rowid,run.accession,experiment.accession,sample.accession,study.accession,bioproject,study.title,study.alias,study.type,study.abstract,study.attributes,study.PMIDs,sample.description,sample.title,sample.alias,sample.centername,sample.attributes,GEOsample.title,GEOsample.dataprocessing,GEOsample.source,GEOsample.treatmentprotocol,GEOsample.extractprotocol,GEOsample.growthprotocol,GEOsample.characteristics,GEOsample.accession,experiment.title,experiment.alias,experiment.library_name,experiment.design_description,experiment.library_construction_protocol,experiment.attributes,experiment.library_strategy,experiment.library_source,experiment.library_selection,experiment.library_layout,experiment.platform,experiment.instrument_model,experiment.spot_descriptor,experiment.study_ref,run.title,run.attributes,run.filename,run.semantic_name,run.total_bases,run.total_spots,run.alias,run.read_lengths,run.base_counts,run.r1_length,run.r2_length,run.r3_length,run.r4_length,run.Acount,run.Ccount,run.Gcount,run.Tcount,run.Ncount,run.experiment,run.pool_member,submission.accession,submission.srasource,submission.bioprojectsource,seqdetective.n_mates,seqdetective.mapping_rate.mate1,seqdetective.mapping_rate.mate2,seqdetective.nofeature_rate.mate1,seqdetective.nofeature_rate.mate2,seqdetective.sparsity.mate1,seqdetective.sparsity.mate2,seqdetective.pos_strand_rate.mate1,seqdetective.pos_strand_rate.mate2,seqdetective.readlen.mate1,seqdetective.readlen.mate2,seqdetective.judgement.mate1,seqdetective.judgement.mate2,seqdetective.judgement.reason,platform_family,instrument_generation,read_bias,selection_class,prep_kit,sc_or_bulk,tech_class,technology,tech_variant,submission.bioprojectsource.country,earliest_date,devstage_curation,devstage_curation_coarse,tissue_curation,tissue_curation_coarse
38,DRR408248,DRX393854,DRS407179,DRP012042,PRJDB14275,Zebrafish EN/ENCDC RNA seq,DRP012042,Transcriptome Analysis,A project to find differential expressed genes between enteric neurons ENs and enteric neural crest derived cells ENCDCs in larval zebrafish gut. We dissected guts of transgenic line TgSAGFFLF217B; uas:gfp for ENs and Tgsox10:cre; EF1alpha:loxP gfp loxP dsred for ENCDCs and isolated GFP+ ENs and dsRed+ ENCDCs. Three duplicates for each of ENs and ENCDCs are prepared. Libraries for NGS are prepared using SMART Seq V4 Ultra Low Input RNA Kit.,,,zebrafish 5 day DsRed positive enteric neural crest derived cells replicate 3,zebrafish ENCDC replicate 3,SAMD00529468,,sample name:zebrafish ENCDC replicate 3|biological replicate:enteric neural crest derived cells 3|strain:Tgsox10:cre; EF3alpha:loxP gfp loxP dsred,,,,,,,,,NextSeq 550 paired end sequencing of SAMD00529468,DRX393854,190326ENvsNC N706 5day;NeuralCrestDerivedCell;rep3,1,1,,RNA-Seq,TRANSCRIPTOMIC,RANDOM,PAIRED,ILLUMINA,NextSeq 550,1600Application ReadForward11Application ReadReverse81,DRP012042,NextSeq 550 paired end sequencing of SAMD00529468,,,,3803721121.0,24526633.0,DRR408248,0:77.54 1:77.54,A:999106107;C:897663781;G:921501114;T:979486853;N:5963266,77,77,,,999106107,897663781,921501114,979486853,5963266,DRX393854,DRS407179,DRA014886,"NIBB|NIBB core research facilities, National Institute for Basic Biology",University of Hyogo,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,unknown,random_priming,unknown,bulk,unknown,unknown,,Japan,2024-09-22,Undetermined,Larval,Brain,Nervous System
39,DRR408247,DRX393853,DRS407178,DRP012042,PRJDB14275,Zebrafish EN/ENCDC RNA seq,DRP012042,Transcriptome Analysis,A project to find differential expressed genes between enteric neurons ENs and enteric neural crest derived cells ENCDCs in larval zebrafish gut. We dissected guts of transgenic line TgSAGFFLF217B; uas:gfp for ENs and Tgsox10:cre; EF1alpha:loxP gfp loxP dsred for ENCDCs and isolated GFP+ ENs and dsRed+ ENCDCs. Three duplicates for each of ENs and ENCDCs are prepared. Libraries for NGS are prepared using SMART Seq V4 Ultra Low Input RNA Kit.,,,zebrafish 5 day DsRed positive enteric neural crest derived cells replicate 2,zebrafish ENCDC replicate 2,SAMD00529467,,sample name:zebrafish ENCDC replicate 2|biological replicate:enteric neural crest derived cells 2|strain:Tgsox10:cre; EF2alpha:loxP gfp loxP dsred,,,,,,,,,NextSeq 550 paired end sequencing of SAMD00529467,DRX393853,190326ENvsNC N705 5day;NeuralCrestDerivedCell;rep2,1,1,,RNA-Seq,TRANSCRIPTOMIC,RANDOM,PAIRED,ILLUMINA,NextSeq 550,1600Application ReadForward11Application ReadReverse81,DRP012042,NextSeq 550 paired end sequencing of SAMD00529467,,,,3436798274.0,22156202.0,DRR408247,0:77.56 1:77.56,A:900848174;C:812031426;G:832960423;T:885671203;N:5287048,77,77,,,900848174,812031426,832960423,885671203,5287048,DRX393853,DRS407178,DRA014886,"NIBB|NIBB core research facilities, National Institute for Basic Biology",University of Hyogo,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,unknown,random_priming,unknown,bulk,unknown,unknown,,Japan,2024-09-22,Undetermined,Larval,Brain,Nervous System
40,DRR408246,DRX393852,DRS407177,DRP012042,PRJDB14275,Zebrafish EN/ENCDC RNA seq,DRP012042,Transcriptome Analysis,A project to find differential expressed genes between enteric neurons ENs and enteric neural crest derived cells ENCDCs in larval zebrafish gut. We dissected guts of transgenic line TgSAGFFLF217B; uas:gfp for ENs and Tgsox10:cre; EF1alpha:loxP gfp loxP dsred for ENCDCs and isolated GFP+ ENs and dsRed+ ENCDCs. Three duplicates for each of ENs and ENCDCs are prepared. Libraries for NGS are prepared using SMART Seq V4 Ultra Low Input RNA Kit.,,,zebrafish 5 day DsRed positive enteric neural crest derived cells replicate 1,zebrafish ENCDC replicate 1,SAMD00529466,,sample name:zebrafish ENCDC replicate 1|biological replicate:enteric neural crest derived cells 1|strain:Tgsox10:cre; EF1alpha:loxP gfp loxP dsred,,,,,,,,,NextSeq 550 paired end sequencing of SAMD00529466,DRX393852,190326ENvsNC N704 5day;NeuralCrestDerivedCell;rep1,1,1,,RNA-Seq,TRANSCRIPTOMIC,RANDOM,PAIRED,ILLUMINA,NextSeq 550,1600Application ReadForward11Application ReadReverse81,DRP012042,NextSeq 550 paired end sequencing of SAMD00529466,,,,3582073512.0,23135170.0,DRR408246,0:77.41 1:77.42,A:943152815;C:841972211;G:863627245;T:927361159;N:5960082,77,77,,,943152815,841972211,863627245,927361159,5960082,DRX393852,DRS407177,DRA014886,"NIBB|NIBB core research facilities, National Institute for Basic Biology",University of Hyogo,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,unknown,random_priming,unknown,bulk,unknown,unknown,,Japan,2024-09-22,Undetermined,Larval,Brain,Nervous System
41,DRR408245,DRX393851,DRS407176,DRP012042,PRJDB14275,Zebrafish EN/ENCDC RNA seq,DRP012042,Transcriptome Analysis,A project to find differential expressed genes between enteric neurons ENs and enteric neural crest derived cells ENCDCs in larval zebrafish gut. We dissected guts of transgenic line TgSAGFFLF217B; uas:gfp for ENs and Tgsox10:cre; EF1alpha:loxP gfp loxP dsred for ENCDCs and isolated GFP+ ENs and dsRed+ ENCDCs. Three duplicates for each of ENs and ENCDCs are prepared. Libraries for NGS are prepared using SMART Seq V4 Ultra Low Input RNA Kit.,,,zebrafish 5 day GFP positive enteric neurons replicate 3,zebrafish EN replicate 3,SAMD00529465,,sample name:zebrafish EN replicate 3|biological replicate:eneteric neurons 3|strain:TgSAGFFLF219B; uas:gfp,,,,,,,,,NextSeq 550 paired end sequencing of SAMD00529465,DRX393851,190326ENvsNC N703 5day;EntericNeuron;rep3,1,1,,RNA-Seq,TRANSCRIPTOMIC,RANDOM,PAIRED,ILLUMINA,NextSeq 550,1600Application ReadForward11Application ReadReverse81,DRP012042,NextSeq 550 paired end sequencing of SAMD00529465,,,,3729799291.0,23985772.0,DRR408245,0:77.75 1:77.75,A:978752781;C:879988139;G:903976580;T:962122970;N:4958821,77,77,,,978752781,879988139,903976580,962122970,4958821,DRX393851,DRS407176,DRA014886,"NIBB|NIBB core research facilities, National Institute for Basic Biology",University of Hyogo,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,unknown,random_priming,unknown,bulk,unknown,unknown,,Japan,2024-09-22,Undetermined,Larval,Undetermined,Undetermined
42,DRR408244,DRX393850,DRS407175,DRP012042,PRJDB14275,Zebrafish EN/ENCDC RNA seq,DRP012042,Transcriptome Analysis,A project to find differential expressed genes between enteric neurons ENs and enteric neural crest derived cells ENCDCs in larval zebrafish gut. We dissected guts of transgenic line TgSAGFFLF217B; uas:gfp for ENs and Tgsox10:cre; EF1alpha:loxP gfp loxP dsred for ENCDCs and isolated GFP+ ENs and dsRed+ ENCDCs. Three duplicates for each of ENs and ENCDCs are prepared. Libraries for NGS are prepared using SMART Seq V4 Ultra Low Input RNA Kit.,,,zebrafish 5 day GFP positive enteric neurons replicate 2,zebrafish EN replicate 2,SAMD00529464,,sample name:zebrafish EN replicate 2|biological replicate:eneteric neurons 2|strain:TgSAGFFLF218B; uas:gfp,,,,,,,,,NextSeq 550 paired end sequencing of SAMD00529464,DRX393850,190326ENvsNC N702 5day;EntericNeuron;rep2,1,1,,RNA-Seq,TRANSCRIPTOMIC,RANDOM,PAIRED,ILLUMINA,NextSeq 550,1600Application ReadForward11Application ReadReverse81,DRP012042,NextSeq 550 paired end sequencing of SAMD00529464,,,,3315994810.0,21477755.0,DRR408244,0:77.19 1:77.20,A:873970427;C:778042505;G:798459853;T:859611841;N:5910184,77,77,,,873970427,778042505,798459853,859611841,5910184,DRX393850,DRS407175,DRA014886,"NIBB|NIBB core research facilities, National Institute for Basic Biology",University of Hyogo,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,unknown,random_priming,unknown,bulk,unknown,unknown,,Japan,2024-09-22,Undetermined,Larval,Undetermined,Undetermined
43,DRR408243,DRX393849,DRS407174,DRP012042,PRJDB14275,Zebrafish EN/ENCDC RNA seq,DRP012042,Transcriptome Analysis,A project to find differential expressed genes between enteric neurons ENs and enteric neural crest derived cells ENCDCs in larval zebrafish gut. We dissected guts of transgenic line TgSAGFFLF217B; uas:gfp for ENs and Tgsox10:cre; EF1alpha:loxP gfp loxP dsred for ENCDCs and isolated GFP+ ENs and dsRed+ ENCDCs. Three duplicates for each of ENs and ENCDCs are prepared. Libraries for NGS are prepared using SMART Seq V4 Ultra Low Input RNA Kit.,,,zebrafish 5 day GFP positive enteric neurons replicate 1,zebrafish EN replicate 1,SAMD00529463,,sample name:zebrafish EN replicate 1|biological replicate:eneteric neurons 1|strain:TgSAGFFLF217B; uas:gfp,,,,,,,,,NextSeq 550 paired end sequencing of SAMD00529463,DRX393849,190326ENvsNC N701 5day;EntericNeuron;rep1,1,1,,RNA-Seq,TRANSCRIPTOMIC,RANDOM,PAIRED,ILLUMINA,NextSeq 550,1600Application ReadForward11Application ReadReverse81,DRP012042,NextSeq 550 paired end sequencing of SAMD00529463,,,,2999501518.0,19455440.0,DRR408243,0:77.08 1:77.09,A:788053541;C:705895776;G:724185148;T:775760738;N:5606315,77,77,,,788053541,705895776,724185148,775760738,5606315,DRX393849,DRS407174,DRA014886,"NIBB|NIBB core research facilities, National Institute for Basic Biology",University of Hyogo,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,unknown,random_priming,unknown,bulk,unknown,unknown,,Japan,2024-09-22,Undetermined,Larval,Undetermined,Undetermined
24906,SRR25532497,SRX21261798,SRS18515093,SRP453533,PRJNA1002570,MBT induced effects in zebrafish eyes,PRJNA1002570,Other,We intended to screen the key events in zebrafish larvae post MBT exposure.,,,,,control1,,strain:not collected|isolate:not collected|breed:not collected|cultivar:not collected|ecotype:not collected|age:not collected|dev stage:not collected|collection date:2022 11|geo loc name:China: Beijing|sex:not applicable|tissue:whole body|lat lon:39.9 N 116.42 E|sample type:whole organism|BioSampleModel:Model organism or animal,,,,,,,,,RNAseq of fish,S10,S10,normal RNAseq of fish,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP453533,,,CK1_1.fq.gz CK1_2.fq.gz,fastq fastq,6650697900.0,22168993.0,CK1 1.fq.gz,0:150 1:150,A:1918460669;C:1420936092;G:1412569553;T:1898656995;N:74591,150,150,,,1918460669,1420936092,1412569553,1898656995,74591,SRX21261798,SRS18515093,SRA1687160,Chinese Academy of Sciences|RESEARCH CENTER FOR ECO-ENVIRONMENTAL SCIENCES,Chinese Academy of Sciences,2,0.91765,0.91694,0.15569,0.15461,0.70185,0.7027,0.47761,0.47369,150,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,China,2023-08-05,Undetermined,Larval,Trunk,Surface Structure
24907,SRR25532498,SRX21261797,SRS18515092,SRP453533,PRJNA1002570,MBT induced effects in zebrafish eyes,PRJNA1002570,Other,We intended to screen the key events in zebrafish larvae post MBT exposure.,,,,,MBTH3,,strain:not collected|isolate:not collected|breed:not collected|cultivar:not collected|ecotype:not collected|age:not collected|dev stage:not collected|collection date:2022 11|geo loc name:China: Beijing|sex:not applicable|tissue:whole body|lat lon:39.9 N 116.41 E|sample type:whole organism|BioSampleModel:Model organism or animal,,,,,,,,,RNAseq of fish,S9,S9,normal RNAseq of fish,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP453533,,,MBTH3_2.fq.gz MBTH3_1.fq.gz,fastq fastq,6333332100.0,21111107.0,MBTH3 1.fq.gz,0:150 1:150,A:1755718187;C:1429192980;G:1420776066;T:1727550080;N:94787,150,150,,,1755718187,1429192980,1420776066,1727550080,94787,SRX21261797,SRS18515092,SRA1687160,Chinese Academy of Sciences|RESEARCH CENTER FOR ECO-ENVIRONMENTAL SCIENCES,Chinese Academy of Sciences,2,0.93518,0.93355,0.11668,0.11602,0.67799,0.67817,0.47705,0.47875,150,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,China,2023-08-05,Undetermined,Larval,Trunk,Surface Structure
