,"Department of Microbiology, Tumor, and Cell Biology, Karolinska Institute, Science for Life Laboratory, Sweden|European Nucleotide Archive","Department of Microbiology, Tumor, and Cell Biology, Karolinska Institute, Science for Life Laboratory, Sweden|European Nucleotide Archive",2,0.82307,0.78117,0.18309,0.18609,0.93888,0.94627,0.73861,0.63812,40,43,B,B,biological fallback assumption,illumina,nextseq,unknown,small_rna,unknown,bulk,unknown,unknown,,Sweden,2023-08-11,Undetermined,Undetermined,Multi-tissue,Multi-system 10210,ERR6474216,ERX6101492,ERS7377022,ERP131171,PRJEB46937,RNA Affinity Purification followed by sequencing RAP seq allows identification of transcriptome wide RBP binding sites using recombinant RBPs and total purified cellular RNA,E-MTAB-10834,Other,RAP seq is a new method that provides in vitro derived RNA Interactomes for any given RBP. In RAP seq a recombinant RBP is produced as fusion with a HaloTag which is used to recover and purify the RBP of interest. The RBP Halo fusion is then incubated with fragmented total RNA derived from any given sample of interest. The bound RNA fragments are subsequently eluted and cloned using a small RNA library preparation protocol for sequencing the pool of bound molecules on an Illumina NGS platform. In this study RAP seq was used to identify RNA Interactomes of 26 novel RBPs aka non canonical RBPs newly discovered in proteome wide studies as RNA binders. RAP seq was also used to profile vertebrate HuR orthologs and described the biochemical evolutionary differences and similarities of the 6 orthologs profiled. Cancer associated IGF2BP1 IGF2BP2 and IGF2BP3 variants were also profiled and transcriptome wide changes in their RNA Interactomes with respect to the wild type IGF2BPs were reported. Also a transcriptome wide cooperative binding assay was perfomed to evaluate the cooperative roles of HuR and PTBP1 in binding to their native RNA targets. In addition a typical RAP seq substrate fragmented total RNA if reverse transcribed into cDNA and than in vitro transcribed again using a T7 RNA Polymerase can be depleted of any native endogenous RNA modifications and RAP seq assyas perfomed in parallel with the native substrate and the T7 RNAP produced one allowed us to discern the m6A dependency in transcriptome wide binding events for YTHDF1 hence with RAP seq we also report T7 RAP seq.,ENA FIRST PUBLIC:2023 08 11|ENA LAST UPDATE:2023 08 11,,Protocols: HepG2 were obtained from American Type Culture Collection ATCC Rockville MD. The cell line was mycoplasma free when periodically tested with Mycoplasmacheck Eurofins Genomics. HepG2 were cultured in T75 flasks at 37 °C and 5 % CO2 atmosphere using Dulbecco's Modified Eagle Medium DMEM supplemented with 1/100 Penicillin/Streptomycin P/S Sigma and 10 % fetal bovine serum Hyclone GE healthcare. HepG2 cells were maintained by splitting 1/6 three times a week done by aspirating the medium gently washing the cells with phosphate buffered saline PBS without xxx+ Sigma and detaching them with 2 mL of a trypsin EDTA solution 0.05% Sigma for 3 5 min. Trypsin EDTA was inactivated with a minimum of 10 fold surplus of culture medium before a cell fraction was passaged Substrate preparation: DNAse treated and column cleaned total RNA was fragmeted at 95 degrees celsius in Tris HCl 80 mM and MgCl2 8 mM final concentrations for 4 minutes and 30 seconds. post fragmentation the RNA was cleaned using 1 volume of RNA CleanXP Ampure beads and 1 volume of isopropanol; post 2 80% Ethanol washes the RNA was eluted in half the volume of AMPure beads used. three prime dephosphorylation was then performed with T4PNK in TAM buffer Tris Acetate 50 mM Magnesium Chloride 10 mM pH8.5 at room temperature for 4 hours followed by AMPure clean up and subsequently five prime phosphorylated with T4PNK in T4PNK buffer with addition of ATP at 37 degreees celsius for 1 hour according to NEB manufacturer instructions then AMPure cleaned and aliquoted and stored at 80 degrees celsius until further used. Binding Assay: RBP Halo fusions are in vitro transcribed and then translated with MegaScript T7 in vitro transcription kit ThermoFisher and Wheat Germ extract according to manufacturers instructions 50 ul in vitro translation reaction. The in vitro translated proteins are recovered using 25 ul Magne Halo Ligand beads Promega washed and resuspended in PBSN 1X PBS 0 005% NP 40 with added RNAse A and Turbo DNAse Thermo. post 1 hour of incubation the beads are washed 4 times twice with high salt PBSN + 1M MgCl2 and twice with normal salt PBSN. Beads are ruspended in 50 ul of PBSN and mixed with one aliquote of substrate RNA 150 ng in total brought to room temperature and diluted to a final volume of 50 ul of PBSN. The binding reaction occurs at room temperature for one hour rotating end over end subsequently 3 washes in PBSN are performed to remove unbound molecules and elution is perfomed in 15 ul of RNAse free water at 70 degrees celsius for 8 minutes resuspending the beads by pipeting up and down whilst the tube is in the thermocycler for a total of 3 times during the 8 minutes at 70 degrees. 11 ul of the eluted RNA are used to prepare an illumina compatible next generation sequencing library. Upon cell harvest 700 µL Qiazol QIAGEN was directly added onto the cells on ice and mixed. The cell extract was either stored at 80 °C or RNA extraction was continued immediately by adding 140 µL chloroform. This Qiazol/chloroform mixture was shaken for 30 sec and incubated at RT for 3 min before centrifugation at 9.000 g for 5 min at 4 °C. The upper aqueous phase was transferred to a new tube and an equal volume of isopropanol was added. The tube was inverted 5 times followed by 10 min incubation at RT. The mixture was centrifuged at 9.000 g and 4 °C for 10 min and the supernatant discarded. The pellet was washed in 700 µL cold 70% ethanol and centrifuged at 15.000 g for 5 min at 4 °C. The supernatant was discarded entirely and the pellet air dried for 5 minutes before resuspension in nuclease free water. RNA concentration was determined by nanodrop Nanodrop 2000c. RNA was DNase treated using the Turbo DNase Kit Thermo Fisher for 30 min at 37 °C and the reaction was column purified using RNA Clean&Concentrator kit Zymo Research. The library preparation was carried out using the NEXTFLEX small RNA library preparation kit v3 PerkinElmer catalog # NOVA 5132 06 according to manufacturer instructions. The quality of every cDNA library was determined on an Agilent Bioanalyzer instrument according to the manufacturer's protocol.,drHuRFISH rep2,E MTAB 10834:drHuRFISH rep2,,isolate:not applicable|disease:normal|ENA FIRST PUBLIC:2023 08 11T00:23:05Z|organism:Danio rerio|organism:Danio rerio|ENA LAST UPDATE:2023 08 11T00:23:05Z|cell line:1|scientific name:Danio rerio|common name:zebrafish|organism part:liver|cell type:hepatocyte|genotype:wild type genotype|ENA FIRST PUBLIC:2023 08 11|ENA LAST UPDATE:2023 08 11,,,,,,,,,NextSeq 550 paired end sequencing; RNA Affinity Purification followed by sequencing RAP seq allows identification of transcriptome wide RBP binding sites using recombinant RBPs and total purified cellular RNA,E MTAB 10834:drHuRFISH rep2 p,drHuRFISH rep2 p,RNA Affinity Purification followed by sequencing RAP seq allows identification of transcriptome wide RBP binding sites using recombinant RBPs and total purified cellular RNA,HepG2 were obtained from American Type Culture Collection ATCC Rockville MD. The cell line was mycoplasma free when periodically tested with Mycoplasmacheck Eurofins Genomics. HepG2 were cultured in T75 flasks at 37 °C and 5 % CO2 atmosphere using Dulbecco's Modified Eagle Medium DMEM supplemented with 1/100 Penicillin/Streptomycin P/S Sigma and 10 % fetal bovine serum Hyclone GE healthcare. HepG2 cells were maintained by splitting 1/6 three times a week done by aspirating the medium gently washing the cells with phosphate buffered saline PBS without xxx+ Sigma and detaching them with 2 mL of a trypsin EDTA solution 0.05% Sigma for 3 5 min. Trypsin EDTA was inactivated with a minimum of 10 fold surplus of culture medium before a cell fraction was passaged Substrate preparation: DNAse treated and column cleaned total RNA was fragmeted at 95 degrees celsius in Tris HCl 80 mM and MgCl2 8 mM final concentrations for 4 minutes and 30 seconds. post fragmentation the RNA was cleaned using 1 volume of RNA CleanXP Ampure beads and 1 volume of isopropanol; post 2 80% Ethanol washes the RNA was eluted in half the volume of AMPure beads used. three prime dephosphorylation was then performed with T4PNK in TAM buffer Tris Acetate 50 mM Magnesium Chloride 10 mM pH8.5 at room temperature for 4 hours followed by AMPure clean up and subsequently five prime phosphorylated with T4PNK in T4PNK buffer with addition of ATP at 37 degreees celsius for 1 hour according to NEB manufacturer instructions then AMPure cleaned and aliquoted and stored at 80 degrees celsius until further used. Binding Assay: RBP Halo fusions are in vitro transcribed and then translated with MegaScript T7 in vitro transcription kit ThermoFisher and Wheat Germ extract according to manufacturers instructions 50 ul in vitro translation reaction. The in vitro translated proteins are recovered using 25 ul Magne Halo Ligand beads Promega washed and resuspended in PBSN 1X PBS 0 005% NP 40 with added RNAse A and Turbo DNAse Thermo. post 1 hour of incubation the beads are washed 4 times twice with high salt PBSN + 1M MgCl2 and twice with normal salt PBSN. Beads are ruspended in 50 ul of PBSN and mixed with one aliquote of substrate RNA 150 ng in total brought to room temperature and diluted to a final volume of 50 ul of PBSN. The binding reaction occurs at room temperature for one hour rotating end over end subsequently 3 washes in PBSN are performed to remove unbound molecules and elution is perfomed in 15 ul of RNAse free water at 70 degrees celsius for 8 minutes resuspending the beads by pipeting up and down whilst the tube is in the thermocycler for a total of 3 times during the 8 minutes at 70 degrees. 11 ul of the eluted RNA are used to prepare an illumina compatible next generation sequencing library. Upon cell harvest 700 µL Qiazol QIAGEN was directly added onto the cells on ice and mixed. The cell extract was either stored at 80 °C or RNA extraction was continued immediately by adding 140 µL chloroform. This Qiazol/chloroform mixture was shaken for 30 sec and incubated at RT for 3 min before centrifugation at 9.000 g for 5 min at 4 °C. The upper aqueous phase was transferred to a new tube and an equal volume of isopropanol was added. The tube was inverted 5 times followed by 10 min incubation at RT. The mixture was centrifuged at 9.000 g and 4 °C for 10 min and the supernatant discarded. The pellet was washed in 700 µL cold 70% ethanol and centrifuged at 15.000 g for 5 min at 4 °C. The supernatant was discarded entirely and the pellet air dried for 5 minutes before resuspension in nuclease free water. RNA concentration was determined by nanodrop Nanodrop 2000c. RNA was DNase treated using the Turbo DNase Kit Thermo Fisher for 30 min at 37 °C and the reaction was column purified using RNA Clean&Concentrator kit Zymo Research. The library preparation was carried out using the NEXTFLEX small RNA library preparation kit v3 PerkinElmer catalog # NOVA 5132 06 according to manufacturer instructions. The quality of every cDNA library was determined on an Agilent Bioanalyzer instrument according to the manufacturer's protocol.,Experimental Factor: immunoprecipitate:anti drHuR|Experimental Factor: organism:Danio rerio,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,NextSeq 550,,ERP131171,NextSeq 550 paired end sequencing; RNA Affinity Purification followed by sequencing RAP seq allows identification of transcriptome wide RBP binding sites using recombinant RBPs and total purified cellular RNA,ENA FIRST PUBLIC:2023 08 11|ENA LAST UPDATE:2023 08 11,drHuRFISH_rep2.R1.fastq.gz drHuRFISH_rep2.R2.fastq.gz,fastq fastq,2408024386.0,29012342.0,E MTAB 10834:drHuRFISH rep2.R,0:40 1:43,A:566287649;C:627743498;G:663052609;T:550604982;N:335648,40,43,,,566287649,627743498,663052609,550604982,335648,ERX6101492,ERS7377022,ERA5607540,"Department of Microbiology, Tumor, and Cell Biology, Karolinska Institute, Science for Life Laboratory, Sweden|European Nucleotide Archive","Department of Microbiology, Tumor, and Cell Biology, Karolinska Institute, Science for Life Laboratory, Sweden|European Nucleotide Archive",2,0.68524,0.62721,0.16916,0.1656,0.93501,0.94541,0.7028,0.64738,40,43,B,B,biological fallback assumption,illumina,nextseq,unknown,small_rna,unknown,bulk,unknown,unknown,,Sweden,2023-08-11,Undetermined,Undetermined,Multi-tissue,Multi-system 10211,ERR6474215,ERX6101491,ERS7377021,ERP131171,PRJEB46937,RNA Affinity Purification followed by sequencing RAP seq allows identification of transcriptome wide RBP binding sites using recombinant RBPs and total purified cellular RNA,E-MTAB-10834,Other,RAP seq is a new method that provides in vitro derived RNA Interactomes for any given RBP. In RAP seq a recombinant RBP is produced as fusion with a HaloTag which is used to recover and purify the RBP of interest. The RBP Halo fusion is then incubated with fragmented total RNA derived from any given sample of interest. The bound RNA fragments are subsequently eluted and cloned using a small RNA library preparation protocol for sequencing the pool of bound molecules on an Illumina NGS platform. In this study RAP seq was used to identify RNA Interactomes of 26 novel RBPs aka non canonical RBPs newly discovered in proteome wide studies as RNA binders. RAP seq was also used to profile vertebrate HuR orthologs and described the biochemical evolutionary differences and similarities of the 6 orthologs profiled. Cancer associated IGF2BP1 IGF2BP2 and IGF2BP3 variants were also profiled and transcriptome wide changes in their RNA Interactomes with respect to the wild type IGF2BPs were reported. Also a transcriptome wide cooperative binding assay was perfomed to evaluate the cooperative roles of HuR and PTBP1 in binding to their native RNA targets. In addition a typical RAP seq substrate fragmented total RNA if reverse transcribed into cDNA and than in vitro transcribed again using a T7 RNA Polymerase can be depleted of any native endogenous RNA modifications and RAP seq assyas perfomed in parallel with the native substrate and the T7 RNAP produced one allowed us to discern the m6A dependency in transcriptome wide binding events for YTHDF1 hence with RAP seq we also report T7 RAP seq.,ENA FIRST PUBLIC:2023 08 11|ENA LAST UPDATE:2023 08 11,,Protocols: HepG2 were obtained from American Type Culture Collection ATCC Rockville MD. The cell line was mycoplasma free when periodically tested with Mycoplasmacheck Eurofins Genomics. HepG2 were cultured in T75 flasks at 37 °C and 5 % CO2 atmosphere using Dulbecco's Modified Eagle Medium DMEM supplemented with 1/100 Penicillin/Streptomycin P/S Sigma and 10 % fetal bovine serum Hyclone GE healthcare. HepG2 cells were maintained by splitting 1/6 three times a week done by aspirating the medium gently washing the cells with phosphate buffered saline PBS without xxx+ Sigma and detaching them with 2 mL of a trypsin EDTA solution 0.05% Sigma for 3 5 min. Trypsin EDTA was inactivated with a minimum of 10 fold surplus of culture medium before a cell fraction was passaged Substrate preparation: DNAse treated and column cleaned total RNA was fragmeted at 95 degrees celsius in Tris HCl 80 mM and MgCl2 8 mM final concentrations for 4 minutes and 30 seconds. post fragmentation the RNA was cleaned using 1 volume of RNA CleanXP Ampure beads and 1 volume of isopropanol; post 2 80% Ethanol washes the RNA was eluted in half the volume of AMPure beads used. three prime dephosphorylation was then performed with T4PNK in TAM buffer Tris Acetate 50 mM Magnesium Chloride 10 mM pH8.5 at room temperature for 4 hours followed by AMPure clean up and subsequently five prime phosphorylated with T4PNK in T4PNK buffer with addition of ATP at 37 degreees celsius for 1 hour according to NEB manufacturer instructions then AMPure cleaned and aliquoted and stored at 80 degrees celsius until further used. Binding Assay: RBP Halo fusions are in vitro transcribed and then translated with MegaScript T7 in vitro transcription kit ThermoFisher and Wheat Germ extract according to manufacturers instructions 50 ul in vitro translation reaction. The in vitro translated proteins are recovered using 25 ul Magne Halo Ligand beads Promega washed and resuspended in PBSN 1X PBS 0 005% NP 40 with added RNAse A and Turbo DNAse Thermo. post 1 hour of incubation the beads are washed 4 times twice with high salt PBSN + 1M MgCl2 and twice with normal salt PBSN. Beads are ruspended in 50 ul of PBSN and mixed with one aliquote of substrate RNA 150 ng in total brought to room temperature and diluted to a final volume of 50 ul of PBSN. The binding reaction occurs at room temperature for one hour rotating end over end subsequently 3 washes in PBSN are performed to remove unbound molecules and elution is perfomed in 15 ul of RNAse free water at 70 degrees celsius for 8 minutes resuspending the beads by pipeting up and down whilst the tube is in the thermocycler for a total of 3 times during the 8 minutes at 70 degrees. 11 ul of the eluted RNA are used to prepare an illumina compatible next generation sequencing library. Upon cell harvest 700 µL Qiazol QIAGEN was directly added onto the cells on ice and mixed. The cell extract was either stored at 80 °C or RNA extraction was continued immediately by adding 140 µL chloroform. This Qiazol/chloroform mixture was shaken for 30 sec and incubated at RT for 3 min before centrifugation at 9.000 g for 5 min at 4 °C. The upper aqueous phase was transferred to a new tube and an equal volume of isopropanol was added. The tube was inverted 5 times followed by 10 min incubation at RT. The mixture was centrifuged at 9.000 g and 4 °C for 10 min and the supernatant discarded. The pellet was washed in 700 µL cold 70% ethanol and centrifuged at 15.000 g for 5 min at 4 °C. The supernatant was discarded entirely and the pellet air dried for 5 minutes before resuspension in nuclease free water. RNA concentration was determined by nanodrop Nanodrop 2000c. RNA was DNase treated using the Turbo DNase Kit Thermo Fisher for 30 min at 37 °C and the reaction was column purified using RNA Clean&Concentrator kit Zymo Research. The library preparation was carried out using the NEXTFLEX small RNA library preparation kit v3 PerkinElmer catalog # NOVA 5132 06 according to manufacturer instructions. The quality of every cDNA library was determined on an Agilent Bioanalyzer instrument according to the manufacturer's protocol.,drHuRFISH rep1,E MTAB 10834:drHuRFISH rep1,,isolate:not applicable|disease:normal|ENA FIRST PUBLIC:2023 08 11T00:23:05Z|organism:Danio rerio|organism:Danio rerio|ENA LAST UPDATE:2023 08 11T00:23:05Z|cell line:1|scientific name:Danio rerio|common name:zebrafish|organism part:liver|cell type:hepatocyte|genotype:wild type genotype|ENA FIRST PUBLIC:2023 08 11|ENA LAST UPDATE:2023 08 11,,,,,,,,,NextSeq 550 paired end sequencing; RNA Affinity Purification followed by sequencing RAP seq allows identification of transcriptome wide RBP binding sites using recombinant RBPs and total purified cellular RNA,E MTAB 10834:drHuRFISH rep1 p,drHuRFISH rep1 p,RNA Affinity Purification followed by sequencing RAP seq allows identification of transcriptome wide RBP binding sites using recombinant RBPs and total purified cellular RNA,HepG2 were obtained from American Type Culture Collection ATCC Rockville MD. The cell line was mycoplasma free when periodically tested with Mycoplasmacheck Eurofins Genomics. HepG2 were cultured in T75 flasks at 37 °C and 5 % CO2 atmosphere using Dulbecco's Modified Eagle Medium DMEM supplemented with 1/100 Penicillin/Streptomycin P/S Sigma and 10 % fetal bovine serum Hyclone GE healthcare. HepG2 cells were maintained by splitting 1/6 three times a week done by aspirating the medium gently washing the cells with phosphate buffered saline PBS without xxx+ Sigma and detaching them with 2 mL of a trypsin EDTA solution 0.05% Sigma for 3 5 min. Trypsin EDTA was inactivated with a minimum of 10 fold surplus of culture medium before a cell fraction was passaged Substrate preparation: DNAse treated and column cleaned total RNA was fragmeted at 95 degrees celsius in Tris HCl 80 mM and MgCl2 8 mM final concentrations for 4 minutes and 30 seconds. post fragmentation the RNA was cleaned using 1 volume of RNA CleanXP Ampure beads and 1 volume of isopropanol; post 2 80% Ethanol washes the RNA was eluted in half the volume of AMPure beads used. three prime dephosphorylation was then performed with T4PNK in TAM buffer Tris Acetate 50 mM Magnesium Chloride 10 mM pH8.5 at room temperature for 4 hours followed by AMPure clean up and subsequently five prime phosphorylated with T4PNK in T4PNK buffer with addition of ATP at 37 degreees celsius for 1 hour according to NEB manufacturer instructions then AMPure cleaned and aliquoted and stored at 80 degrees celsius until further used. Binding Assay: RBP Halo fusions are in vitro transcribed and then translated with MegaScript T7 in vitro transcription kit ThermoFisher and Wheat Germ extract according to manufacturers instructions 50 ul in vitro translation reaction. The in vitro translated proteins are recovered using 25 ul Magne Halo Ligand beads Promega washed and resuspended in PBSN 1X PBS 0 005% NP 40 with added RNAse A and Turbo DNAse Thermo. post 1 hour of incubation the beads are washed 4 times twice with high salt PBSN + 1M MgCl2 and twice with normal salt PBSN. Beads are ruspended in 50 ul of PBSN and mixed with one aliquote of substrate RNA 150 ng in total brought to room temperature and diluted to a final volume of 50 ul of PBSN. The binding reaction occurs at room temperature for one hour rotating end over end subsequently 3 washes in PBSN are performed to remove unbound molecules and elution is perfomed in 15 ul of RNAse free water at 70 degrees celsius for 8 minutes resuspending the beads by pipeting up and down whilst the tube is in the thermocycler for a total of 3 times during the 8 minutes at 70 degrees. 11 ul of the eluted RNA are used to prepare an illumina compatible next generation sequencing library. Upon cell harvest 700 µL Qiazol QIAGEN was directly added onto the cells on ice and mixed. The cell extract was either stored at 80 °C or RNA extraction was continued immediately by adding 140 µL chloroform. This Qiazol/chloroform mixture was shaken for 30 sec and incubated at RT for 3 min before centrifugation at 9.000 g for 5 min at 4 °C. The upper aqueous phase was transferred to a new tube and an equal volume of isopropanol was added. The tube was inverted 5 times followed by 10 min incubation at RT. The mixture was centrifuged at 9.000 g and 4 °C for 10 min and the supernatant discarded. The pellet was washed in 700 µL cold 70% ethanol and centrifuged at 15.000 g for 5 min at 4 °C. The supernatant was discarded entirely and the pellet air dried for 5 minutes before resuspension in nuclease free water. RNA concentration was determined by nanodrop Nanodrop 2000c. RNA was DNase treated using the Turbo DNase Kit Thermo Fisher for 30 min at 37 °C and the reaction was column purified using RNA Clean&Concentrator kit Zymo Research. The library preparation was carried out using the NEXTFLEX small RNA library preparation kit v3 PerkinElmer catalog # NOVA 5132 06 according to manufacturer instructions. The quality of every cDNA library was determined on an Agilent Bioanalyzer instrument according to the manufacturer's protocol.,Experimental Factor: immunoprecipitate:anti drHuR|Experimental Factor: organism:Danio rerio,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,NextSeq 550,,ERP131171,NextSeq 550 paired end sequencing; RNA Affinity Purification followed by sequencing RAP seq allows identification of transcriptome wide RBP binding sites using recombinant RBPs and total purified cellular RNA,ENA FIRST PUBLIC:2023 08 11|ENA LAST UPDATE:2023 08 11,drHuRFISH_rep1.R1.fastq.gz drHuRFISH_rep1.R2.fastq.gz,fastq fastq,3025188980.0,36448060.0,E MTAB 10834:drHuRFISH rep1.R,0:40 1:43,A:720153781;C:784188971;G:824077525;T:696330222;N:438481,40,43,,,720153781,784188971,824077525,696330222,438481,ERX6101491,ERS7377021,ERA5607540,"Department of Microbiology, Tumor, and Cell Biology, Karolinska Institute, Science for Life Laboratory, Sweden|European Nucleotide Archive","Department of Microbiology, Tumor, and Cell Biology, Karolinska Institute, Science for Life Laboratory, Sweden|European Nucleotide Archive",2,0.7001,0.64217,0.17626,0.1728,0.93154,0.94249,0.72494,0.65821,40,43,B,B,biological fallback assumption,illumina,nextseq,unknown,small_rna,unknown,bulk,unknown,unknown,,Sweden,2023-08-11,Undetermined,Undetermined,Multi-tissue,Multi-system 30210,SRR27722348,SRX23388314,SRS20249507,SRP485828,PRJNA1068830,skeletal toxicity studies of polystyrene nanoplastic in zebrafish,PRJNA1068830,Other,Employing standard polystyrene NPs as the representative the investigation of the bone loss in the caudal fin from environmentally realistic concentration of NPs was assessed in zebrafish.,,,,,2 F5 NPs,,isolate:b1 F5|host:male|collection date:2022 09 06|geo loc name:China:qingdao|tissue:b1|BioSampleModel:Invertebrate,,,,,,,,,skeletal toxicity studies of polystyrene nanoplastic in zebrafish,2 F5 NPs,2 F5 NPs,bone,,,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 4000,,SRP485828,,,L1EGI0701134_L1EGI0701134--WT_M5.R1.raw.fastq.gz L1EGI0701134_L1EGI0701134--WT_M5.R2.raw.fastq.gz,fastq fastq,6858985646.0,22711873.0,L1EGI0701134 L1EGI0701134 WT M5.R1.raw.fastq.gz,0:151 1:151,A:1775374486;C:1607590004;G:1736749854;T:1739241353;N:29949,151,151,,,1775374486,1607590004,1736749854,1739241353,29949,SRX23388314,SRS20249507,SRA1791477,zhejiang university|the college of animal science,zhejiang university,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2024-01-25,Undetermined,Undetermined,Bone or Cartilage,Skeletal Element 30211,SRR27722349,SRX23388313,SRS20249506,SRP485828,PRJNA1068830,skeletal toxicity studies of polystyrene nanoplastic in zebrafish,PRJNA1068830,Other,Employing standard polystyrene NPs as the representative the investigation of the bone loss in the caudal fin from environmentally realistic concentration of NPs was assessed in zebrafish.,,,,,2 F4 NPs,,isolate:b1 F4|host:male|collection date:2022 09 06|geo loc name:China:qingdao|tissue:b1|BioSampleModel:Invertebrate,,,,,,,,,skeletal toxicity studies of polystyrene nanoplastic in zebrafish,2 F4 NPs,2 F4 NPs,bone,,,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 4000,,SRP485828,,,L1EGI0701133--WT_M4.R1.raw.fastq.gz L1EGI0701133--WT_M4.R2.raw.fastq.gz,fastq fastq,8367706978.0,27707639.0,L1EGI0701133 WT M4.R1.raw.fastq.gz,0:151 1:151,A:2190978299;C:1972956945;G:2068607164;T:2135130434;N:34136,151,151,,,2190978299,1972956945,2068607164,2135130434,34136,SRX23388313,SRS20249506,SRA1791477,zhejiang university|the college of animal science,zhejiang university,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2024-01-25,Undetermined,Undetermined,Bone or Cartilage,Skeletal Element 30212,SRR27722350,SRX23388312,SRS20249505,SRP485828,PRJNA1068830,skeletal toxicity studies of polystyrene nanoplastic in zebrafish,PRJNA1068830,Other,Employing standard polystyrene NPs as the representative the investigation of the bone loss in the caudal fin from environmentally realistic concentration of NPs was assessed in zebrafish.,,,,,2 F3 NPs,,isolate:b1 F3|host:male|collection date:2022 09 06|geo loc name:China:qingdao|tissue:b1|BioSampleModel:Invertebrate,,,,,,,,,skeletal toxicity studies of polystyrene nanoplastic in zebrafish,2 F3 NPs,2 F3 NPs,bone,,,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 4000,,SRP485828,,,L1EGI0701132--WT_M3.R1.raw.fastq.gz L1EGI0701132--WT_M3.R2.raw.fastq.gz,fastq fastq,8356526334.0,27670617.0,L1EGI0701132 WT M3.R1.raw.fastq.gz,0:151 1:151,A:2162579680;C:1984443655;G:2083109306;T:2126359754;N:33939,151,151,,,2162579680,1984443655,2083109306,2126359754,33939,SRX23388312,SRS20249505,SRA1791477,zhejiang university|the college of animal science,zhejiang university,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2024-01-25,Undetermined,Undetermined,Bone or Cartilage,Skeletal Element 30213,SRR27722351,SRX23388311,SRS20249504,SRP485828,PRJNA1068830,skeletal toxicity studies of polystyrene nanoplastic in zebrafish,PRJNA1068830,Other,Employing standard polystyrene NPs as the representative the investigation of the bone loss in the caudal fin from environmentally realistic concentration of NPs was assessed in zebrafish.,,,,,2 F2 NPs,,isolate:b1 F2|host:male|collection date:2022 09 06|geo loc name:China:qingdao|tissue:b1|BioSampleModel:Invertebrate,,,,,,,,,skeletal toxicity studies of polystyrene nanoplastic in zebrafish,2 F2 NPs,2 F2 