24908,SRR25532499,SRX21261796,SRS18515091,SRP453533,PRJNA1002570,MBT induced effects in zebrafish eyes,PRJNA1002570,Other,We intended to screen the key events in zebrafish larvae post MBT exposure.,,,,,MBTH2,,strain:not collected|isolate:not collected|breed:not collected|cultivar:not collected|ecotype:not collected|age:not collected|dev stage:not collected|collection date:2022 11|geo loc name:China: Beijing|sex:not applicable|tissue:whole body|lat lon:39.9 N 116.40 E|sample type:whole organism|BioSampleModel:Model organism or animal,,,,,,,,,RNAseq of fish,S8,S8,normal RNAseq of fish,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP453533,,,MBTH2_1.fq.gz MBTH2_2.fq.gz,fastq fastq,6373733400.0,21245778.0,MBTH2 1.fq.gz,0:150 1:150,A:1775132718;C:1430955007;G:1424605018;T:1742942742;N:97915,150,150,,,1775132718,1430955007,1424605018,1742942742,97915,SRX21261796,SRS18515091,SRA1687160,Chinese Academy of Sciences|RESEARCH CENTER FOR ECO-ENVIRONMENTAL SCIENCES,Chinese Academy of Sciences,2,0.93081,0.93016,0.12061,0.11947,0.68215,0.68172,0.47956,0.48186,150,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,China,2023-08-05,Undetermined,Larval,Trunk,Surface Structure
24909,SRR25532500,SRX21261795,SRS18515090,SRP453533,PRJNA1002570,MBT induced effects in zebrafish eyes,PRJNA1002570,Other,We intended to screen the key events in zebrafish larvae post MBT exposure.,,,,,MBTH1,,strain:not collected|isolate:not collected|breed:not collected|cultivar:not collected|ecotype:not collected|age:not collected|dev stage:not collected|collection date:2022 11|geo loc name:China: Beijing|sex:not applicable|tissue:whole body|lat lon:39.9 N 116.39 E|sample type:whole organism|BioSampleModel:Model organism or animal,,,,,,,,,RNAseq of fish,S7,S7,normal RNAseq of fish,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP453533,,,MBTH1_1.fq.gz MBTH1_2.fq.gz,fastq fastq,6224052600.0,20746842.0,MBTH1 1.fq.gz,0:150 1:150,A:1753175301;C:1379045823;G:1371537072;T:1720226102;N:68302,150,150,,,1753175301,1379045823,1371537072,1720226102,68302,SRX21261795,SRS18515090,SRA1687160,Chinese Academy of Sciences|RESEARCH CENTER FOR ECO-ENVIRONMENTAL SCIENCES,Chinese Academy of Sciences,2,0.9276,0.92379,0.13642,0.13482,0.68416,0.68479,0.47638,0.47581,150,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,China,2023-08-05,Undetermined,Larval,Trunk,Surface Structure
24910,SRR25532501,SRX21261794,SRS18515089,SRP453533,PRJNA1002570,MBT induced effects in zebrafish eyes,PRJNA1002570,Other,We intended to screen the key events in zebrafish larvae post MBT exposure.,,,,,MBTM3,,strain:not collected|isolate:not collected|breed:not collected|cultivar:not collected|ecotype:not collected|age:not collected|dev stage:not collected|collection date:2022 11|geo loc name:China: Beijing|sex:not applicable|tissue:whole body|lat lon:39.9 N 116.38 E|sample type:whole organism|BioSampleModel:Model organism or animal,,,,,,,,,RNAseq of fish,S6,S6,normal RNAseq of fish,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP453533,,,MBTM3_2.fq.gz MBTM3_1.fq.gz,fastq fastq,6885667800.0,22952226.0,MBTM3 1.fq.gz,0:150 1:150,A:1936367424;C:1526831248;G:1520656271;T:1901736749;N:76108,150,150,,,1936367424,1526831248,1520656271,1901736749,76108,SRX21261794,SRS18515089,SRA1687160,Chinese Academy of Sciences|RESEARCH CENTER FOR ECO-ENVIRONMENTAL SCIENCES,Chinese Academy of Sciences,2,0.92736,0.92516,0.12801,0.12693,0.68982,0.69063,0.47163,0.4612,150,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,China,2023-08-05,Undetermined,Larval,Trunk,Surface Structure
24911,SRR25532502,SRX21261793,SRS18515088,SRP453533,PRJNA1002570,MBT induced effects in zebrafish eyes,PRJNA1002570,Other,We intended to screen the key events in zebrafish larvae post MBT exposure.,,,,,MBTM2,,strain:not collected|isolate:not collected|breed:not collected|cultivar:not collected|ecotype:not collected|age:not collected|dev stage:not collected|collection date:2022 11|geo loc name:China: Beijing|sex:not applicable|tissue:whole body|lat lon:39.9 N 116.37 E|sample type:whole organism|BioSampleModel:Model organism or animal,,,,,,,,,RNAseq of fish,S5,S5,normal RNAseq of fish,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP453533,,,MBTM2_1.fq.gz MBTM2_2.fq.gz,fastq fastq,6529427400.0,21764758.0,MBTM2 1.fq.gz,0:150 1:150,A:1808908277;C:1472638598;G:1467975655;T:1779801002;N:103868,150,150,,,1808908277,1472638598,1467975655,1779801002,103868,SRX21261793,SRS18515088,SRA1687160,Chinese Academy of Sciences|RESEARCH CENTER FOR ECO-ENVIRONMENTAL SCIENCES,Chinese Academy of Sciences,2,0.9296,0.93217,0.11772,0.11735,0.68262,0.68331,0.4724,0.4721,150,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,China,2023-08-05,Undetermined,Larval,Trunk,Surface Structure
24912,SRR25532503,SRX21261792,SRS18515087,SRP453533,PRJNA1002570,MBT induced effects in zebrafish eyes,PRJNA1002570,Other,We intended to screen the key events in zebrafish larvae post MBT exposure.,,,,,MBTM1,,strain:not collected|isolate:not collected|breed:not collected|cultivar:not collected|ecotype:not collected|age:not collected|dev stage:not collected|collection date:2022 11|geo loc name:China: Beijing|sex:not applicable|tissue:whole body|lat lon:39.9 N 116.36 E|sample type:whole organism|BioSampleModel:Model organism or animal,,,,,,,,,RNAseq of fish,S4,S4,normal RNAseq of fish,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP453533,,,MBTM1_2.fq.gz MBTM1_1.fq.gz,fastq fastq,6733924800.0,22446416.0,MBTM1 1.fq.gz,0:150 1:150,A:1847490053;C:1535661831;G:1528806965;T:1821868439;N:97512,150,150,,,1847490053,1535661831,1528806965,1821868439,97512,SRX21261792,SRS18515087,SRA1687160,Chinese Academy of Sciences|RESEARCH CENTER FOR ECO-ENVIRONMENTAL SCIENCES,Chinese Academy of Sciences,2,0.93177,0.93448,0.11165,0.11192,0.67722,0.67823,0.47325,0.46912,150,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,China,2023-08-05,Undetermined,Larval,Trunk,Surface Structure
24913,SRR25532504,SRX21261791,SRS18515086,SRP453533,PRJNA1002570,MBT induced effects in zebrafish eyes,PRJNA1002570,Other,We intended to screen the key events in zebrafish larvae post MBT exposure.,,,,,MBTL3,,strain:not collected|isolate:not collected|breed:not collected|cultivar:not collected|ecotype:not collected|age:not collected|dev stage:not collected|collection date:2022 11|geo loc name:China: Beijing|sex:not applicable|tissue:whole body|lat lon:39.9 N 116.35 E|sample type:whole organism|BioSampleModel:Model organism or animal,,,,,,,,,RNAseq of fish,S3,S3,normal RNAseq of fish,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP453533,,,MBTL3_1.fq.gz MBTL3_2.fq.gz,fastq fastq,9066238500.0,30220795.0,MBTL3 1.fq.gz,0:150 1:150,A:2629692873;C:1932648084;G:1927694770;T:2576111685;N:91088,150,150,,,2629692873,1932648084,1927694770,2576111685,91088,SRX21261791,SRS18515086,SRA1687160,Chinese Academy of Sciences|RESEARCH CENTER FOR ECO-ENVIRONMENTAL SCIENCES,Chinese Academy of Sciences,2,0.93079,0.91809,0.1476,0.14446,0.69201,0.69258,0.47663,0.47687,150,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,China,2023-08-05,Undetermined,Larval,Trunk,Surface Structure
24914,SRR25532505,SRX21261790,SRS18515085,SRP453533,PRJNA1002570,MBT induced effects in zebrafish eyes,PRJNA1002570,Other,We intended to screen the key events in zebrafish larvae post MBT exposure.,,,,,control3,,strain:not collected|isolate:not collected|breed:not collected|cultivar:not collected|ecotype:not collected|age:not collected|dev stage:not collected|collection date:2022 11|geo loc name:China: Beijing|sex:not applicable|tissue:whole body|lat lon:39.9 N 116.44 E|sample type:whole organism|BioSampleModel:Model organism or animal,,,,,,,,,RNAseq of fish,S12,S12,normal RNAseq of fish,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP453533,,,CK3_1.fq.gz CK3_2.fq.gz,fastq fastq,6596041200.0,21986804.0,CK3 1.fq.gz,0:150 1:150,A:1886076947;C:1431757712;G:1423068767;T:1855067482;N:70292,150,150,,,1886076947,1431757712,1423068767,1855067482,70292,SRX21261790,SRS18515085,SRA1687160,Chinese Academy of Sciences|RESEARCH CENTER FOR ECO-ENVIRONMENTAL SCIENCES,Chinese Academy of Sciences,2,0.92168,0.92147,0.14797,0.14768,0.68962,0.68935,0.47874,0.48307,150,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,China,2023-08-05,Undetermined,Larval,Trunk,Surface Structure
24915,SRR25532506,SRX21261789,SRS18515084,SRP453533,PRJNA1002570,MBT induced effects in zebrafish eyes,PRJNA1002570,Other,We intended to screen the key events in zebrafish larvae post MBT exposure.,,,,,control2,,strain:not collected|isolate:not collected|breed:not collected|cultivar:not collected|ecotype:not collected|age:not collected|dev stage:not collected|collection date:2022 11|geo loc name:China: Beijing|sex:not applicable|tissue:whole body|lat lon:39.9 N 116.43 E|sample type:whole organism|BioSampleModel:Model organism or animal,,,,,,,,,RNAseq of fish,S11,S11,normal RNAseq of fish,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP453533,,,CK2_1.fq.gz CK2_2.fq.gz,fastq fastq,6749651400.0,22498838.0,CK2 1.fq.gz,0:150 1:150,A:1934306700;C:1451979582;G:1445551014;T:1917740723;N:73381,150,150,,,1934306700,1451979582,1445551014,1917740723,73381,SRX21261789,SRS18515084,SRA1687160,Chinese Academy of Sciences|RESEARCH CENTER FOR ECO-ENVIRONMENTAL SCIENCES,Chinese Academy of Sciences,2,0.92261,0.92062,0.15096,0.14969,0.69783,0.69702,0.48303,0.49016,150,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,China,2023-08-05,Undetermined,Larval,Trunk,Surface Structure
24916,SRR25532507,SRX21261788,SRS18515083,SRP453533,PRJNA1002570,MBT induced effects in zebrafish eyes,PRJNA1002570,Other,We intended to screen the key events in zebrafish larvae post MBT exposure.,,,,,MBTL2,,strain:not collected|isolate:not collected|breed:not collected|cultivar:not collected|ecotype:not collected|age:not collected|dev stage:not collected|collection date:2022 11|geo loc name:China: Beijing|sex:not applicable|tissue:whole body|lat lon:39.9 N 116.34 E|sample type:whole organism|BioSampleModel:Model organism or animal,,,,,,,,,RNAseq of fish,S2,S2,normal RNAseq of fish,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP453533,,,MBTL2_1.fq.gz MBTL2_2.fq.gz,fastq fastq,6868354800.0,22894516.0,MBTL2 1.fq.gz,0:150 1:150,A:1956017484;C:1493585329;G:1486220640;T:1932456728;N:74619,150,150,,,1956017484,1493585329,1486220640,1932456728,74619,SRX21261788,SRS18515083,SRA1687160,Chinese Academy of Sciences|RESEARCH CENTER FOR ECO-ENVIRONMENTAL SCIENCES,Chinese Academy of Sciences,2,0.92126,0.91908,0.14701,0.14525,0.69394,0.69363,0.47281,0.47636,150,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,China,2023-08-05,Undetermined,Larval,Trunk,Surface Structure
24917,SRR25532508,SRX21261787,SRS18515082,SRP453533,PRJNA1002570,MBT induced effects in zebrafish eyes,PRJNA1002570,Other,We intended to screen the key events in zebrafish larvae post MBT exposure.,,,,,MBTL1,,strain:not collected|isolate:not collected|breed:not collected|cultivar:not collected|ecotype:not collected|age:not collected|dev stage:not collected|collection date:2022 11|geo loc name:China: Beijing|sex:not applicable|tissue:whole body|lat lon:39.9 N 116.33 E|sample type:whole organism|BioSampleModel:Model organism or animal,,,,,,,,,RNAseq of fish,S1,S1,normal RNAseq of fish,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP453533,,,MBTL1_1.fq.gz MBTL1_2.fq.gz,fastq fastq,6305127900.0,21017093.0,MBTL1 1.fq.gz,0:150 1:150,A:1797030982;C:1364002775;G:1357954929;T:1786051425;N:87789,150,150,,,1797030982,1364002775,1357954929,1786051425,87789,SRX21261787,SRS18515082,SRA1687160,Chinese Academy of Sciences|RESEARCH CENTER FOR ECO-ENVIRONMENTAL SCIENCES,Chinese Academy of Sciences,2,0.92195,0.92138,0.14404,0.1433,0.69656,0.69623,0.47185,0.46936,150,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,China,2023-08-05,Undetermined,Larval,Trunk,Surface Structure
29569,SRR27368685,SRX23045203,SRS20006222,SRP480346,PRJNA1057908,An in vivo repertoire of zebrafish cardiomyocyte specific cis regulatory elements [RNA Seq],GSE252151,Transcriptome Analysis,cis Regulatory elements cREs are essential for the spatio temporal control of gene expression during development and disease. However cRE activity is highly dependent on cell and tissue type. The developing heart is composed of several cell types predominantly cardiomyocytes. Therefore cardiomyocytes specific modelling is required to understand the cis regulation of the developing heart. Zebrafish are an ideal model to study heart development as they share a number of physiological features with the human heart during development. Therefore we present a comprehensive cardiomyocyte specific repertoire of cREs isolated from zebrafish larvae. This data combines live transcriptomics and epigenetic profiling providing insights into cREs and their associated genes involved in heart development. We further perform a transgenic reporter assay for the identified cREs of bmp10 and popdc2 genes validating these genomic regions as cardiac regulatory elements. We share this comprehensive reproducible cardiomyocyte specific cRE resource as an interrogable web tool for understanding the epigenetic and transcriptomic mechanisms underlying heart development and emergence of congenital heart defects. Overall design: Cardiomyocytes were isolated from the Tgmyl7::GFP zebrafish transgenic line. Larvae were collected 72 hpf GFP positive 30 000 cells n=3 biological replicates and GFP negative cells 500 000 cells n=3 biological replicates were collected and RNA sequencing was performed on these samples.,parent bioproject:PRJNA1057890,,,500kGFPneg6 Non cardiomyocytes,GSM7995233,,source name:Heart|tissue:Heart|cell line:Primary cells|cell type:Non cardiomyocytes|genotype:Tgmyl7::GFP|gfp status:GFPneg|treatment:Control|geo loc name:missing|collection date:missing,500kGFPneg6 Non cardiomyocytes,FASTQ files were quality trimmed for overrepresented sequences using Cutadapt version 1.16 Martin 2011. The files were then processed for mapping and obtaining read counts with RNAsik Tsyganov et al 2018 using default parameters. There were two sets of counts obtained the first were the reads mapped to genome Zv9 and the second to genome Zv10. Read counts obtained from mapping to Zv10 were used for RNA seq analysis and visualizations. Read counts obtained from mapping to Zv9 were used for RNA seq analysis to obtain a set of DEGs and were then used to overlap with the genes associated to peaks of the ChIP seq data sets. Assembly: Zv9 Zv10 Supplementary files format and content: txt.gz: compressed tab delimited text files include count values for each sample,Heart,,RNA extraction was performed using the RNEasy Plus Micro Kit Qiagen according to the instructions provided in the manual. Integrity of the extracted RNA was assessed with BioAnalyzer Agilent and the concentration was measured with Qubit Q32866 Qubit™ RNA HS Assay Kit Q32852 ThermoFisher Scientific. RNA libraries were prepared for sequencing using standard Illumina protocols,,tissue:Heart|cell line:Primary cells|cell type:Non cardiomyocytes|genotype:Tgmyl7::GFP|gfp status:GFPneg|treatment:Control,GSM7995233,GSM7995233: 500kGFPneg6 Non cardiomyocytes; Danio rerio; RNA Seq,GSM7995233 r1,GSM7995233,1,RNA extraction was performed using the RNEasy Plus Micro Kit Qiagen according to the instructions provided in the manual. Integrity of the extracted RNA was assessed with BioAnalyzer Agilent and the concentration was measured with Qubit Q32866 Qubit™ RNA HS Assay Kit Q32852 ThermoFisher Scientific. RNA libraries were prepared for sequencing using standard Illumina protocols,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 3000,,SRP480346,,,500kGFPneg6_S42_L008_R1_001.fastq.gz,fastq,527477356.0,10449387.0,GSM7995233 r1,0:50.48,A:141759410;C:113279303;G:116384028;T:155860577;N:194038,50,,,,141759410,113279303,116384028,155860577,194038,SRX23045203,SRS20006222,SRA1776396,"Australian Regenerative Medicine Institute, Monash University","Australian Regenerative Medicine Institute, Monash University",1,0.79175,,0.2711,,0.7587,,0.61924,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Australia,2023-12-27,Undetermined,Larval,Heart,Cardiovascular System
29570,SRR27368686,SRX23045202,SRS20006221,SRP480346,PRJNA1057908,An in vivo repertoire of zebrafish cardiomyocyte specific cis regulatory elements [RNA Seq],GSE252151,Transcriptome Analysis,cis Regulatory elements cREs are essential for the spatio temporal control of gene expression during development and disease. However cRE activity is highly dependent on cell and tissue type. The developing heart is composed of several cell types predominantly cardiomyocytes. Therefore cardiomyocytes specific modelling is required to understand the cis regulation of the developing heart. Zebrafish are an ideal model to study heart development as they share a number of physiological features with the human heart during development. Therefore we present a comprehensive cardiomyocyte specific repertoire of cREs isolated from zebrafish larvae. This data combines live transcriptomics and epigenetic profiling providing insights into cREs and their associated genes involved in heart development. We further perform a transgenic reporter assay for the identified cREs of bmp10 and popdc2 genes validating these genomic regions as cardiac regulatory elements. We share this comprehensive reproducible cardiomyocyte specific cRE resource as an interrogable web tool for understanding the epigenetic and transcriptomic mechanisms underlying heart development and emergence of congenital heart defects. Overall design: Cardiomyocytes were isolated from the Tgmyl7::GFP zebrafish transgenic line. Larvae were collected 72 hpf GFP positive 30 000 cells n=3 biological replicates and GFP negative cells 500 000 cells n=3 biological replicates were collected and RNA sequencing was performed on these samples.,parent bioproject:PRJNA1057890,,,500kGFPneg5 Non cardiomyocytes,GSM7995232,,source name:Heart|tissue:Heart|cell line:Primary cells|cell type:Non cardiomyocytes|genotype:Tgmyl7::GFP|gfp status:GFPneg|treatment:Control|geo loc name:missing|collection date:missing,500kGFPneg5 Non cardiomyocytes,FASTQ files were quality trimmed for overrepresented sequences using Cutadapt version 1.16 Martin 2011. The files were then processed for mapping and obtaining read counts with RNAsik Tsyganov et al 2018 using default parameters. There were two sets of counts obtained the first were the reads mapped to genome Zv9 and the second to genome Zv10. Read counts obtained from mapping to Zv10 were used for RNA seq analysis and visualizations. Read counts obtained from mapping to Zv9 were used for RNA seq analysis to obtain a set of DEGs and were then used to overlap with the genes associated to peaks of the ChIP seq data sets. Assembly: Zv9 Zv10 Supplementary files format and content: txt.gz: compressed tab delimited text files include count values for each sample,Heart,,RNA extraction was performed using the RNEasy Plus Micro Kit Qiagen according to the instructions provided in the manual. Integrity of the extracted RNA was assessed with BioAnalyzer Agilent and the concentration was measured with Qubit Q32866 Qubit™ RNA HS Assay Kit Q32852 ThermoFisher Scientific. RNA libraries were prepared for sequencing using standard Illumina protocols,,tissue:Heart|cell line:Primary cells|cell type:Non cardiomyocytes|genotype:Tgmyl7::GFP|gfp status:GFPneg|treatment:Control,GSM7995232,GSM7995232: 500kGFPneg5 Non cardiomyocytes; Danio rerio; RNA Seq,GSM7995232 r1,GSM7995232,1,RNA extraction was performed using the RNEasy Plus Micro Kit Qiagen according to the instructions provided in the manual. Integrity of the extracted RNA was assessed with BioAnalyzer Agilent and the concentration was measured with Qubit Q32866 Qubit™ RNA HS Assay Kit Q32852 ThermoFisher Scientific. RNA libraries were prepared for sequencing using standard Illumina protocols,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 3000,,SRP480346,,,500kGFPneg5_S41_L008_R1_001.fastq.gz,fastq,3356204764.0,66511806.0,GSM7995232 r1,0:50.46,A:860342578;C:766593257;G:774473426;T:953992775;N:802728,50,,,,860342578,766593257,774473426,953992775,802728,SRX23045202,SRS20006221,SRA1776396,"Australian Regenerative Medicine Institute, Monash University","Australian Regenerative Medicine Institute, Monash University",1,0.70469,,0.23332,,0.76992,,0.62712,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Australia,2023-12-27,Undetermined,Larval,Heart,Cardiovascular System
29571,SRR27368687,SRX23045201,SRS20006220,SRP480346,PRJNA1057908,An in vivo repertoire of zebrafish cardiomyocyte specific cis regulatory elements [RNA Seq],GSE252151,Transcriptome Analysis,cis Regulatory elements cREs are essential for the spatio temporal control of gene expression during development and disease. However cRE activity is highly dependent on cell and tissue type. The developing heart is composed of several cell types predominantly cardiomyocytes. Therefore cardiomyocytes specific modelling is required to understand the cis regulation of the developing heart. Zebrafish are an ideal model to study heart development as they share a number of physiological features with the human heart during development. Therefore we present a comprehensive cardiomyocyte specific repertoire of cREs isolated from zebrafish larvae. This data combines live transcriptomics and epigenetic profiling providing insights into cREs and their associated genes involved in heart development. We further perform a transgenic reporter assay for the identified cREs of bmp10 and popdc2 genes validating these genomic regions as cardiac regulatory elements. We share this comprehensive reproducible cardiomyocyte specific cRE resource as an interrogable web tool for understanding the epigenetic and transcriptomic mechanisms underlying heart development and emergence of congenital heart defects. Overall design: Cardiomyocytes were isolated from the Tgmyl7::GFP zebrafish transgenic line. Larvae were collected 72 hpf GFP positive 30 000 cells n=3 biological replicates and GFP negative cells 500 000 cells n=3 biological replicates were collected and RNA sequencing was performed on these samples.,parent bioproject:PRJNA1057890,,,500kGFPneg4 Non cardiomyocytes,GSM7995231,,source name:Heart|tissue:Heart|cell line:Primary cells|cell type:Non cardiomyocytes|genotype:Tgmyl7::GFP|gfp status:GFPneg|treatment:Control|geo loc name:missing|collection date:missing,500kGFPneg4 Non cardiomyocytes,FASTQ files were quality trimmed for overrepresented sequences using Cutadapt version 1.16 Martin 2011. The files were then processed for mapping and obtaining read counts with RNAsik Tsyganov et al 2018 using default parameters. There were two sets of counts obtained the first were the reads mapped to genome Zv9 and the second to genome Zv10. Read counts obtained from mapping to Zv10 were used for RNA seq analysis and visualizations. Read counts obtained from mapping to Zv9 were used for RNA seq analysis to obtain a set of DEGs and were then used to overlap with the genes associated to peaks of the ChIP seq data sets. Assembly: Zv9 Zv10 Supplementary files format and content: txt.gz: compressed tab delimited text files include count values for each sample,Heart,,RNA extraction was performed using the RNEasy Plus Micro Kit Qiagen according to the instructions provided in the manual. Integrity of the extracted RNA was assessed with BioAnalyzer Agilent and the concentration was measured with Qubit Q32866 Qubit™ RNA HS Assay Kit Q32852 ThermoFisher Scientific. RNA libraries were prepared for sequencing using standard Illumina protocols,,tissue:Heart|cell line:Primary cells|cell type:Non cardiomyocytes|genotype:Tgmyl7::GFP|gfp status:GFPneg|treatment:Control,GSM7995231,GSM7995231: 500kGFPneg4 Non cardiomyocytes; Danio rerio; RNA Seq,GSM7995231 r1,GSM7995231,1,RNA extraction was performed using the RNEasy Plus Micro Kit Qiagen according to the instructions provided in the manual. Integrity of the extracted RNA was assessed with BioAnalyzer Agilent and the concentration was measured with Qubit Q32866 Qubit™ RNA HS Assay Kit Q32852 ThermoFisher Scientific. RNA libraries were prepared for sequencing using standard Illumina protocols,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 3000,,SRP480346,,,500kGFPneg4_S40_L008_R1_001.fastq.gz,fastq,3075367681.0,60986692.0,GSM7995231 r1,0:50.43,A:807059039;C:682279458;G:696326840;T:888937765;N:764579,50,,,,807059039,682279458,696326840,888937765,764579,SRX23045201,SRS20006220,SRA1776396,"Australian Regenerative Medicine Institute, Monash University","Australian Regenerative Medicine Institute, Monash University",1,0.74255,,0.26699,,0.76786,,0.63053,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Australia,2023-12-27,Undetermined,Larval,Heart,Cardiovascular System
29572,SRR27368688,SRX23045200,SRS20006219,SRP480346,PRJNA1057908,An in vivo repertoire of zebrafish cardiomyocyte specific cis regulatory elements [RNA Seq],GSE252151,Transcriptome Analysis,cis Regulatory elements cREs are essential for the spatio temporal control of gene expression during development and disease. However cRE activity is highly dependent on cell and tissue type. The developing heart is composed of several cell types predominantly cardiomyocytes. Therefore cardiomyocytes specific modelling is required to understand the cis regulation of the developing heart. Zebrafish are an ideal model to study heart development as they share a number of physiological features with the human heart during development. Therefore we present a comprehensive cardiomyocyte specific repertoire of cREs isolated from zebrafish larvae. This data combines live transcriptomics and epigenetic profiling providing insights into cREs and their associated genes involved in heart development. We further perform a transgenic reporter assay for the identified cREs of bmp10 and popdc2 genes validating these genomic regions as cardiac regulatory elements. We share this comprehensive reproducible cardiomyocyte specific cRE resource as an interrogable web tool for understanding the epigenetic and transcriptomic mechanisms underlying heart development and emergence of congenital heart defects. Overall design: Cardiomyocytes were isolated from the Tgmyl7::GFP zebrafish transgenic line. Larvae were collected 72 hpf GFP positive 30 000 cells n=3 biological replicates and GFP negative cells 500 000 cells n=3 biological replicates were collected and RNA sequencing was performed on these samples.,parent bioproject:PRJNA1057890,,,30kGFPpos3 Cardiomyocytes,GSM7995230,,source name:Heart|tissue:Heart|cell line:Primary cells|cell type:Cardiomyocytes|genotype:Tgmyl7::GFP|gfp status:GFPpos|treatment:Control|geo loc name:missing|collection date:missing,30kGFPpos3 Cardiomyocytes,FASTQ files were quality trimmed for overrepresented sequences using Cutadapt version 1.16 Martin 2011. The files were then processed for mapping and obtaining read counts with RNAsik Tsyganov et al 2018 using default parameters. There were two sets of counts obtained the first were the reads mapped to genome Zv9 and the second to genome Zv10. Read counts obtained from mapping to Zv10 were used for RNA seq analysis and visualizations. Read counts obtained from mapping to Zv9 were used for RNA seq analysis to obtain a set of DEGs and were then used to overlap with the genes associated to peaks of the ChIP seq data sets. Assembly: Zv9 Zv10 Supplementary files format and content: txt.gz: compressed tab delimited text files include count values for each sample,Heart,,RNA extraction was performed using the RNEasy Plus Micro Kit Qiagen according to the instructions provided in the manual. Integrity of the extracted RNA was assessed with BioAnalyzer Agilent and the concentration was measured with Qubit Q32866 Qubit™ RNA HS Assay Kit Q32852 ThermoFisher Scientific. RNA libraries were prepared for sequencing using standard Illumina protocols,,tissue:Heart|cell line:Primary cells|cell type:Cardiomyocytes|genotype:Tgmyl7::GFP|gfp status:GFPpos|treatment:Control,GSM7995230,GSM7995230: 30kGFPpos3 Cardiomyocytes; Danio rerio; RNA Seq,GSM7995230 r1,GSM7995230,1,RNA extraction was performed using the RNEasy Plus Micro Kit Qiagen according to the instructions provided in the manual. Integrity of the extracted RNA was assessed with BioAnalyzer Agilent and the concentration was measured with Qubit Q32866 Qubit™ RNA HS Assay Kit Q32852 ThermoFisher Scientific. RNA libraries were prepared for sequencing using standard Illumina protocols,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 3000,,SRP480346,,,30kGFPpos3_S39_L008_R1_001.fastq.gz,fastq,2938808771.0,58361915.0,GSM7995230 r1,0:50.35,A:533261626;C:883704329;G:825929620;T:694986734;N:926462,50,,,,533261626,883704329,825929620,694986734,926462,SRX23045200,SRS20006219,SRA1776396,"Australian Regenerative Medicine Institute, Monash University","Australian Regenerative Medicine Institute, Monash University",1,0.12924,,0.05415,,0.92034,,0.70896,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Australia,2023-12-27,Undetermined,Larval,Heart,Cardiovascular System