NPs,bone,,,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 4000,,SRP485828,,,L1EGI0701131--WT_M2.R1.raw.fastq.gz L1EGI0701131--WT_M2.R2.raw.fastq.gz,fastq fastq,8143546874.0,26965387.0,L1EGI0701131 WT M2.R1.raw.fastq.gz,0:151 1:151,A:2114633540;C:1938964033;G:2015877300;T:2074038855;N:33146,151,151,,,2114633540,1938964033,2015877300,2074038855,33146,SRX23388311,SRS20249504,SRA1791477,zhejiang university|the college of animal science,zhejiang university,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2024-01-25,Undetermined,Undetermined,Bone or Cartilage,Skeletal Element 30214,SRR27722352,SRX23388310,SRS20249503,SRP485828,PRJNA1068830,skeletal toxicity studies of polystyrene nanoplastic in zebrafish,PRJNA1068830,Other,Employing standard polystyrene NPs as the representative the investigation of the bone loss in the caudal fin from environmentally realistic concentration of NPs was assessed in zebrafish.,,,,,2 F1 NPs,,isolate:b1 F1|host:male|collection date:2022 09 06|geo loc name:China:qingdao|tissue:b1|BioSampleModel:Invertebrate,,,,,,,,,skeletal toxicity studies of polystyrene nanoplastic in zebrafish,2 F1 NPs,2 F1 NPs,bone,,,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 4000,,SRP485828,,,L1EGI0701130--WT_M1.R1.raw.fastq.gz L1EGI0701130--WT_M1.R2.raw.fastq.gz,fastq fastq,9004594174.0,29816537.0,L1EGI0701130 WT M1.R1.raw.fastq.gz,0:151 1:151,A:2356139884;C:2114457727;G:2228436842;T:2305522562;N:37159,151,151,,,2356139884,2114457727,2228436842,2305522562,37159,SRX23388310,SRS20249503,SRA1791477,zhejiang university|the college of animal science,zhejiang university,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2024-01-25,Undetermined,Undetermined,Bone or Cartilage,Skeletal Element 30215,SRR27722353,SRX23388309,SRS20249502,SRP485828,PRJNA1068830,skeletal toxicity studies of polystyrene nanoplastic in zebrafish,PRJNA1068830,Other,Employing standard polystyrene NPs as the representative the investigation of the bone loss in the caudal fin from environmentally realistic concentration of NPs was assessed in zebrafish.,,,,,1 F5 WT,,isolate:b1 F5|host:female|collection date:2022 09 06|geo loc name:China:qingdao|tissue:b1|BioSampleModel:Invertebrate,,,,,,,,,skeletal toxicity studies of polystyrene nanoplastic in zebrafish,1 F5 WT,1 F5 WT,bone,,,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 4000,,SRP485828,,,L1EGI0701128--WT_F5.R1.raw.fastq.gz L1EGI0701128--WT_F5.R2.raw.fastq.gz,fastq fastq,9595399794.0,31772847.0,L1EGI0701128 WT F5.R1.raw.fastq.gz,0:151 1:151,A:2471647902;C:2293433569;G:2400056012;T:2430223486;N:38825,151,151,,,2471647902,2293433569,2400056012,2430223486,38825,SRX23388309,SRS20249502,SRA1791477,zhejiang university|the college of animal science,zhejiang university,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2024-01-25,Undetermined,Undetermined,Bone or Cartilage,Skeletal Element 30216,SRR27722354,SRX23388308,SRS20249501,SRP485828,PRJNA1068830,skeletal toxicity studies of polystyrene nanoplastic in zebrafish,PRJNA1068830,Other,Employing standard polystyrene NPs as the representative the investigation of the bone loss in the caudal fin from environmentally realistic concentration of NPs was assessed in zebrafish.,,,,,1 F4 WT,,isolate:b1 F4|host:female|collection date:2022 09 06|geo loc name:China:qingdao|tissue:b1|BioSampleModel:Invertebrate,,,,,,,,,skeletal toxicity studies of polystyrene nanoplastic in zebrafish,1 F4 WT,1 F4 WT,bone,,,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 4000,,SRP485828,,,L1EGI0701127--WT_F4.R1.raw.fastq.gz L1EGI0701127--WT_F4.R2.raw.fastq.gz,fastq fastq,7628679456.0,25260528.0,L1EGI0701127 WT F4.R1.raw.fastq.gz,0:151 1:151,A:2006324404;C:1789150133;G:1873940582;T:1959232617;N:31720,151,151,,,2006324404,1789150133,1873940582,1959232617,31720,SRX23388308,SRS20249501,SRA1791477,zhejiang university|the college of animal science,zhejiang university,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2024-01-25,Undetermined,Undetermined,Bone or Cartilage,Skeletal Element 30217,SRR27722355,SRX23388307,SRS20249500,SRP485828,PRJNA1068830,skeletal toxicity studies of polystyrene nanoplastic in zebrafish,PRJNA1068830,Other,Employing standard polystyrene NPs as the representative the investigation of the bone loss in the caudal fin from environmentally realistic concentration of NPs was assessed in zebrafish.,,,,,1 F3 WT,,isolate:b1 F3|host:female|collection date:2022 09 06|geo loc name:China:qingdao|tissue:b1|BioSampleModel:Invertebrate,,,,,,,,,skeletal toxicity studies of polystyrene nanoplastic in zebrafish,1 F3 WT,1 F3 WT,bone,,,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 4000,,SRP485828,,,L1EGI0701126--WT_F3.R1.raw.fastq.gz L1EGI0701126--WT_F3.R2.raw.fastq.gz,fastq fastq,8853107954.0,29314927.0,L1EGI0701126 WT F3.R1.raw.fastq.gz,0:151 1:151,A:2281668777;C:2122390553;G:2205818678;T:2243193679;N:36267,151,151,,,2281668777,2122390553,2205818678,2243193679,36267,SRX23388307,SRS20249500,SRA1791477,zhejiang university|the college of animal science,zhejiang university,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2024-01-25,Undetermined,Undetermined,Bone or Cartilage,Skeletal Element 30218,SRR27722356,SRX23388306,SRS20249499,SRP485828,PRJNA1068830,skeletal toxicity studies of polystyrene nanoplastic in zebrafish,PRJNA1068830,Other,Employing standard polystyrene NPs as the representative the investigation of the bone loss in the caudal fin from environmentally realistic concentration of NPs was assessed in zebrafish.,,,,,4 M5 NPs,,isolate:b1 M5|host:male|collection date:2022 09 06|geo loc name:China:qingdao|tissue:b1|BioSampleModel:Invertebrate,,,,,,,,,skeletal toxicity studies of polystyrene nanoplastic in zebrafish,4 M5 NPs,4 M5 NPs,bone,,,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 4000,,SRP485828,,,L1EGI0701146--NPs_M5.R1.raw.fastq.gz L1EGI0701146--NPs_M5.R2.raw.fastq.gz,fastq fastq,7440341686.0,24636893.0,L1EGI0701146 NPs M5.R1.raw.fastq.gz,0:151 1:151,A:1926837197;C:1774447312;G:1865805171;T:1873221668;N:30338,151,151,,,1926837197,1774447312,1865805171,1873221668,30338,SRX23388306,SRS20249499,SRA1791477,zhejiang university|the college of animal science,zhejiang university,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2024-01-25,Undetermined,Undetermined,Bone or Cartilage,Skeletal Element 30219,SRR27722357,SRX23388305,SRS20249498,SRP485828,PRJNA1068830,skeletal toxicity studies of polystyrene nanoplastic in zebrafish,PRJNA1068830,Other,Employing standard polystyrene NPs as the representative the investigation of the bone loss in the caudal fin from environmentally realistic concentration of NPs was assessed in zebrafish.,,,,,4 M4 NPs,,isolate:b1 M4|host:male|collection date:2022 09 06|geo loc name:China:qingdao|tissue:b1|BioSampleModel:Invertebrate,,,,,,,,,skeletal toxicity studies of polystyrene nanoplastic in zebrafish,4 M4 NPs,4 M4 NPs,bone,,,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 4000,,SRP485828,,,L1EGI0701145_L1EGI0701145--NPs_M4.R1.raw.fastq.gz L1EGI0701145_L1EGI0701145--NPs_M4.R2.raw.fastq.gz,fastq fastq,7482324518.0,24775909.0,L1EGI0701145 L1EGI0701145 NPs M4.R1.raw.fastq.gz,0:151 1:151,A:2074937139;C:1646093888;G:1749156387;T:2012102736;N:34368,151,151,,,2074937139,1646093888,1749156387,2012102736,34368,SRX23388305,SRS20249498,SRA1791477,zhejiang university|the college of animal science,zhejiang university,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2024-01-25,Undetermined,Undetermined,Bone or Cartilage,Skeletal Element 30220,SRR27722358,SRX23388304,SRS20249497,SRP485828,PRJNA1068830,skeletal toxicity studies of polystyrene nanoplastic in zebrafish,PRJNA1068830,Other,Employing standard polystyrene NPs as the representative the investigation of the bone loss in the caudal fin from environmentally realistic concentration of NPs was assessed in zebrafish.,,,,,4 M3 NPs,,isolate:b1 M3|host:male|collection date:2022 09 06|geo loc name:China:qingdao|tissue:b1|BioSampleModel:Invertebrate,,,,,,,,,skeletal toxicity studies of polystyrene nanoplastic in zebrafish,4 M3 NPs,4 M3 NPs,bone,,,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 4000,,SRP485828,,,L1EGI0701144--NPs_M3.R1.raw.fastq.gz L1EGI0701144--NPs_M3.R2.raw.fastq.gz,fastq fastq,8439432280.0,27945140.0,L1EGI0701144 NPs M3.R1.raw.fastq.gz,0:151 1:151,A:2168219326;C:2022693060;G:2132822366;T:2115662612;N:34916,151,151,,,2168219326,2022693060,2132822366,2115662612,34916,SRX23388304,SRS20249497,SRA1791477,zhejiang university|the college of animal science,zhejiang university,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2024-01-25,Undetermined,Undetermined,Bone or Cartilage,Skeletal Element 30221,SRR27722359,SRX23388303,SRS20249496,SRP485828,PRJNA1068830,skeletal toxicity studies of polystyrene nanoplastic in zebrafish,PRJNA1068830,Other,Employing standard polystyrene NPs as the representative the investigation of the bone loss in the caudal fin from environmentally realistic concentration of NPs was assessed in zebrafish.,,,,,4 M2 NPs,,isolate:b1 M2|host:male|collection date:2022 09 06|geo loc name:China:qingdao|tissue:b1|BioSampleModel:Invertebrate,,,,,,,,,skeletal toxicity studies of polystyrene nanoplastic in zebrafish,4 M2 NPs,4 M2 NPs,bone,,,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 4000,,SRP485828,,,L1EGI0701143--NPs_M2.R1.raw.fastq.gz L1EGI0701143--NPs_M2.R2.raw.fastq.gz,fastq fastq,7033808614.0,23290757.0,L1EGI0701143 NPs M2.R1.raw.fastq.gz,0:151 1:151,A:1828789906;C:1675914023;G:1760006026;T:1769068832;N:29827,151,151,,,1828789906,1675914023,1760006026,1769068832,29827,SRX23388303,SRS20249496,SRA1791477,zhejiang university|the college of animal science,zhejiang university,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2024-01-25,Undetermined,Undetermined,Bone or Cartilage,Skeletal Element 30222,SRR27722360,SRX23388302,SRS20249495,SRP485828,PRJNA1068830,skeletal toxicity studies of polystyrene nanoplastic in zebrafish,PRJNA1068830,Other,Employing standard polystyrene NPs as the representative the investigation of the bone loss in the caudal fin from environmentally realistic concentration of NPs was assessed in zebrafish.,,,,,4 M1 NPs,,isolate:b1 M1|host:male|collection date:2022 09 06|geo loc name:China:qingdao|tissue:b1|BioSampleModel:Invertebrate,,,,,,,,,skeletal toxicity studies of polystyrene nanoplastic in zebrafish,4 M1 NPs,4 M1 NPs,bone,,,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 4000,,SRP485828,,,L1EGI0701142--NPs_M1.R1.raw.fastq.gz L1EGI0701142--NPs_M1.R2.raw.fastq.gz,fastq fastq,8087463964.0,26779682.0,L1EGI0701142 NPs M1.R1.raw.fastq.gz,0:151 1:151,A:2097695704;C:1931279917;G:2029894750;T:2028560473;N:33120,151,151,,,2097695704,1931279917,2029894750,2028560473,33120,SRX23388302,SRS20249495,SRA1791477,zhejiang university|the college of animal science,zhejiang university,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2024-01-25,Undetermined,Undetermined,Bone or Cartilage,Skeletal Element 30223,SRR27722361,SRX23388301,SRS20249494,SRP485828,PRJNA1068830,skeletal toxicity studies of polystyrene nanoplastic in zebrafish,PRJNA1068830,Other,Employing standard polystyrene NPs as the representative the investigation of the bone loss in the caudal fin from environmentally realistic concentration of NPs was assessed in zebrafish.,,,,,3 M5 WT,,isolate:b1 M5|host:female|collection date:2022 09 06|geo loc name:China:qingdao|tissue:b1|BioSampleModel:Invertebrate,,,,,,,,,skeletal toxicity studies of polystyrene nanoplastic in zebrafish,3 M5 WT,3 M5 WT,bone,,,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 4000,,SRP485828,,,L1EGI0701140--NPs_F5.R1.raw.fastq.gz L1EGI0701140--NPs_F5.R2.raw.fastq.gz,fastq fastq,8478344376.0,28073988.0,L1EGI0701140 NPs F5.R1.raw.fastq.gz,0:151 1:151,A:2202734913;C:2015133130;G:2106431143;T:2154009977;N:35213,151,151,,,2202734913,2015133130,2106431143,2154009977,35213,SRX23388301,SRS20249494,SRA1791477,zhejiang university|the college of animal science,zhejiang university,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2024-01-25,Undetermined,Undetermined,Bone or Cartilage,Skeletal Element 30224,SRR27722362,SRX23388300,SRS20249493,SRP485828,PRJNA1068830,skeletal toxicity studies of polystyrene nanoplastic in zebrafish,PRJNA1068830,Other,Employing standard polystyrene NPs as the representative the investigation of the bone loss in the caudal fin from environmentally realistic concentration of NPs was assessed in zebrafish.,,,,,3 M4 WT,,isolate:b1 M4|host:female|collection date:2022 09 06|geo loc name:China:qingdao|tissue:b1|BioSampleModel:Invertebrate,,,,,,,,,skeletal toxicity studies of polystyrene nanoplastic in zebrafish,3 M4 WT,3 M4 WT,bone,,,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 4000,,SRP485828,,,L1EGI0701139--NPs_F4.R1.raw.fastq.gz L1EGI0701139--NPs_F4.R2.raw.fastq.gz,fastq fastq,8569883596.0,28377098.0,L1EGI0701139 NPs F4.R1.raw.fastq.gz,0:151 1:151,A:2215047248;C:2038336388;G:2145335785;T:2171128844;N:35331,151,151,,,2215047248,2038336388,2145335785,2171128844,35331,SRX23388300,SRS20249493,SRA1791477,zhejiang university|the college of animal science,zhejiang university,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2024-01-25,Undetermined,Undetermined,Bone or Cartilage,Skeletal Element 30225,SRR27722363,SRX23388299,SRS20249492,SRP485828,PRJNA1068830,skeletal toxicity studies of polystyrene nanoplastic in zebrafish,PRJNA1068830,Other,Employing standard polystyrene NPs as the representative the investigation of the bone loss in the caudal fin from environmentally realistic concentration of NPs was assessed in zebrafish.,,,,,3 M3 WT,,isolate:b1 M3|host:female|collection date:2022 09 06|geo loc name:China:qingdao|tissue:b1|BioSampleModel:Invertebrate,,,,,,,,,skeletal toxicity studies of polystyrene nanoplastic in zebrafish,3 M3 WT,3 M3 WT,bone,,,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 4000,,SRP485828,,,L1EGI0701138--NPs_F3.R1.raw.fastq.gz L1EGI0701138--NPs_F3.R2.raw.fastq.gz,fastq fastq,7930364168.0,26259484.0,L1EGI0701138 NPs F3.R1.raw.fastq.gz,0:151 1:151,A:2046759305;C:1898600276;G:1959125241;T:2025847086;N:32260,151,151,,,2046759305,1898600276,1959125241,2025847086,32260,SRX23388299,SRS20249492,SRA1791477,zhejiang university|the college of animal science,zhejiang university,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2024-01-25,Undetermined,Undetermined,Bone or Cartilage,Skeletal Element 30226,SRR27722364,SRX23388298,SRS20249491,SRP485828,PRJNA1068830,skeletal toxicity studies of polystyrene nanoplastic in zebrafish,PRJNA1068830,Other,Employing standard polystyrene NPs as the representative the investigation of the bone loss in the caudal fin from environmentally realistic concentration of NPs was assessed in zebrafish.,,,,,3 M2 WT,,isolate:b1 M2|host:female|collection date:2022 09 06|geo loc name:China:qingdao|tissue:b1|BioSampleModel:Invertebrate,,,,,,,,,skeletal toxicity studies of polystyrene nanoplastic in zebrafish,3 M2 WT,3 M2 WT,bone,,,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 4000,,SRP485828,,,L1EGI0701137--NPs_F2.R1.raw.fastq.gz L1EGI0701137--NPs_F2.R2.raw.fastq.gz,fastq fastq,6914965272.0,22897236.0,L1EGI0701137 NPs F2.R1.raw.fastq.gz,0:151 1:151,A:1789644342;C:1644676301;G:1738643678;T:1741972870;N:28081,151,151,,,1789644342,1644676301,1738643678,1741972870,28081,SRX23388298,SRS20249491,SRA1791477,zhejiang university|the college of animal science,zhejiang university,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2024-01-25,Undetermined,Undetermined,Bone or Cartilage,Skeletal Element 30227,SRR27722365,SRX23388297,SRS20249490,SRP485828,PRJNA1068830,skeletal toxicity studies of polystyrene nanoplastic in zebrafish,PRJNA1068830,Other,Employing standard polystyrene NPs as the representative the investigation of the bone loss in the caudal fin from environmentally realistic concentration of NPs was assessed in zebrafish.,,,,,3 M1 WT,,isolate:b1 M1|host:female|collection date:2022 09 06|geo loc name:China:qingdao|tissue:b1|BioSampleModel:Invertebrate,,,,,,,,,skeletal toxicity studies of polystyrene nanoplastic in zebrafish,3 M1 WT,3 M1 WT,bone,,,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 4000,,SRP485828,,,L1EGI0701136--NPs_F1.R1.raw.fastq.gz L1EGI0701136--NPs_F1.R2.raw.fastq.gz,fastq fastq,7957071840.0,26347920.0,L1EGI0701136 NPs F1.R1.raw.fastq.gz,0:151 1:151,A:2056500264;C:1899503313;G:1979706436;T:2021329536;N:32291,151,151,,,2056500264,1899503313,1979706436,2021329536,32291,SRX23388297,SRS20249490,SRA1791477,zhejiang university|the college of animal science,zhejiang university,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2024-01-25,Undetermined,Undetermined,Bone or Cartilage,Skeletal Element 30228,SRR27722366,SRX23388296,SRS20249489,SRP485828,PRJNA1068830,skeletal toxicity studies of polystyrene nanoplastic in zebrafish,PRJNA1068830,Other,Employing standard polystyrene NPs as the representative the investigation of the bone loss in the caudal fin from environmentally realistic concentration of NPs was assessed in zebrafish.,,,,,1 F2 WT,,isolate:b1 F2|host:female|collection date:2022 09 06|geo loc name:China:qingdao|tissue:b1|BioSampleModel:Invertebrate,,,,,,,,,skeletal toxicity studies of polystyrene nanoplastic in zebrafish,1 F2 WT,1 F2 WT,bone,,,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 4000,,SRP485828,,,L1EGI0701125--WT_F2.R1.raw.fastq.gz L1EGI0701125--WT_F2.R2.raw.fastq.gz,fastq fastq,7960683760.0,26359880.0,L1EGI0701125 WT F2.R1.raw.fastq.gz,0:151 1:151,A:2087534093;C:1862286963;G:1962292721;T:2048536454;N:33529,151,151,,,2087534093,1862286963,1962292721,2048536454,33529,SRX23388296,SRS20249489,SRA1791477,zhejiang university|the college of animal science,zhejiang university,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2024-01-25,Undetermined,Undetermined,Bone or Cartilage,Skeletal Element 30229,SRR27722367,SRX23388295,SRS20249488,SRP485828,PRJNA1068830,skeletal toxicity studies of polystyrene nanoplastic in zebrafish,PRJNA1068830,Other,Employing standard polystyrene NPs as the representative the investigation of the bone loss in the caudal fin from environmentally realistic concentration of NPs was assessed in zebrafish.,,,,,1 F1 WT,,isolate:b1 F1|host:female|collection date:2022 09 06|geo loc name:China:qingdao|tissue:b1|BioSampleModel:Invertebrate,,,,,,,,,skeletal toxicity studies of polystyrene nanoplastic in zebrafish,1 F1 WT,1 F1 WT,bone,,,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 4000,,SRP485828,,,L1EGI0701124--WT_F1.R1.raw.fastq.gz L1EGI0701124--WT_F1.R2.raw.fastq.gz,fastq fastq,8373285522.0,27726111.0,L1EGI0701124 WT F1.R1.raw.fastq.gz,0:151 1:151,A:2148645285;C:1996284185;G:2121066399;T:2107255525;N:34128,151,151,,,2148645285,1996284185,2121066399,2107255525,34128,SRX23388295,SRS20249488,SRA1791477,zhejiang university|the college of animal science,zhejiang university,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2024-01-25,Undetermined,Undetermined,Bone or Cartilage,Skeletal Element 30650,SRR28054745,SRX23704460,SRS20534455,SRP491086,PRJNA1078753,Integrated mRNA and miRNA sequencing analyses unveil the underlying mechanism of tobacco pollutant induced developmental toxicity in zebrafish embryos,PRJNA1078753,Other,Tobacco pollutants are prevalent in the environment leading to inadvertent exposure of pregnant females. Studies of these pollutants' toxic effects on development have not fully elucidated the potential underlying mechanisms. Therefore in this study we aim at investigate the developmental toxicity induced by cigarette smoke extract CSE at concentrations of 0.25% 1% and 2.5% using a zebrafish embryo toxicity test and integrated transcriptomic analysis of microRNA miRNA and messenger RNA mRNA. The findings revealed that CSE caused developmental toxicity including increased mortality and decreased incubation rate in a dose dependent manner. Moreover CSE induced malformations and apoptosis specifically in the head and heart of zebrafish larvae. We used mRNA and miRNA sequencing analyses to compare changes in the expression of genes and miRNAs in zebrafish larvae. The bioinformatics analysis indicates that the mechanism underlying CSE induced developmental toxicity was associated with genetic repair impairment apoptosis disorder and lipid metabolism disturbance. The enrichment analysis and RT qPCR show that the ctsba gene plays a crucial function in embryo developmental apoptosis and the fads2 gene mainly regulates lipid metabolic toxicity. The results of this study improve the understanding of CSE induced developmental toxicity in zebrafish embryos and contribute insights into the formulation of novel preventive strategies against tobacco pollutants during early embryonic development.,,,,,S21K1228,,library ID:H 1|title:High 1|library strategy:OTHER|library source:METATRANSCRIPTIOMIC|library selection:other|library layout:paired|platform:ILLUMINA|instrument model:RNA seq|filetype:fastq|filename:S21K1228 rep1 1 URNA S72 L003 R1 001.fastq|filename2:S21K1228 rep1 1 URNA S72 L003 R2 001.fastq|host:missing|isolation source:missing|collection date:missing|geographic location:missing|latitude and longitude:missing|age:missing|breed:missing|cultivar:missing|dev stage:missing|ecotype:missing|isolate:missing|sex:missing|strain:missing|tissue:missing|BioSampleModel:Model organism or animal,,,,,,,,,High 1,H 1,H 1,missing,,,RNA-Seq,METATRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP491086,,,S21K1228_rep1_1_URNA_S72_L003_R1_001.fastq.gz S21K1228_rep1_1_URNA_S72_L003_R2_001.fastq.gz,fastq fastq,6506930400.0,21689768.0,S21K1228 rep1 1 URNA S72 L003 R1 001.fastq.gz,0:150 1:150,A:1750770382;C:1473474222;G:1551729505;T:1730941027;N:15264,150,150,,,1750770382,1473474222,1551729505,1730941027,15264,SRX23704460,SRS20534455,SRA1806456,The Second Affiliated Hospital of Shantou University Medical College|Department of Burns and Plastic Surgery,The Second Affiliated Hospital of Shantou University Medical College,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,China,2024-02-22,Undetermined,Multi-stage,Undetermined,Undetermined 30651,SRR28054746,SRX23704459,SRS20534452,SRP491086,PRJNA1078753,Integrated mRNA and miRNA sequencing analyses unveil the underlying mechanism of tobacco pollutant induced developmental toxicity in zebrafish embryos,PRJNA1078753,Other,Tobacco pollutants are prevalent in the environment leading to inadvertent exposure of pregnant females. Studies of these pollutants' toxic effects on development have not fully elucidated the potential underlying mechanisms. Therefore in this study we aim at investigate the developmental toxicity induced by cigarette smoke extract CSE at concentrations of 0.25% 1% and 2.5% using a zebrafish embryo toxicity test and integrated transcriptomic analysis of microRNA miRNA and messenger RNA mRNA. The findings revealed that CSE caused developmental toxicity including increased mortality and decreased incubation rate in a dose dependent manner. Moreover CSE induced malformations and apoptosis specifically in the head and heart of zebrafish larvae. We used mRNA and miRNA sequencing analyses to compare changes in the expression of genes and miRNAs in zebrafish larvae. The bioinformatics analysis indicates that the mechanism underlying CSE induced developmental toxicity was associated with genetic repair impairment apoptosis disorder and lipid metabolism disturbance. The enrichment analysis and RT qPCR show that the ctsba gene plays a crucial function in embryo developmental apoptosis and the fads2 gene mainly regulates lipid metabolic toxicity. The results of this study improve the understanding of CSE induced developmental toxicity in zebrafish embryos and contribute insights into the formulation of novel preventive strategies against tobacco pollutants during early embryonic development.,,,,,S21K1227,,library ID:M 3|title:Medium 3|library strategy:OTHER|library source:METATRANSCRIPTIOMIC|library selection:other|library layout:paired|platform:ILLUMINA|instrument model:RNA seq|filetype:fastq|filename:S21K1227 rep1 1 URNA S71 L003 R1 001.fastq|filename2:S21K1227 rep1 1 URNA S71 L003 R2 001.fastq|host:missing|isolation source:missing|collection date:missing|geographic location:missing|latitude and longitude:missing|age:missing|breed:missing|cultivar:missing|dev stage:missing|ecotype:missing|isolate:missing|sex:missing|strain:missing|tissue:missing|BioSampleModel:Model organism or animal,,,,,,,,,Medium 3,M 3,M 3,missing,,,RNA-Seq,METATRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP491086,,,S21K1227_rep1_1_URNA_S71_L003_R1_001.fastq.gz S21K1227_rep1_1_URNA_S71_L003_R2_001.fastq.gz,fastq fastq,6899268300.0,22997561.0,S21K1227 rep1 1 URNA S71 L003 R1 001.fastq.gz,0:150 1:150,A:1858425383;C:1565856426;G:1639602501;T:1835367744;N:16246,150,150,,,1858425383,1565856426,1639602501,1835367744,16246,SRX23704459,SRS20534452,SRA1806456,The Second Affiliated Hospital of Shantou University Medical College|Department of Burns and Plastic Surgery,The Second Affiliated Hospital of Shantou University Medical College,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,China,2024-02-22,Undetermined,Multi-stage,Undetermined,Undetermined 30652,SRR28054747,SRX23704458,SRS20534453,SRP491086,PRJNA1078753,Integrated mRNA and miRNA sequencing analyses unveil the underlying mechanism of tobacco pollutant induced developmental toxicity in zebrafish embryos,PRJNA1078753,Other,Tobacco pollutants are prevalent in the environment leading to inadvertent exposure of pregnant females. Studies of these pollutants' toxic effects on development have not fully elucidated the potential underlying mechanisms. Therefore in this study we aim at investigate the developmental toxicity induced by cigarette smoke extract CSE at concentrations of 0.25% 1% and 2.5% using a zebrafish embryo toxicity test and integrated transcriptomic analysis of microRNA miRNA and messenger RNA mRNA. The findings revealed that CSE caused developmental toxicity including increased mortality and decreased incubation rate in a dose dependent manner. Moreover CSE induced malformations and apoptosis specifically in the head and heart of zebrafish larvae. We used mRNA and miRNA sequencing analyses to compare changes in the expression of genes and miRNAs in zebrafish larvae. The bioinformatics analysis indicates that the mechanism underlying CSE induced developmental toxicity was associated with genetic repair impairment apoptosis disorder and lipid metabolism disturbance. The enrichment analysis and RT qPCR show that the ctsba gene plays a crucial function in embryo developmental apoptosis and the fads2 gene mainly regulates lipid metabolic toxicity. The results of this study improve the understanding of CSE induced developmental toxicity in zebrafish embryos and contribute insights into the formulation of novel preventive strategies against tobacco pollutants during early embryonic development.,,,,,S21K1226,,library ID:M 2|title:Medium 2|library strategy:OTHER|library source:METATRANSCRIPTIOMIC|library selection:other|library layout:paired|platform:ILLUMINA|instrument model:RNA seq|filetype:fastq|filename:S21K1226 rep1 1 URNA S70 L003 R1 001.fastq|filename2:S21K1226 rep1 1 URNA S70 L003 R2 001.fastq|host:missing|isolation source:missing|collection date:missing|geographic location:missing|latitude and longitude:missing|age:missing|breed:missing|cultivar:missing|dev stage:missing|ecotype:missing|isolate:missing|sex:missing|strain:missing|tissue:missing|BioSampleModel:Model organism or animal,,,,,,,,,Medium 2,M 2,M 2,missing,,,RNA-Seq,METATRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP491086,,,S21K1226_rep1_1_URNA_S70_L003_R1_001.fastq.gz S21K1226_rep1_1_URNA_S70_L003_R2_001.fastq.gz,fastq fastq,6310969500.0,21036565.0,S21K1226 rep1 1 URNA S70 L003 R1 001.fastq.gz,0:150 1:150,A:1688391347;C:1451351943;G:1503321023;T:1667755412;N:149775,150,150,,,1688391347,1451351943,1503321023,1667755412,149775,SRX23704458,SRS20534453,SRA1806456,The Second Affiliated Hospital of Shantou University Medical College|Department of Burns and Plastic Surgery,The Second Affiliated Hospital of Shantou University Medical College,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,China,2024-02-22,Undetermined,Multi-stage,Undetermined,Undetermined 30653,SRR28054748,SRX23704457,SRS20534454,SRP491086,PRJNA1078753,Integrated mRNA and miRNA sequencing analyses unveil the underlying mechanism of tobacco pollutant induced developmental toxicity in zebrafish embryos,PRJNA1078753,Other,Tobacco pollutants are prevalent in the environment leading to inadvertent exposure of pregnant females. Studies of these pollutants' toxic effects on development have not fully elucidated the potential underlying mechanisms. Therefore in this study we aim at investigate the developmental toxicity induced by cigarette smoke extract CSE at concentrations of 0.25% 1% and 2.5% using a zebrafish embryo toxicity test and integrated transcriptomic analysis of microRNA miRNA and messenger RNA mRNA. The findings revealed that CSE caused developmental toxicity including increased