29573,SRR27368689,SRX23045199,SRS20006218,SRP480346,PRJNA1057908,An in vivo repertoire of zebrafish cardiomyocyte specific cis regulatory elements [RNA Seq],GSE252151,Transcriptome Analysis,cis Regulatory elements cREs are essential for the spatio temporal control of gene expression during development and disease. However cRE activity is highly dependent on cell and tissue type. The developing heart is composed of several cell types predominantly cardiomyocytes. Therefore cardiomyocytes specific modelling is required to understand the cis regulation of the developing heart. Zebrafish are an ideal model to study heart development as they share a number of physiological features with the human heart during development. Therefore we present a comprehensive cardiomyocyte specific repertoire of cREs isolated from zebrafish larvae. This data combines live transcriptomics and epigenetic profiling providing insights into cREs and their associated genes involved in heart development. We further perform a transgenic reporter assay for the identified cREs of bmp10 and popdc2 genes validating these genomic regions as cardiac regulatory elements. We share this comprehensive reproducible cardiomyocyte specific cRE resource as an interrogable web tool for understanding the epigenetic and transcriptomic mechanisms underlying heart development and emergence of congenital heart defects. Overall design: Cardiomyocytes were isolated from the Tgmyl7::GFP zebrafish transgenic line. Larvae were collected 72 hpf GFP positive 30 000 cells n=3 biological replicates and GFP negative cells 500 000 cells n=3 biological replicates were collected and RNA sequencing was performed on these samples.,parent bioproject:PRJNA1057890,,,30kGFPpos2 Cardiomyocytes,GSM7995229,,source name:Heart|tissue:Heart|cell line:Primary cells|cell type:Cardiomyocytes|genotype:Tgmyl7::GFP|gfp status:GFPpos|treatment:Control|geo loc name:missing|collection date:missing,30kGFPpos2 Cardiomyocytes,FASTQ files were quality trimmed for overrepresented sequences using Cutadapt version 1.16 Martin 2011. The files were then processed for mapping and obtaining read counts with RNAsik Tsyganov et al 2018 using default parameters. There were two sets of counts obtained the first were the reads mapped to genome Zv9 and the second to genome Zv10. Read counts obtained from mapping to Zv10 were used for RNA seq analysis and visualizations. Read counts obtained from mapping to Zv9 were used for RNA seq analysis to obtain a set of DEGs and were then used to overlap with the genes associated to peaks of the ChIP seq data sets. Assembly: Zv9 Zv10 Supplementary files format and content: txt.gz: compressed tab delimited text files include count values for each sample,Heart,,RNA extraction was performed using the RNEasy Plus Micro Kit Qiagen according to the instructions provided in the manual. Integrity of the extracted RNA was assessed with BioAnalyzer Agilent and the concentration was measured with Qubit Q32866 Qubit™ RNA HS Assay Kit Q32852 ThermoFisher Scientific. RNA libraries were prepared for sequencing using standard Illumina protocols,,tissue:Heart|cell line:Primary cells|cell type:Cardiomyocytes|genotype:Tgmyl7::GFP|gfp status:GFPpos|treatment:Control,GSM7995229,GSM7995229: 30kGFPpos2 Cardiomyocytes; Danio rerio; RNA Seq,GSM7995229 r1,GSM7995229,1,RNA extraction was performed using the RNEasy Plus Micro Kit Qiagen according to the instructions provided in the manual. Integrity of the extracted RNA was assessed with BioAnalyzer Agilent and the concentration was measured with Qubit Q32866 Qubit™ RNA HS Assay Kit Q32852 ThermoFisher Scientific. RNA libraries were prepared for sequencing using standard Illumina protocols,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 3000,,SRP480346,,,30kGFPpos2_S38_L008_R1_001.fastq.gz,fastq,3006409096.0,59645543.0,GSM7995229 r1,0:50.40,A:560839480;C:885691877;G:830121593;T:728932219;N:823927,50,,,,560839480,885691877,830121593,728932219,823927,SRX23045199,SRS20006218,SRA1776396,"Australian Regenerative Medicine Institute, Monash University","Australian Regenerative Medicine Institute, Monash University",1,0.17805,,0.06115,,0.89769,,0.68731,,49,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Australia,2023-12-27,Undetermined,Larval,Heart,Cardiovascular System
29574,SRR27368690,SRX23045198,SRS20006217,SRP480346,PRJNA1057908,An in vivo repertoire of zebrafish cardiomyocyte specific cis regulatory elements [RNA Seq],GSE252151,Transcriptome Analysis,cis Regulatory elements cREs are essential for the spatio temporal control of gene expression during development and disease. However cRE activity is highly dependent on cell and tissue type. The developing heart is composed of several cell types predominantly cardiomyocytes. Therefore cardiomyocytes specific modelling is required to understand the cis regulation of the developing heart. Zebrafish are an ideal model to study heart development as they share a number of physiological features with the human heart during development. Therefore we present a comprehensive cardiomyocyte specific repertoire of cREs isolated from zebrafish larvae. This data combines live transcriptomics and epigenetic profiling providing insights into cREs and their associated genes involved in heart development. We further perform a transgenic reporter assay for the identified cREs of bmp10 and popdc2 genes validating these genomic regions as cardiac regulatory elements. We share this comprehensive reproducible cardiomyocyte specific cRE resource as an interrogable web tool for understanding the epigenetic and transcriptomic mechanisms underlying heart development and emergence of congenital heart defects. Overall design: Cardiomyocytes were isolated from the Tgmyl7::GFP zebrafish transgenic line. Larvae were collected 72 hpf GFP positive 30 000 cells n=3 biological replicates and GFP negative cells 500 000 cells n=3 biological replicates were collected and RNA sequencing was performed on these samples.,parent bioproject:PRJNA1057890,,,30kGFPpos1 Cardiomyocytes,GSM7995228,,source name:Heart|tissue:Heart|cell line:Primary cells|cell type:Cardiomyocytes|genotype:Tgmyl7::GFP|gfp status:GFPpos|treatment:Control|geo loc name:missing|collection date:missing,30kGFPpos1 Cardiomyocytes,FASTQ files were quality trimmed for overrepresented sequences using Cutadapt version 1.16 Martin 2011. The files were then processed for mapping and obtaining read counts with RNAsik Tsyganov et al 2018 using default parameters. There were two sets of counts obtained the first were the reads mapped to genome Zv9 and the second to genome Zv10. Read counts obtained from mapping to Zv10 were used for RNA seq analysis and visualizations. Read counts obtained from mapping to Zv9 were used for RNA seq analysis to obtain a set of DEGs and were then used to overlap with the genes associated to peaks of the ChIP seq data sets. Assembly: Zv9 Zv10 Supplementary files format and content: txt.gz: compressed tab delimited text files include count values for each sample,Heart,,RNA extraction was performed using the RNEasy Plus Micro Kit Qiagen according to the instructions provided in the manual. Integrity of the extracted RNA was assessed with BioAnalyzer Agilent and the concentration was measured with Qubit Q32866 Qubit™ RNA HS Assay Kit Q32852 ThermoFisher Scientific. RNA libraries were prepared for sequencing using standard Illumina protocols,,tissue:Heart|cell line:Primary cells|cell type:Cardiomyocytes|genotype:Tgmyl7::GFP|gfp status:GFPpos|treatment:Control,GSM7995228,GSM7995228: 30kGFPpos1 Cardiomyocytes; Danio rerio; RNA Seq,GSM7995228 r1,GSM7995228,1,RNA extraction was performed using the RNEasy Plus Micro Kit Qiagen according to the instructions provided in the manual. Integrity of the extracted RNA was assessed with BioAnalyzer Agilent and the concentration was measured with Qubit Q32866 Qubit™ RNA HS Assay Kit Q32852 ThermoFisher Scientific. RNA libraries were prepared for sequencing using standard Illumina protocols,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 3000,,SRP480346,,,30kGFPpos1_S37_L008_R1_001.fastq.gz,fastq,3254639839.0,64665631.0,GSM7995228 r1,0:50.33,A:545193535;C:1023804678;G:938318027;T:746302007;N:1021592,50,,,,545193535,1023804678,938318027,746302007,1021592,SRX23045198,SRS20006217,SRA1776396,"Australian Regenerative Medicine Institute, Monash University","Australian Regenerative Medicine Institute, Monash University",1,0.05453,,0.01921,,0.9643,,0.78064,,49,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Australia,2023-12-27,Undetermined,Larval,Heart,Cardiovascular System
30776,SRR28359146,SRX23964396,SRS20764037,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 E22,GSM8150156,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 E22,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150156,GSM8150156: CSN48 1 03 E22; Danio rerio; RNA Seq,GSM8150156 r1,GSM8150156,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53728_Track-95571_R1.fastq.gz L53728_Track-95571_R2.fastq.gz,fastq fastq,104878542.0,1028221.0,GSM8150156 r1,0:51 1:51,A:28863138;C:21525262;G:22453118;T:32031599;N:5425,51,51,,,28863138,21525262,22453118,32031599,5425,SRX23964396,SRS20764037,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.77262,0.78585,0.0988,0.10576,0.98981,0.98969,0.68036,0.67233,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30777,SRR28359147,SRX23964395,SRS20764036,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 E21,GSM8150155,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 E21,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150155,GSM8150155: CSN48 1 03 E21; Danio rerio; RNA Seq,GSM8150155 r1,GSM8150155,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53727_Track-95291_R1.fastq.gz L53727_Track-95291_R2.fastq.gz,fastq fastq,121185282.0,1188091.0,GSM8150155 r1,0:51 1:51,A:33696023;C:24967708;G:26140769;T:36374401;N:6381,51,51,,,33696023,24967708,26140769,36374401,6381,SRX23964395,SRS20764036,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.81964,0.8273,0.07915,0.08503,0.98072,0.98082,0.5136,0.50712,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30778,SRR28359148,SRX23964394,SRS20764035,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 E20,GSM8150154,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 E20,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150154,GSM8150154: CSN48 1 03 E20; Danio rerio; RNA Seq,GSM8150154 r1,GSM8150154,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53726_Track-95418_R1.fastq.gz L53726_Track-95418_R2.fastq.gz,fastq fastq,72575040.0,711520.0,GSM8150154 r1,0:51 1:51,A:20943429;C:14224819;G:14955120;T:22447601;N:4071,51,51,,,20943429,14224819,14955120,22447601,4071,SRX23964394,SRS20764035,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.82387,0.83093,0.08054,0.08675,0.98687,0.98721,0.5993,0.61815,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30779,SRR28359149,SRX23964393,SRS20764034,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 E19,GSM8150153,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 E19,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150153,GSM8150153: CSN48 1 03 E19; Danio rerio; RNA Seq,GSM8150153 r1,GSM8150153,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53725_Track-95634_R1.fastq.gz L53725_Track-95634_R2.fastq.gz,fastq fastq,80873046.0,792873.0,GSM8150153 r1,0:51 1:51,A:23739380;C:13085794;G:15017775;T:29025944;N:4153,51,51,,,23739380,13085794,15017775,29025944,4153,SRX23964393,SRS20764034,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.05147,0.14716,0.0371,0.1306,0.98806,0.98833,0.56028,0.59733,51,51,B,B,mate1-mate2 similar by mapping diff,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30780,SRR28359150,SRX23964392,SRS20764033,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 E18,GSM8150152,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 E18,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150152,GSM8150152: CSN48 1 03 E18; Danio rerio; RNA Seq,GSM8150152 r1,GSM8150152,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53724_Track-95288_R2.fastq.gz L53724_Track-95288_R1.fastq.gz,fastq fastq,70936512.0,695456.0,GSM8150152 r1,0:51 1:51,A:19357090;C:14845900;G:15470063;T:21259791;N:3668,51,51,,,19357090,14845900,15470063,21259791,3668,SRX23964392,SRS20764033,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.7423,0.75148,0.09603,0.10377,0.99066,0.99062,0.56913,0.56951,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30781,SRR28359151,SRX23964391,SRS20764032,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 E17,GSM8150151,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 E17,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150151,GSM8150151: CSN48 1 03 E17; Danio rerio; RNA Seq,GSM8150151 r1,GSM8150151,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53723_Track-95437_R1.fastq.gz L53723_Track-95437_R2.fastq.gz,fastq fastq,55774620.0,546810.0,GSM8150151 r1,0:51 1:51,A:15911187;C:11099571;G:11653395;T:17107731;N:2736,51,51,,,15911187,11099571,11653395,17107731,2736,SRX23964391,SRS20764032,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.78444,0.80042,0.1432,0.15501,0.98204,0.98218,0.51608,0.51677,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30782,SRR28359152,SRX23964390,SRS20764030,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 E16,GSM8150150,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 E16,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150150,GSM8150150: CSN48 1 03 E16; Danio rerio; RNA Seq,GSM8150150 r1,GSM8150150,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53722_Track-95347_R1.fastq.gz L53722_Track-95347_R2.fastq.gz,fastq fastq,76449000.0,749500.0,GSM8150150 r1,0:51 1:51,A:22809962;C:14680254;G:15102439;T:23852396;N:3949,51,51,,,22809962,14680254,15102439,23852396,3949,SRX23964390,SRS20764030,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.86893,0.87396,0.03149,0.03559,0.99212,0.99198,0.98514,0.97868,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30783,SRR28359153,SRX23964389,SRS20764029,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 E15,GSM8150149,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 E15,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150149,GSM8150149: CSN48 1 03 E15; Danio rerio; RNA Seq,GSM8150149 r1,GSM8150149,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53721_Track-95493_R1.fastq.gz L53721_Track-95493_R2.fastq.gz,fastq fastq,99461424.0,975112.0,GSM8150149 r1,0:51 1:51,A:27045437;C:21070936;G:21587770;T:29752188;N:5093,51,51,,,27045437,21070936,21587770,29752188,5093,SRX23964389,SRS20764029,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.76782,0.77265,0.08688,0.09118,0.98681,0.98664,0.63246,0.63378,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30784,SRR28359154,SRX23964388,SRS20764031,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 D14,GSM8150124,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 D14,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150124,GSM8150124: CSN48 1 03 D14; Danio rerio; RNA Seq,GSM8150124 r1,GSM8150124,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53696_Track-95353_R1.fastq.gz L53696_Track-95353_R2.fastq.gz,fastq fastq,69766878.0,683989.0,GSM8150124 r1,0:51 1:51,A:20239008;C:13266241;G:14104575;T:22153275;N:3779,51,51,,,20239008,13266241,14104575,22153275,3779,SRX23964388,SRS20764031,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.78176,0.78796,0.18103,0.1874,0.98186,0.9821,0.67624,0.66145,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30785,SRR28359155,SRX23964387,SRS20764027,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 D13,GSM8150123,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 D13,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150123,GSM8150123: CSN48 1 03 D13; Danio rerio; RNA Seq,GSM8150123 r1,GSM8150123,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53695_Track-95522_R1.fastq.gz L53695_Track-95522_R2.fastq.gz,fastq fastq,91446672.0,896536.0,GSM8150123 r1,0:51 1:51,A:26181544;C:17663296;G:18796711;T:28800124;N:4997,51,51,,,26181544,17663296,18796711,28800124,4997,SRX23964387,SRS20764027,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.78134,0.7878,0.12516,0.13008,0.98644,0.9865,0.71837,0.72978,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30786,SRR28359156,SRX23964386,SRS20764028,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 D12,GSM8150122,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 D12,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150122,GSM8150122: CSN48 1 03 D12; Danio rerio; RNA Seq,GSM8150122 r1,GSM8150122,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53694_Track-95365_R1.fastq.gz L53694_Track-95365_R2.fastq.gz,fastq fastq,69981894.0,686097.0,GSM8150122 r1,0:51 1:51,A:19839934;C:13755443;G:14688765;T:21694242;N:3510,51,51,,,19839934,13755443,14688765,21694242,3510,SRX23964386,SRS20764028,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.78924,0.79909,0.08205,0.08909,0.9847,0.98445,0.58412,0.58962,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30787,SRR28359157,SRX23964385,SRS20764026,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 D11,GSM8150121,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 D11,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150121,GSM8150121: CSN48 1 03 D11; Danio rerio; RNA Seq,GSM8150121 r1,GSM8150121,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53693_Track-95450_R1.fastq.gz L53693_Track-95450_R2.fastq.gz,fastq fastq,69573792.0,682096.0,GSM8150121 r1,0:51 1:51,A:19025628;C:14356513;G:14950413;T:21237487;N:3751,51,51,,,19025628,14356513,14950413,21237487,3751,SRX23964385,SRS20764026,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.75688,0.77057,0.12799,0.13935,0.98652,0.98636,0.64152,0.63755,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30788,SRR28359158,SRX23964384,SRS20764025,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 D10,GSM8150120,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 D10,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150120,GSM8150120: CSN48 1 03 D10; Danio rerio; RNA Seq,GSM8150120 r1,GSM8150120,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53692_Track-95404_R1.fastq.gz L53692_Track-95404_R2.fastq.gz,fastq fastq,71057382.0,696641.0,GSM8150120 r1,0:51 1:51,A:19447181;C:14614798;G:15443597;T:21548130;N:3676,51,51,,,19447181,14614798,15443597,21548130,3676,SRX23964384,SRS20764025,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.75621,0.77479,0.0847,0.09971,0.9881,0.98841,0.64117,0.6427,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30789,SRR28359159,SRX23964383,SRS20764024,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 D09,GSM8150119,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 D09,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150119,GSM8150119: CSN48 1 03 D09; Danio rerio; RNA Seq,GSM8150119 r1,GSM8150119,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53691_Track-95318_R1.fastq.gz L53691_Track-95318_R2.fastq.gz,fastq fastq,89856084.0,880942.0,GSM8150119 r1,0:51 1:51,A:24229021;C:19039299;G:19705052;T:26877901;N:4811,51,51,,,24229021,19039299,19705052,26877901,4811,SRX23964383,SRS20764024,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.73565,0.74513,0.08918,0.09582,0.98882,0.98875,0.63639,0.63689,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30790,SRR28359160,SRX23964382,SRS20764023,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 D08,GSM8150118,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 D08,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150118,GSM8150118: CSN48 1 03 D08; Danio rerio; RNA Seq,GSM8150118 r1,GSM8150118,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53690_Track-95414_R1.fastq.gz L53690_Track-95414_R2.fastq.gz,fastq fastq,51053856.0,500528.0,GSM8150118 r1,0:51 1:51,A:14497740;C:9903942;G:10595509;T:16053978;N:2687,51,51,,,14497740,9903942,10595509,16053978,2687,SRX23964382,SRS20764023,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.76986,0.77936,0.11864,0.12512,0.97264,0.97268,0.5459,0.55357,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30791,SRR28359161,SRX23964381,SRS20764022,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 D07,GSM8150117,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 D07,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150117,GSM8150117: CSN48 1 03 D07; Danio rerio; RNA Seq,GSM8150117 r1,GSM8150117,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53689_Track-95464_R1.fastq.gz L53689_Track-95464_R2.fastq.gz,fastq fastq,97634706.0,957203.0,GSM8150117 r1,0:51 1:51,A:27221899;C:20175184;G:21078138;T:29154379;N:5106,51,51,,,27221899,20175184,21078138,29154379,5106,SRX23964381,SRS20764022,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.81639,0.82226,0.09416,0.09868,0.98492,0.98506,0.71814,0.67945,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30792,SRR28359162,SRX23964380,SRS20764021,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 C22,GSM8150108,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 C22,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150108,GSM8150108: CSN48 1 03 C22; Danio rerio; RNA Seq,GSM8150108 r1,GSM8150108,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53680_Track-95514_R1.fastq.gz L53680_Track-95514_R2.fastq.gz,fastq fastq,85898790.0,842145.0,GSM8150108 r1,0:51 1:51,A:25113234;C:15409408;G:16800656;T:28570810;N:4682,51,51,,,25113234,15409408,16800656,28570810,4682,SRX23964380,SRS20764021,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.73097,0.73915,0.16293,0.16856,0.97788,0.97757,0.69417,0.68758,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30793,SRR28359163,SRX23964379,SRS20764020,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 C21,GSM8150107,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 C21,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150107,GSM8150107: CSN48 1 03 C21; Danio rerio; RNA Seq,GSM8150107 r1,GSM8150107,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53679_Track-95616_R1.fastq.gz L53679_Track-95616_R2.fastq.gz,fastq fastq,171200064.0,1678432.0,GSM8150107 r1,0:51 1:51,A:48056238;C:34021609;G:36283975;T:52829024;N:9218,51,51,,,48056238,34021609,36283975,52829024,9218,SRX23964379,SRS20764020,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.74103,0.76548,0.09277,0.10863,0.98545,0.9853,0.58617,0.58598,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30794,SRR28359164,SRX23964378,SRS20764019,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 C20,GSM8150106,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 C20,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150106,GSM8150106: CSN48 1 03 C20; Danio rerio; RNA Seq,GSM8150106 r1,GSM8150106,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53678_Track-95480_R1.fastq.gz L53678_Track-95480_R2.fastq.gz,fastq fastq,67253088.0,659344.0,GSM8150106 r1,0:51 1:51,A:19337100;C:12492945;G:13534630;T:21884840;N:3573,51,51,,,19337100,12492945,13534630,21884840,3573,SRX23964378,SRS20764019,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.72673,0.73997,0.10543,0.11545,0.98096,0.98039,0.64224,0.61696,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30795,SRR28359165,SRX23964377,SRS20764018,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 C19,GSM8150105,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 C19,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150105,GSM8150105: CSN48 1 03 C19; Danio rerio; RNA Seq,GSM8150105 r1,GSM8150105,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53677_Track-95374_R1.fastq.gz L53677_Track-95374_R2.fastq.gz,fastq fastq,73674396.0,722298.0,GSM8150105 r1,0:51 1:51,A:19978507;C:15426475;G:17689441;T:20576082;N:3891,51,51,,,19978507,15426475,17689441,20576082,3891,SRX23964377,SRS20764018,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.77752,0.77935,0.02812,0.0303,0.97321,0.97333,0.1899,0.18724,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30796,SRR28359166,SRX23964376,SRS20764017,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 C18,GSM8150104,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 C18,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150104,GSM8150104: CSN48 1 03 C18; Danio rerio; RNA Seq,GSM8150104 r1,GSM8150104,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53676_Track-95642_R1.fastq.gz L53676_Track-95642_R2.fastq.gz,fastq fastq,215575572.0,2113486.0,GSM8150104 r1,0:51 1:51,A:62335546;C:39531343;G:42959177;T:70737929;N:11577,51,51,,,62335546,39531343,42959177,70737929,11577,SRX23964376,SRS20764017,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.62757,0.65364,0.15539,0.17268,0.99446,0.99439,0.50474,0.50773,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30797,SRR28359167,SRX23964375,SRS20764016,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 C17,GSM8150103,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 C17,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150103,GSM8150103: CSN48 1 03 C17; Danio rerio; RNA Seq,GSM8150103 r1,GSM8150103,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53675_Track-95562_R1.fastq.gz L53675_Track-95562_R2.fastq.gz,fastq fastq,84986298.0,833199.0,GSM8150103 r1,0:51 1:51,A:23272888;C:17266049;G:18271557;T:26171384;N:4420,51,51,,,23272888,17266049,18271557,26171384,4420,SRX23964375,SRS20764016,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.72053,0.73608,0.07211,0.08237,0.98786,0.98827,0.59708,0.59102,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30798,SRR28359168,SRX23964374,SRS20764015,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 C16,GSM8150102,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 C16,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150102,GSM8150102: CSN48 1 03 C16; Danio rerio; RNA Seq,GSM8150102 r1,GSM8150102,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53674_Track-95440_R1.fastq.gz L53674_Track-95440_R2.fastq.gz,fastq fastq,54376302.0,533101.0,GSM8150102 r1,0:51 1:51,A:15467523;C:10868690;G:11508252;T:16529091;N:2746,51,51,,,15467523,10868690,11508252,16529091,2746,SRX23964374,SRS20764015,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.79732,0.80686,0.11376,0.1223,0.98088,0.98133,0.50056,0.50786,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30799,SRR28359169,SRX23964373,SRS20764014,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 C15,GSM8150101,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 C15,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150101,GSM8150101: CSN48 1 03 C15; Danio rerio; RNA Seq,GSM8150101 