mortality and decreased incubation rate in a dose dependent manner. Moreover CSE induced malformations and apoptosis specifically in the head and heart of zebrafish larvae. We used mRNA and miRNA sequencing analyses to compare changes in the expression of genes and miRNAs in zebrafish larvae. The bioinformatics analysis indicates that the mechanism underlying CSE induced developmental toxicity was associated with genetic repair impairment apoptosis disorder and lipid metabolism disturbance. The enrichment analysis and RT qPCR show that the ctsba gene plays a crucial function in embryo developmental apoptosis and the fads2 gene mainly regulates lipid metabolic toxicity. The results of this study improve the understanding of CSE induced developmental toxicity in zebrafish embryos and contribute insights into the formulation of novel preventive strategies against tobacco pollutants during early embryonic development.,,,,,S21K1225,,library ID:M 1|title:Medium 1|library strategy:OTHER|library source:METATRANSCRIPTIOMIC|library selection:other|library layout:paired|platform:ILLUMINA|instrument model:RNA seq|filetype:fastq|filename:S21K1225 rep1 1 URNA S69 L003 R1 001.fastq|filename2:S21K1225 rep1 1 URNA S69 L003 R2 001.fastq|host:missing|isolation source:missing|collection date:missing|geographic location:missing|latitude and longitude:missing|age:missing|breed:missing|cultivar:missing|dev stage:missing|ecotype:missing|isolate:missing|sex:missing|strain:missing|tissue:missing|BioSampleModel:Model organism or animal,,,,,,,,,Medium 1,M 1,M 1,missing,,,RNA-Seq,METATRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP491086,,,S21K1225_rep1_1_URNA_S69_L003_R1_001.fastq.gz S21K1225_rep1_1_URNA_S69_L003_R2_001.fastq.gz,fastq fastq,8677007700.0,28923359.0,S21K1225 rep1 1 URNA S69 L003 R1 001.fastq.gz,0:150 1:150,A:2318840740;C:1999375306;G:2068690840;T:2290080340;N:20474,150,150,,,2318840740,1999375306,2068690840,2290080340,20474,SRX23704457,SRS20534454,SRA1806456,The Second Affiliated Hospital of Shantou University Medical College|Department of Burns and Plastic Surgery,The Second Affiliated Hospital of Shantou University Medical College,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,China,2024-02-22,Undetermined,Multi-stage,Undetermined,Undetermined 30654,SRR28054749,SRX23704456,SRS20534450,SRP491086,PRJNA1078753,Integrated mRNA and miRNA sequencing analyses unveil the underlying mechanism of tobacco pollutant induced developmental toxicity in zebrafish embryos,PRJNA1078753,Other,Tobacco pollutants are prevalent in the environment leading to inadvertent exposure of pregnant females. Studies of these pollutants' toxic effects on development have not fully elucidated the potential underlying mechanisms. Therefore in this study we aim at investigate the developmental toxicity induced by cigarette smoke extract CSE at concentrations of 0.25% 1% and 2.5% using a zebrafish embryo toxicity test and integrated transcriptomic analysis of microRNA miRNA and messenger RNA mRNA. The findings revealed that CSE caused developmental toxicity including increased mortality and decreased incubation rate in a dose dependent manner. Moreover CSE induced malformations and apoptosis specifically in the head and heart of zebrafish larvae. We used mRNA and miRNA sequencing analyses to compare changes in the expression of genes and miRNAs in zebrafish larvae. The bioinformatics analysis indicates that the mechanism underlying CSE induced developmental toxicity was associated with genetic repair impairment apoptosis disorder and lipid metabolism disturbance. The enrichment analysis and RT qPCR show that the ctsba gene plays a crucial function in embryo developmental apoptosis and the fads2 gene mainly regulates lipid metabolic toxicity. The results of this study improve the understanding of CSE induced developmental toxicity in zebrafish embryos and contribute insights into the formulation of novel preventive strategies against tobacco pollutants during early embryonic development.,,,,,S21K1224,,library ID:L 3|title:Low 3|library strategy:OTHER|library source:METATRANSCRIPTIOMIC|library selection:other|library layout:paired|platform:ILLUMINA|instrument model:RNA seq|filetype:fastq|filename:S21K1224 rep1 1 URNA S68 L003 R1 001.fastq|filename2:S21K1224 rep1 1 URNA S68 L003 R2 001.fastq|host:missing|isolation source:missing|collection date:missing|geographic location:missing|latitude and longitude:missing|age:missing|breed:missing|cultivar:missing|dev stage:missing|ecotype:missing|isolate:missing|sex:missing|strain:missing|tissue:missing|BioSampleModel:Model organism or animal,,,,,,,,,Low 3,L 3,L 3,missing,,,RNA-Seq,METATRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP491086,,,S21K1224_rep1_1_URNA_S68_L003_R1_001.fastq.gz S21K1224_rep1_1_URNA_S68_L003_R2_001.fastq.gz,fastq fastq,7160279400.0,23867598.0,S21K1224 rep1 1 URNA S68 L003 R1 001.fastq.gz,0:150 1:150,A:1893984011;C:1641393143;G:1753657602;T:1871228004;N:16640,150,150,,,1893984011,1641393143,1753657602,1871228004,16640,SRX23704456,SRS20534450,SRA1806456,The Second Affiliated Hospital of Shantou University Medical College|Department of Burns and Plastic Surgery,The Second Affiliated Hospital of Shantou University Medical College,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,China,2024-02-22,Undetermined,Multi-stage,Undetermined,Undetermined 30655,SRR28054750,SRX23704455,SRS20534451,SRP491086,PRJNA1078753,Integrated mRNA and miRNA sequencing analyses unveil the underlying mechanism of tobacco pollutant induced developmental toxicity in zebrafish embryos,PRJNA1078753,Other,Tobacco pollutants are prevalent in the environment leading to inadvertent exposure of pregnant females. Studies of these pollutants' toxic effects on development have not fully elucidated the potential underlying mechanisms. Therefore in this study we aim at investigate the developmental toxicity induced by cigarette smoke extract CSE at concentrations of 0.25% 1% and 2.5% using a zebrafish embryo toxicity test and integrated transcriptomic analysis of microRNA miRNA and messenger RNA mRNA. The findings revealed that CSE caused developmental toxicity including increased mortality and decreased incubation rate in a dose dependent manner. Moreover CSE induced malformations and apoptosis specifically in the head and heart of zebrafish larvae. We used mRNA and miRNA sequencing analyses to compare changes in the expression of genes and miRNAs in zebrafish larvae. The bioinformatics analysis indicates that the mechanism underlying CSE induced developmental toxicity was associated with genetic repair impairment apoptosis disorder and lipid metabolism disturbance. The enrichment analysis and RT qPCR show that the ctsba gene plays a crucial function in embryo developmental apoptosis and the fads2 gene mainly regulates lipid metabolic toxicity. The results of this study improve the understanding of CSE induced developmental toxicity in zebrafish embryos and contribute insights into the formulation of novel preventive strategies against tobacco pollutants during early embryonic development.,,,,,S21K1223,,library ID:L 2|title:Low 2|library strategy:OTHER|library source:METATRANSCRIPTIOMIC|library selection:other|library layout:paired|platform:ILLUMINA|instrument model:RNA seq|filetype:fastq|filename:S21K1223 rep1 1 URNA S67 L003 R1 001.fastq|filename2:S21K1223 rep1 1 URNA S67 L003 R2 001.fastq|host:missing|isolation source:missing|collection date:missing|geographic location:missing|latitude and longitude:missing|age:missing|breed:missing|cultivar:missing|dev stage:missing|ecotype:missing|isolate:missing|sex:missing|strain:missing|tissue:missing|BioSampleModel:Model organism or animal,,,,,,,,,Low 2,L 2,L 2,missing,,,RNA-Seq,METATRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP491086,,,S21K1223_rep1_1_URNA_S67_L003_R1_001.fastq.gz S21K1223_rep1_1_URNA_S67_L003_R2_001.fastq.gz,fastq fastq,6779124000.0,22597080.0,S21K1223 rep1 1 URNA S67 L003 R1 001.fastq.gz,0:150 1:150,A:1804338053;C:1556291420;G:1636850001;T:1781628665;N:15861,150,150,,,1804338053,1556291420,1636850001,1781628665,15861,SRX23704455,SRS20534451,SRA1806456,The Second Affiliated Hospital of Shantou University Medical College|Department of Burns and Plastic Surgery,The Second Affiliated Hospital of Shantou University Medical College,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,China,2024-02-22,Undetermined,Multi-stage,Undetermined,Undetermined 30656,SRR28054751,SRX23704454,SRS20534449,SRP491086,PRJNA1078753,Integrated mRNA and miRNA sequencing analyses unveil the underlying mechanism of tobacco pollutant induced developmental toxicity in zebrafish embryos,PRJNA1078753,Other,Tobacco pollutants are prevalent in the environment leading to inadvertent exposure of pregnant females. Studies of these pollutants' toxic effects on development have not fully elucidated the potential underlying mechanisms. Therefore in this study we aim at investigate the developmental toxicity induced by cigarette smoke extract CSE at concentrations of 0.25% 1% and 2.5% using a zebrafish embryo toxicity test and integrated transcriptomic analysis of microRNA miRNA and messenger RNA mRNA. The findings revealed that CSE caused developmental toxicity including increased mortality and decreased incubation rate in a dose dependent manner. Moreover CSE induced malformations and apoptosis specifically in the head and heart of zebrafish larvae. We used mRNA and miRNA sequencing analyses to compare changes in the expression of genes and miRNAs in zebrafish larvae. The bioinformatics analysis indicates that the mechanism underlying CSE induced developmental toxicity was associated with genetic repair impairment apoptosis disorder and lipid metabolism disturbance. The enrichment analysis and RT qPCR show that the ctsba gene plays a crucial function in embryo developmental apoptosis and the fads2 gene mainly regulates lipid metabolic toxicity. The results of this study improve the understanding of CSE induced developmental toxicity in zebrafish embryos and contribute insights into the formulation of novel preventive strategies against tobacco pollutants during early embryonic development.,,,,,S21K1222,,library ID:L 1|title:Low 1|library strategy:OTHER|library source:METATRANSCRIPTIOMIC|library selection:other|library layout:paired|platform:ILLUMINA|instrument model:RNA seq|filetype:fastq|filename:S21K1222 rep1 1 URNA S66 L003 R1 001.fastq|filename2:S21K1222 rep1 1 URNA S66 L003 R2 001.fastq|host:missing|isolation source:missing|collection date:missing|geographic location:missing|latitude and longitude:missing|age:missing|breed:missing|cultivar:missing|dev stage:missing|ecotype:missing|isolate:missing|sex:missing|strain:missing|tissue:missing|BioSampleModel:Model organism or animal,,,,,,,,,Low 1,L 1,L 1,missing,,,RNA-Seq,METATRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP491086,,,S21K1222_rep1_1_URNA_S66_L003_R1_001.fastq.gz S21K1222_rep1_1_URNA_S66_L003_R2_001.fastq.gz,fastq fastq,7484014500.0,24946715.0,S21K1222 rep1 1 URNA S66 L003 R1 001.fastq.gz,0:150 1:150,A:1895991723;C:1633895559;G:2095064183;T:1859045639;N:17396,150,150,,,1895991723,1633895559,2095064183,1859045639,17396,SRX23704454,SRS20534449,SRA1806456,The Second Affiliated Hospital of Shantou University Medical College|Department of Burns and Plastic Surgery,The Second Affiliated Hospital of Shantou University Medical College,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,China,2024-02-22,Undetermined,Multi-stage,Undetermined,Undetermined 30657,SRR28054752,SRX23704453,SRS20534447,SRP491086,PRJNA1078753,Integrated mRNA and miRNA sequencing analyses unveil the underlying mechanism of tobacco pollutant induced developmental toxicity in zebrafish embryos,PRJNA1078753,Other,Tobacco pollutants are prevalent in the environment leading to inadvertent exposure of pregnant females. Studies of these pollutants' toxic effects on development have not fully elucidated the potential underlying mechanisms. Therefore in this study we aim at investigate the developmental toxicity induced by cigarette smoke extract CSE at concentrations of 0.25% 1% and 2.5% using a zebrafish embryo toxicity test and integrated transcriptomic analysis of microRNA miRNA and messenger RNA mRNA. The findings revealed that CSE caused developmental toxicity including increased mortality and decreased incubation rate in a dose dependent manner. Moreover CSE induced malformations and apoptosis specifically in the head and heart of zebrafish larvae. We used mRNA and miRNA sequencing analyses to compare changes in the expression of genes and miRNAs in zebrafish larvae. The bioinformatics analysis indicates that the mechanism underlying CSE induced developmental toxicity was associated with genetic repair impairment apoptosis disorder and lipid metabolism disturbance. The enrichment analysis and RT qPCR show that the ctsba gene plays a crucial function in embryo developmental apoptosis and the fads2 gene mainly regulates lipid metabolic toxicity. The results of this study improve the understanding of CSE induced developmental toxicity in zebrafish embryos and contribute insights into the formulation of novel preventive strategies against tobacco pollutants during early embryonic development.,,,,,S21K1221,,library ID:C 3|title:Control 3|library strategy:OTHER|library source:METATRANSCRIPTIOMIC|library selection:other|library layout:paired|platform:ILLUMINA|instrument model:RNA seq|filetype:fastq|filename:S21K1221 rep1 1 URNA S65 L003 R1 001.fastq|filename2:S21K1221 rep1 1 URNA S65 L003 R2 001.fastq|host:missing|isolation source:missing|collection date:missing|geographic location:missing|latitude and longitude:missing|age:missing|breed:missing|cultivar:missing|dev stage:missing|ecotype:missing|isolate:missing|sex:missing|strain:missing|tissue:missing|BioSampleModel:Model organism or animal,,,,,,,,,Control 3,C 3,C 3,missing,,,RNA-Seq,METATRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP491086,,,S21K1221_rep1_1_URNA_S65_L003_R1_001.fastq.gz S21K1221_rep1_1_URNA_S65_L003_R2_001.fastq.gz,fastq fastq,6562506000.0,21875020.0,S21K1221 rep1 1 URNA S65 L003 R1 001.fastq.gz,0:150 1:150,A:1753018331;C:1507753283;G:1569109292;T:1732610076;N:15018,150,150,,,1753018331,1507753283,1569109292,1732610076,15018,SRX23704453,SRS20534447,SRA1806456,The Second Affiliated Hospital of Shantou University Medical College|Department of Burns and Plastic Surgery,The Second Affiliated Hospital of Shantou University Medical College,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,China,2024-02-22,Undetermined,Multi-stage,Undetermined,Undetermined 30658,SRR28054753,SRX23704452,SRS20534448,SRP491086,PRJNA1078753,Integrated mRNA and miRNA sequencing analyses unveil the underlying mechanism of tobacco pollutant induced developmental toxicity in zebrafish embryos,PRJNA1078753,Other,Tobacco pollutants are prevalent in the environment leading to inadvertent exposure of pregnant females. Studies of these pollutants' toxic effects on development have not fully elucidated the potential underlying mechanisms. Therefore in this study we aim at investigate the developmental toxicity induced by cigarette smoke extract CSE at concentrations of 0.25% 1% and 2.5% using a zebrafish embryo toxicity test and integrated transcriptomic analysis of microRNA miRNA and messenger RNA mRNA. The findings revealed that CSE caused developmental toxicity including increased mortality and decreased incubation rate in a dose dependent manner. Moreover CSE induced malformations and apoptosis specifically in the head and heart of zebrafish larvae. We used mRNA and miRNA sequencing analyses to compare changes in the expression of genes and miRNAs in zebrafish larvae. The bioinformatics analysis indicates that the mechanism underlying CSE induced developmental toxicity was associated with genetic repair impairment apoptosis disorder and lipid metabolism disturbance. The enrichment analysis and RT qPCR show that the ctsba gene plays a crucial function in embryo developmental apoptosis and the fads2 gene mainly regulates lipid metabolic toxicity. The results of this study improve the understanding of CSE induced developmental toxicity in zebrafish embryos and contribute insights into the formulation of novel preventive strategies against tobacco pollutants during early embryonic development.,,,,,S21K1230,,library ID:H 3|title:High 3|library strategy:OTHER|library source:METATRANSCRIPTIOMIC|library selection:other|library layout:paired|platform:ILLUMINA|instrument model:RNA seq|filetype:fastq|filename:S21K1230 rep1 1 URNA S74 L003 R1 001.fastq|filename2:S21K1230 rep1 1 URNA S74 L003 R2 001.fastq|host:missing|isolation source:missing|collection date:missing|geographic location:missing|latitude and longitude:missing|age:missing|breed:missing|cultivar:missing|dev stage:missing|ecotype:missing|isolate:missing|sex:missing|strain:missing|tissue:missing|BioSampleModel:Model organism or animal,,,,,,,,,High 3,H 3,H 3,missing,,,RNA-Seq,METATRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP491086,,,S21K1230_rep1_1_URNA_S74_L003_R1_001.fastq.gz S21K1230_rep1_1_URNA_S74_L003_R2_001.fastq.gz,fastq fastq,6117817800.0,20392726.0,S21K1230 rep1 1 URNA S74 L003 R1 001.fastq.gz,0:150 1:150,A:1635728688;C:1405168032;G:1464072107;T:1612834762;N:14211,150,150,,,1635728688,1405168032,1464072107,1612834762,14211,SRX23704452,SRS20534448,SRA1806456,The Second Affiliated Hospital of Shantou University Medical College|Department of Burns and Plastic Surgery,The Second Affiliated Hospital of Shantou University Medical College,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,China,2024-02-22,Undetermined,Multi-stage,Undetermined,Undetermined 30659,SRR28054754,SRX23704451,SRS20534446,SRP491086,PRJNA1078753,Integrated mRNA and miRNA sequencing analyses unveil the underlying mechanism of tobacco pollutant induced developmental toxicity in zebrafish embryos,PRJNA1078753,Other,Tobacco pollutants are prevalent in the environment leading to inadvertent exposure of pregnant females. Studies of these pollutants' toxic effects on development have not fully elucidated the potential underlying mechanisms. Therefore in this study we aim at investigate the developmental toxicity induced by cigarette smoke extract CSE at concentrations of 0.25% 1% and 2.5% using a zebrafish embryo toxicity test and integrated transcriptomic analysis of microRNA miRNA and messenger RNA mRNA. The findings revealed that CSE caused developmental toxicity including increased mortality and decreased incubation rate in a dose dependent manner. Moreover CSE induced malformations and apoptosis specifically in the head and heart of zebrafish larvae. We used mRNA and miRNA sequencing analyses to compare changes in the expression of genes and miRNAs in zebrafish larvae. The bioinformatics analysis indicates that the mechanism underlying CSE induced developmental toxicity was associated with genetic repair impairment apoptosis disorder and lipid metabolism disturbance. The enrichment analysis and RT qPCR show that the ctsba gene plays a crucial function in embryo developmental apoptosis and the fads2 gene mainly regulates lipid metabolic toxicity. The results of this study improve the understanding of CSE induced developmental toxicity in zebrafish embryos and contribute insights into the formulation of novel preventive strategies against tobacco pollutants during early embryonic development.,,,,,S21K1229,,library ID:H 2|title:High 2|library strategy:OTHER|library source:METATRANSCRIPTIOMIC|library selection:other|library layout:paired|platform:ILLUMINA|instrument model:RNA seq|filetype:fastq|filename:S21K1229 rep1 1 URNA S73 L003 R1 001.fastq|filename2:S21K1229 rep1 1 URNA S73 L003 R2 001.fastq|host:missing|isolation source:missing|collection date:missing|geographic location:missing|latitude and longitude:missing|age:missing|breed:missing|cultivar:missing|dev stage:missing|ecotype:missing|isolate:missing|sex:missing|strain:missing|tissue:missing|BioSampleModel:Model organism or animal,,,,,,,,,High 2,H 2,H 2,missing,,,RNA-Seq,METATRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP491086,,,S21K1229_rep1_1_URNA_S73_L003_R1_001.fastq.gz S21K1229_rep1_1_URNA_S73_L003_R2_001.fastq.gz,fastq fastq,7164803100.0,23882677.0,S21K1229 rep1 1 URNA S73 L003 R1 001.fastq.gz,0:150 1:150,A:1920286881;C:1649856655;G:1697032084;T:1897610671;N:16809,150,150,,,1920286881,1649856655,1697032084,1897610671,16809,SRX23704451,SRS20534446,SRA1806456,The Second Affiliated Hospital of Shantou University Medical College|Department of Burns and Plastic Surgery,The Second Affiliated Hospital of Shantou University Medical College,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,China,2024-02-22,Undetermined,Multi-stage,Undetermined,Undetermined 30660,SRR28054755,SRX23704450,SRS20534445,SRP491086,PRJNA1078753,Integrated mRNA and miRNA sequencing analyses unveil the underlying mechanism of tobacco pollutant induced developmental toxicity in zebrafish embryos,PRJNA1078753,Other,Tobacco pollutants are prevalent in the environment leading to inadvertent exposure of pregnant females. Studies of these pollutants' toxic effects on development have not fully elucidated the potential underlying mechanisms. Therefore in this study we aim at investigate the developmental toxicity induced by cigarette smoke extract CSE at concentrations of 0.25% 1% and 2.5% using a zebrafish embryo toxicity test and integrated transcriptomic analysis of microRNA miRNA and messenger RNA mRNA. The findings revealed that CSE caused developmental toxicity including increased mortality and decreased incubation rate in a dose dependent manner. Moreover CSE induced malformations and apoptosis specifically in the head and heart of zebrafish larvae. We used mRNA and miRNA sequencing analyses to compare changes in the expression of genes and miRNAs in zebrafish larvae. The bioinformatics analysis indicates that the mechanism underlying CSE induced developmental toxicity was associated with genetic repair impairment apoptosis disorder and lipid metabolism disturbance. The enrichment analysis and RT qPCR show that the ctsba gene plays a crucial function in embryo developmental apoptosis and the fads2 gene mainly regulates lipid metabolic toxicity. The results of this study improve the understanding of CSE induced developmental toxicity in zebrafish embryos and contribute insights into the formulation of novel preventive strategies against tobacco pollutants during early embryonic development.,,,,,S21K1220,,library ID:C 2|title:Control 2|library strategy:OTHER|library source:METATRANSCRIPTIOMIC|library selection:other|library layout:paired|platform:ILLUMINA|instrument model:RNA seq|filetype:fastq|filename:S21K1220 rep1 1 URNA S64 L003 R1 001.fastq|filename2:S21K1220 rep1 1 URNA S64 L003 R2 001.fastq|host:missing|isolation source:missing|collection date:missing|geographic location:missing|latitude and longitude:missing|age:missing|breed:missing|cultivar:missing|dev stage:missing|ecotype:missing|isolate:missing|sex:missing|strain:missing|tissue:missing|BioSampleModel:Model organism or animal,,,,,,,,,Control 2,C 2,C 2,missing,,,RNA-Seq,METATRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP491086,,,S21K1220_rep1_1_URNA_S64_L003_R1_001.fastq.gz S21K1220_rep1_1_URNA_S64_L003_R2_001.fastq.gz,fastq fastq,6790504800.0,22635016.0,S21K1220 rep1 1 URNA S64 L003 R1 001.fastq.gz,0:150 1:150,A:1784553430;C:1593393319;G:1650087761;T:1762454671;N:15619,150,150,,,1784553430,1593393319,1650087761,1762454671,15619,SRX23704450,SRS20534445,SRA1806456,The Second Affiliated Hospital of Shantou University Medical College|Department of Burns and Plastic Surgery,The Second Affiliated Hospital of Shantou University Medical College,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,China,2024-02-22,Undetermined,Multi-stage,Undetermined,Undetermined 30661,SRR28054756,SRX23704449,SRS20534444,SRP491086,PRJNA1078753,Integrated mRNA and miRNA sequencing analyses unveil the underlying mechanism of tobacco pollutant induced developmental toxicity in zebrafish embryos,PRJNA1078753,Other,Tobacco pollutants are prevalent in the environment leading to inadvertent exposure of pregnant females. Studies of these pollutants' toxic effects on development have not fully elucidated the potential underlying mechanisms. Therefore in this study we aim at investigate the developmental toxicity induced by cigarette smoke extract CSE at concentrations of 0.25% 1% and 2.5% using a zebrafish embryo toxicity test and integrated transcriptomic analysis of microRNA miRNA and messenger RNA mRNA. The findings revealed that CSE caused developmental toxicity including increased mortality and decreased incubation rate in a dose dependent manner. Moreover CSE induced malformations and apoptosis specifically in the head and heart of zebrafish larvae. We used mRNA and miRNA sequencing analyses to compare changes in the expression of genes and miRNAs in zebrafish larvae. The bioinformatics analysis indicates that the mechanism underlying CSE induced developmental toxicity was associated with genetic repair impairment apoptosis disorder and lipid metabolism disturbance. The enrichment analysis and RT qPCR show that the ctsba gene plays a crucial function in embryo developmental apoptosis and the fads2 gene mainly regulates lipid metabolic toxicity. The results of this study improve the understanding of CSE induced developmental toxicity in zebrafish embryos and contribute insights into the formulation of novel preventive strategies against tobacco pollutants during early embryonic development.,,,,,S21K1219,,library ID:C 1|title:Control 1|library strategy:OTHER|library source:METATRANSCRIPTIOMIC|library selection:other|library layout:paired|platform:ILLUMINA|instrument model:RNA seq|filetype:fastq|filename:S21K1219 rep1 1 URNA S63 L003 R1 001.fastq|filename2:S21K1219 rep1 1 URNA S63 L003 R2 001.fastq|host:missing|isolation source:missing|collection date:missing|geographic location:missing|latitude and longitude:missing|age:missing|breed:missing|cultivar:missing|dev stage:missing|ecotype:missing|isolate:missing|sex:missing|strain:missing|tissue:missing|BioSampleModel:Model organism or animal,,,,,,,,,Control 1,C 1,C 1,missing,,,RNA-Seq,METATRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP491086,,,S21K1219_rep1_1_URNA_S63_L003_R1_001.fastq.gz S21K1219_rep1_1_URNA_S63_L003_R2_001.fastq.gz,fastq fastq,7498264200.0,24994214.0,S21K1219 rep1 1 URNA S63 L003 R1 001.fastq.gz,0:150 1:150,A:2002773492;C:1716996682;G:1800329295;T:1978147319;N:17412,150,150,,,2002773492,1716996682,1800329295,1978147319,17412,SRX23704449,SRS20534444,SRA1806456,The Second Affiliated Hospital of Shantou University Medical College|Department of Burns and Plastic Surgery,The Second Affiliated Hospital of Shantou University Medical College,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,China,2024-02-22,Undetermined,Multi-stage,Undetermined,Undetermined 32858,SRR29482326,SRX24993370,SRS21694834,SRP515140,PRJNA1126247,Specific oncogene activation of the cell of origin in mucosal melanoma [SORT seq],GSE270356,Other,Mucosal melanoma MM is a deadly cancer derived from mucosal melanocytes. To test the consequences of MM genetics we develop a zebrafish model in which all melanocytes experience CCND1 expression and loss of PTEN and TP53. Surprisingly melanoma only develops from melanocytes lining internal organs analogous to the location of patient MM. We find that zebrafish MMs have a unique chromatin landscape from cutaneous melanoma. Internal melanocytes are labeled using a MM specific transcriptional enhancer. Normal zebrafish internal melanocytes share a gene expression signature with MMs. Patient and zebrafish MMs show increased migratory neural crest gene and decreased antigen presentation gene expression consistent with the increased metastatic behavior and decreased immunotherapy sensitivity of MM. Our work suggests the cell state of the originating melanocyte influences the behavior of derived melanomas. Our animal model phenotypically and transcriptionally mimics patient tumors allowing this model to be used for MM therapeutic discovery. As this is a non MAPK driven genetically engineered model of melanoma our work also has implications for the 15% of cutaneous melanoma patients who lack MAPK driving mutations. Overall design: Single cell RNA sequencing was done on internal vs. external normal adult zebrafish melanocytes using the SORT seq platform.,,,,Internal melanocytes,GSM8340241,,source name:Internal melanocytes|tissue:Internal melanocytes|cell type:melanocytes|genotype:mitfa / ; roy / fish injected with mitfa:GFP|geo loc name:missing|collection date:missing,Internal melanocytes,BWA was used to align paired end read to danRer11. Count tables were generated using MapAndGo. Count tables were corrected using UMI to remove duplicate reads. Transcript counts were adjusted using Poissonian counting statistics to yield the number of UMIs detected per cell. Counts were imported into R using the Seurat suite version 3.0 Assembly: danRer11 Supplementary files format and content: .tsv file contains count matrix file used for data normalization and visualization using Seurat Library strategy: SORT seq,Internal melanocytes,,Respective tissues were mechanically dissociated digested in TrypLE for 45 min Invitrogen 12563011 40uM filtered spun down and resuspended in FACs buffer dPBS Mg+/Ca+ free with 2% FBS pen/strep. Cells were heat lysed at 65°C followed by cDNA synthesis with barcodes. All the barcoded material from one plate was pooled into one library and amplified using in vitro transcription. Following amplification library preparation was done following the CEL Seq2 protocol to prepare a cDNA library for sequencing using TruSeq small RNA primers Illumina.,mitfa / ; roy / zebrafish injected with mitfa:GFP were Raised to maturity to obtain tissues,tissue:Internal melanocytes|cell type:melanocytes|genotype:mitfa / ; roy / fish injected with mitfa:GFP,GSM8340241,GSM8340241: Internal melanocytes; Danio rerio; OTHER,GSM8340241 r1,GSM8340241,1,Respective tissues were mechanically dissociated digested in TrypLE for 45 min Invitrogen 12563011 40uM filtered spun down and resuspended in FACs buffer dPBS Mg+/Ca+ free with 2% FBS pen/strep. Cells were heat lysed at 65°C followed by cDNA synthesis with barcodes. All the barcoded material from one plate was pooled into one library and amplified using in vitro transcription. Following amplification library preparation was done following the CEL Seq2 protocol to prepare a cDNA library for sequencing using TruSeq small RNA primers Illumina.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,NextSeq 500,,SRP515140,,,HAR-MI-002_H5GCWBGXF_R2.fastq.gz HAR-MI-002_H5GCWBGXF_R1.fastq.gz,fastq fastq,2957975418.0,34395063.0,GSM8340241 r1,0:26 1:60,A:738954503;C:560052455;G:520746060;T:1137116132;N:1106268,26,60,,,738954503,560052455,520746060,1137116132,1106268,SRX24993370,SRS21694834,SRA1904773,"Insco Lab, Medical Oncology, Dana Farber Cancer Institute","Insco Lab, Medical Oncology, Dana Farber Cancer Institute",2,0.11637,0.84116,0.10894,0.31188,0.98851,0.71526,0.6688,0.60221,26,60,T,B,sc-like readlen,illumina,nextseq,unknown,small_rna,trueseq,sc,single_cell_plate,celseq,,United States,2024-06-20,Undetermined,Adult,Skin,Surface Structure 32859,SRR29482327,SRX24993369,SRS21694833,SRP515140,PRJNA1126247,Specific oncogene activation of the cell of origin in mucosal melanoma [SORT seq],GSE270356,Other,Mucosal melanoma MM is a deadly cancer derived from mucosal melanocytes. To test the consequences of MM genetics we develop a zebrafish model in which all melanocytes experience CCND1 expression and loss of PTEN and TP53. Surprisingly melanoma only develops from melanocytes lining internal organs analogous to the location of patient MM. We find that zebrafish MMs have a unique chromatin landscape from cutaneous melanoma. Internal melanocytes are labeled using a MM specific transcriptional enhancer. Normal zebrafish internal melanocytes share a gene expression signature with MMs. Patient and zebrafish MMs show increased migratory neural crest gene and decreased antigen presentation gene expression consistent with the increased metastatic behavior and decreased immunotherapy sensitivity of MM. Our work suggests the cell state of the originating melanocyte influences the behavior of derived melanomas. Our animal model phenotypically and transcriptionally mimics patient tumors allowing this model to be used for MM therapeutic discovery. As this is a non MAPK driven genetically engineered model of melanoma our work also has implications for the 15% of cutaneous melanoma patients who lack MAPK driving mutations. Overall design: Single cell RNA sequencing was done on internal vs. external normal adult zebrafish melanocytes using the SORT seq platform.,,,,Cutaneous melanocytes,GSM8340240,,source name:Cutaneous melanocytes|tissue:Cutaneous melanocytes|cell type:melanocytes|genotype:mitfa / ; roy / fish injected with mitfa:GFP|geo loc name:missing|collection date:missing,Cutaneous melanocytes,BWA was used to align paired end read to danRer11. Count tables were generated using MapAndGo. Count tables were corrected using UMI to remove duplicate reads. Transcript counts were adjusted using Poissonian counting statistics to yield the number of UMIs detected per cell. Counts were imported into R using the Seurat suite version 3.0 Assembly: danRer11 Supplementary files format and content: .tsv file contains count matrix file used for data normalization and visualization using Seurat Library strategy: SORT seq,Cutaneous melanocytes,,Respective tissues were mechanically dissociated digested in TrypLE for 45 min Invitrogen 12563011 40uM filtered spun down and resuspended in FACs buffer dPBS Mg+/Ca+ free with 2% FBS pen/strep. Cells were heat lysed at 65°C followed by cDNA synthesis with barcodes. All the barcoded material from one plate was pooled into one library and amplified using in vitro transcription. Following amplification library preparation was done following the CEL Seq2 protocol to prepare a cDNA library for sequencing using TruSeq small RNA primers Illumina.,mitfa / ; roy / zebrafish injected with mitfa:GFP were Raised to maturity to obtain tissues,tissue:Cutaneous melanocytes|cell type:melanocytes|genotype:mitfa / ; roy / fish injected with mitfa:GFP,GSM8340240,GSM8340240: Cutaneous melanocytes; Danio rerio; OTHER,GSM8340240 r1,GSM8340240,1,Respective tissues were mechanically dissociated digested in TrypLE for 45 min Invitrogen 12563011 40uM filtered spun down and resuspended in FACs buffer dPBS Mg+/Ca+ free with 2% FBS pen/strep. Cells were heat lysed at 65°C followed by cDNA synthesis with barcodes. All the barcoded material from one plate was pooled into one library and amplified using in vitro transcription. Following amplification library preparation was done following the CEL Seq2 protocol to prepare a cDNA library for sequencing using TruSeq small RNA primers Illumina.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,NextSeq 500,,SRP515140,,,HAR-MI-001_H5GCWBGXF_R2.fastq.gz HAR-MI-001_H5GCWBGXF_R1.fastq.gz,fastq fastq,2680460212.0,31168142.0,GSM8340240 r1,0:26 1:60,A:704357434;C:519158361;G:467098420;T:988838604;N:1007393,26,60,,,704357434,519158361,467098420,988838604,1007393,SRX24993369,SRS21694833,SRA1904773,"Insco Lab, Medical Oncology, Dana Farber Cancer Institute","Insco Lab, Medical Oncology, Dana Farber Cancer Institute",2,0.11679,0.81545,0.10693,0.5033,0.9808,0.76404,0.44749,0.57623,26,60,T,B,sc-like readlen,illumina,nextseq,unknown,small_rna,trueseq,sc,single_cell_plate,celseq,,United States,2024-06-20,Undetermined,Adult,Skin,Surface Structure 33123,SRR29672615,SRX25176099,SRS21866000,SRP517393,PRJNA1130538,ac4C transcriptomes of Zebrafish and Worm,GSE271258,Other,ac4C modification appears in mutilple model organisms including Zebrafish and Worm Overall design: To investigate whether ac4C modification is involved in evolution we performed ac4C RIP seq on Zebrafish and Worm.,,,,Zebrafish ac4C,GSM8372406,,tissue:Animal organ cells|cell type:Animal organ cells|genotype:Wild type|rip antibody:anti ac4C Abcam catalog No. ab252215|geo loc name:missing|collection date:missing,Zebrafish ac4C,The raw ac4C RIP seq data were aligned to genome reference sequences by Hisat2. The aligned reads were used for ac4C modification peak calling and the significant methylation was identified by exomepeak2 and the ac4C peak calling can be visualized by IGV software. The MetaTX was used to examine the distribution pattern of epitranscriptome profiles. The STREME was used to determine if the ac4C peaks contained the consensus of ac4C motif sequences. For mRNA seq the mRNA expression level was analyzed by StringTie and differentially expressed mRNAs were calculated by DEseq. The substrates of ac4C regulators were obtained from starBase v2.0. The statistical enrichment analysis of Gene Ontology GO and Kyoto Encyclopedia of Genes and Genomes KEGG pathway for differentially expressed genes DEGs and differentially methylated mRNAs were applied by DAVID. Assembly: danRer10 or WBcel235 Supplementary files format and content: The processed data files is in CSV format containing the expression levels and ac4C status changes for each gene.,Animal organ cells,,Total RNA was extracted according to manufacturer’s instruction. The stranded RNA sequencing library was constructed by KC DigitalTM Stranded mRNA Library Prep Kit for Illumina® Catalog NO. DR08502 Wuhan Seqhealth Co. Ltd. China following the manufacturer’s instruction. The kit eliminates duplication bias in PCR and sequencing steps by using unique molecular identifier UMI of 8 random bases to label the pre amplified cDNA molecules. The library products corresponding to 200 500 bps were enriched,,cell type:Animal organ cells|genotype:Wild type|rip antibody:anti ac4C Abcam catalog No. ab252215,GSM8372406,GSM8372406: Zebrafish ac4C; Danio rerio; RIP Seq,GSM8372406 r1,GSM8372406,1,Total RNA was extracted according to manufacturer's instruction. The stranded RNA sequencing library was constructed by KC DigitalTM Stranded mRNA Library Prep Kit for Illumina® Catalog NO. DR08502 Wuhan Seqhealth Co. Ltd. China following the manufacturer's instruction. The kit eliminates duplication bias in PCR and sequencing steps by using unique molecular identifier UMI of 8 random bases to label the pre amplified cDNA molecules. The library products corresponding to 200 500 bps were enriched,,RIP-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP517393,,,Fish_IP.clean.R2.fastq.gz Fish_IP.clean.R1.fastq.gz,fastq fastq,816231517.0,3830403.0,GSM8372406 r1,0:102.34 1:110.76,A:199381841;C:207571478;G:205740791;T:203535549;N:1858,102,110,,,199381841,207571478,205740791,203535549,1858,SRX25176099,SRS21866000,SRA1914369,Fujian Medical University,Fujian Medical University,2,0.60415,0.60545,0.08824,0.08794,0.78796,0.78733,0.43432,0.43842,126,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2024-07-01,Undetermined,Undetermined,Undetermined,Undetermined 36265,SRR058073,SRX022206,SRS084221,SRP002640,PRJNA128943,Expanding the MicroRNA Targeting Code: A Novel Type of Site with Centered Pairing,GSE22068,Other,We present “centered sites ” a class of microRNA target sites that lacks both perfect seed pairing and three prime compensatory pairing and instead has 11–12 contiguous Watson–Crick pairs to the center of the microRNA. In elevated Mg2+ centered sites impart mRNA cleavage but in cells centered sites repress protein output without xxx Agronaute catalyzed cleavage. Our study also identified novel extensively paired sites that are cleavage substrates in cultured cells and human brain. This expanded repertoire of cleavage targets and the identification of the centered site type help explain why central regions of many microRNAs are evolutionarily conserved. Overall design: To study centered sites and identify miRNA cleavage targets mRNA degradomes were sequenced from human brain and HeLa cells and smallRNAs were sequenced from human brain and zebrafish embryo at 24 hpf. Replicates were combined before the analysis. Fastq files are not available for GSM548638 and GSM548639.,,pubmed:20620952,,Zebrafish Embryo small RNAs,GSM548640,,source name:Embryo Cells|data type:small RNAs|tissue:embryo,Zebrafish Embryo small RNAs,Small RNA sequences from same total RNA samples were mapped to the human genome hg18 requiring a perfect match and reads co localizing to annotated miRNA loci miRBase version 11.0 were counted. sequence reads are summarized as frequency counts,Embryo Cells,,The small RNA cDNA libraries were made as described Grimson et al. 2008 except for the three prime adaptor ligation which was five prime adenylated pTCGTATGCCGTCTTCTGCTTGidT. For a detailed protocol see http://web.wi.mit.edu/bartel/pub/protocols.html.,,data type:small RNAs|tissue:embryo,GSM548640,GSM548640: Zebrafish Embryo small RNAs,GSM548640: Zebrafish Embryo small RNAs,GSM548640: Zebrafish Embryo small RNAs,1,,GEO Accession:GSM548640,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina Genome Analyzer,0Application ReadForward1,SRP002640,,quality book char:@|quality scoring system:log odds,Zebrafish_embryo_24h.fastq,fastq,62213148.0,1728143.0,GSM548640 1,0:36,A:13550515;C:14269249;G:15670049;T:18673533;N:49802,36,,,,13550515,14269249,15670049,18673533,49802,SRX022206,SRS084221,SRA020539,GEO,"Bartel lab, Whitehead Institute",1,0.02298,,0.02186,,0.9988,,0.3246,,36,,B,,usable mapping rate,illumina,early_illumina,unknown,small_rna,unknown,bulk,unknown,unknown,,United States,2010-06-01,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 36285,SRR363985,SRX105298,SRS270141,SRP009275,PRJNA148581,Hen1 analysis in zebrafish,GSE33582,Transcriptome Analysis,small RNA libraries from wild type and Hen1 mutant testes were made with either polyA tailing VASAGFPHen1minus/plus or adapter ligation Hen1Testis and WTTestis and sequenced on an Illumina GAII platform. Overall design: RNA was isolated from total testis tissue of both Hen1 wildtype and Hen1 mutant animals. post size selection from gel the small RNA libraries wre made.,,pubmed:20859253,,wildtype ligation,GSM830247,,source name:testis|strain:TL|genotype/variation:Hen1 wildtype|tissue:testis|small rna library prep method:adapter ligation,wildtype ligation,three prime adapter sequences were trimmed and inserts longer than 18 nt were mapped to the zebrafish genome Zv8,testis,,Small RNAs in the size range of 19 31 bases were excised from a denaturing gel. Adaptors were ligated to the five prime and three prime ends of the isolated RNA and the product was converted to cDNA using a primer on the three prime adaptor. post 15 cycles PCR amplification of the library the product was gel purified and sequenced on a Solexa platform.,,strain:TL|genotype/variation:Hen1 wildtype|tissue:testis|small rna library prep method:adapter ligation,GSM830247,GSM830247: wildtype ligation,GSM830247: wildtype ligation,GSM830247: wildtype ligation,1,,GEO Accession:GSM830247,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina Genome Analyzer II,460Application ReadForward1,SRP009275,,read name barcode proc directive:ignore,WTTESTIS.fastq,fastq,395791130.0,8604155.0,GSM830247 1,0:46,A:79045664;C:90489917;G:99082007;T:127024229;N:149313,46,,,,79045664,90489917,99082007,127024229,149313,SRX105298,SRS270141,SRA047996,GEO,"European Research Institute for the Biology of Ageing, University Medical Center Groningen",1,0.00021,,0.00015,,0.99989,,0.0,,46,,T,,under 1.2% mapping rate,illumina,early_illumina,5prime,poly_a,unknown,bulk,unknown,unknown,,Netherlands,2011-11-09,Undetermined,Undetermined,Gonad,Reproductive System 36286,SRR363984,SRX105297,SRS270140,SRP009275,PRJNA148581,Hen1 analysis in zebrafish,GSE33582,Transcriptome Analysis,small RNA libraries from wild type and Hen1 mutant testes were made with either polyA tailing VASAGFPHen1minus/plus or adapter ligation Hen1Testis and WTTestis and sequenced on an Illumina GAII platform. Overall design: RNA was isolated from total testis tissue of both Hen1 wildtype and Hen1 mutant animals. post size selection from gel the small RNA libraries wre made.,,pubmed:20859253,,hen1 mutant ligation,GSM830246,,source name:testis|strain:TL|genotype/variation:Hen1 mutant|tissue:testis|small rna library prep method:adapter ligation,hen1 mutant ligation,three prime adapter sequences were trimmed and inserts longer than 18 nt were mapped to the zebrafish genome Zv8,testis,,Small RNAs in the size range of 19 31 bases were excised from a denaturing gel. Adaptors were ligated to the five prime and three prime ends of the isolated RNA and the product was converted to cDNA using a primer on the three prime adaptor. post 15 cycles PCR amplification of the library the product was gel purified and sequenced on a Solexa platform.,,strain:TL|genotype/variation:Hen1 mutant|tissue:testis|small rna library prep method:adapter ligation,GSM830246,GSM830246: hen1 mutant ligation,GSM830246: hen1 mutant ligation,GSM830246: hen1 mutant ligation,1,,GEO Accession:GSM830246,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina Genome Analyzer II,460Application ReadForward1,SRP009275,,read name barcode proc directive:ignore,HEN1TESTIS.fastq,fastq,440876374.0,9584269.0,GSM830246 1,0:46,A:91693980;C:99515953;G:105634029;T:143841954;N:190458,46,,,,91693980,99515953,105634029,143841954,190458,SRX105297,SRS270140,SRA047996,GEO,"European Research Institute for the Biology of Ageing, University Medical Center Groningen",1,0.00039,,0.00033,,0.99995,,0.0,,46,,T,,under 1.2% mapping rate,illumina,early_illumina,5prime,poly_a,unknown,bulk,unknown,unknown,,Netherlands,2011-11-09,Undetermined,Undetermined,Gonad,Reproductive System 36287,SRR363983,SRX105296,SRS270139,SRP009275,PRJNA148581,Hen1 analysis in zebrafish,GSE33582,Transcriptome Analysis,small RNA libraries from wild type and Hen1 mutant testes were made with either polyA tailing VASAGFPHen1minus/plus or adapter ligation Hen1Testis and WTTestis and sequenced on an Illumina GAII platform. Overall design: RNA was isolated from total testis tissue of both Hen1 wildtype and Hen1 mutant animals. post size selection from gel the small RNA libraries wre made.,,pubmed:20859253,,wildtype polyA,GSM830245,,source name:testis|strain:TL|genotype/variation:Hen1 wildtype|tissue:testis|small rna library prep method:polyA tailing,wildtype polyA,three prime adapter sequences were trimmed and inserts longer than 18 nt were mapped to the zebrafish genome Zv8,testis,,Small RNAs in the size range of 19 31 bases were excised from a denaturing gel. RNA was polyA tailed using polyA polymerase followed by ligation of a RNA adaptor to the five prime phosphate of the small RNAs. First strand cDNA synthesis was performed using an oligodT linker primer and M MLV RNase H reverse transcriptase. post amplification the cDNA was sent for sequencing on an Illumina/Solexa platform.,,strain:TL|genotype/variation:Hen1 wildtype|tissue:testis|small rna library prep method:polyA tailing,GSM830245,GSM830245: wildtype polyA,GSM830245: wildtype polyA,GSM830245: wildtype polyA,1,,GEO Accession:GSM830245,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina Genome Analyzer II,440Application ReadForward1,SRP009275,,read name barcode proc directive:ignore,VASAGFPHEN1plusMALE.fastq,fastq,167344144.0,3803276.0,GSM830245 1,0:44,A:87935982;C:21182538;G:19081938;T:34474815;N:4668871,44,,,,87935982,21182538,19081938,34474815,4668871,SRX105296,SRS270139,SRA047996,GEO,"European Research Institute for the Biology of Ageing, University Medical Center Groningen",1,0.06642,,0.05042,,0.99226,,0.38346,,44,,B,,usable mapping rate,illumina,early_illumina,unknown,poly_a,unknown,bulk,unknown,unknown,,Netherlands,2011-11-09,Undetermined,Undetermined,Gonad,Reproductive System 40576,SRR3228716,SRX1634616,SRS1345843,SRP071818,PRJNA315314,The functions of m6A and Ythdf2 during zebrafish early development,GSE79213,Other,We report the m6A methylation maps of zebrafish embryos during early development and transcriptome wide changes occured in ythdf2 LOF mutant embryos. Our study reveals the m6A dependent RNA decay as a previously unidentified maternal mode mechanism to regulate maternal mRNA clearance during zebrafish   MZT highlighting the critical role of the m6A mRNA methylation in animal development. Overall design: m6A seq of mRNA from zebrafish embryos at 0 2 4 6 8 h.p.f.; mRNA seq of wild type and maternal ythdf2 null mutant embryos at 0 2 4 6 8 h.p.f.; mRNA seq of embryos injected with control or ythdf2 MO at xxx h.p.f.; mRNA seq of wild type and maternal zygotic ythdf2 null mutant embryos at 6 8 12 24 h.p.f; and mRNA seq of wild type and maternal ythdf2 null mutant embryos injected with control or ythdf2 MO at xxx 36 48 h.p.f. Replicate of each seq is also included.,,pubmed:28192787,,m6A CLIP 8,GSM2088181,,tissue:whole zebrafish embryo|genotype:WT|treatment:n1,m6A CLIP 8,Data analysis for each experiment: 1 for m6A seq reads were aligned to the reference genome danRer10 using Tophat v2.0.14 ref with parameter g 1 library type=fr firststrand. RefSeq Gene structure annotations were downloaded from UCSC Table Browser. The longest isoform was used if the gene has multiple isoforms. Aligned reads were extended to 150bp average fragments size and converted from genome based coordinates to isoform based coordinates in order to eliminate the interference from intron in peak calling. The peak calling method was modified from Dan Dominissini nature 2012 work. To call m6A peaks the longest isoform of each human gene was scanned using a 100 bp sliding window with 10 bp step. To reduce bias from potential inaccurate gene structure annotation and the arbitrary usage of the longest isoform windows with reads counts less than 1/20 of the top window in both m6A IP and input sample were excluded. For each gene the reads count in each window was normalized by the median count of all windows of that gene. A fisher exact test was used to identify the differential windows between IP and input samples. The window was called as positive if the fdr < 0.01 and log2Enrichment Score >= 1. Overlapping positive windows were merged. The following four numbers were calculated to obtain the enrichment score of each peak or window: reads count of the IP sample in the current peak/window a median reads count of the IP sample in all 100 bp windows on the current mRNA b reads count of the input sample in the current peak/window c and median reads count of the input sample in all 100 bp windows on the current mRNA d. The enrichment score of each window was calculated as a×d/b×c. 2 for m6A CLIP seq post removing the adapter sequence the reads were mapped to the reference genome danRer10 using bowtie2. Peak calling method was similar to previous study chen kai's Angew 2015. Briefly mutations were considered as signal and all mapped reads were treated as background. A Gaussian Kernel density estimation were used to identify the binding regions. The motif analysis was performed using HOMER homer ref here to search motifs in each set of m6A peaks. The longest isoform of all genes was used as background. 3 for mRNA Seq Reads were mapped with Tophat and Cufflink v2.2.1 was used to calculate the FPKM of each gene to represent their mRNA expression level.,whole zebrafish embryo,,total RNA was extracted using Direct zol Zymo from embryos homogenized in TRIzol. mRNA was further purified using Dynabeads mRNA DIRECT Kit. For IP samples mRNA was sonicated and subjected to IP using m6A antibody Synaptic Systems 202003. Libraries were constructed using TruSeq Stranded mRNA Library Prep Kit Illumina.,embryos were collected and cultured in medium at 28.5 °C and then harvested at each time point into TRIzol.,development time h.p.f.:8|genotype:WT|treatment:n1,GSM2088181,GSM2088181: m6A CLIP 8; Danio rerio; RIP Seq,GSM2088181,,1,total RNA was extracted using Direct zol Zymo from embryos homogenized in TRIzol. mRNA was further purified using Dynabeads mRNA DIRECT Kit. For IP samples mRNA was sonicated and subjected to IP using m6A antibody Synaptic Systems 202003. Libraries were constructed using TruSeq Stranded mRNA Library Prep Kit Illumina.,GEO Accession:GSM2088181,RIP-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP071818,,,CLIP_8h-IP.fastq.gz,fastq,921977050.0,18439541.0,GSM2088181 r1,0:50,A:233396466;C:263744643;G:252737160;T:172064890;N:33891,50,,,,233396466,263744643,252737160,172064890,33891,SRX1634616,SRS1345843,SRA385720,GEO,"Chuan He Lab, Chemistry, University of Chicago",1,0.61408,,0.1783,,0.88032,,0.72361,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,United States,2016-03-14,Undetermined,Embryo,Whole Organism,All anatomical structures 40577,SRR3228715,SRX1634615,SRS1345844,SRP071818,PRJNA315314,The functions of m6A and Ythdf2 during zebrafish early development,GSE79213,Other,We report the m6A methylation maps of zebrafish embryos during early development and transcriptome wide changes occured in ythdf2 LOF mutant embryos. Our study reveals the m6A dependent RNA decay as a previously unidentified maternal mode mechanism to regulate maternal mRNA clearance during zebrafish   MZT highlighting the critical role of the m6A mRNA methylation in animal development. Overall design: m6A seq of mRNA from zebrafish embryos at 0 2 4 6 8 h.p.f.; mRNA seq of wild type and maternal ythdf2 null mutant embryos at 0 2 4 6 8 h.p.f.; mRNA seq of embryos injected with control or ythdf2 MO at xxx h.p.f.; mRNA seq of wild type and maternal zygotic ythdf2 null mutant embryos at 6 8 12 24 h.p.f; and mRNA seq of wild type and maternal ythdf2 null mutant embryos injected with control or ythdf2 MO at xxx 36 48 h.p.f. Replicate of each seq is also included.,,pubmed:28192787,,m6A CLIP 6,GSM2088180,,tissue:whole zebrafish embryo|genotype:WT|treatment:n1,m6A CLIP 6,Data analysis for each experiment: 1 for m6A seq reads were aligned to the reference genome danRer10 using Tophat v2.0.14 ref with parameter g 1 library type=fr firststrand. RefSeq Gene structure annotations were downloaded from UCSC Table Browser. The longest isoform was used if the gene has multiple isoforms. Aligned reads were extended to 150bp average fragments size and converted from genome based coordinates to isoform based coordinates in order to eliminate the interference from intron in peak calling. The peak calling method was modified from Dan Dominissini nature 2012 work. To call m6A peaks the longest isoform of each human gene was scanned using a 100 bp sliding window with 10 bp step. To reduce bias from potential inaccurate gene structure annotation and the arbitrary usage of the longest isoform windows with reads counts less than 1/20 of the top window in both m6A IP and input sample were excluded. For each gene the reads count in each window was normalized by the median count of all windows of that gene. A fisher exact test was used to identify the differential windows between IP and input samples. The window was called as positive if the fdr < 0.01 and log2Enrichment Score >= 1. Overlapping positive windows were merged. The following four numbers were calculated to obtain the enrichment score of each peak or window: reads count of the IP sample in the current peak/window a median reads count of the IP sample in all 100 bp windows on the current mRNA b reads count of the input sample in the current peak/window c and median reads count of the input sample in all 100 bp windows on the current mRNA d. The enrichment score of each window was calculated as a×d/b×c. 2 for m6A CLIP seq post removing the adapter sequence the reads were mapped to the reference genome danRer10 using bowtie2. Peak calling method was similar to previous study chen kai's Angew 2015. Briefly mutations were considered as signal and all mapped reads were treated as background. A Gaussian Kernel density estimation were used to identify the binding regions. The motif analysis was performed using HOMER homer ref here to search motifs in each set of m6A peaks. The longest isoform of all genes was used as background. 