r1,GSM8150101,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53673_Track-95645_R1.fastq.gz L53673_Track-95645_R2.fastq.gz,fastq fastq,49047108.0,480854.0,GSM8150101 r1,0:51 1:51,A:14358922;C:7821096;G:9574290;T:17290303;N:2497,51,51,,,14358922,7821096,9574290,17290303,2497,SRX23964373,SRS20764014,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.07332,0.18211,0.06412,0.1716,0.98752,0.9878,0.60524,0.60709,51,51,B,B,mate1-mate2 similar by mapping diff,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30800,SRR28359170,SRX23964372,SRS20764012,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 C06,GSM8150092,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 C06,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150092,GSM8150092: CSN48 1 03 C06; Danio rerio; RNA Seq,GSM8150092 r1,GSM8150092,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53664_Track-95589_R1.fastq.gz L53664_Track-95589_R2.fastq.gz,fastq fastq,121511172.0,1191286.0,GSM8150092 r1,0:51 1:51,A:33322240;C:24518333;G:25957434;T:37706758;N:6407,51,51,,,33322240,24518333,25957434,37706758,6407,SRX23964372,SRS20764012,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.71937,0.73419,0.0931,0.10476,0.99145,0.99155,0.70144,0.71082,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30801,SRR28359171,SRX23964371,SRS20764011,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 C05,GSM8150091,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 C05,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150091,GSM8150091: CSN48 1 03 C05; Danio rerio; RNA Seq,GSM8150091 r1,GSM8150091,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53663_Track-95466_R1.fastq.gz L53663_Track-95466_R2.fastq.gz,fastq fastq,52394136.0,513668.0,GSM8150091 r1,0:51 1:51,A:14630212;C:10551053;G:11807354;T:15402620;N:2897,51,51,,,14630212,10551053,11807354,15402620,2897,SRX23964371,SRS20764011,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.76894,0.77786,0.06069,0.06658,0.98242,0.98275,0.2236,0.17186,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30802,SRR28359172,SRX23964370,SRS20764013,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 C04,GSM8150090,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 C04,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150090,GSM8150090: CSN48 1 03 C04; Danio rerio; RNA Seq,GSM8150090 r1,GSM8150090,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53662_Track-95349_R1.fastq.gz L53662_Track-95349_R2.fastq.gz,fastq fastq,79670568.0,781084.0,GSM8150090 r1,0:51 1:51,A:22771076;C:15643583;G:16620665;T:24630900;N:4344,51,51,,,22771076,15643583,16620665,24630900,4344,SRX23964370,SRS20764013,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.80374,0.806,0.08033,0.08287,0.97222,0.97218,0.61535,0.6175,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30803,SRR28359173,SRX23964369,SRS20764010,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 C03,GSM8150089,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 C03,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150089,GSM8150089: CSN48 1 03 C03; Danio rerio; RNA Seq,GSM8150089 r1,GSM8150089,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53661_Track-95298_R1.fastq.gz L53661_Track-95298_R2.fastq.gz,fastq fastq,66877320.0,655660.0,GSM8150089 r1,0:51 1:51,A:19121399;C:13054001;G:13795637;T:20902909;N:3374,51,51,,,19121399,13054001,13795637,20902909,3374,SRX23964369,SRS20764010,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.79253,0.80117,0.0821,0.08811,0.9777,0.97792,0.69404,0.69921,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30804,SRR28359174,SRX23964368,SRS20764009,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 C02,GSM8150088,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 C02,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150088,GSM8150088: CSN48 1 03 C02; Danio rerio; RNA Seq,GSM8150088 r1,GSM8150088,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53660_Track-95527_R1.fastq.gz L53660_Track-95527_R2.fastq.gz,fastq fastq,71446716.0,700458.0,GSM8150088 r1,0:51 1:51,A:20608056;C:12796514;G:14019234;T:24019077;N:3835,51,51,,,20608056,12796514,14019234,24019077,3835,SRX23964368,SRS20764009,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.71157,0.7141,0.16048,0.1627,0.97792,0.97845,0.67132,0.66879,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30805,SRR28359175,SRX23964367,SRS20764008,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 C01,GSM8150087,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 C01,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150087,GSM8150087: CSN48 1 03 C01; Danio rerio; RNA Seq,GSM8150087 r1,GSM8150087,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53659_Track-95461_R1.fastq.gz L53659_Track-95461_R2.fastq.gz,fastq fastq,64670142.0,634021.0,GSM8150087 r1,0:51 1:51,A:17956351;C:12818976;G:13752850;T:20138633;N:3332,51,51,,,17956351,12818976,13752850,20138633,3332,SRX23964367,SRS20764008,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.74832,0.7561,0.09794,0.10329,0.98403,0.98388,0.40094,0.40168,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30806,SRR28359176,SRX23964366,SRS20764007,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 B24,GSM8150086,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 B24,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150086,GSM8150086: CSN48 1 03 B24; Danio rerio; RNA Seq,GSM8150086 r1,GSM8150086,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53658_Track-95603_R1.fastq.gz L53658_Track-95603_R2.fastq.gz,fastq fastq,59920920.0,587460.0,GSM8150086 r1,0:51 1:51,A:17319267;C:9434358;G:12121423;T:21042551;N:3321,51,51,,,17319267,9434358,12121423,21042551,3321,SRX23964366,SRS20764007,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.04427,0.19448,0.03621,0.185,0.98839,0.98794,0.61065,0.61792,51,51,T,B,mate1 technical by mapping diff,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30807,SRR28359177,SRX23964365,SRS20764006,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 B23,GSM8150085,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 B23,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150085,GSM8150085: CSN48 1 03 B23; Danio rerio; RNA Seq,GSM8150085 r1,GSM8150085,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53657_Track-95283_R2.fastq.gz L53657_Track-95283_R1.fastq.gz,fastq fastq,53226966.0,521833.0,GSM8150085 r1,0:51 1:51,A:14941614;C:10508290;G:11101152;T:16673114;N:2796,51,51,,,14941614,10508290,11101152,16673114,2796,SRX23964365,SRS20764006,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.73632,0.75417,0.12668,0.14077,0.98295,0.98313,0.57551,0.57154,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30808,SRR28359178,SRX23964364,SRS20764005,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 B14,GSM8150076,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 B14,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150076,GSM8150076: CSN48 1 03 B14; Danio rerio; RNA Seq,GSM8150076 r1,GSM8150076,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53648_Track-95397_R1.fastq.gz L53648_Track-95397_R2.fastq.gz,fastq fastq,76392594.0,748947.0,GSM8150076 r1,0:51 1:51,A:21364045;C:15464328;G:16352646;T:23207328;N:4247,51,51,,,21364045,15464328,16352646,23207328,4247,SRX23964364,SRS20764005,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.81786,0.82381,0.08799,0.09132,0.97642,0.97666,0.62228,0.61882,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30809,SRR28359179,SRX23964363,SRS20764004,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 B13,GSM8150075,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 B13,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150075,GSM8150075: CSN48 1 03 B13; Danio rerio; RNA Seq,GSM8150075 r1,GSM8150075,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53647_Track-95506_R1.fastq.gz L53647_Track-95506_R2.fastq.gz,fastq fastq,36946746.0,362223.0,GSM8150075 r1,0:51 1:51,A:10280031;C:7534451;G:7970199;T:11160067;N:1998,51,51,,,10280031,7534451,7970199,11160067,1998,SRX23964363,SRS20764004,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.79907,0.80822,0.09071,0.0998,0.98175,0.98208,0.68971,0.64595,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30810,SRR28359180,SRX23964362,SRS20764003,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 B12,GSM8150074,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 B12,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150074,GSM8150074: CSN48 1 03 B12; Danio rerio; RNA Seq,GSM8150074 r1,GSM8150074,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53646_Track-95453_R1.fastq.gz L53646_Track-95453_R2.fastq.gz,fastq fastq,85714476.0,840338.0,GSM8150074 r1,0:51 1:51,A:23566340;C:17568852;G:18323517;T:26251427;N:4340,51,51,,,23566340,17568852,18323517,26251427,4340,SRX23964362,SRS20764003,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.75881,0.76801,0.12155,0.12856,0.98482,0.98472,0.61286,0.62362,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30811,SRR28359181,SRX23964361,SRS20764000,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 B11,GSM8150073,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 B11,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150073,GSM8150073: CSN48 1 03 B11; Danio rerio; RNA Seq,GSM8150073 r1,GSM8150073,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53645_Track-95322_R1.fastq.gz L53645_Track-95322_R2.fastq.gz,fastq fastq,60880230.0,596865.0,GSM8150073 r1,0:51 1:51,A:16894823;C:12375429;G:12826233;T:18781441;N:2304,51,51,,,16894823,12375429,12826233,18781441,2304,SRX23964361,SRS20764000,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.79235,0.79169,0.14033,0.14537,0.99149,0.99115,0.64974,0.6485,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30812,SRR28359182,SRX23964360,SRS20764001,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 B10,GSM8150072,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 B10,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150072,GSM8150072: CSN48 1 03 B10; Danio rerio; RNA Seq,GSM8150072 r1,GSM8150072,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53644_Track-95467_R1.fastq.gz L53644_Track-95467_R2.fastq.gz,fastq fastq,98242626.0,963163.0,GSM8150072 r1,0:51 1:51,A:28157017;C:18311799;G:19643019;T:32125552;N:5239,51,51,,,28157017,18311799,19643019,32125552,5239,SRX23964360,SRS20764001,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.69857,0.71216,0.26037,0.27217,0.98441,0.98439,0.59596,0.58485,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30813,SRR28359183,SRX23964359,SRS20764002,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 B09,GSM8150071,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 B09,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150071,GSM8150071: CSN48 1 03 B09; Danio rerio; RNA Seq,GSM8150071 r1,GSM8150071,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53643_Track-95356_R1.fastq.gz L53643_Track-95356_R2.fastq.gz,fastq fastq,72683262.0,712581.0,GSM8150071 r1,0:51 1:51,A:19574281;C:15308619;G:16971728;T:20824824;N:3810,51,51,,,19574281,15308619,16971728,20824824,3810,SRX23964359,SRS20764002,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.79621,0.80188,0.03212,0.03548,0.98159,0.98125,0.37766,0.43082,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30814,SRR28359184,SRX23964358,SRS20763999,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 B08,GSM8150070,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 B08,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150070,GSM8150070: CSN48 1 03 B08; Danio rerio; RNA Seq,GSM8150070 r1,GSM8150070,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53642_Track-95490_R1.fastq.gz L53642_Track-95490_R2.fastq.gz,fastq fastq,48215502.0,472701.0,GSM8150070 r1,0:51 1:51,A:13666032;C:9613857;G:10126815;T:14806354;N:2444,51,51,,,13666032,9613857,10126815,14806354,2444,SRX23964358,SRS20763999,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.81988,0.82624,0.07106,0.07582,0.98175,0.98108,0.57602,0.57798,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30815,SRR28359185,SRX23964357,SRS20763998,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 B07,GSM8150069,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 B07,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150069,GSM8150069: CSN48 1 03 B07; Danio rerio; RNA Seq,GSM8150069 r1,GSM8150069,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53641_Track-95473_R1.fastq.gz L53641_Track-95473_R2.fastq.gz,fastq fastq,76201854.0,747077.0,GSM8150069 r1,0:51 1:51,A:21033710;C:15513104;G:16188842;T:23462426;N:3772,51,51,,,21033710,15513104,16188842,23462426,3772,SRX23964357,SRS20763998,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.74996,0.76625,0.11529,0.12633,0.98843,0.98857,0.67337,0.6751,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30816,SRR28359186,SRX23964356,SRS20763997,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 A22,GSM8150060,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 A22,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150060,GSM8150060: CSN48 1 03 A22; Danio rerio; RNA Seq,GSM8150060 r1,GSM8150060,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53632_Track-95579_R1.fastq.gz L53632_Track-95579_R2.fastq.gz,fastq fastq,89337312.0,875856.0,GSM8150060 r1,0:51 1:51,A:24279913;C:18508911;G:19215997;T:27327967;N:4524,51,51,,,24279913,18508911,19215997,27327967,4524,SRX23964356,SRS20763997,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.77307,0.78079,0.08474,0.08819,0.98496,0.98555,0.60362,0.59775,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30817,SRR28359187,SRX23964355,SRS20763996,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 A21,GSM8150059,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 A21,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150059,GSM8150059: CSN48 1 03 A21; Danio rerio; RNA Seq,GSM8150059 