3 for mRNA Seq Reads were mapped with Tophat and Cufflink v2.2.1 was used to calculate the FPKM of each gene to represent their mRNA expression level.,whole zebrafish embryo,,total RNA was extracted using Direct zol Zymo from embryos homogenized in TRIzol. mRNA was further purified using Dynabeads mRNA DIRECT Kit. For IP samples mRNA was sonicated and subjected to IP using m6A antibody Synaptic Systems 202003. Libraries were constructed using TruSeq Stranded mRNA Library Prep Kit Illumina.,embryos were collected and cultured in medium at 28.5 °C and then harvested at each time point into TRIzol.,development time h.p.f.:6|genotype:WT|treatment:n1,GSM2088180,GSM2088180: m6A CLIP 6; Danio rerio; RIP Seq,GSM2088180,,1,total RNA was extracted using Direct zol Zymo from embryos homogenized in TRIzol. mRNA was further purified using Dynabeads mRNA DIRECT Kit. For IP samples mRNA was sonicated and subjected to IP using m6A antibody Synaptic Systems 202003. Libraries were constructed using TruSeq Stranded mRNA Library Prep Kit Illumina.,GEO Accession:GSM2088180,RIP-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP071818,,,CLIP_6h-IP.fastq.gz,fastq,811777600.0,16235552.0,GSM2088180 r1,0:50,A:214241727;C:241830821;G:208608337;T:147066789;N:29926,50,,,,214241727,241830821,208608337,147066789,29926,SRX1634615,SRS1345844,SRA385720,GEO,"Chuan He Lab, Chemistry, University of Chicago",1,0.68946,,0.17622,,0.9194,,0.62968,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,United States,2016-03-14,Undetermined,Embryo,Whole Organism,All anatomical structures 40578,SRR3228714,SRX1634614,SRS1345845,SRP071818,PRJNA315314,The functions of m6A and Ythdf2 during zebrafish early development,GSE79213,Other,We report the m6A methylation maps of zebrafish embryos during early development and transcriptome wide changes occured in ythdf2 LOF mutant embryos. Our study reveals the m6A dependent RNA decay as a previously unidentified maternal mode mechanism to regulate maternal mRNA clearance during zebrafish   MZT highlighting the critical role of the m6A mRNA methylation in animal development. Overall design: m6A seq of mRNA from zebrafish embryos at 0 2 4 6 8 h.p.f.; mRNA seq of wild type and maternal ythdf2 null mutant embryos at 0 2 4 6 8 h.p.f.; mRNA seq of embryos injected with control or ythdf2 MO at xxx h.p.f.; mRNA seq of wild type and maternal zygotic ythdf2 null mutant embryos at 6 8 12 24 h.p.f; and mRNA seq of wild type and maternal ythdf2 null mutant embryos injected with control or ythdf2 MO at xxx 36 48 h.p.f. Replicate of each seq is also included.,,pubmed:28192787,,m6A CLIP 4,GSM2088179,,tissue:whole zebrafish embryo|genotype:WT|treatment:n1,m6A CLIP 4,Data analysis for each experiment: 1 for m6A seq reads were aligned to the reference genome danRer10 using Tophat v2.0.14 ref with parameter g 1 library type=fr firststrand. RefSeq Gene structure annotations were downloaded from UCSC Table Browser. The longest isoform was used if the gene has multiple isoforms. Aligned reads were extended to 150bp average fragments size and converted from genome based coordinates to isoform based coordinates in order to eliminate the interference from intron in peak calling. The peak calling method was modified from Dan Dominissini nature 2012 work. To call m6A peaks the longest isoform of each human gene was scanned using a 100 bp sliding window with 10 bp step. To reduce bias from potential inaccurate gene structure annotation and the arbitrary usage of the longest isoform windows with reads counts less than 1/20 of the top window in both m6A IP and input sample were excluded. For each gene the reads count in each window was normalized by the median count of all windows of that gene. A fisher exact test was used to identify the differential windows between IP and input samples. The window was called as positive if the fdr < 0.01 and log2Enrichment Score >= 1. Overlapping positive windows were merged. The following four numbers were calculated to obtain the enrichment score of each peak or window: reads count of the IP sample in the current peak/window a median reads count of the IP sample in all 100 bp windows on the current mRNA b reads count of the input sample in the current peak/window c and median reads count of the input sample in all 100 bp windows on the current mRNA d. The enrichment score of each window was calculated as a×d/b×c. 2 for m6A CLIP seq post removing the adapter sequence the reads were mapped to the reference genome danRer10 using bowtie2. Peak calling method was similar to previous study chen kai's Angew 2015. Briefly mutations were considered as signal and all mapped reads were treated as background. A Gaussian Kernel density estimation were used to identify the binding regions. The motif analysis was performed using HOMER homer ref here to search motifs in each set of m6A peaks. The longest isoform of all genes was used as background. 3 for mRNA Seq Reads were mapped with Tophat and Cufflink v2.2.1 was used to calculate the FPKM of each gene to represent their mRNA expression level.,whole zebrafish embryo,,total RNA was extracted using Direct zol Zymo from embryos homogenized in TRIzol. mRNA was further purified using Dynabeads mRNA DIRECT Kit. For IP samples mRNA was sonicated and subjected to IP using m6A antibody Synaptic Systems 202003. Libraries were constructed using TruSeq Stranded mRNA Library Prep Kit Illumina.,embryos were collected and cultured in medium at 28.5 °C and then harvested at each time point into TRIzol.,development time h.p.f.:4|genotype:WT|treatment:n1,GSM2088179,GSM2088179: m6A CLIP 4; Danio rerio; RIP Seq,GSM2088179,,1,total RNA was extracted using Direct zol Zymo from embryos homogenized in TRIzol. mRNA was further purified using Dynabeads mRNA DIRECT Kit. For IP samples mRNA was sonicated and subjected to IP using m6A antibody Synaptic Systems 202003. Libraries were constructed using TruSeq Stranded mRNA Library Prep Kit Illumina.,GEO Accession:GSM2088179,RIP-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP071818,,,CLIP_4h-IP.fastq.gz,fastq,746223800.0,14924476.0,GSM2088179 r1,0:50,A:185147085;C:236139555;G:187875436;T:137034934;N:26790,50,,,,185147085,236139555,187875436,137034934,26790,SRX1634614,SRS1345845,SRA385720,GEO,"Chuan He Lab, Chemistry, University of Chicago",1,0.80174,,0.17015,,0.86164,,0.77262,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,United States,2016-03-14,Undetermined,Embryo,Whole Organism,All anatomical structures 40579,SRR3228713,SRX1634613,SRS1345846,SRP071818,PRJNA315314,The functions of m6A and Ythdf2 during zebrafish early development,GSE79213,Other,We report the m6A methylation maps of zebrafish embryos during early development and transcriptome wide changes occured in ythdf2 LOF mutant embryos. Our study reveals the m6A dependent RNA decay as a previously unidentified maternal mode mechanism to regulate maternal mRNA clearance during zebrafish   MZT highlighting the critical role of the m6A mRNA methylation in animal development. Overall design: m6A seq of mRNA from zebrafish embryos at 0 2 4 6 8 h.p.f.; mRNA seq of wild type and maternal ythdf2 null mutant embryos at 0 2 4 6 8 h.p.f.; mRNA seq of embryos injected with control or ythdf2 MO at xxx h.p.f.; mRNA seq of wild type and maternal zygotic ythdf2 null mutant embryos at 6 8 12 24 h.p.f; and mRNA seq of wild type and maternal ythdf2 null mutant embryos injected with control or ythdf2 MO at xxx 36 48 h.p.f. Replicate of each seq is also included.,,pubmed:28192787,,m6A CLIP 2,GSM2088178,,tissue:whole zebrafish embryo|genotype:WT|treatment:n1,m6A CLIP 2,Data analysis for each experiment: 1 for m6A seq reads were aligned to the reference genome danRer10 using Tophat v2.0.14 ref with parameter g 1 library type=fr firststrand. RefSeq Gene structure annotations were downloaded from UCSC Table Browser. The longest isoform was used if the gene has multiple isoforms. Aligned reads were extended to 150bp average fragments size and converted from genome based coordinates to isoform based coordinates in order to eliminate the interference from intron in peak calling. The peak calling method was modified from Dan Dominissini nature 2012 work. To call m6A peaks the longest isoform of each human gene was scanned using a 100 bp sliding window with 10 bp step. To reduce bias from potential inaccurate gene structure annotation and the arbitrary usage of the longest isoform windows with reads counts less than 1/20 of the top window in both m6A IP and input sample were excluded. For each gene the reads count in each window was normalized by the median count of all windows of that gene. A fisher exact test was used to identify the differential windows between IP and input samples. The window was called as positive if the fdr < 0.01 and log2Enrichment Score >= 1. Overlapping positive windows were merged. The following four numbers were calculated to obtain the enrichment score of each peak or window: reads count of the IP sample in the current peak/window a median reads count of the IP sample in all 100 bp windows on the current mRNA b reads count of the input sample in the current peak/window c and median reads count of the input sample in all 100 bp windows on the current mRNA d. The enrichment score of each window was calculated as a×d/b×c. 2 for m6A CLIP seq post removing the adapter sequence the reads were mapped to the reference genome danRer10 using bowtie2. Peak calling method was similar to previous study chen kai's Angew 2015. Briefly mutations were considered as signal and all mapped reads were treated as background. A Gaussian Kernel density estimation were used to identify the binding regions. The motif analysis was performed using HOMER homer ref here to search motifs in each set of m6A peaks. The longest isoform of all genes was used as background. 3 for mRNA Seq Reads were mapped with Tophat and Cufflink v2.2.1 was used to calculate the FPKM of each gene to represent their mRNA expression level.,whole zebrafish embryo,,total RNA was extracted using Direct zol Zymo from embryos homogenized in TRIzol. mRNA was further purified using Dynabeads mRNA DIRECT Kit. For IP samples mRNA was sonicated and subjected to IP using m6A antibody Synaptic Systems 202003. Libraries were constructed using TruSeq Stranded mRNA Library Prep Kit Illumina.,embryos were collected and cultured in medium at 28.5 °C and then harvested at each time point into TRIzol.,development time h.p.f.:2|genotype:WT|treatment:n1,GSM2088178,GSM2088178: m6A CLIP 2; Danio rerio; RIP Seq,GSM2088178,,1,total RNA was extracted using Direct zol Zymo from embryos homogenized in TRIzol. mRNA was further purified using Dynabeads mRNA DIRECT Kit. For IP samples mRNA was sonicated and subjected to IP using m6A antibody Synaptic Systems 202003. Libraries were constructed using TruSeq Stranded mRNA Library Prep Kit Illumina.,GEO Accession:GSM2088178,RIP-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP071818,,,CLIP_2h-IP.fastq.gz,fastq,937426800.0,18748536.0,GSM2088178 r1,0:50,A:263526034;C:262864870;G:241415141;T:169586820;N:33935,50,,,,263526034,262864870,241415141,169586820,33935,SRX1634613,SRS1345846,SRA385720,GEO,"Chuan He Lab, Chemistry, University of Chicago",1,0.75612,,0.2242,,0.87823,,0.61308,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,United States,2016-03-14,Undetermined,Embryo,Whole Organism,All anatomical structures 40580,SRR3228712,SRX1634612,SRS1345847,SRP071818,PRJNA315314,The functions of m6A and Ythdf2 during zebrafish early development,GSE79213,Other,We report the m6A methylation maps of zebrafish embryos during early development and transcriptome wide changes occured in ythdf2 LOF mutant embryos. Our study reveals the m6A dependent RNA decay as a previously unidentified maternal mode mechanism to regulate maternal mRNA clearance during zebrafish   MZT highlighting the critical role of the m6A mRNA methylation in animal development. Overall design: m6A seq of mRNA from zebrafish embryos at 0 2 4 6 8 h.p.f.; mRNA seq of wild type and maternal ythdf2 null mutant embryos at 0 2 4 6 8 h.p.f.; mRNA seq of embryos injected with control or ythdf2 MO at xxx h.p.f.; mRNA seq of wild type and maternal zygotic ythdf2 null mutant embryos at 6 8 12 24 h.p.f; and mRNA seq of wild type and maternal ythdf2 null mutant embryos injected with control or ythdf2 MO at xxx 36 48 h.p.f. Replicate of each seq is also included.,,pubmed:28192787,,m6A CLIP 0,GSM2088177,,tissue:whole zebrafish embryo|genotype:WT|treatment:n1,m6A CLIP 0,Data analysis for each experiment: 1 for m6A seq reads were aligned to the reference genome danRer10 using Tophat v2.0.14 ref with parameter g 1 library type=fr firststrand. RefSeq Gene structure annotations were downloaded from UCSC Table Browser. The longest isoform was used if the gene has multiple isoforms. Aligned reads were extended to 150bp average fragments size and converted from genome based coordinates to isoform based coordinates in order to eliminate the interference from intron in peak calling. The peak calling method was modified from Dan Dominissini nature 2012 work. To call m6A peaks the longest isoform of each human gene was scanned using a 100 bp sliding window with 10 bp step. To reduce bias from potential inaccurate gene structure annotation and the arbitrary usage of the longest isoform windows with reads counts less than 1/20 of the top window in both m6A IP and input sample were excluded. For each gene the reads count in each window was normalized by the median count of all windows of that gene. A fisher exact test was used to identify the differential windows between IP and input samples. The window was called as positive if the fdr < 0.01 and log2Enrichment Score >= 1. Overlapping positive windows were merged. The following four numbers were calculated to obtain the enrichment score of each peak or window: reads count of the IP sample in the current peak/window a median reads count of the IP sample in all 100 bp windows on the current mRNA b reads count of the input sample in the current peak/window c and median reads count of the input sample in all 100 bp windows on the current mRNA d. The enrichment score of each window was calculated as a×d/b×c. 2 for m6A CLIP seq post removing the adapter sequence the reads were mapped to the reference genome danRer10 using bowtie2. Peak calling method was similar to previous study chen kai's Angew 2015. Briefly mutations were considered as signal and all mapped reads were treated as background. A Gaussian Kernel density estimation were used to identify the binding regions. The motif analysis was performed using HOMER homer ref here to search motifs in each set of m6A peaks. The longest isoform of all genes was used as background. 3 for mRNA Seq Reads were mapped with Tophat and Cufflink v2.2.1 was used to calculate the FPKM of each gene to represent their mRNA expression level.,whole zebrafish embryo,,total RNA was extracted using Direct zol Zymo from embryos homogenized in TRIzol. mRNA was further purified using Dynabeads mRNA DIRECT Kit. For IP samples mRNA was sonicated and subjected to IP using m6A antibody Synaptic Systems 202003. Libraries were constructed using TruSeq Stranded mRNA Library Prep Kit Illumina.,embryos were collected and cultured in medium at 28.5 °C and then harvested at each time point into TRIzol.,development time h.p.f.:0|genotype:WT|treatment:n1,GSM2088177,GSM2088177: m6A CLIP 0; Danio rerio; RIP Seq,GSM2088177,,1,total RNA was extracted using Direct zol Zymo from embryos homogenized in TRIzol. mRNA was further purified using Dynabeads mRNA DIRECT Kit. For IP samples mRNA was sonicated and subjected to IP using m6A antibody Synaptic Systems 202003. Libraries were constructed using TruSeq Stranded mRNA Library Prep Kit Illumina.,GEO Accession:GSM2088177,RIP-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP071818,,,CLIP_0h-IP.fastq.gz,fastq,1320186200.0,26403724.0,GSM2088177 r1,0:50,A:362282258;C:387362464;G:326692598;T:243799324;N:49556,50,,,,362282258,387362464,326692598,243799324,49556,SRX1634612,SRS1345847,SRA385720,GEO,"Chuan He Lab, Chemistry, University of Chicago",1,0.50689,,0.10395,,0.89755,,0.72663,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,United States,2016-03-14,Undetermined,Embryo,Whole Organism,All anatomical structures 40581,SRR3228711,SRX1634611,SRS1345848,SRP071818,PRJNA315314,The functions of m6A and Ythdf2 during zebrafish early development,GSE79213,Other,We report the m6A methylation maps of zebrafish embryos during early development and transcriptome wide changes occured in ythdf2 LOF mutant embryos. Our study reveals the m6A dependent RNA decay as a previously unidentified maternal mode mechanism to regulate maternal mRNA clearance during zebrafish   MZT highlighting the critical role of the m6A mRNA methylation in animal development. Overall design: m6A seq of mRNA from zebrafish embryos at 0 2 4 6 8 h.p.f.; mRNA seq of wild type and maternal ythdf2 null mutant embryos at 0 2 4 6 8 h.p.f.; mRNA seq of embryos injected with control or ythdf2 MO at xxx h.p.f.; mRNA seq of wild type and maternal zygotic ythdf2 null mutant embryos at 6 8 12 24 h.p.f; and mRNA seq of wild type and maternal ythdf2 null mutant embryos injected with control or ythdf2 MO at xxx 36 48 h.p.f. Replicate of each seq is also included.,,pubmed:28192787,,input CLIP 8,GSM2088176,,tissue:whole zebrafish embryo|genotype:WT|treatment:n1,input CLIP 8,Data analysis for each experiment: 1 for m6A seq reads were aligned to the reference genome danRer10 using Tophat v2.0.14 ref with parameter g 1 library type=fr firststrand. RefSeq Gene structure annotations were downloaded from UCSC Table Browser. The longest isoform was used if the gene has multiple isoforms. Aligned reads were extended to 150bp average fragments size and converted from genome based coordinates to isoform based coordinates in order to eliminate the interference from intron in peak calling. The peak calling method was modified from Dan Dominissini nature 2012 work. To call m6A peaks the longest isoform of each human gene was scanned using a 100 bp sliding window with 10 bp step. To reduce bias from potential inaccurate gene structure annotation and the arbitrary usage of the longest isoform windows with reads counts less than 1/20 of the top window in both m6A IP and input sample were excluded. For each gene the reads count in each window was normalized by the median count of all windows of that gene. A fisher exact test was used to identify the differential windows between IP and input samples. The window was called as positive if the fdr < 0.01 and log2Enrichment Score >= 1. Overlapping positive windows were merged. The following four numbers were calculated to obtain the enrichment score of each peak or window: reads count of the IP sample in the current peak/window a median reads count of the IP sample in all 100 bp windows on the current mRNA b reads count of the input sample in the current peak/window c and median reads count of the input sample in all 100 bp windows on the current mRNA d. The enrichment score of each window was calculated as a×d/b×c. 2 for m6A CLIP seq post removing the adapter sequence the reads were mapped to the reference genome danRer10 using bowtie2. Peak calling method was similar to previous study chen kai's Angew 2015. Briefly mutations were considered as signal and all mapped reads were treated as background. A Gaussian Kernel density estimation were used to identify the binding regions. The motif analysis was performed using HOMER homer ref here to search motifs in each set of m6A peaks. The longest isoform of all genes was used as background. 3 for mRNA Seq Reads were mapped with Tophat and Cufflink v2.2.1 was used to calculate the FPKM of each gene to represent their mRNA expression level.,whole zebrafish embryo,,total RNA was extracted using Direct zol Zymo from embryos homogenized in TRIzol. mRNA was further purified using Dynabeads mRNA DIRECT Kit. For IP samples mRNA was sonicated and subjected to IP using m6A antibody Synaptic Systems 202003. Libraries were constructed using TruSeq Stranded mRNA Library Prep Kit Illumina.,embryos were collected and cultured in medium at 28.5 °C and then harvested at each time point into TRIzol.,development time h.p.f.:8|genotype:WT|treatment:n1,GSM2088176,GSM2088176: input CLIP 8; Danio rerio; RIP Seq,GSM2088176,,1,total RNA was extracted using Direct zol Zymo from embryos homogenized in TRIzol. mRNA was further purified using Dynabeads mRNA DIRECT Kit. For IP samples mRNA was sonicated and subjected to IP using m6A antibody Synaptic Systems 202003. Libraries were constructed using TruSeq Stranded mRNA Library Prep Kit Illumina.,GEO Accession:GSM2088176,RIP-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP071818,,,CLIP_8h-input.fastq.gz,fastq,1971263900.0,39425278.0,GSM2088176 r1,0:50,A:530986171;C:559974651;G:547087685;T:333110850;N:104543,50,,,,530986171,559974651,547087685,333110850,104543,SRX1634611,SRS1345848,SRA385720,GEO,"Chuan He Lab, Chemistry, University of Chicago",1,0.64576,,0.23563,,0.91618,,0.71461,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,United States,2016-03-14,Undetermined,Embryo,Whole Organism,All anatomical structures 40582,SRR3228710,SRX1634610,SRS1345849,SRP071818,PRJNA315314,The functions of m6A and Ythdf2 during zebrafish early development,GSE79213,Other,We report the m6A methylation maps of zebrafish embryos during early development and transcriptome wide changes occured in ythdf2 LOF mutant embryos. Our study reveals the m6A dependent RNA decay as a previously unidentified maternal mode mechanism to regulate maternal mRNA clearance during zebrafish   MZT highlighting the critical role of the m6A mRNA methylation in animal development. Overall design: m6A seq of mRNA from zebrafish embryos at 0 2 4 6 8 h.p.f.; mRNA seq of wild type and maternal ythdf2 null mutant embryos at 0 2 4 6 8 h.p.f.; mRNA seq of embryos injected with control or ythdf2 MO at xxx h.p.f.; mRNA seq of wild type and maternal zygotic ythdf2 null mutant embryos at 6 8 12 24 h.p.f; and mRNA seq of wild type and maternal ythdf2 null mutant embryos injected with control or ythdf2 MO at xxx 36 48 h.p.f. Replicate of each seq is also included.,,pubmed:28192787,,input CLIP 6,GSM2088175,,tissue:whole zebrafish embryo|genotype:WT|treatment:n1,input CLIP 6,Data analysis for each experiment: 1 for m6A seq reads were aligned to the reference genome danRer10 using Tophat v2.0.14 ref with parameter g 1 library type=fr firststrand. RefSeq Gene structure annotations were downloaded from UCSC Table Browser. The longest isoform was used if the gene has multiple isoforms. Aligned reads were extended to 150bp average fragments size and converted from genome based coordinates to isoform based coordinates in order to eliminate the interference from intron in peak calling. The peak calling method was modified from Dan Dominissini nature 2012 work. To call m6A peaks the longest isoform of each human gene was scanned using a 100 bp sliding window with 10 bp step. To reduce bias from potential inaccurate gene structure annotation and the arbitrary usage of the longest isoform windows with reads counts less than 1/20 of the top window in both m6A IP and input sample were excluded. For each gene the reads count in each window was normalized by the median count of all windows of that gene. A fisher exact test was used to identify the differential windows between IP and input samples. The window was called as positive if the fdr < 0.01 and log2Enrichment Score >= 1. Overlapping positive windows were merged. The following four numbers were calculated to obtain the enrichment score of each peak or window: reads count of the IP sample in the current peak/window a median reads count of the IP sample in all 100 bp windows on the current mRNA b reads count of the input sample in the current peak/window c and median reads count of the input sample in all 100 bp windows on the current mRNA d. The enrichment score of each window was calculated as a×d/b×c. 2 for m6A CLIP seq post removing the adapter sequence the reads were mapped to the reference genome danRer10 using bowtie2. Peak calling method was similar to previous study chen kai's Angew 2015. Briefly mutations were considered as signal and all mapped reads were treated as background. A Gaussian Kernel density estimation were used to identify the binding regions. The motif analysis was performed using HOMER homer ref here to search motifs in each set of m6A peaks. The longest isoform of all genes was used as background. 3 for mRNA Seq Reads were mapped with Tophat and Cufflink v2.2.1 was used to calculate the FPKM of each gene to represent their mRNA expression level.,whole zebrafish embryo,,total RNA was extracted using Direct zol Zymo from embryos homogenized in TRIzol. mRNA was further purified using Dynabeads mRNA DIRECT Kit. For IP samples mRNA was sonicated and subjected to IP using m6A antibody Synaptic Systems 202003. Libraries were constructed using TruSeq Stranded mRNA Library Prep Kit Illumina.,embryos were collected and cultured in medium at 28.5 °C and then harvested at each time point into TRIzol.,development time h.p.f.:6|genotype:WT|treatment:n1,GSM2088175,GSM2088175: input CLIP 6; Danio rerio; RIP Seq,GSM2088175,,1,total RNA was extracted using Direct zol Zymo from embryos homogenized in TRIzol. mRNA was further purified using Dynabeads mRNA DIRECT Kit. For IP samples mRNA was sonicated and subjected to IP using m6A antibody Synaptic Systems 202003. Libraries were constructed using TruSeq Stranded mRNA Library Prep Kit Illumina.,GEO Accession:GSM2088175,RIP-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP071818,,,CLIP_6h-input.fastq.gz,fastq,2424925650.0,48498513.0,GSM2088175 r1,0:50,A:622469966;C:699224547;G:701719139;T:401382845;N:129153,50,,,,622469966,699224547,701719139,401382845,129153,SRX1634610,SRS1345849,SRA385720,GEO,"Chuan He Lab, Chemistry, University of Chicago",1,0.68121,,0.23857,,0.93123,,0.73919,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,United States,2016-03-14,Undetermined,Embryo,Whole Organism,All anatomical structures 40583,SRR3228709,SRX1634609,SRS1345850,SRP071818,PRJNA315314,The functions of m6A and Ythdf2 during zebrafish early development,GSE79213,Other,We report the m6A methylation maps of zebrafish embryos during early development and transcriptome wide changes occured in ythdf2 LOF mutant embryos. Our study reveals the m6A dependent RNA decay as a previously unidentified maternal mode mechanism to regulate maternal mRNA clearance during zebrafish   MZT highlighting the critical role of the m6A mRNA methylation in animal development. Overall design: m6A seq of mRNA from zebrafish embryos at 0 2 4 6 8 h.p.f.; mRNA seq of wild type and maternal ythdf2 null mutant embryos at 0 2 4 6 8 h.p.f.; mRNA seq of embryos injected with control or ythdf2 MO at xxx h.p.f.; mRNA seq of wild type and maternal zygotic ythdf2 null mutant embryos at 6 8 12 24 h.p.f; and mRNA seq of wild type and maternal ythdf2 null mutant embryos injected with control or ythdf2 MO at xxx 36 48 h.p.f. Replicate of each seq is also included.,,pubmed:28192787,,input CLIP 4,GSM2088174,,tissue:whole zebrafish embryo|genotype:WT|treatment:n1,input CLIP 4,Data analysis for each experiment: 1 for m6A seq reads were aligned to the reference genome danRer10 using Tophat v2.0.14 ref with parameter g 1 library type=fr firststrand. RefSeq Gene structure annotations were downloaded from UCSC Table Browser. The longest isoform was used if the gene has multiple isoforms. Aligned reads were extended to 150bp average fragments size and converted from genome based coordinates to isoform based coordinates in order to eliminate the interference from intron in peak calling. The peak calling method was modified from Dan Dominissini nature 2012 work. To call m6A peaks the longest isoform of each human gene was scanned using a 100 bp sliding window with 10 bp step. To reduce bias from potential inaccurate gene structure annotation and the arbitrary usage of the longest isoform windows with reads counts less than 1/20 of the top window in both m6A IP and input sample were excluded. For each gene the reads count in each window was normalized by the median count of all windows of that gene. A fisher exact test was used to identify the differential windows between IP and input samples. The window was called as positive if the fdr < 0.01 and log2Enrichment Score >= 1. Overlapping positive windows were merged. The following four numbers were calculated to obtain the enrichment score of each peak or window: reads count of the IP sample in the current peak/window a median reads count of the IP sample in all 100 bp windows on the current mRNA b reads count of the input sample in the current peak/window c and median reads count of the input sample in all 100 bp windows on the current mRNA d. The enrichment score of each window was calculated as a×d/b×c. 2 for m6A CLIP seq post removing the adapter sequence the reads were mapped to the reference genome danRer10 using bowtie2. Peak calling method was similar to previous study chen kai's Angew 2015. Briefly mutations were considered as signal and all mapped reads were treated as background. A Gaussian Kernel density estimation were used to identify the binding regions. The motif analysis was performed using HOMER homer ref here to search motifs in each set of m6A peaks. The longest isoform of all genes was used as background. 3 for mRNA Seq Reads were mapped with Tophat and Cufflink v2.2.1 was used to calculate the FPKM of each gene to represent their mRNA expression level.,whole zebrafish embryo,,total RNA was extracted using Direct zol Zymo from embryos homogenized in TRIzol. mRNA was further purified using Dynabeads mRNA DIRECT Kit. For IP samples mRNA was sonicated and subjected to IP using m6A antibody Synaptic Systems 202003. Libraries were constructed using TruSeq Stranded mRNA Library Prep Kit Illumina.,embryos were collected and cultured in medium at 28.5 °C and then harvested at each time point into TRIzol.,development time h.p.f.:4|genotype:WT|treatment:n1,GSM2088174,GSM2088174: input CLIP 4; Danio rerio; RIP Seq,GSM2088174,,1,total RNA was extracted using Direct zol Zymo from embryos homogenized in TRIzol. mRNA was further purified using Dynabeads mRNA DIRECT Kit. For IP samples mRNA was sonicated and subjected to IP using m6A antibody Synaptic Systems 202003. Libraries were constructed using TruSeq Stranded mRNA Library Prep Kit Illumina.,GEO Accession:GSM2088174,RIP-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP071818,,,CLIP_4h-input.fastq.gz,fastq,1996829250.0,39936585.0,GSM2088174 r1,0:50,A:527211013;C:600800804;G:528828160;T:339883128;N:106145,50,,,,527211013,600800804,528828160,339883128,106145,SRX1634609,SRS1345850,SRA385720,GEO,"Chuan He Lab, Chemistry, University of Chicago",1,0.60745,,0.19305,,0.92537,,0.74508,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,United States,2016-03-14,Undetermined,Embryo,Whole Organism,All anatomical structures 40584,SRR3228708,SRX1634608,SRS1345851,SRP071818,PRJNA315314,The functions of m6A and Ythdf2 during zebrafish early development,GSE79213,Other,We report the m6A methylation maps of zebrafish embryos during early development and transcriptome wide changes occured in ythdf2 LOF mutant embryos. Our study reveals the m6A dependent RNA decay as a previously unidentified maternal mode mechanism to regulate maternal mRNA clearance during zebrafish   MZT highlighting the critical role of the m6A mRNA methylation in animal development. Overall design: m6A seq of mRNA from zebrafish embryos at 0 2 4 6 8 h.p.f.; mRNA seq of wild type and maternal ythdf2 null mutant embryos at 0 2 4 6 8 h.p.f.; mRNA seq of embryos injected with control or ythdf2 MO at xxx h.p.f.; mRNA seq of wild type and maternal zygotic ythdf2 null mutant embryos at 6 8 12 24 h.p.f; and mRNA seq of wild type and maternal ythdf2 null mutant embryos injected with control or ythdf2 MO at xxx 36 48 h.p.f. Replicate of each seq is also included.,,pubmed:28192787,,input CLIP 2,GSM2088173,,tissue:whole zebrafish embryo|genotype:WT|treatment:n1,input CLIP 2,Data analysis for each experiment: 1 for m6A seq reads were aligned to the reference genome danRer10 using Tophat v2.0.14 ref with parameter g 1 library type=fr firststrand. RefSeq Gene structure annotations were downloaded from UCSC Table Browser. The longest isoform was used if the gene has multiple isoforms. Aligned reads were extended to 150bp average fragments size and converted from genome based coordinates to isoform based coordinates in order to eliminate the interference from intron in peak calling. The peak calling method was modified from Dan Dominissini nature 2012 work. To call m6A peaks the longest isoform of each human gene was scanned using a 100 bp sliding window with 10 bp step. To reduce bias from potential inaccurate gene structure annotation and the arbitrary usage of the longest isoform windows with reads counts less than 1/20 of the top window in both m6A IP and input sample were excluded. For each gene the reads count in each window was normalized by the median count of all windows of that gene. A fisher exact test was used to identify the differential windows between IP and input samples. The window was called as positive if the fdr < 0.01 and log2Enrichment Score >= 1. Overlapping positive windows were merged. The following four numbers were calculated to obtain the enrichment score of each peak or window: reads count of the IP sample in the current peak/window a median reads count of the IP sample in all 100 bp windows on the current mRNA b reads count of the input sample in the current peak/window c and median reads count of the input sample in all 100 bp windows on the current mRNA d. The enrichment score of each window was calculated as a×d/b×c. 2 for m6A CLIP seq post removing the adapter sequence the reads were mapped to the reference genome danRer10 using bowtie2. Peak calling method was similar to previous study chen kai's Angew 2015. Briefly mutations were considered as signal and all mapped reads were treated as background. A Gaussian Kernel density estimation were used to identify the binding regions. The motif analysis was performed using HOMER homer ref here to search motifs in each set of m6A peaks. The longest isoform of all genes was used as background. 3 for mRNA Seq Reads were mapped with Tophat and Cufflink v2.2.1 was used to calculate the FPKM of each gene to represent their mRNA expression level.,whole zebrafish embryo,,total RNA was extracted using Direct zol Zymo from embryos homogenized in TRIzol. mRNA was further purified using Dynabeads mRNA DIRECT Kit. For IP samples mRNA was sonicated and subjected to IP using m6A antibody Synaptic Systems 202003. Libraries were constructed using TruSeq Stranded mRNA Library Prep Kit Illumina.,embryos were collected and cultured in medium at 28.5 °C and then harvested at each time point into TRIzol.,development time h.p.f.:2|genotype:WT|treatment:n1,GSM2088173,GSM2088173: input CLIP 2; Danio rerio; RIP Seq,GSM2088173,,1,total RNA was extracted using Direct zol Zymo from embryos homogenized in TRIzol. mRNA was further purified using Dynabeads mRNA DIRECT Kit. For IP samples mRNA was sonicated and subjected to IP using m6A antibody Synaptic Systems 202003. Libraries were constructed using TruSeq Stranded mRNA Library Prep Kit Illumina.,GEO Accession:GSM2088173,RIP-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP071818,,,CLIP_2h-input.fastq.gz,fastq,2119606350.0,42392127.0,GSM2088173 r1,0:50,A:555894042;C:598667411;G:609233481;T:355698501;N:112915,50,,,,555894042,598667411,609233481,355698501,112915,SRX1634608,SRS1345851,SRA385720,GEO,"Chuan He Lab, Chemistry, University of Chicago",1,0.65392,,0.2263,,0.9049,,0.72736,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,United States,2016-03-14,Undetermined,Embryo,Whole Organism,All anatomical structures 40585,SRR3228707,SRX1634607,SRS1345852,SRP071818,PRJNA315314,The functions of m6A and Ythdf2 during zebrafish early development,GSE79213,Other,We report the m6A methylation maps of zebrafish embryos during early development and transcriptome wide changes occured in ythdf2 LOF mutant embryos. Our study reveals the m6A dependent RNA decay as a previously unidentified maternal mode mechanism to regulate maternal mRNA clearance during zebrafish   MZT highlighting the critical role of the m6A mRNA methylation in animal development. Overall design: m6A seq of mRNA from zebrafish embryos at 0 2 4 6 8 h.p.f.; mRNA seq of wild type and maternal ythdf2 null mutant embryos at 0 2 4 6 8 h.p.f.; mRNA seq of embryos injected with control or ythdf2 MO at xxx h.p.f.; mRNA seq of wild type and maternal zygotic ythdf2 null mutant embryos at 6 8 12 24 h.p.f; and mRNA seq of wild type and maternal ythdf2 null mutant embryos injected with control or ythdf2 MO at xxx 36 48 h.p.f. Replicate of each seq is also included.,,pubmed:28192787,,input CLIP 0,GSM2088172,,tissue:whole zebrafish embryo|genotype:WT|treatment:n1,input CLIP 0,Data analysis for each experiment: 1 for m6A seq reads were aligned to the reference genome danRer10 using Tophat v2.0.14 ref with parameter g 1 library type=fr firststrand. RefSeq Gene structure annotations were downloaded from UCSC Table Browser. The longest isoform was used if the gene has multiple isoforms. Aligned reads were extended to 150bp average fragments size and converted from genome based coordinates to isoform based coordinates in order to eliminate the interference from intron in peak calling. The peak calling method was modified from Dan Dominissini nature 2012 work. To call m6A peaks the longest isoform of each human gene was scanned using a 100 bp sliding window with 10 bp step. To reduce bias from potential inaccurate gene structure annotation and the arbitrary usage of the longest isoform windows with reads counts less than 1/20 of the top window in both m6A IP and input sample were excluded. For each gene the reads count in each window was normalized by the median count of all windows of that gene. A fisher exact test was used to identify the differential windows between IP and input samples. The window was called as positive if the fdr < 0.01 and log2Enrichment Score >= 1. Overlapping positive windows were merged. The following four numbers were calculated to obtain the enrichment score of each peak or window: reads count of the IP sample in the current peak/window a median reads count of the IP sample in all 100 bp windows on the current mRNA b reads count of the input sample in the current peak/window c and median reads count of the input sample in all 100 bp windows on the current mRNA d. The enrichment score of each window was calculated as a×d/b×c. 2 for m6A CLIP seq post removing the adapter sequence the reads were mapped to the reference genome danRer10 using bowtie2. Peak calling method was similar to previous study chen kai's Angew 2015. Briefly mutations were considered as signal and all mapped reads were treated as background. A Gaussian Kernel density estimation were used to identify the binding regions. The motif analysis was performed using HOMER homer ref here to search motifs in each set of m6A peaks. The longest isoform of all genes was used as background. 3 for mRNA Seq Reads were mapped with Tophat and Cufflink v2.2.1 was used to calculate the FPKM of each gene to represent their mRNA expression level.,whole zebrafish embryo,,total RNA was extracted using Direct zol Zymo from embryos homogenized in TRIzol. mRNA was further purified using Dynabeads mRNA DIRECT Kit. For IP samples mRNA was sonicated and subjected to IP using m6A antibody Synaptic Systems 202003. Libraries were constructed using TruSeq Stranded mRNA Library Prep Kit Illumina.,embryos were collected and cultured in medium at 28.5 °C and then harvested at each time point into TRIzol.,development time h.p.f.:0|genotype:WT|treatment:n1,GSM2088172,GSM2088172: input CLIP 0; Danio rerio; RIP Seq,GSM2088172,,1,total RNA was extracted using Direct zol Zymo from embryos homogenized in TRIzol. mRNA was further purified using Dynabeads mRNA DIRECT Kit. For IP samples mRNA was sonicated and subjected to IP using m6A antibody Synaptic Systems 202003. Libraries were constructed using TruSeq Stranded mRNA Library Prep Kit Illumina.,GEO Accession:GSM2088172,RIP-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP071818,,,CLIP_0h-input.fastq.gz,fastq,2150269400.0,43005388.0,GSM2088172 r1,,,,,,,,,,,,SRX1634607,SRS1345852,SRA385720,GEO,"Chuan He Lab, Chemistry, University of Chicago",1,0.57233,,0.18947,,0.91323,,0.75741,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,United States,2016-03-14,Undetermined,Embryo,Whole Organism,All anatomical structures 40586,SRR3228706,SRX1634606,SRS1345853,SRP071818,PRJNA315314,The functions of m6A and Ythdf2 during zebrafish early development,GSE79213,Other,We report the m6A methylation maps of zebrafish embryos during early development and transcriptome wide changes occured in ythdf2 LOF mutant embryos. Our study reveals the m6A dependent RNA decay as a previously unidentified maternal mode mechanism to regulate maternal mRNA clearance during zebrafish   MZT highlighting the critical role of the m6A mRNA methylation in animal development. Overall design: m6A seq of mRNA from zebrafish embryos at 0 2 4 6 8 h.p.f.; mRNA seq of wild type and maternal ythdf2 null mutant embryos at 0 2 4 6 8 h.p.f.; mRNA seq of embryos injected with control or ythdf2 MO at xxx h.p.f.; mRNA seq of wild type and maternal zygotic ythdf2 null mutant embryos at 6 8 12 24 h.p.f; and mRNA seq of wild type and maternal ythdf2 null mutant embryos injected with control or ythdf2 MO at xxx 36 48 h.p.f. Replicate of each seq is also included.,,pubmed:28192787,,m6A IP 8,GSM2088171,,tissue:whole zebrafish embryo|genotype:WT|treatment:n1,m6A IP 8,Data analysis for each experiment: 1 for m6A seq reads were aligned to the reference genome danRer10 using Tophat v2.0.14 ref with parameter g 1 library type=fr firststrand. RefSeq Gene structure annotations were downloaded from UCSC Table Browser. The longest isoform was used if the gene has multiple isoforms. Aligned reads were extended to 150bp average fragments size and converted from genome based coordinates to isoform based coordinates in order to eliminate the interference from intron in peak calling. The peak calling method was modified from Dan Dominissini nature 2012 work. To call m6A peaks the longest isoform of each human gene was scanned using a 100 bp sliding window with 10 bp step. To reduce bias from potential inaccurate gene structure annotation and the arbitrary usage of the longest isoform windows with reads counts less than 1/20 of the top window in both m6A IP and input sample were excluded. For each gene the reads count in each window was normalized by the median count of all windows of that gene. A fisher exact test was used to identify the differential windows between IP and input samples. The window was called as positive if the fdr < 0.01 and log2Enrichment Score >= 1. Overlapping positive windows were merged. The following four numbers were calculated to obtain the enrichment score of each peak or window: reads count of the IP sample in the current peak/window a median reads count of the IP sample in all 100 bp windows on the current mRNA b reads count of the input sample in the current peak/window c and median reads count of the input sample in all 100 bp windows on the current mRNA d. The enrichment score of each window was calculated as a×d/b×c. 2 for m6A CLIP seq post removing the adapter sequence the reads were mapped to the reference genome danRer10 using bowtie2. Peak calling method was similar to previous study chen kai's Angew 2015. Briefly mutations were considered as signal and all mapped reads were treated as background. A Gaussian Kernel density estimation were used to identify the binding regions. The motif analysis was performed using HOMER homer ref here to search motifs in each set of m6A peaks. The longest isoform of all genes was used as background. 3 for mRNA Seq Reads were mapped with Tophat and Cufflink v2.2.1 was used to calculate the FPKM of each gene to represent their mRNA expression level.,whole zebrafish embryo,,total RNA was extracted using Direct zol Zymo from embryos homogenized in TRIzol. mRNA was further purified using Dynabeads mRNA DIRECT Kit. For IP samples mRNA was sonicated and subjected to IP using m6A antibody Synaptic Systems 202003. Libraries were constructed using TruSeq Stranded mRNA Library Prep Kit Illumina.,embryos were collected and cultured in medium at 28.5 °C and then harvested at each time point into TRIzol.,development time h.p.f.:8|genotype:WT|treatment:n1,GSM2088171,GSM2088171: m6A IP 8; Danio rerio; RIP Seq,GSM2088171,,1,total RNA was extracted using Direct zol Zymo from embryos homogenized in TRIzol. mRNA was further purified using Dynabeads mRNA DIRECT Kit. For IP samples mRNA was sonicated and subjected to IP using m6A antibody Synaptic Systems 202003. Libraries were constructed using TruSeq Stranded mRNA Library Prep Kit Illumina.,GEO Accession:GSM2088171,RIP-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP071818,,,m6A_8h.IP.fastq.gz,fastq,527347000.0,10546940.0,GSM2088171 r1,0:50,A:90387238;C:157767772;G:129133581;T:150048442;N:9967,50,,,,90387238,157767772,129133581,150048442,9967,SRX1634606,SRS1345853,SRA385720,GEO,"Chuan He Lab, Chemistry, University of Chicago",1,0.90207,,0.11796,,0.80208,,0.51587,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,United States,2016-03-14,Undetermined,Embryo,Whole Organism,All anatomical structures 40587,SRR3228705,SRX1634605,SRS1345854,SRP071818,PRJNA315314,The functions of m6A and Ythdf2 during zebrafish early development,GSE79213,Other,We report the m6A methylation maps of zebrafish embryos during early development and transcriptome wide changes occured in ythdf2 LOF mutant embryos. Our study reveals the m6A dependent RNA decay as a previously unidentified maternal mode mechanism to regulate maternal mRNA clearance during zebrafish   MZT highlighting the critical role of the m6A mRNA methylation in animal development. Overall design: m6A seq of mRNA from zebrafish embryos at 0 2 4 6 8 h.p.f.; mRNA seq of wild type and maternal ythdf2 null mutant embryos at 0 2 4 6 8 h.p.f.; mRNA seq of embryos injected with control or ythdf2 MO at xxx h.p.f.; mRNA seq of wild type and maternal zygotic ythdf2 null mutant embryos at 6 8 12 24 h.p.f; and mRNA seq of wild type and maternal ythdf2 null mutant embryos injected with control or ythdf2 MO at xxx 36 48 h.p.f. Replicate of each seq is also included.,,pubmed:28192787,,m6A IP 6,GSM2088170,,tissue:whole zebrafish embryo|genotype:WT|treatment:n1,m6A IP 6,Data analysis for each experiment: 1 for m6A seq reads were aligned to the reference genome danRer10 using Tophat v2.0.14 ref with parameter g 1 library type=fr firststrand. RefSeq Gene structure annotations were downloaded from UCSC Table Browser. The longest isoform was used if the gene has multiple isoforms. Aligned reads were extended to 150bp average fragments size and converted from genome based coordinates to isoform based coordinates in order to eliminate the interference from intron in peak calling. The peak calling method was modified from Dan Dominissini nature 2012 work. To call m6A peaks the longest isoform of each human gene was scanned using a 100 bp sliding window with 10 bp step. To reduce bias from potential inaccurate gene structure annotation and the arbitrary usage of the longest isoform windows with reads counts less than 1/20 of the top window in both m6A IP and input sample were excluded. For each gene the reads count in each window was normalized by the median count of all windows of that gene. A fisher exact test was used to identify the differential windows between IP and input samples. The window was called as positive if the fdr < 0.01 and log2Enrichment Score >= 1. Overlapping positive windows were merged. The following four numbers were calculated to obtain the enrichment score of each peak or window: reads count of the IP sample in the current peak/window a median reads count of the IP sample in all 100 bp windows on the current mRNA b reads count of the input sample in the current peak/window c and median reads count of the input sample in all 100 bp windows on the current mRNA d. The enrichment score of each window was calculated as a×d/b×c. 2 for m6A CLIP seq post removing the adapter sequence the reads were mapped to the reference genome danRer10 using bowtie2. Peak calling method was similar to previous study chen kai's Angew 2015. Briefly mutations were considered as signal and all mapped reads were treated as background. A Gaussian Kernel density estimation were used to identify the binding regions. The motif analysis was performed using HOMER homer ref here to search motifs in each set of m6A peaks. The longest isoform of all genes was used as background. 3 for mRNA Seq Reads were mapped with Tophat and Cufflink v2.2.1 was used to calculate the FPKM of each gene to represent their mRNA expression level.,whole zebrafish embryo,,total RNA was extracted using Direct zol Zymo from embryos homogenized in TRIzol. mRNA was further purified using Dynabeads mRNA DIRECT Kit. For IP samples mRNA was sonicated and subjected to IP using m6A antibody Synaptic Systems 202003. Libraries were constructed using TruSeq Stranded mRNA Library Prep Kit Illumina.,embryos were collected and cultured in medium at 28.5 °C and then harvested at each time point into TRIzol.,development time h.p.f.:6|genotype:WT|treatment:n1,GSM2088170,GSM2088170: m6A IP 6; Danio rerio; RIP Seq,GSM2088170,,1,total RNA was extracted using Direct zol Zymo from embryos homogenized in TRIzol. mRNA was further purified using Dynabeads mRNA DIRECT Kit. For IP samples mRNA was sonicated and subjected to IP using m6A antibody Synaptic Systems 202003. Libraries were constructed using TruSeq Stranded mRNA Library Prep Kit Illumina.,GEO Accession:GSM2088170,RIP-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP071818,,,m6A_6h.IP.fastq.gz,fastq,606551300.0,12131026.0,GSM2088170 r1,0:50,A:100429722;C:200919401;G:156361859;T:148828837;N:11481,50,,,,100429722,200919401,156361859,148828837,11481,SRX1634605,SRS1345854,SRA385720,GEO,"Chuan He Lab, Chemistry, University of Chicago",1,0.94517,,0.23269,,0.84571,,0.73203,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,United States,2016-03-14,Undetermined,Embryo,Whole Organism,All anatomical structures 40588,SRR3228704,SRX1634604,SRS1345855,SRP071818,PRJNA315314,The functions of m6A and Ythdf2 during zebrafish early development,GSE79213,Other,We report the m6A methylation maps of zebrafish embryos during early development and transcriptome wide changes occured in ythdf2 LOF mutant embryos. Our study reveals the m6A dependent RNA decay as a previously unidentified maternal mode mechanism to regulate maternal mRNA clearance during zebrafish   MZT highlighting the critical role of the m6A mRNA methylation in animal development. Overall design: m6A seq of mRNA from zebrafish embryos at 0 2 4 6 8 h.p.f.; mRNA seq of wild type and maternal ythdf2 null mutant embryos at 0 2 4 6 8 h.p.f.; mRNA seq of embryos injected with control or ythdf2 MO at xxx h.p.f.; mRNA seq of wild type and maternal zygotic ythdf2 null mutant embryos at 6 8 12 24 h.p.f; and mRNA seq of wild type and maternal ythdf2 null mutant embryos injected with control or ythdf2 MO at xxx 36 48 h.p.f. Replicate of each seq is also included.,,pubmed:28192787,,m6A IP 4,GSM2088169,,tissue:whole zebrafish embryo|genotype:WT|treatment:n1,m6A IP 4,Data analysis for each experiment: 1 for m6A seq reads were aligned to the reference genome danRer10 using Tophat v2.0.14 ref with parameter g 1 library type=fr firststrand. RefSeq Gene structure annotations were downloaded from UCSC Table Browser. The longest isoform was used if the gene has multiple isoforms. Aligned reads were extended to 150bp average fragments size and converted from genome based coordinates to isoform based coordinates in order to eliminate the interference from intron in peak calling. The peak calling method was modified from Dan Dominissini nature 2012 work. To call m6A peaks the longest isoform of each human gene was scanned using a 100 bp sliding window with 10 bp step. To reduce bias from potential inaccurate gene structure annotation and the arbitrary usage of the longest isoform windows with reads counts less than 1/20 of the top window in both m6A IP and input sample were excluded. For each gene the reads count in each window was normalized by the median count of all windows of that gene. A fisher exact test was used to identify the differential windows between IP and input samples. The window was called as positive if the fdr < 0.01 and log2Enrichment Score >= 1. Overlapping positive windows were merged. The following four numbers were calculated to obtain the enrichment score of each peak or window: reads count of the IP sample in the current peak/window a median reads count of the IP sample in all 100 bp windows on the current mRNA b reads count of the input sample in the current peak/window c and median reads count of the input sample in all 100 bp windows on the current mRNA d. The enrichment score of each window was calculated as a×d/b×c. 2 for m6A CLIP seq post removing the adapter sequence the reads were mapped to the reference genome danRer10 using bowtie2. Peak calling method was similar to previous study chen kai's Angew 2015. Briefly mutations were considered as signal and all mapped reads were treated as background. A Gaussian Kernel density estimation were used to identify the binding regions. The motif analysis was performed using HOMER homer ref here to search motifs in each set of m6A peaks. The longest isoform of all genes was used as background. 3 for mRNA Seq Reads were mapped with Tophat and Cufflink v2.2.1 was used to calculate the FPKM of each gene to represent their mRNA expression level.,whole zebrafish embryo,,total RNA was extracted using Direct zol Zymo from embryos homogenized in TRIzol. mRNA was further purified using Dynabeads mRNA DIRECT Kit. For IP samples mRNA was sonicated and subjected to IP using m6A antibody Synaptic Systems 202003. Libraries were constructed using TruSeq Stranded mRNA Library Prep Kit Illumina.,embryos were collected and cultured in medium at 28.5 °C and then harvested at each time point into TRIzol.,development time h.p.f.:4|genotype:WT|treatment:n1,GSM2088169,GSM2088169: m6A IP 4; Danio rerio; RIP Seq,GSM2088169,,1,total RNA was extracted using Direct zol Zymo from embryos homogenized in TRIzol. mRNA was further purified using Dynabeads mRNA DIRECT Kit. For IP samples mRNA was sonicated and subjected to IP using m6A antibody Synaptic Systems 202003. Libraries were constructed using TruSeq Stranded mRNA Library Prep Kit Illumina.,GEO Accession:GSM2088169,RIP-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP071818,,,m6A_4h.IP.fastq.gz,fastq,616373350.0,12327467.0,GSM2088169 r1,0:50,A:103511937;C:199101152;G:159952372;T:153796186;N:11703,50,,,,103511937,199101152,159952372,153796186,11703,SRX1634604,SRS1345855,SRA385720,GEO,"Chuan He Lab, Chemistry, University of Chicago",1,0.9484,,0.20806,,0.81349,,0.68893,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,United States,2016-03-14,Undetermined,Embryo,Whole Organism,All anatomical structures 40589,SRR3228703,SRX1634603,SRS1345856,SRP071818,PRJNA315314,The functions of m6A and Ythdf2 during zebrafish early development,GSE79213,Other,We report the m6A methylation maps of zebrafish embryos during early development and transcriptome wide changes occured in ythdf2 LOF mutant embryos. Our study reveals the m6A dependent RNA decay as a previously unidentified maternal mode mechanism to regulate maternal mRNA clearance during zebrafish   MZT highlighting the critical role of the m6A mRNA methylation in animal development. Overall design: m6A seq of mRNA from zebrafish embryos at 0 2 4 6 8 h.p.f.; mRNA seq of wild type and maternal ythdf2 null mutant embryos at 0 2 4 6 8 h.p.f.; mRNA seq of embryos injected with control or ythdf2 MO at xxx h.p.f.; mRNA seq of wild type and maternal zygotic ythdf2 null mutant embryos at 6 8 12 24 h.p.f; and mRNA seq of wild type and maternal ythdf2 null mutant embryos injected with control or ythdf2 MO at xxx 36 48 h.p.f. Replicate of each seq is also included.,,pubmed:28192787,,m6A IP 2,GSM2088168,,tissue:whole zebrafish embryo|genotype:WT|treatment:n1,m6A IP 2,Data analysis for each experiment: 1 for m6A seq reads were aligned to the reference genome danRer10 using Tophat v2.0.14 ref with parameter g 1 library type=fr firststrand. RefSeq Gene structure annotations were downloaded from UCSC Table Browser. The longest isoform was used if the gene has multiple isoforms. Aligned reads were extended to 150bp average fragments size and converted from genome based coordinates to isoform based coordinates in order to eliminate the interference from intron in peak calling. The peak calling method was modified from Dan Dominissini nature 2012 work. To call m6A peaks the longest isoform of each human gene was scanned using a 100 bp sliding window with 10 bp step. To reduce bias from potential inaccurate gene structure annotation and the arbitrary usage of the longest isoform windows with reads counts less than 1/20 of the top window in both m6A IP and input sample were excluded. For each gene the reads count in each window was normalized by the median count of all windows of that gene. A fisher exact test was used to identify the differential windows between IP and input samples. The window was called as positive if the fdr < 0.01 and log2Enrichment Score >= 1. Overlapping positive windows were merged. The following four numbers were calculated to obtain the enrichment score of each peak or window: reads count of the IP sample in the current peak/window a median reads count of the IP sample in all 100 bp windows on the current mRNA b reads count of the input sample in the current peak/window c and median reads count of the input sample in all 100 bp windows on the current mRNA d. The enrichment score of each window was calculated as a×d/b×c. 2 for m6A CLIP seq post removing the adapter sequence the reads were mapped to the reference genome danRer10 using bowtie2. Peak calling method was similar to previous study chen kai's Angew 2015. Briefly mutations were considered as signal and all mapped reads were treated as background. A Gaussian Kernel density estimation were used to identify the binding regions. The motif analysis was performed using HOMER homer ref here to search motifs in each set of m6A peaks. The longest isoform of all genes was used as background. 