r1,GSM8150059,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53631_Track-95546_R1.fastq.gz L53631_Track-95546_R2.fastq.gz,fastq fastq,102868938.0,1008519.0,GSM8150059 r1,0:51 1:51,A:28279557;C:21161886;G:21755461;T:31666533;N:5501,51,51,,,28279557,21161886,21755461,31666533,5501,SRX23964355,SRS20763996,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.75403,0.76348,0.13488,0.13978,0.98675,0.98723,0.61677,0.61653,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30818,SRR28359188,SRX23964354,SRS20763995,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 A20,GSM8150058,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 A20,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150058,GSM8150058: CSN48 1 03 A20; Danio rerio; RNA Seq,GSM8150058 r1,GSM8150058,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53630_Track-95543_R1.fastq.gz L53630_Track-95543_R2.fastq.gz,fastq fastq,59958762.0,587831.0,GSM8150058 r1,0:51 1:51,A:17881823;C:10575047;G:11761109;T:19737967;N:2816,51,51,,,17881823,10575047,11761109,19737967,2816,SRX23964354,SRS20763995,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.71592,0.74628,0.02396,0.03109,0.99245,0.99251,0.92743,0.92775,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30819,SRR28359189,SRX23964353,SRS20763994,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 A19,GSM8150057,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 A19,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150057,GSM8150057: CSN48 1 03 A19; Danio rerio; RNA Seq,GSM8150057 r1,GSM8150057,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53629_Track-95580_R1.fastq.gz L53629_Track-95580_R2.fastq.gz,fastq fastq,83836350.0,821925.0,GSM8150057 r1,0:51 1:51,A:23566723;C:16925562;G:17589346;T:25750439;N:4280,51,51,,,23566723,16925562,17589346,25750439,4280,SRX23964353,SRS20763994,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.73931,0.75043,0.11385,0.12193,0.98557,0.98557,0.63327,0.63481,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30820,SRR28359190,SRX23964352,SRS20763991,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 A18,GSM8150056,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 A18,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150056,GSM8150056: CSN48 1 03 A18; Danio rerio; RNA Seq,GSM8150056 r1,GSM8150056,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53628_Track-95573_R1.fastq.gz L53628_Track-95573_R2.fastq.gz,fastq fastq,47908686.0,469693.0,GSM8150056 r1,0:51 1:51,A:13941866;C:9036815;G:9616683;T:15310786;N:2536,51,51,,,13941866,9036815,9616683,15310786,2536,SRX23964352,SRS20763991,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.73338,0.75945,0.01988,0.03615,0.99064,0.99062,0.88101,0.86842,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30821,SRR28359191,SRX23964351,SRS20763993,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 A17,GSM8150055,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 A17,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150055,GSM8150055: CSN48 1 03 A17; Danio rerio; RNA Seq,GSM8150055 r1,GSM8150055,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53627_Track-95648_R1.fastq.gz L53627_Track-95648_R2.fastq.gz,fastq fastq,48067296.0,471248.0,GSM8150055 r1,0:51 1:51,A:14258002;C:7716733;G:8570836;T:17519000;N:2725,51,51,,,14258002,7716733,8570836,17519000,2725,SRX23964351,SRS20763993,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.03558,0.10254,0.01613,0.07956,0.98346,0.98366,0.62736,0.61877,51,51,B,B,mate1-mate2 similar by mapping diff,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30822,SRR28359192,SRX23964350,SRS20763990,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 A16,GSM8150054,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 A16,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150054,GSM8150054: CSN48 1 03 A16; Danio rerio; RNA Seq,GSM8150054 r1,GSM8150054,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53626_Track-95285_R1.fastq.gz L53626_Track-95285_R2.fastq.gz,fastq fastq,64520100.0,632550.0,GSM8150054 r1,0:51 1:51,A:18529980;C:12360945;G:13126104;T:20499523;N:3548,51,51,,,18529980,12360945,13126104,20499523,3548,SRX23964350,SRS20763990,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.79225,0.79957,0.09612,0.09923,0.98565,0.98569,0.68585,0.68805,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30823,SRR28359193,SRX23964349,SRS20763992,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 A15,GSM8150053,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 A15,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150053,GSM8150053: CSN48 1 03 A15; Danio rerio; RNA Seq,GSM8150053 r1,GSM8150053,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53625_Track-95310_R1.fastq.gz L53625_Track-95310_R2.fastq.gz,fastq fastq,57464964.0,563382.0,GSM8150053 r1,0:51 1:51,A:16027163;C:9875941;G:11249945;T:20308844;N:3071,51,51,,,16027163,9875941,11249945,20308844,3071,SRX23964349,SRS20763992,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.54793,0.56093,0.14665,0.15373,0.97423,0.97374,0.52447,0.52236,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30824,SRR28359194,SRX23964348,SRS20763987,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 A06,GSM8150044,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 A06,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150044,GSM8150044: CSN48 1 03 A06; Danio rerio; RNA Seq,GSM8150044 r1,GSM8150044,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53616_Track-95627_R1.fastq.gz L53616_Track-95627_R2.fastq.gz,fastq fastq,42204234.0,413767.0,GSM8150044 r1,0:51 1:51,A:12167972;C:7098285;G:8516860;T:14418918;N:2199,51,51,,,12167972,7098285,8516860,14418918,2199,SRX23964348,SRS20763987,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.01728,0.13044,0.0054,0.11743,0.98835,0.98813,0.55491,0.55686,51,51,T,B,mate1 technical by mapping diff,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30825,SRR28359195,SRX23964347,SRS20763988,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 A05,GSM8150043,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 A05,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150043,GSM8150043: CSN48 1 03 A05; Danio rerio; RNA Seq,GSM8150043 r1,GSM8150043,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53615_Track-95570_R1.fastq.gz L53615_Track-95570_R2.fastq.gz,fastq fastq,60711318.0,595209.0,GSM8150043 r1,0:51 1:51,A:16616267;C:12702862;G:12998651;T:18390580;N:2958,51,51,,,16616267,12702862,12998651,18390580,2958,SRX23964347,SRS20763988,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.74171,0.75015,0.09281,0.09756,0.98196,0.98135,0.61594,0.6145,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30826,SRR28359196,SRX23964346,SRS20763989,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 A04,GSM8150042,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 A04,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150042,GSM8150042: CSN48 1 03 A04; Danio rerio; RNA Seq,GSM8150042 r1,GSM8150042,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53614_Track-95647_R1.fastq.gz L53614_Track-95647_R2.fastq.gz,fastq fastq,25999596.0,254898.0,GSM8150042 r1,0:51 1:51,A:7736401;C:4216599;G:4559315;T:9486137;N:1144,51,51,,,7736401,4216599,4559315,9486137,1144,SRX23964346,SRS20763989,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.02907,0.09609,0.00643,0.06909,0.98064,0.98019,0.59162,0.61734,51,51,B,B,mate1-mate2 similar by mapping diff,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30827,SRR28359197,SRX23964345,SRS20763985,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 A03,GSM8150041,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 A03,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150041,GSM8150041: CSN48 1 03 A03; Danio rerio; RNA Seq,GSM8150041 r1,GSM8150041,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53613_Track-95474_R1.fastq.gz L53613_Track-95474_R2.fastq.gz,fastq fastq,74797620.0,733310.0,GSM8150041 r1,0:51 1:51,A:20648666;C:15688335;G:16673606;T:21782908;N:4105,51,51,,,20648666,15688335,16673606,21782908,4105,SRX23964345,SRS20763985,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.80802,0.81136,0.0624,0.06518,0.97928,0.9792,0.60689,0.60864,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30828,SRR28359198,SRX23964344,SRS20763986,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 A02,GSM8150040,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 A02,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150040,GSM8150040: CSN48 1 03 A02; Danio rerio; RNA Seq,GSM8150040 r1,GSM8150040,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53612_Track-95321_R1.fastq.gz L53612_Track-95321_R2.fastq.gz,fastq fastq,67447806.0,661253.0,GSM8150040 r1,0:51 1:51,A:19270398;C:12732437;G:13850269;T:21591414;N:3288,51,51,,,19270398,12732437,13850269,21591414,3288,SRX23964344,SRS20763986,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.73104,0.75072,0.13206,0.14505,0.97626,0.97648,0.54313,0.47631,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30829,SRR28359199,SRX23964343,SRS20763984,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN48 1 03 A01,GSM8150039,,tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing,CSN48 1 03 A01,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN48 1,GSM8150039,GSM8150039: CSN48 1 03 A01; Danio rerio; RNA Seq,GSM8150039 r1,GSM8150039,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53611_Track-95455_R1.fastq.gz L53611_Track-95455_R2.fastq.gz,fastq fastq,77367510.0,758505.0,GSM8150039 r1,0:51 1:51,A:21309760;C:15498935;G:16220238;T:24334550;N:4027,51,51,,,21309760,15498935,16220238,24334550,4027,SRX23964343,SRS20763984,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.72269,0.73574,0.13644,0.14483,0.97693,0.97678,0.64678,0.65363,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30830,SRR28359200,SRX23964342,SRS20763983,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,RNA 02 G11,GSM8150038,,tissue:beta cells|cell type:beta cells|treatment: |geo loc name:missing|collection date:missing,RNA 02 G11,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment: ,GSM8150038,GSM8150038: RNA 02 G11; Danio rerio; RNA Seq,GSM8150038 r1,GSM8150038,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53609_Track-94987_R1.fastq.gz L53609_Track-94987_R2.fastq.gz,fastq fastq,61240392.0,600396.0,GSM8150038 r1,0:51 1:51,A:16426906;C:13172096;G:13880608;T:17757981;N:2801,51,51,,,16426906,13172096,13880608,17757981,2801,SRX23964342,SRS20763983,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.00606,0.00847,0.00186,0.00408,0.99391,0.9934,0.61997,0.6247,51,51,T,T,mates < 9% mapping rate,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30831,SRR28359201,SRX23964341,SRS20763982,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN24 02 G10,GSM8150037,,tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing,CSN24 02 G10,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN24,GSM8150037,GSM8150037: CSN24 02 G10; Danio rerio; RNA Seq,GSM8150037 r1,GSM8150037,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53608_Track-95181_R1.fastq.gz L53608_Track-95181_R2.fastq.gz,fastq fastq,108348684.0,1062242.0,GSM8150037 r1,0:51 1:51,A:30298833;C:22284186;G:23138502;T:32621431;N:5732,51,51,,,30298833,22284186,23138502,32621431,5732,SRX23964341,SRS20763982,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.81665,0.82026,0.10911,0.111,0.9903,0.99022,0.58375,0.60752,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30832,SRR28359202,SRX23964340,SRS20763981,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN24 02 F17,GSM8150020,,tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing,CSN24 02 F17,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN24,GSM8150020,GSM8150020: CSN24 02 F17; Danio rerio; RNA Seq,GSM8150020 r1,GSM8150020,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53591_Track-95206_R1.fastq.gz L53591_Track-95206_R2.fastq.gz,fastq fastq,86279862.0,845881.0,GSM8150020 r1,0:51 1:51,A:24115181;C:17714131;G:19964968;T:24482228;N:3354,51,51,,,24115181,17714131,19964968,24482228,3354,SRX23964340,SRS20763981,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.80701,0.81935,0.05082,0.05296,0.99001,0.98916,0.20716,0.20255,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30833,SRR28359203,SRX23964339,SRS20763980,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN24 02 F16,GSM8150019,,tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing,CSN24 02 F16,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN24,GSM8150019,GSM8150019: CSN24 02 F16; Danio rerio; RNA Seq,GSM8150019 r1,GSM8150019,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53590_Track-95236_R1.fastq.gz L53590_Track-95236_R2.fastq.gz,fastq fastq,52062228.0,510414.0,GSM8150019 r1,0:51 1:51,A:14020180;C:10872213;G:11468886;T:15698256;N:2693,51,51,,,14020180,10872213,11468886,15698256,2693,SRX23964339,SRS20763980,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.73918,0.76144,0.08666,0.10335,0.99164,0.99172,0.62609,0.62128,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30834,SRR28359204,SRX23964338,SRS20763979,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN24 02 F15,GSM8150018,,tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing,CSN24 02 F15,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN24,GSM8150018,GSM8150018: CSN24 02 F15; Danio rerio; RNA Seq,GSM8150018 r1,GSM8150018,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53589_Track-95141_R1.fastq.gz L53589_Track-95141_R2.fastq.gz,fastq fastq,77157492.0,756446.0,GSM8150018 r1,0:51 1:51,A:21605693;C:15599581;G:16432852;T:23515612;N:3754,51,51,,,21605693,15599581,16432852,23515612,3754,SRX23964338,SRS20763979,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.74476,0.74702,0.10865,0.11076,0.98652,0.9862,0.44979,0.44751,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30835,SRR28359205,SRX23964337,SRS20763978,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN24 