3 for mRNA Seq Reads were mapped with Tophat and Cufflink v2.2.1 was used to calculate the FPKM of each gene to represent their mRNA expression level.,whole zebrafish embryo,,total RNA was extracted using Direct zol Zymo from embryos homogenized in TRIzol. mRNA was further purified using Dynabeads mRNA DIRECT Kit. For IP samples mRNA was sonicated and subjected to IP using m6A antibody Synaptic Systems 202003. Libraries were constructed using TruSeq Stranded mRNA Library Prep Kit Illumina.,embryos were collected and cultured in medium at 28.5 °C and then harvested at each time point into TRIzol.,development time h.p.f.:2|genotype:WT|treatment:n1,GSM2088168,GSM2088168: m6A IP 2; Danio rerio; RIP Seq,GSM2088168,,1,total RNA was extracted using Direct zol Zymo from embryos homogenized in TRIzol. mRNA was further purified using Dynabeads mRNA DIRECT Kit. For IP samples mRNA was sonicated and subjected to IP using m6A antibody Synaptic Systems 202003. Libraries were constructed using TruSeq Stranded mRNA Library Prep Kit Illumina.,GEO Accession:GSM2088168,RIP-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP071818,,,m6A_2h.IP.fastq.gz,fastq,560037350.0,11200747.0,GSM2088168 r1,0:50,A:90079119;C:192220024;G:154098019;T:123629702;N:10486,50,,,,90079119,192220024,154098019,123629702,10486,SRX1634603,SRS1345856,SRA385720,GEO,"Chuan He Lab, Chemistry, University of Chicago",1,0.95056,,0.25053,,0.87322,,0.82008,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,United States,2016-03-14,Undetermined,Embryo,Whole Organism,All anatomical structures 40590,SRR3228702,SRX1634602,SRS1345857,SRP071818,PRJNA315314,The functions of m6A and Ythdf2 during zebrafish early development,GSE79213,Other,We report the m6A methylation maps of zebrafish embryos during early development and transcriptome wide changes occured in ythdf2 LOF mutant embryos. Our study reveals the m6A dependent RNA decay as a previously unidentified maternal mode mechanism to regulate maternal mRNA clearance during zebrafish   MZT highlighting the critical role of the m6A mRNA methylation in animal development. Overall design: m6A seq of mRNA from zebrafish embryos at 0 2 4 6 8 h.p.f.; mRNA seq of wild type and maternal ythdf2 null mutant embryos at 0 2 4 6 8 h.p.f.; mRNA seq of embryos injected with control or ythdf2 MO at xxx h.p.f.; mRNA seq of wild type and maternal zygotic ythdf2 null mutant embryos at 6 8 12 24 h.p.f; and mRNA seq of wild type and maternal ythdf2 null mutant embryos injected with control or ythdf2 MO at xxx 36 48 h.p.f. Replicate of each seq is also included.,,pubmed:28192787,,m6A IP 0,GSM2088167,,tissue:whole zebrafish embryo|genotype:WT|treatment:n1,m6A IP 0,Data analysis for each experiment: 1 for m6A seq reads were aligned to the reference genome danRer10 using Tophat v2.0.14 ref with parameter g 1 library type=fr firststrand. RefSeq Gene structure annotations were downloaded from UCSC Table Browser. The longest isoform was used if the gene has multiple isoforms. Aligned reads were extended to 150bp average fragments size and converted from genome based coordinates to isoform based coordinates in order to eliminate the interference from intron in peak calling. The peak calling method was modified from Dan Dominissini nature 2012 work. To call m6A peaks the longest isoform of each human gene was scanned using a 100 bp sliding window with 10 bp step. To reduce bias from potential inaccurate gene structure annotation and the arbitrary usage of the longest isoform windows with reads counts less than 1/20 of the top window in both m6A IP and input sample were excluded. For each gene the reads count in each window was normalized by the median count of all windows of that gene. A fisher exact test was used to identify the differential windows between IP and input samples. The window was called as positive if the fdr < 0.01 and log2Enrichment Score >= 1. Overlapping positive windows were merged. The following four numbers were calculated to obtain the enrichment score of each peak or window: reads count of the IP sample in the current peak/window a median reads count of the IP sample in all 100 bp windows on the current mRNA b reads count of the input sample in the current peak/window c and median reads count of the input sample in all 100 bp windows on the current mRNA d. The enrichment score of each window was calculated as a×d/b×c. 2 for m6A CLIP seq post removing the adapter sequence the reads were mapped to the reference genome danRer10 using bowtie2. Peak calling method was similar to previous study chen kai's Angew 2015. Briefly mutations were considered as signal and all mapped reads were treated as background. A Gaussian Kernel density estimation were used to identify the binding regions. The motif analysis was performed using HOMER homer ref here to search motifs in each set of m6A peaks. The longest isoform of all genes was used as background. 3 for mRNA Seq Reads were mapped with Tophat and Cufflink v2.2.1 was used to calculate the FPKM of each gene to represent their mRNA expression level.,whole zebrafish embryo,,total RNA was extracted using Direct zol Zymo from embryos homogenized in TRIzol. mRNA was further purified using Dynabeads mRNA DIRECT Kit. For IP samples mRNA was sonicated and subjected to IP using m6A antibody Synaptic Systems 202003. Libraries were constructed using TruSeq Stranded mRNA Library Prep Kit Illumina.,embryos were collected and cultured in medium at 28.5 °C and then harvested at each time point into TRIzol.,development time h.p.f.:0|genotype:WT|treatment:n1,GSM2088167,GSM2088167: m6A IP 0; Danio rerio; RIP Seq,GSM2088167,,1,total RNA was extracted using Direct zol Zymo from embryos homogenized in TRIzol. mRNA was further purified using Dynabeads mRNA DIRECT Kit. For IP samples mRNA was sonicated and subjected to IP using m6A antibody Synaptic Systems 202003. Libraries were constructed using TruSeq Stranded mRNA Library Prep Kit Illumina.,GEO Accession:GSM2088167,RIP-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP071818,,,m6A_0h.IP.fastq.gz,fastq,458827450.0,9176549.0,GSM2088167 r1,0:50,A:74889651;C:150121353;G:121032505;T:112775237;N:8704,50,,,,74889651,150121353,121032505,112775237,8704,SRX1634602,SRS1345857,SRA385720,GEO,"Chuan He Lab, Chemistry, University of Chicago",1,0.96567,,0.22221,,0.84471,,0.70341,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,United States,2016-03-14,Undetermined,Embryo,Whole Organism,All anatomical structures 40591,SRR3228701,SRX1634601,SRS1345858,SRP071818,PRJNA315314,The functions of m6A and Ythdf2 during zebrafish early development,GSE79213,Other,We report the m6A methylation maps of zebrafish embryos during early development and transcriptome wide changes occured in ythdf2 LOF mutant embryos. Our study reveals the m6A dependent RNA decay as a previously unidentified maternal mode mechanism to regulate maternal mRNA clearance during zebrafish   MZT highlighting the critical role of the m6A mRNA methylation in animal development. Overall design: m6A seq of mRNA from zebrafish embryos at 0 2 4 6 8 h.p.f.; mRNA seq of wild type and maternal ythdf2 null mutant embryos at 0 2 4 6 8 h.p.f.; mRNA seq of embryos injected with control or ythdf2 MO at xxx h.p.f.; mRNA seq of wild type and maternal zygotic ythdf2 null mutant embryos at 6 8 12 24 h.p.f; and mRNA seq of wild type and maternal ythdf2 null mutant embryos injected with control or ythdf2 MO at xxx 36 48 h.p.f. Replicate of each seq is also included.,,pubmed:28192787,,input 8,GSM2088166,,tissue:whole zebrafish embryo|genotype:WT|treatment:n1,input 8,Data analysis for each experiment: 1 for m6A seq reads were aligned to the reference genome danRer10 using Tophat v2.0.14 ref with parameter g 1 library type=fr firststrand. RefSeq Gene structure annotations were downloaded from UCSC Table Browser. The longest isoform was used if the gene has multiple isoforms. Aligned reads were extended to 150bp average fragments size and converted from genome based coordinates to isoform based coordinates in order to eliminate the interference from intron in peak calling. The peak calling method was modified from Dan Dominissini nature 2012 work. To call m6A peaks the longest isoform of each human gene was scanned using a 100 bp sliding window with 10 bp step. To reduce bias from potential inaccurate gene structure annotation and the arbitrary usage of the longest isoform windows with reads counts less than 1/20 of the top window in both m6A IP and input sample were excluded. For each gene the reads count in each window was normalized by the median count of all windows of that gene. A fisher exact test was used to identify the differential windows between IP and input samples. The window was called as positive if the fdr < 0.01 and log2Enrichment Score >= 1. Overlapping positive windows were merged. The following four numbers were calculated to obtain the enrichment score of each peak or window: reads count of the IP sample in the current peak/window a median reads count of the IP sample in all 100 bp windows on the current mRNA b reads count of the input sample in the current peak/window c and median reads count of the input sample in all 100 bp windows on the current mRNA d. The enrichment score of each window was calculated as a×d/b×c. 2 for m6A CLIP seq post removing the adapter sequence the reads were mapped to the reference genome danRer10 using bowtie2. Peak calling method was similar to previous study chen kai's Angew 2015. Briefly mutations were considered as signal and all mapped reads were treated as background. A Gaussian Kernel density estimation were used to identify the binding regions. The motif analysis was performed using HOMER homer ref here to search motifs in each set of m6A peaks. The longest isoform of all genes was used as background. 3 for mRNA Seq Reads were mapped with Tophat and Cufflink v2.2.1 was used to calculate the FPKM of each gene to represent their mRNA expression level.,whole zebrafish embryo,,total RNA was extracted using Direct zol Zymo from embryos homogenized in TRIzol. mRNA was further purified using Dynabeads mRNA DIRECT Kit. For IP samples mRNA was sonicated and subjected to IP using m6A antibody Synaptic Systems 202003. Libraries were constructed using TruSeq Stranded mRNA Library Prep Kit Illumina.,embryos were collected and cultured in medium at 28.5 °C and then harvested at each time point into TRIzol.,development time h.p.f.:8|genotype:WT|treatment:n1,GSM2088166,GSM2088166: input 8; Danio rerio; RIP Seq,GSM2088166,,1,total RNA was extracted using Direct zol Zymo from embryos homogenized in TRIzol. mRNA was further purified using Dynabeads mRNA DIRECT Kit. For IP samples mRNA was sonicated and subjected to IP using m6A antibody Synaptic Systems 202003. Libraries were constructed using TruSeq Stranded mRNA Library Prep Kit Illumina.,GEO Accession:GSM2088166,RIP-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP071818,,,m6A_8h.input.fastq.gz,fastq,575536100.0,11510722.0,GSM2088166 r1,0:50,A:111158012;C:168916114;G:151564939;T:143886262;N:10773,50,,,,111158012,168916114,151564939,143886262,10773,SRX1634601,SRS1345858,SRA385720,GEO,"Chuan He Lab, Chemistry, University of Chicago",1,0.95515,,0.19883,,0.79245,,0.6247,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,United States,2016-03-14,Undetermined,Embryo,Whole Organism,All anatomical structures 40592,SRR3228700,SRX1634600,SRS1345859,SRP071818,PRJNA315314,The functions of m6A and Ythdf2 during zebrafish early development,GSE79213,Other,We report the m6A methylation maps of zebrafish embryos during early development and transcriptome wide changes occured in ythdf2 LOF mutant embryos. Our study reveals the m6A dependent RNA decay as a previously unidentified maternal mode mechanism to regulate maternal mRNA clearance during zebrafish   MZT highlighting the critical role of the m6A mRNA methylation in animal development. Overall design: m6A seq of mRNA from zebrafish embryos at 0 2 4 6 8 h.p.f.; mRNA seq of wild type and maternal ythdf2 null mutant embryos at 0 2 4 6 8 h.p.f.; mRNA seq of embryos injected with control or ythdf2 MO at xxx h.p.f.; mRNA seq of wild type and maternal zygotic ythdf2 null mutant embryos at 6 8 12 24 h.p.f; and mRNA seq of wild type and maternal ythdf2 null mutant embryos injected with control or ythdf2 MO at xxx 36 48 h.p.f. Replicate of each seq is also included.,,pubmed:28192787,,input 6,GSM2088165,,tissue:whole zebrafish embryo|genotype:WT|treatment:n1,input 6,Data analysis for each experiment: 1 for m6A seq reads were aligned to the reference genome danRer10 using Tophat v2.0.14 ref with parameter g 1 library type=fr firststrand. RefSeq Gene structure annotations were downloaded from UCSC Table Browser. The longest isoform was used if the gene has multiple isoforms. Aligned reads were extended to 150bp average fragments size and converted from genome based coordinates to isoform based coordinates in order to eliminate the interference from intron in peak calling. The peak calling method was modified from Dan Dominissini nature 2012 work. To call m6A peaks the longest isoform of each human gene was scanned using a 100 bp sliding window with 10 bp step. To reduce bias from potential inaccurate gene structure annotation and the arbitrary usage of the longest isoform windows with reads counts less than 1/20 of the top window in both m6A IP and input sample were excluded. For each gene the reads count in each window was normalized by the median count of all windows of that gene. A fisher exact test was used to identify the differential windows between IP and input samples. The window was called as positive if the fdr < 0.01 and log2Enrichment Score >= 1. Overlapping positive windows were merged. The following four numbers were calculated to obtain the enrichment score of each peak or window: reads count of the IP sample in the current peak/window a median reads count of the IP sample in all 100 bp windows on the current mRNA b reads count of the input sample in the current peak/window c and median reads count of the input sample in all 100 bp windows on the current mRNA d. The enrichment score of each window was calculated as a×d/b×c. 2 for m6A CLIP seq post removing the adapter sequence the reads were mapped to the reference genome danRer10 using bowtie2. Peak calling method was similar to previous study chen kai's Angew 2015. Briefly mutations were considered as signal and all mapped reads were treated as background. A Gaussian Kernel density estimation were used to identify the binding regions. The motif analysis was performed using HOMER homer ref here to search motifs in each set of m6A peaks. The longest isoform of all genes was used as background. 3 for mRNA Seq Reads were mapped with Tophat and Cufflink v2.2.1 was used to calculate the FPKM of each gene to represent their mRNA expression level.,whole zebrafish embryo,,total RNA was extracted using Direct zol Zymo from embryos homogenized in TRIzol. mRNA was further purified using Dynabeads mRNA DIRECT Kit. For IP samples mRNA was sonicated and subjected to IP using m6A antibody Synaptic Systems 202003. Libraries were constructed using TruSeq Stranded mRNA Library Prep Kit Illumina.,embryos were collected and cultured in medium at 28.5 °C and then harvested at each time point into TRIzol.,development time h.p.f.:6|genotype:WT|treatment:n1,GSM2088165,GSM2088165: input 6; Danio rerio; RIP Seq,GSM2088165,,1,total RNA was extracted using Direct zol Zymo from embryos homogenized in TRIzol. mRNA was further purified using Dynabeads mRNA DIRECT Kit. For IP samples mRNA was sonicated and subjected to IP using m6A antibody Synaptic Systems 202003. Libraries were constructed using TruSeq Stranded mRNA Library Prep Kit Illumina.,GEO Accession:GSM2088165,RIP-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP071818,,,m6A_6h.input.fastq.gz,fastq,613333150.0,12266663.0,GSM2088165 r1,0:50,A:113451661;C:194144306;G:164598114;T:141127589;N:11480,50,,,,113451661,194144306,164598114,141127589,11480,SRX1634600,SRS1345859,SRA385720,GEO,"Chuan He Lab, Chemistry, University of Chicago",1,0.97989,,0.33526,,0.84798,,0.72512,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,United States,2016-03-14,Undetermined,Embryo,Whole Organism,All anatomical structures 40593,SRR3228699,SRX1634599,SRS1345860,SRP071818,PRJNA315314,The functions of m6A and Ythdf2 during zebrafish early development,GSE79213,Other,We report the m6A methylation maps of zebrafish embryos during early development and transcriptome wide changes occured in ythdf2 LOF mutant embryos. Our study reveals the m6A dependent RNA decay as a previously unidentified maternal mode mechanism to regulate maternal mRNA clearance during zebrafish   MZT highlighting the critical role of the m6A mRNA methylation in animal development. Overall design: m6A seq of mRNA from zebrafish embryos at 0 2 4 6 8 h.p.f.; mRNA seq of wild type and maternal ythdf2 null mutant embryos at 0 2 4 6 8 h.p.f.; mRNA seq of embryos injected with control or ythdf2 MO at xxx h.p.f.; mRNA seq of wild type and maternal zygotic ythdf2 null mutant embryos at 6 8 12 24 h.p.f; and mRNA seq of wild type and maternal ythdf2 null mutant embryos injected with control or ythdf2 MO at xxx 36 48 h.p.f. Replicate of each seq is also included.,,pubmed:28192787,,input 4,GSM2088164,,tissue:whole zebrafish embryo|genotype:WT|treatment:n1,input 4,Data analysis for each experiment: 1 for m6A seq reads were aligned to the reference genome danRer10 using Tophat v2.0.14 ref with parameter g 1 library type=fr firststrand. RefSeq Gene structure annotations were downloaded from UCSC Table Browser. The longest isoform was used if the gene has multiple isoforms. Aligned reads were extended to 150bp average fragments size and converted from genome based coordinates to isoform based coordinates in order to eliminate the interference from intron in peak calling. The peak calling method was modified from Dan Dominissini nature 2012 work. To call m6A peaks the longest isoform of each human gene was scanned using a 100 bp sliding window with 10 bp step. To reduce bias from potential inaccurate gene structure annotation and the arbitrary usage of the longest isoform windows with reads counts less than 1/20 of the top window in both m6A IP and input sample were excluded. For each gene the reads count in each window was normalized by the median count of all windows of that gene. A fisher exact test was used to identify the differential windows between IP and input samples. The window was called as positive if the fdr < 0.01 and log2Enrichment Score >= 1. Overlapping positive windows were merged. The following four numbers were calculated to obtain the enrichment score of each peak or window: reads count of the IP sample in the current peak/window a median reads count of the IP sample in all 100 bp windows on the current mRNA b reads count of the input sample in the current peak/window c and median reads count of the input sample in all 100 bp windows on the current mRNA d. The enrichment score of each window was calculated as a×d/b×c. 2 for m6A CLIP seq post removing the adapter sequence the reads were mapped to the reference genome danRer10 using bowtie2. Peak calling method was similar to previous study chen kai's Angew 2015. Briefly mutations were considered as signal and all mapped reads were treated as background. A Gaussian Kernel density estimation were used to identify the binding regions. The motif analysis was performed using HOMER homer ref here to search motifs in each set of m6A peaks. The longest isoform of all genes was used as background. 3 for mRNA Seq Reads were mapped with Tophat and Cufflink v2.2.1 was used to calculate the FPKM of each gene to represent their mRNA expression level.,whole zebrafish embryo,,total RNA was extracted using Direct zol Zymo from embryos homogenized in TRIzol. mRNA was further purified using Dynabeads mRNA DIRECT Kit. For IP samples mRNA was sonicated and subjected to IP using m6A antibody Synaptic Systems 202003. Libraries were constructed using TruSeq Stranded mRNA Library Prep Kit Illumina.,embryos were collected and cultured in medium at 28.5 °C and then harvested at each time point into TRIzol.,development time h.p.f.:4|genotype:WT|treatment:n1,GSM2088164,GSM2088164: input 4; Danio rerio; RIP Seq,GSM2088164,,1,total RNA was extracted using Direct zol Zymo from embryos homogenized in TRIzol. mRNA was further purified using Dynabeads mRNA DIRECT Kit. For IP samples mRNA was sonicated and subjected to IP using m6A antibody Synaptic Systems 202003. Libraries were constructed using TruSeq Stranded mRNA Library Prep Kit Illumina.,GEO Accession:GSM2088164,RIP-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP071818,,,m6A_4h.input.fastq.gz,fastq,576058200.0,11521164.0,GSM2088164 r1,0:50,A:108062480;C:178888385;G:153976688;T:135119699;N:10948,50,,,,108062480,178888385,153976688,135119699,10948,SRX1634599,SRS1345860,SRA385720,GEO,"Chuan He Lab, Chemistry, University of Chicago",1,0.97495,,0.29544,,0.81162,,0.71268,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,United States,2016-03-14,Undetermined,Embryo,Whole Organism,All anatomical structures 40594,SRR3228698,SRX1634598,SRS1345861,SRP071818,PRJNA315314,The functions of m6A and Ythdf2 during zebrafish early development,GSE79213,Other,We report the m6A methylation maps of zebrafish embryos during early development and transcriptome wide changes occured in ythdf2 LOF mutant embryos. Our study reveals the m6A dependent RNA decay as a previously unidentified maternal mode mechanism to regulate maternal mRNA clearance during zebrafish   MZT highlighting the critical role of the m6A mRNA methylation in animal development. Overall design: m6A seq of mRNA from zebrafish embryos at 0 2 4 6 8 h.p.f.; mRNA seq of wild type and maternal ythdf2 null mutant embryos at 0 2 4 6 8 h.p.f.; mRNA seq of embryos injected with control or ythdf2 MO at xxx h.p.f.; mRNA seq of wild type and maternal zygotic ythdf2 null mutant embryos at 6 8 12 24 h.p.f; and mRNA seq of wild type and maternal ythdf2 null mutant embryos injected with control or ythdf2 MO at xxx 36 48 h.p.f. Replicate of each seq is also included.,,pubmed:28192787,,input 2,GSM2088163,,tissue:whole zebrafish embryo|genotype:WT|treatment:n1,input 2,Data analysis for each experiment: 1 for m6A seq reads were aligned to the reference genome danRer10 using Tophat v2.0.14 ref with parameter g 1 library type=fr firststrand. RefSeq Gene structure annotations were downloaded from UCSC Table Browser. The longest isoform was used if the gene has multiple isoforms. Aligned reads were extended to 150bp average fragments size and converted from genome based coordinates to isoform based coordinates in order to eliminate the interference from intron in peak calling. The peak calling method was modified from Dan Dominissini nature 2012 work. To call m6A peaks the longest isoform of each human gene was scanned using a 100 bp sliding window with 10 bp step. To reduce bias from potential inaccurate gene structure annotation and the arbitrary usage of the longest isoform windows with reads counts less than 1/20 of the top window in both m6A IP and input sample were excluded. For each gene the reads count in each window was normalized by the median count of all windows of that gene. A fisher exact test was used to identify the differential windows between IP and input samples. The window was called as positive if the fdr < 0.01 and log2Enrichment Score >= 1. Overlapping positive windows were merged. The following four numbers were calculated to obtain the enrichment score of each peak or window: reads count of the IP sample in the current peak/window a median reads count of the IP sample in all 100 bp windows on the current mRNA b reads count of the input sample in the current peak/window c and median reads count of the input sample in all 100 bp windows on the current mRNA d. The enrichment score of each window was calculated as a×d/b×c. 2 for m6A CLIP seq post removing the adapter sequence the reads were mapped to the reference genome danRer10 using bowtie2. Peak calling method was similar to previous study chen kai's Angew 2015. Briefly mutations were considered as signal and all mapped reads were treated as background. A Gaussian Kernel density estimation were used to identify the binding regions. The motif analysis was performed using HOMER homer ref here to search motifs in each set of m6A peaks. The longest isoform of all genes was used as background. 3 for mRNA Seq Reads were mapped with Tophat and Cufflink v2.2.1 was used to calculate the FPKM of each gene to represent their mRNA expression level.,whole zebrafish embryo,,total RNA was extracted using Direct zol Zymo from embryos homogenized in TRIzol. mRNA was further purified using Dynabeads mRNA DIRECT Kit. For IP samples mRNA was sonicated and subjected to IP using m6A antibody Synaptic Systems 202003. Libraries were constructed using TruSeq Stranded mRNA Library Prep Kit Illumina.,embryos were collected and cultured in medium at 28.5 °C and then harvested at each time point into TRIzol.,development time h.p.f.:2|genotype:WT|treatment:n1,GSM2088163,GSM2088163: input 2; Danio rerio; RIP Seq,GSM2088163,,1,total RNA was extracted using Direct zol Zymo from embryos homogenized in TRIzol. mRNA was further purified using Dynabeads mRNA DIRECT Kit. For IP samples mRNA was sonicated and subjected to IP using m6A antibody Synaptic Systems 202003. Libraries were constructed using TruSeq Stranded mRNA Library Prep Kit Illumina.,GEO Accession:GSM2088163,RIP-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP071818,,,m6A_2h.input.fastq.gz,fastq,703375200.0,14067504.0,GSM2088163 r1,0:50,A:125686246;C:228251341;G:193846290;T:155577830;N:13493,50,,,,125686246,228251341,193846290,155577830,13493,SRX1634598,SRS1345861,SRA385720,GEO,"Chuan He Lab, Chemistry, University of Chicago",1,0.98596,,0.35619,,0.88521,,0.80927,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,United States,2016-03-14,Undetermined,Embryo,Whole Organism,All anatomical structures 40595,SRR3228697,SRX1634597,SRS1345862,SRP071818,PRJNA315314,The functions of m6A and Ythdf2 during zebrafish early development,GSE79213,Other,We report the m6A methylation maps of zebrafish embryos during early development and transcriptome wide changes occured in ythdf2 LOF mutant embryos. Our study reveals the m6A dependent RNA decay as a previously unidentified maternal mode mechanism to regulate maternal mRNA clearance during zebrafish   MZT highlighting the critical role of the m6A mRNA methylation in animal development. Overall design: m6A seq of mRNA from zebrafish embryos at 0 2 4 6 8 h.p.f.; mRNA seq of wild type and maternal ythdf2 null mutant embryos at 0 2 4 6 8 h.p.f.; mRNA seq of embryos injected with control or ythdf2 MO at xxx h.p.f.; mRNA seq of wild type and maternal zygotic ythdf2 null mutant embryos at 6 8 12 24 h.p.f; and mRNA seq of wild type and maternal ythdf2 null mutant embryos injected with control or ythdf2 MO at xxx 36 48 h.p.f. Replicate of each seq is also included.,,pubmed:28192787,,input 0,GSM2088162,,tissue:whole zebrafish embryo|genotype:WT|treatment:n1,input 0,Data analysis for each experiment: 1 for m6A seq reads were aligned to the reference genome danRer10 using Tophat v2.0.14 ref with parameter g 1 library type=fr firststrand. RefSeq Gene structure annotations were downloaded from UCSC Table Browser. The longest isoform was used if the gene has multiple isoforms. Aligned reads were extended to 150bp average fragments size and converted from genome based coordinates to isoform based coordinates in order to eliminate the interference from intron in peak calling. The peak calling method was modified from Dan Dominissini nature 2012 work. To call m6A peaks the longest isoform of each human gene was scanned using a 100 bp sliding window with 10 bp step. To reduce bias from potential inaccurate gene structure annotation and the arbitrary usage of the longest isoform windows with reads counts less than 1/20 of the top window in both m6A IP and input sample were excluded. For each gene the reads count in each window was normalized by the median count of all windows of that gene. A fisher exact test was used to identify the differential windows between IP and input samples. The window was called as positive if the fdr < 0.01 and log2Enrichment Score >= 1. Overlapping positive windows were merged. The following four numbers were calculated to obtain the enrichment score of each peak or window: reads count of the IP sample in the current peak/window a median reads count of the IP sample in all 100 bp windows on the current mRNA b reads count of the input sample in the current peak/window c and median reads count of the input sample in all 100 bp windows on the current mRNA d. The enrichment score of each window was calculated as a×d/b×c. 2 for m6A CLIP seq post removing the adapter sequence the reads were mapped to the reference genome danRer10 using bowtie2. Peak calling method was similar to previous study chen kai's Angew 2015. Briefly mutations were considered as signal and all mapped reads were treated as background. A Gaussian Kernel density estimation were used to identify the binding regions. The motif analysis was performed using HOMER homer ref here to search motifs in each set of m6A peaks. The longest isoform of all genes was used as background. 3 for mRNA Seq Reads were mapped with Tophat and Cufflink v2.2.1 was used to calculate the FPKM of each gene to represent their mRNA expression level.,whole zebrafish embryo,,total RNA was extracted using Direct zol Zymo from embryos homogenized in TRIzol. mRNA was further purified using Dynabeads mRNA DIRECT Kit. For IP samples mRNA was sonicated and subjected to IP using m6A antibody Synaptic Systems 202003. Libraries were constructed using TruSeq Stranded mRNA Library Prep Kit Illumina.,embryos were collected and cultured in medium at 28.5 °C and then harvested at each time point into TRIzol.,development time h.p.f.:0|genotype:WT|treatment:n1,GSM2088162,GSM2088162: input 0; Danio rerio; RIP Seq,GSM2088162,,1,total RNA was extracted using Direct zol Zymo from embryos homogenized in TRIzol. mRNA was further purified using Dynabeads mRNA DIRECT Kit. For IP samples mRNA was sonicated and subjected to IP using m6A antibody Synaptic Systems 202003. Libraries were constructed using TruSeq Stranded mRNA Library Prep Kit Illumina.,GEO Accession:GSM2088162,RIP-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP071818,,,m6A_0h.input.fastq.gz,fastq,650787500.0,13015750.0,GSM2088162 r1,0:50,A:117902403;C:207274717;G:177773347;T:147824646;N:12387,50,,,,117902403,207274717,177773347,147824646,12387,SRX1634597,SRS1345862,SRA385720,GEO,"Chuan He Lab, Chemistry, University of Chicago",1,0.98268,,0.32108,,0.85669,,0.76239,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,United States,2016-03-14,Undetermined,Embryo,Whole Organism,All anatomical structures 43402,SRR5931544,SRX3091819,SRS2429165,SRP115388,PRJNA397956,Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads,PRJNA397956,Whole Genome Sequencing,To evaluate underlying environmental risks of difenoconazole in aquatic organisms,,,To evaluate underlying environmental risks of difenoconazole in zebrafish embryo,Model organism or animal sample from Danio rerio,Zebrafish,,strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal,,,,,,,,,with difenoconazole,397969,397969,to evulate the environmental risks of difenoconazole in zebrafish embryo,,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP115388,,,,,4755826950.0,31705513.0,D 500 1 2.fq.gz,0:0 1:150,A:1274207449;C:1094727902;G:1122524378;T:1264331427;N:35794,0,150,,,1274207449,1094727902,1122524378,1264331427,35794,SRX3091819,SRS2429165,SRA598900,China Agricultural University|College of Sciences,China Agricultural University,1,0.91191,,0.10926,,0.68341,,0.47196,,150,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2017-08-14,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 43403,SRR5931545,SRX3091818,SRS2429165,SRP115388,PRJNA397956,Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads,PRJNA397956,Whole Genome Sequencing,To evaluate underlying environmental risks of difenoconazole in aquatic organisms,,,To evaluate underlying environmental risks of difenoconazole in zebrafish embryo,Model organism or animal sample from Danio rerio,Zebrafish,,strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal,,,,,,,,,with difenoconazole,397968,397968,to evulate the environmental risks of difenoconazole in zebrafish embryo,,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP115388,,,,,4755826950.0,31705513.0,D 500 1 1.fq.gz,0:150 1:0,A:1276129214;C:1100761964;G:1115345594;T:1263574047;N:16131,150,0,,,1276129214,1100761964,1115345594,1263574047,16131,SRX3091818,SRS2429165,SRA598900,China Agricultural University|College of Sciences,China Agricultural University,1,0.91044,,0.10895,,0.67659,,0.46952,,150,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2017-08-14,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 43404,SRR5931546,SRX3091817,SRS2429165,SRP115388,PRJNA397956,Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads,PRJNA397956,Whole Genome Sequencing,To evaluate underlying environmental risks of difenoconazole in aquatic organisms,,,To evaluate underlying environmental risks of difenoconazole in zebrafish embryo,Model organism or animal sample from Danio rerio,Zebrafish,,strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal,,,,,,,,,with difenoconazole,397967,397967,to evulate the environmental risks of difenoconazole in zebrafish embryo,,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP115388,,,,,4584658950.0,30564393.0,D 50 3 2.fq.gz,0:0 1:150,A:1214232270;C:1065003267;G:1091428812;T:1213867330;N:127271,0,150,,,1214232270,1065003267,1091428812,1213867330,127271,SRX3091817,SRS2429165,SRA598900,China Agricultural University|College of Sciences,China Agricultural University,1,0.92229,,0.10554,,0.68667,,0.4535,,150,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2017-08-14,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 43405,SRR5931547,SRX3091816,SRS2429165,SRP115388,PRJNA397956,Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads,PRJNA397956,Whole Genome Sequencing,To evaluate underlying environmental risks of difenoconazole in aquatic organisms,,,To evaluate underlying environmental risks of difenoconazole in zebrafish embryo,Model organism or animal sample from Danio rerio,Zebrafish,,strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal,,,,,,,,,with difenoconazole,397966,397966,to evulate the environmental risks of difenoconazole in zebrafish embryo,,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP115388,,,,,4584658950.0,30564393.0,D 50 3 1.fq.gz,0:150 1:0,A:1219702088;C:1067643780;G:1085480895;T:1211806100;N:26087,150,0,,,1219702088,1067643780,1085480895,1211806100,26087,SRX3091816,SRS2429165,SRA598900,China Agricultural University|College of Sciences,China Agricultural University,1,0.92126,,0.10598,,0.68398,,0.44901,,150,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2017-08-14,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 43406,SRR5931548,SRX3091815,SRS2429165,SRP115388,PRJNA397956,Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads,PRJNA397956,Whole Genome Sequencing,To evaluate underlying environmental risks of difenoconazole in aquatic organisms,,,To evaluate underlying environmental risks of difenoconazole in zebrafish embryo,Model organism or animal sample from Danio rerio,Zebrafish,,strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal,,,,,,,,,with difenoconazole,397973,397973,to evulate the environmental risks of difenoconazole in zebrafish embryo,,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP115388,,,,,4705867200.0,31372448.0,D 500 3 2.fq.gz,0:0 1:150,A:1240294141;C:1111008282;G:1125861755;T:1228667971;N:35051,0,150,,,1240294141,1111008282,1125861755,1228667971,35051,SRX3091815,SRS2429165,SRA598900,China Agricultural University|College of Sciences,China Agricultural University,1,0.92297,,0.09739,,0.6856,,0.47451,,150,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2017-08-14,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 43407,SRR5931549,SRX3091814,SRS2429165,SRP115388,PRJNA397956,Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads,PRJNA397956,Whole Genome Sequencing,To evaluate underlying environmental risks of difenoconazole in aquatic organisms,,,To evaluate underlying environmental risks of difenoconazole in zebrafish embryo,Model organism or animal sample from Danio rerio,Zebrafish,,strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal,,,,,,,,,with difenoconazole,397972,397972,to evulate the environmental risks of difenoconazole in zebrafish embryo,,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP115388,,,,,4705867200.0,31372448.0,D 500 3 1.fq.gz,0:150 1:0,A:1241514886;C:1108723884;G:1123339576;T:1232273510;N:15344,150,0,,,1241514886,1108723884,1123339576,1232273510,15344,SRX3091814,SRS2429165,SRA598900,China Agricultural University|College of Sciences,China Agricultural University,1,0.92062,,0.09796,,0.67856,,0.47388,,150,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2017-08-14,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 43408,SRR5931550,SRX3091813,SRS2429165,SRP115388,PRJNA397956,Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads,PRJNA397956,Whole Genome Sequencing,To evaluate underlying environmental risks of difenoconazole in aquatic organisms,,,To evaluate underlying environmental risks of difenoconazole in zebrafish embryo,Model organism or animal sample from Danio rerio,Zebrafish,,strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal,,,,,,,,,with difenoconazole,397971,397971,to evulate the environmental risks of difenoconazole in zebrafish embryo,,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP115388,,,,,4750951350.0,31673009.0,D 500 2 2.fq.gz,0:0 1:150,A:1286144024;C:1079544004;G:1112952985;T:1272274928;N:35409,0,150,,,1286144024,1079544004,1112952985,1272274928,35409,SRX3091813,SRS2429165,SRA598900,China Agricultural University|College of Sciences,China Agricultural University,1,0.90446,,0.13747,,0.68639,,0.46726,,150,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2017-08-14,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 43409,SRR5931551,SRX3091812,SRS2429165,SRP115388,PRJNA397956,Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads,PRJNA397956,Whole Genome Sequencing,To evaluate underlying environmental risks of difenoconazole in aquatic organisms,,,To evaluate underlying environmental risks of difenoconazole in zebrafish embryo,Model organism or animal sample from Danio rerio,Zebrafish,,strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal,,,,,,,,,with difenoconazole,397970,397970,to evulate the environmental risks of difenoconazole in zebrafish embryo,,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP115388,,,,,4750951350.0,31673009.0,D 500 2 1.fq.gz,0:150 1:0,A:1287515334;C:1090783234;G:1101469034;T:1271168008;N:15740,150,0,,,1287515334,1090783234,1101469034,1271168008,15740,SRX3091812,SRS2429165,SRA598900,China Agricultural University|College of Sciences,China Agricultural University,1,0.90214,,0.13756,,0.68158,,0.46719,,150,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2017-08-14,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 43410,SRR5931552,SRX3091811,SRS2429165,SRP115388,PRJNA397956,Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads,PRJNA397956,Whole Genome Sequencing,To evaluate underlying environmental risks of difenoconazole in aquatic organisms,,,To evaluate underlying environmental risks of difenoconazole in zebrafish embryo,Model organism or animal sample from Danio rerio,Zebrafish,,strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal,,,,,,,,,without xxx,397957,397957,to evulate the environmental risks of difenoconazole in zebrafish embryo,,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP115388,,,,,4071934650.0,27146231.0,CK 1 2.fq.gz,0:0 1:150,A:1052229682;C:975525985;G:991345538;T:1052207035;N:626410,0,150,,,1052229682,975525985,991345538,1052207035,626410,SRX3091811,SRS2429165,SRA598900,China Agricultural University|College of Sciences,China Agricultural University,1,0.93603,,0.0589,,0.71492,,0.48298,,150,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2017-08-14,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 43411,SRR5931553,SRX3091810,SRS2429165,SRP115388,PRJNA397956,Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads,PRJNA397956,Whole Genome Sequencing,To evaluate underlying environmental risks of difenoconazole in aquatic organisms,,,To evaluate underlying environmental risks of difenoconazole in zebrafish embryo,Model organism or animal sample from Danio rerio,Zebrafish,,strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal,,,,,,,,,without xxx,397956,397956,to evulate the environmental risks of difenoconazole in zebrafish embryo,,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP115388,,,,,4071934650.0,27146231.0,CK 1 1.fq.gz,0:150 1:0,A:1057694098;C:975549420;G:988477956;T:1049766896;N:446280,150,0,,,1057694098,975549420,988477956,1049766896,446280,SRX3091810,SRS2429165,SRA598900,China Agricultural University|College of Sciences,China Agricultural University,1,0.93688,,0.05854,,0.7091,,0.48309,,150,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2017-08-14,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 43412,SRR5931554,SRX3091809,SRS2429165,SRP115388,PRJNA397956,Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads,PRJNA397956,Whole Genome Sequencing,To evaluate underlying environmental risks of difenoconazole in aquatic organisms,,,To evaluate underlying environmental risks of difenoconazole in zebrafish embryo,Model organism or animal sample from Danio rerio,Zebrafish,,strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal,,,,,,,,,without xxx,397959,397959,to evulate the environmental risks of difenoconazole in zebrafish embryo,,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP115388,,,,,4343291550.0,28955277.0,CK 2 2.fq.gz,0:0 1:150,A:1153253014;C:1007267471;G:1028912357;T:1153739160;N:119548,0,150,,,1153253014,1007267471,1028912357,1153739160,119548,SRX3091809,SRS2429165,SRA598900,China Agricultural University|College of Sciences,China Agricultural University,1,0.9209,,0.11211,,0.68649,,0.45293,,150,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2017-08-14,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 43413,SRR5931555,SRX3091808,SRS2429165,SRP115388,PRJNA397956,Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads,PRJNA397956,Whole Genome Sequencing,To evaluate underlying environmental risks of difenoconazole in aquatic organisms,,,To evaluate underlying environmental risks of difenoconazole in zebrafish embryo,Model organism or animal sample from Danio rerio,Zebrafish,,strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal,,,,,,,,,without xxx,397958,397958,to evulate the environmental risks of difenoconazole in zebrafish embryo,,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP115388,,,,,4343291550.0,28955277.0,CK 2 1.fq.gz,0:150 1:0,A:1157702407;C:1008975846;G:1024287434;T:1151988746;N:337117,150,0,,,1157702407,1008975846,1024287434,1151988746,337117,SRX3091808,SRS2429165,SRA598900,China Agricultural University|College of Sciences,China Agricultural University,1,0.91946,,0.11191,,0.6828,,0.45241,,150,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2017-08-14,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 43414,SRR5931556,SRX3091807,SRS2429165,SRP115388,PRJNA397956,Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads,PRJNA397956,Whole Genome Sequencing,To evaluate underlying environmental risks of difenoconazole in aquatic organisms,,,To evaluate underlying environmental risks of difenoconazole in zebrafish embryo,Model organism or animal sample from Danio rerio,Zebrafish,,strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal,,,,,,,,,without xxx,397961,397961,to evulate the environmental risks of difenoconazole in zebrafish embryo,,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP115388,,,,,4518061050.0,30120407.0,CK 3 2.fq.gz,0:0 1:150,A:1188586431;C:1058258572;G:1080153332;T:1190907666;N:155049,0,150,,,1188586431,1058258572,1080153332,1190907666,155049,SRX3091807,SRS2429165,SRA598900,China Agricultural University|College of Sciences,China Agricultural University,1,0.92512,,0.09744,,0.69085,,0.45772,,150,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2017-08-14,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 43415,SRR5931557,SRX3091806,SRS2429165,SRP115388,PRJNA397956,Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads,PRJNA397956,Whole Genome Sequencing,To evaluate underlying environmental risks of difenoconazole in aquatic organisms,,,To evaluate underlying environmental risks of difenoconazole in zebrafish embryo,Model organism or animal sample from Danio rerio,Zebrafish,,strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal,,,,,,,,,without xxx,397960,397960,to evulate the environmental risks of difenoconazole in zebrafish embryo,,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP115388,,,,,4518061050.0,30120407.0,CK 3 1.fq.gz,0:150 1:0,A:1195164171;C:1059996453;G:1074722334;T:1188143044;N:35048,150,0,,,1195164171,1059996453,1074722334,1188143044,35048,SRX3091806,SRS2429165,SRA598900,China Agricultural University|College of Sciences,China Agricultural University,1,0.9249,,0.09772,,0.68562,,0.45606,,150,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2017-08-14,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 43416,SRR5931558,SRX3091805,SRS2429165,SRP115388,PRJNA397956,Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads,PRJNA397956,Whole Genome Sequencing,To evaluate underlying environmental risks of difenoconazole in aquatic organisms,,,To evaluate underlying environmental risks of difenoconazole in zebrafish embryo,Model organism or animal sample from Danio rerio,Zebrafish,,strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal,,,,,,,,,with difenoconazole,397963,397963,to evulate the environmental risks of difenoconazole in zebrafish embryo,,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP115388,,,,,4572900600.0,30486004.0,D 50 1 2.fq.gz,0:0 1:150,A:1218364634;C:1054987971;G:1079106780;T:1220261884;N:179331,0,150,,,1218364634,1054987971,1079106780,1220261884,179331,SRX3091805,SRS2429165,SRA598900,China Agricultural University|College of Sciences,China Agricultural University,1,0.91953,,0.11512,,0.68722,,0.45056,,150,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2017-08-14,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 43417,SRR5931559,SRX3091804,SRS2429165,SRP115388,PRJNA397956,Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads,PRJNA397956,Whole Genome Sequencing,To evaluate underlying environmental risks of difenoconazole in aquatic organisms,,,To evaluate underlying environmental risks of difenoconazole in zebrafish embryo,Model organism or animal sample from Danio rerio,Zebrafish,,strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal,,,,,,,,,with difenoconazole,397962,397962,to evulate the environmental risks of difenoconazole in zebrafish embryo,,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP115388,,,,,4572900600.0,30486004.0,D 50 1 1.fq.gz,0:150 1:0,A:1223844243;C:1057030107;G:1074694968;T:1217286959;N:44323,150,0,,,1223844243,1057030107,1074694968,1217286959,44323,SRX3091804,SRS2429165,SRA598900,China Agricultural University|College of Sciences,China Agricultural University,1,0.91779,,0.1149,,0.68258,,0.46006,,150,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2017-08-14,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 43418,SRR5931560,SRX3091803,SRS2429165,SRP115388,PRJNA397956,Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads,PRJNA397956,Whole Genome Sequencing,To evaluate underlying environmental risks of difenoconazole in aquatic organisms,,,To evaluate underlying environmental risks of difenoconazole in zebrafish embryo,Model organism or animal sample from Danio rerio,Zebrafish,,strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal,,,,,,,,,with difenoconazole,397965,397965,to evulate the environmental risks of difenoconazole in zebrafish embryo,,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP115388,,,,,4595232150.0,30634881.0,D 50 2 2.fq.gz,0:0 1:150,A:1225033548;C:1062169088;G:1082021478;T:1225833369;N:174667,0,150,,,1225033548,1062169088,1082021478,1225833369,174667,SRX3091803,SRS2429165,SRA598900,China Agricultural University|College of Sciences,China Agricultural University,1,0.91827,,0.11697,,0.68511,,0.44407,,150,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2017-08-14,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 43419,SRR5931561,SRX3091802,SRS2429165,SRP115388,PRJNA397956,Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads,PRJNA397956,Whole Genome Sequencing,To evaluate underlying environmental risks of difenoconazole in aquatic organisms,,,To evaluate underlying environmental risks of difenoconazole in zebrafish embryo,Model organism or animal sample from Danio rerio,Zebrafish,,strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal,,,,,,,,,with difenoconazole,397964,397964,to evulate the environmental risks of difenoconazole in zebrafish embryo,,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP115388,,,,,4595232150.0,30634881.0,D 50 2 1.fq.gz,0:150 1:0,A:1231719851;C:1064618233;G:1076698645;T:1222155912;N:39509,150,0,,,1231719851,1064618233,1076698645,1222155912,39509,SRX3091802,SRS2429165,SRA598900,China Agricultural University|College of Sciences,China Agricultural University,,,,,,,,,,,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2017-08-14,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 44015,SRR6211474,SRX3320751,SRS2626325,SRP121343,PRJNA415636,Simultaneous lineage tracing and cell type identification using CRISPR/Cas9 induced genetic scars,GSE106121,Other,A key goal of developmental biology is to understand how a single cell transforms into a full grown organism consisting of many different cell types. Single cell RNA sequencing scRNA seq has become a widely used method due to its ability to identify all cell types in a tissue or organ in a systematic manner. However a major challenge is to organize the resulting taxonomy of cell types into lineage trees revealing the developmental origin of cells. Here we present a strategy for simultaneous lineage tracing and transcriptome profiling in thousands of single cells. By combining scRNA seq with computational analysis of lineage barcodes generated by genome editing of transgenic reporter genes we reconstruct developmental lineage trees in zebrafish larvae and adult fish. In future analyses LINNAEUS LINeage tracing by Nuclease Activated Editing of Ubiquitous Sequences can be used as a systematic approach for identifying the lineage origin of novel cell types or of known cell types under different conditions. Overall design: Combining scRNA seq with computational analysis of lineage barcodes generated by genome editing of transgenic reporter genes.,,pubmed:29644996,,Time course 10h24h mRNA,GSM2830047,,source name:Full organism|strain/background:Zebrabow M|tissue:Whole body|developmental stage:Embryo|time point:10h 24h,Time course 10h24h mRNA,Library strategy: Targeted amplification Embryos were injected with Cas9 and sgRNA at the 1 cell stage. post 1 2 3 4 6 8 10 and 24 hours 2 3 embryos were collected and RNA and/or DNA were extracted using TRIzol Reagent according to the manufacturer’s protocols. Bulk scar libraries were produced similarly to the bulk libraries for the scar probabilities. For each sample we calculated the percentage of unscarred RFP. We fit a negative exponential to this data assuming that the fraction of unscarred RFP at t=0 was one. Genome build: N/A Supplementary files format and content: List of scar sequences with CIGAR and cell barcode.,Full organism,,Trizol extraction of RNA. CEL seq,,strain/background:Zebrabow M|tissue:Whole body|developmental stage:Embryo|time point:10h 24h,GSM2830047,GSM2830047: Time course 10h24h mRNA; Danio rerio; OTHER,GSM2830047,,1,Trizol extraction of RNA. CEL seq,GEO Accession:GSM2830047,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,NextSeq 500,,SRP121343,,,dyn_RNA_10h24h_S13_R2_001.fastq.gz dyn_RNA_10h24h_S13_R1_001.fastq.gz,fastq fastq,1456176300.0,9707842.0,GSM2830047 r1,0:100 1:50,A:216943159;C:398650961;G:516656316;T:323899428;N:26436,100,50,,,216943159,398650961,516656316,323899428,26436,SRX3320751,SRS2626325,SRA623333,GEO,Max Delbrück Center,2,3e-05,0.00111,0.0,0.0011,0.99995,1.0,0.75,,100,50,T,T,mates < 9% mapping rate,illumina,nextseq,unknown,other,unknown,sc,single_cell_plate,celseq,,Germany,2017-10-24,Undetermined,Embryo,Trunk,Surface Structure 44016,SRR6211473,SRX3320750,SRS2626324,SRP121343,PRJNA415636,Simultaneous lineage tracing and cell type identification using CRISPR/Cas9 induced genetic scars,GSE106121,Other,A key goal of developmental biology is to understand how a single cell transforms into a full grown organism consisting of many different cell types. Single cell RNA sequencing scRNA seq has become a widely used method due to its ability to identify all cell types in a tissue or organ in a systematic manner. However a major challenge is to organize the resulting taxonomy of cell types into lineage trees revealing the developmental origin of cells. Here we present a strategy for simultaneous lineage tracing and transcriptome profiling in thousands of single cells. By combining scRNA seq with computational analysis of lineage barcodes generated by genome editing of transgenic reporter genes we reconstruct developmental lineage trees in zebrafish larvae and adult fish. In future analyses LINNAEUS LINeage tracing by Nuclease Activated Editing of Ubiquitous Sequences can be used as a systematic approach for identifying the lineage origin of novel cell types or of known cell types under different conditions. Overall design: Combining scRNA seq with computational analysis of lineage barcodes generated by genome editing of transgenic reporter genes.,,pubmed:29644996,,Time course 3h6h8h mRNA,GSM2830046,,source name:Full organism|strain/background:Zebrabow M|tissue:Whole body|developmental stage:Embryo|time point:3h 6h 8h,Time course 3h6h8h mRNA,Library strategy: Targeted amplification Embryos were injected with Cas9 and sgRNA at the 1 cell stage. post 1 2 3 4 6 8 10 and 24 hours 2 3 embryos were collected and RNA and/or DNA were extracted using TRIzol Reagent according to the manufacturer’s protocols. Bulk scar libraries were produced similarly to the bulk libraries for the scar probabilities. For each sample we calculated the percentage of unscarred RFP. We fit a negative exponential to this data assuming that the fraction of unscarred RFP at t=0 was one. Genome build: N/A Supplementary files format and content: List of scar sequences with CIGAR and cell barcode.,Full organism,,Trizol extraction of RNA. CEL seq,,strain/background:Zebrabow M|tissue:Whole body|developmental stage:Embryo|time point:3h 6h 8h,GSM2830046,GSM2830046: Time course 3h6h8h mRNA; Danio rerio; OTHER,GSM2830046,,1,Trizol extraction of RNA. CEL seq,GEO Accession:GSM2830046,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,NextSeq 500,,SRP121343,,,dyn_RNA_3h6h8h_S12_R1_001.fastq.gz dyn_RNA_3h6h8h_S12_R2_001.fastq.gz,fastq fastq,1382400000.0,9216000.0,GSM2830046 r1,0:100 1:50,A:219040774;C:378529638;G:475287684;T:309516830;N:25074,100,50,,,219040774,378529638,475287684,309516830,25074,SRX3320750,SRS2626324,SRA623333,GEO,Max Delbrück Center,2,5e-05,0.00116,0.0,0.00115,0.99987,1.0,0.5,,100,50,T,T,mates < 9% mapping rate,illumina,nextseq,unknown,other,unknown,sc,single_cell_plate,celseq,,Germany,2017-10-24,Undetermined,Embryo,Trunk,Surface Structure 47735,SRR6846413,SRX3801804,SRS3053760,SRP135842,PRJNA438572,RNA seq of embryo stimulated by interferons in Danio rerio,PRJNA438572,Other,RNA seq of embryo stimulated by interferons in Danio rerio provides transcriptome data which affords a unique view for understanding differences of expression of ISGs regulated by different interferons.,,,,,IFNY,,strain:missing|isolate:missing|breed:missing|cultivar:missing|ecotype:missing|age:missing|dev stage:stimulated by interferons|sex:missing|tissue:embryo|collection date:2017 03 12|geo loc name:China:Wuhan|BioSampleModel:Model organism or animal,,,,,,,,,RNA seq of embryo stimulated by interferons in Danio rerio,IFNY,IFNY,RNA seq of embryo stimulated by interferons in Danio rerio provides transcriptome data which affords a unique view for understanding differences of expression of ISGs regulated by different interferons.,,,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 4000,,SRP135842,,,IFNY_S13_L004_R2_001.fastq.gz IFNY_S13_L004_R1_001.fastq.gz,fastq fastq,8611053142.0,28513421.0,IFNY S13 L004 R1 001.fastq.gz,0:151 1:151,A:2172756042;C:2133682578;G:2133331951;T:2170977207;N:305364,151,151,,,2172756042,2133682578,2133331951,2170977207,305364,SRX3801804,SRS3053760,SRA666995,Chinese Academy of Sciences|Institute of Hydrobiology,Chinese Academy of Sciences,2,0.955,0.95804,0.04308,0.04392,0.70218,0.71033,0.46525,0.462,151,151,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2018-03-16,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 47736,SRR6846414,SRX3801803,SRS3053759,SRP135842,PRJNA438572,RNA seq of embryo stimulated by interferons in Danio rerio,PRJNA438572,Other,RNA seq of embryo stimulated by interferons in Danio rerio provides transcriptome data which affords a unique view for understanding differences of expression of ISGs regulated by different interferons.,,,,,vector,,strain:missing|isolate:missing|breed:missing|cultivar:missing|ecotype:missing|age:missing|dev stage:stimulated by interferons|sex:missing|tissue:embryo|collection date:2017 03 11|geo loc name:China:Wuhan|BioSampleModel:Model organism or animal,,,,,,,,,RNA seq of embryo stimulated by interferons in Danio rerio,vector,vector,RNA seq of embryo stimulated by interferons in Danio rerio provides transcriptome data which affords a unique view for understanding differences of expression of ISGs regulated by different interferons.,,,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 4000,,SRP135842,,,vector_S12_L004_R1_001.fastq.gz vector_S12_L004_R2_001.fastq.gz,fastq fastq,10279577472.0,34038336.0,vector S12 L004 R1 001.fastq.gz,0:151 1:151,A:2615896150;C:2524788585;G:2528030423;T:2610500306;N:362008,151,151,,,2615896150,2524788585,2528030423,2610500306,362008,SRX3801803,SRS3053759,SRA666995,Chinese Academy of Sciences|Institute of Hydrobiology,Chinese Academy of Sciences,2,0.9555,0.9579,0.04617,0.04728,0.70337,0.71072,0.46191,0.46954,151,151,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2018-03-16,Undetermined,Embryo,Embryo Imprecise,All anatomical structures