02 F14,GSM8150017,,tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing,CSN24 02 F14,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN24,GSM8150017,GSM8150017: CSN24 02 F14; Danio rerio; RNA Seq,GSM8150017 r1,GSM8150017,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53588_Track-95126_R1.fastq.gz L53588_Track-95126_R2.fastq.gz,fastq fastq,53797452.0,527426.0,GSM8150017 r1,0:51 1:51,A:15116683;C:10915128;G:11435804;T:16327174;N:2663,51,51,,,15116683,10915128,11435804,16327174,2663,SRX23964337,SRS20763978,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.79782,0.80616,0.07566,0.08202,0.98723,0.9876,0.63965,0.6399,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30836,SRR28359206,SRX23964336,SRS20763977,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN24 02 F13,GSM8150016,,tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing,CSN24 02 F13,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN24,GSM8150016,GSM8150016: CSN24 02 F13; Danio rerio; RNA Seq,GSM8150016 r1,GSM8150016,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53587_Track-95258_R1.fastq.gz L53587_Track-95258_R2.fastq.gz,fastq fastq,94360302.0,925101.0,GSM8150016 r1,0:51 1:51,A:25592436;C:19902737;G:20439380;T:28420944;N:4805,51,51,,,25592436,19902737,20439380,28420944,4805,SRX23964336,SRS20763977,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.77378,0.78037,0.12707,0.1297,0.99206,0.99182,0.61719,0.62462,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30837,SRR28359207,SRX23964335,SRS20763976,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN24 02 F12,GSM8150015,,tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing,CSN24 02 F12,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN24,GSM8150015,GSM8150015: CSN24 02 F12; Danio rerio; RNA Seq,GSM8150015 r1,GSM8150015,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53586_Track-95184_R1.fastq.gz L53586_Track-95184_R2.fastq.gz,fastq fastq,62354844.0,611322.0,GSM8150015 r1,0:51 1:51,A:16894234;C:13102917;G:13985509;T:18368881;N:3303,51,51,,,16894234,13102917,13985509,18368881,3303,SRX23964335,SRS20763976,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.77413,0.77856,0.0563,0.06016,0.97601,0.97546,0.52098,0.52409,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30838,SRR28359208,SRX23964334,SRS20763975,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN24 02 F11,GSM8150014,,tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing,CSN24 02 F11,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN24,GSM8150014,GSM8150014: CSN24 02 F11; Danio rerio; RNA Seq,GSM8150014 r1,GSM8150014,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53585_Track-95282_R1.fastq.gz L53585_Track-95282_R2.fastq.gz,fastq fastq,134866134.0,1322217.0,GSM8150014 r1,0:51 1:51,A:36606180;C:28153427;G:29082203;T:41017328;N:6996,51,51,,,36606180,28153427,29082203,41017328,6996,SRX23964334,SRS20763975,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.78038,0.78847,0.103,0.10673,0.99022,0.99026,0.63847,0.64824,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30839,SRR28359209,SRX23964333,SRS20763973,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN24 02 F10,GSM8150013,,tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing,CSN24 02 F10,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN24,GSM8150013,GSM8150013: CSN24 02 F10; Danio rerio; RNA Seq,GSM8150013 r1,GSM8150013,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53584_Track-94961_R1.fastq.gz L53584_Track-94961_R2.fastq.gz,fastq fastq,57289218.0,561659.0,GSM8150013 r1,0:51 1:51,A:15654996;C:12067784;G:13483977;T:16079504;N:2957,51,51,,,15654996,12067784,13483977,16079504,2957,SRX23964333,SRS20763973,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.78546,0.78801,0.03275,0.0365,0.98451,0.98484,0.18731,0.18714,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30840,SRR28359210,SRX23964332,SRS20763974,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN24 02 F01,GSM8150004,,tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing,CSN24 02 F01,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN24,GSM8150004,GSM8150004: CSN24 02 F01; Danio rerio; RNA Seq,GSM8150004 r1,GSM8150004,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53575_Track-95159_R1.fastq.gz L53575_Track-95159_R2.fastq.gz,fastq fastq,120780648.0,1184124.0,GSM8150004 r1,0:51 1:51,A:32680701;C:24675276;G:25705829;T:37712522;N:6320,51,51,,,32680701,24675276,25705829,37712522,6320,SRX23964332,SRS20763974,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.74064,0.74741,0.09215,0.09447,0.98746,0.98764,0.6778,0.66742,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30841,SRR28359211,SRX23964331,SRS20763972,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN24 02 E24,GSM8150003,,tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing,CSN24 02 E24,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN24,GSM8150003,GSM8150003: CSN24 02 E24; Danio rerio; RNA Seq,GSM8150003 r1,GSM8150003,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53574_Track-95235_R1.fastq.gz L53574_Track-95235_R2.fastq.gz,fastq fastq,125646150.0,1231825.0,GSM8150003 r1,0:51 1:51,A:34906622;C:25653760;G:26843705;T:38235468;N:6595,51,51,,,34906622,25653760,26843705,38235468,6595,SRX23964331,SRS20763972,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.79136,0.79591,0.11781,0.1209,0.99275,0.99261,0.59738,0.60471,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30842,SRR28359212,SRX23964330,SRS20763971,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN24 02 E23,GSM8150002,,tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing,CSN24 02 E23,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN24,GSM8150002,GSM8150002: CSN24 02 E23; Danio rerio; RNA Seq,GSM8150002 r1,GSM8150002,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53573_Track-95222_R1.fastq.gz L53573_Track-95222_R2.fastq.gz,fastq fastq,102050286.0,1000493.0,GSM8150002 r1,0:51 1:51,A:28856641;C:20351972;G:21425480;T:31410880;N:5313,51,51,,,28856641,20351972,21425480,31410880,5313,SRX23964330,SRS20763971,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.77509,0.78297,0.13105,0.13959,0.98275,0.98236,0.57536,0.56425,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30843,SRR28359213,SRX23964329,SRS20763970,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN24 02 E22,GSM8150001,,tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing,CSN24 02 E22,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN24,GSM8150001,GSM8150001: CSN24 02 E22; Danio rerio; RNA Seq,GSM8150001 r1,GSM8150001,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53572_Track-95208_R1.fastq.gz L53572_Track-95208_R2.fastq.gz,fastq fastq,93339384.0,915092.0,GSM8150001 r1,0:51 1:51,A:24881598;C:19769054;G:20522772;T:28161697;N:4263,51,51,,,24881598,19769054,20522772,28161697,4263,SRX23964329,SRS20763970,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.79486,0.79815,0.0588,0.06066,0.99391,0.99375,0.61742,0.62514,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30844,SRR28359214,SRX23964328,SRS20763969,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN24 02 E21,GSM8150000,,tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing,CSN24 02 E21,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN24,GSM8150000,GSM8150000: CSN24 02 E21; Danio rerio; RNA Seq,GSM8150000 r1,GSM8150000,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53571_Track-95100_R1.fastq.gz L53571_Track-95100_R2.fastq.gz,fastq fastq,81079596.0,794898.0,GSM8150000 r1,0:51 1:51,A:22871371;C:16291248;G:17451823;T:24461074;N:4080,51,51,,,22871371,16291248,17451823,24461074,4080,SRX23964328,SRS20763969,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.76031,0.78541,0.13661,0.15665,0.98693,0.98683,0.524,0.53378,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30845,SRR28359215,SRX23964327,SRS20763968,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN24 02 E20,GSM8149999,,tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing,CSN24 02 E20,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN24,GSM8149999,GSM8149999: CSN24 02 E20; Danio rerio; RNA Seq,GSM8149999 r1,GSM8149999,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53570_Track-95253_R1.fastq.gz L53570_Track-95253_R2.fastq.gz,fastq fastq,110380524.0,1082162.0,GSM8149999 r1,0:51 1:51,A:29965518;C:23223337;G:24025378;T:33160713;N:5578,51,51,,,29965518,23223337,24025378,33160713,5578,SRX23964327,SRS20763968,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.80146,0.80582,0.09058,0.09163,0.99153,0.99155,0.59927,0.60152,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30846,SRR28359216,SRX23964326,SRS20763967,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN24 02 E19,GSM8149998,,tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing,CSN24 02 E19,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN24,GSM8149998,GSM8149998: CSN24 02 E19; Danio rerio; RNA Seq,GSM8149998 r1,GSM8149998,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53569_Track-95196_R1.fastq.gz L53569_Track-95196_R2.fastq.gz,fastq fastq,69006060.0,676530.0,GSM8149998 r1,0:51 1:51,A:18708547;C:14544311;G:15053174;T:20696747;N:3281,51,51,,,18708547,14544311,15053174,20696747,3281,SRX23964326,SRS20763967,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.79623,0.80729,0.10708,0.11406,0.98378,0.98388,0.63419,0.64935,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30847,SRR28359217,SRX23964325,SRS20763965,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN24 02 E18,GSM8149997,,tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing,CSN24 02 E18,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN24,GSM8149997,GSM8149997: CSN24 02 E18; Danio rerio; RNA Seq,GSM8149997 r1,GSM8149997,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53568_Track-95096_R1.fastq.gz L53568_Track-95096_R2.fastq.gz,fastq fastq,99737232.0,977816.0,GSM8149997 r1,0:51 1:51,A:26637824;C:21626541;G:22174230;T:29293509;N:5128,51,51,,,26637824,21626541,22174230,29293509,5128,SRX23964325,SRS20763965,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.81323,0.82081,0.05142,0.05469,0.98796,0.98778,0.60536,0.61653,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30848,SRR28359218,SRX23964324,SRS20763964,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN24 02 E09,GSM8149988,,tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing,CSN24 02 E09,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN24,GSM8149988,GSM8149988: CSN24 02 E09; Danio rerio; RNA Seq,GSM8149988 r1,GSM8149988,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53559_Track-95194_R1.fastq.gz L53559_Track-95194_R2.fastq.gz,fastq fastq,163634418.0,1604259.0,GSM8149988 r1,0:51 1:51,A:44510452;C:34830439;G:36037266;T:48247463;N:8798,51,51,,,44510452,34830439,36037266,48247463,8798,SRX23964324,SRS20763964,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.81161,0.81908,0.10681,0.11049,0.98541,0.98508,0.61527,0.61898,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30849,SRR28359219,SRX23964323,SRS20763966,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN24 02 E08,GSM8149987,,tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing,CSN24 02 E08,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN24,GSM8149987,GSM8149987: CSN24 02 E08; Danio rerio; RNA Seq,GSM8149987 r1,GSM8149987,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53558_Track-95209_R1.fastq.gz L53558_Track-95209_R2.fastq.gz,fastq fastq,57472104.0,563452.0,GSM8149987 r1,0:51 1:51,A:15516019;C:11920636;G:12819202;T:17212927;N:3320,51,51,,,15516019,11920636,12819202,17212927,3320,SRX23964323,SRS20763966,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.77941,0.80237,0.11606,0.13655,0.98843,0.98802,0.63415,0.6372,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30850,SRR28359220,SRX23964322,SRS20763962,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN24 02 E07,GSM8149986,,tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing,CSN24 02 E07,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN24,GSM8149986,GSM8149986: CSN24 02 E07; Danio rerio; RNA Seq,GSM8149986 r1,GSM8149986,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53557_Track-95060_R1.fastq.gz L53557_Track-95060_R2.fastq.gz,fastq fastq,84329724.0,826762.0,GSM8149986 r1,0:51 1:51,A:23213591;C:17425659;G:18317338;T:25368637;N:4499,51,51,,,23213591,17425659,18317338,25368637,4499,SRX23964322,SRS20763962,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.77061,0.77727,0.10045,0.10712,0.98121,0.98068,0.56772,0.60046,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System
30851,SRR28359221,SRX23964321,SRS20763963,SRP495499,PRJNA1088503,Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity,GSE261729,Transcriptome Analysis,Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2.,,pubmed:39762647,,CSN24 02 E06,GSM8149985,,tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing,CSN24 02 E06,bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample.,beta cells,,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,cell type:beta cells|treatment:CSN24,GSM8149985,GSM8149985: CSN24 02 E06; Danio rerio; RNA Seq,GSM8149985 r1,GSM8149985,1,The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP495499,,loader:fastq load.py,L53556_Track-95157_R1.fastq.gz L53556_Track-95157_R2.fastq.gz,fastq fastq,90084054.0,883177.0,GSM8149985 r1,0:51 1:51,A:24491087;C:18640738;G:19792986;T:27154578;N:4665,51,51,,,24491087,18640738,19792986,27154578,4665,SRX23964321,SRS20763963,SRA1825239,"Dresden-concept Genome Center, TU Dresden","Ninov Lab, CRTD, TU Dresden",2,0.78647,0.79489,0.08515,0.09456,0.98849,0.98857,0.63931,0.66604,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,sc,single_cell_plate,smartseq,,Germany,2024-03-15,Undetermined,Larval,Pancreas,Endocrine System