rowid,run.accession,experiment.accession,sample.accession,study.accession,bioproject,study.title,study.alias,study.type,study.abstract,study.attributes,study.PMIDs,sample.description,sample.title,sample.alias,sample.centername,sample.attributes,GEOsample.title,GEOsample.dataprocessing,GEOsample.source,GEOsample.treatmentprotocol,GEOsample.extractprotocol,GEOsample.growthprotocol,GEOsample.characteristics,GEOsample.accession,experiment.title,experiment.alias,experiment.library_name,experiment.design_description,experiment.library_construction_protocol,experiment.attributes,experiment.library_strategy,experiment.library_source,experiment.library_selection,experiment.library_layout,experiment.platform,experiment.instrument_model,experiment.spot_descriptor,experiment.study_ref,run.title,run.attributes,run.filename,run.semantic_name,run.total_bases,run.total_spots,run.alias,run.read_lengths,run.base_counts,run.r1_length,run.r2_length,run.r3_length,run.r4_length,run.Acount,run.Ccount,run.Gcount,run.Tcount,run.Ncount,run.experiment,run.pool_member,submission.accession,submission.srasource,submission.bioprojectsource,seqdetective.n_mates,seqdetective.mapping_rate.mate1,seqdetective.mapping_rate.mate2,seqdetective.nofeature_rate.mate1,seqdetective.nofeature_rate.mate2,seqdetective.sparsity.mate1,seqdetective.sparsity.mate2,seqdetective.pos_strand_rate.mate1,seqdetective.pos_strand_rate.mate2,seqdetective.readlen.mate1,seqdetective.readlen.mate2,seqdetective.judgement.mate1,seqdetective.judgement.mate2,seqdetective.judgement.reason,platform_family,instrument_generation,read_bias,selection_class,prep_kit,sc_or_bulk,tech_class,technology,tech_variant,submission.bioprojectsource.country,earliest_date,devstage_curation,devstage_curation_coarse,tissue_curation,tissue_curation_coarse
11226,ERR10368639,ERX9900562,ERS13563108,ERP141667,PRJEB56699,RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,E-MTAB-12301,Other,It has been recently shown that SNRNP70  a major component of the spliceosome  as well as other splicing regulators are found in axons. To investigate the role of SNRNP70 in axons  we generated a zebrafish null mutant and found motor connectivity defects that can be partially rescued upon transgenic overexpression of cytoplasmic only human SNRNP70 cyt hSNRNP70. To understand the molecular function of the cytoplasmic pool of this splicing protein  we performed this RNA seq experiment with the aim to identify mRNA transcripts whose expression is regulated by the cytoplasmic pool of SNRNP70. To do that  we crossed heterozygous mutant animals that are also positive for the cyt SNRNP70 transgene. We then split embryos into four groups: i sibling  ii siblings/cyt hSNRNP70  iii null  iv null/cyt hSNRNP70. Total RNA was extracted from each one of the four groups three biological replicates per sample and sequenced.,ENA FIRST PUBLIC:2022 10 31|ENA LAST UPDATE:2022 10 31,,Protocols: Embryos were collected and raised in Danieau's solution together with 2 μΜ 4 OHΤ. Treated embryos were screened for GFP fluorescence at 24hpf and sorted into the four genotypes. Total RNA from whole embryos was isolated from each genotype group at 28hpf using a RNeasy Mini kit and eluted in nuclease free water. Total RNA was purified using Illumina TruSeq Stranded Total RNA Library Prep Ribo Zero Gold,16261X9,SAMEA111469072,Department of Life Sciences University of Bath,ENA FIRST PUBLIC:2022 10 31|ENA LAST UPDATE:2022 10 31|External Id:SAMEA111469072|INSDC center alias:Department of Life Sciences University of Bath|INSDC center name:Department of Life Sciences University of Bath|INSDC first public:2022 10 31T00:16:52Z|INSDC last update:2022 10 31T00:16:52Z|INSDC status:public|Submitter Id:E MTAB 12301:16261X9|age:28|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|disease:normal|genotype:snrnp70  / |organism part:whole organism|sample name:E MTAB 12301:16261X9,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,E MTAB 12301:16261X9 p,16261X9 p,RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,Embryos were collected and raised in Danieau's solution together with 2 μΜ 4 OHΤ. Treated embryos were screened for GFP fluorescence at 24hpf and sorted into the four genotypes. Total RNA from whole embryos was isolated from each genotype group at 28hpf using a RNeasy Mini kit and eluted in nuclease free water. Total RNA was purified using Illumina TruSeq Stranded Total RNA Library Prep Ribo Zero Gold,Experimental Factor: genotype:snrnp70  / ,RNA-Seq,TRANSCRIPTOMIC,Inverse rRNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP141667,Illumina NovaSeq 6000 paired end sequencing; RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,ENA FIRST PUBLIC:2022 10 31|ENA LAST UPDATE:2022 10 31,16261X9_190815_A00421_0101_BHFL23DRXX_S2_L001_R1_001.fastq.gz 16261X9_190815_A00421_0101_BHFL23DRXX_S2_L001_R2_001.fastq.gz,fastq fastq,2686590240.0,26339120.0,E MTAB 12301:16261X9 190815 A00421 0101 BHFL23DRXX S2 L001 R,0:51 1:51,A:694597606;C:635153638;G:628248232;T:728333026;N:257738,51,51,,,694597606,635153638,628248232,728333026,257738,ERX9900562,ERS13563108,ERA18523376,Department of Life Sciences University of Bath|European Nucleotide Archive,Department of Life Sciences University of Bath|European Nucleotide Archive,2,0.94614,0.94723,0.1538,0.15109,0.70398,0.70352,0.48123,0.48168,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,rrna_depletion,trueseq,bulk,bulk,bulk,,United Kingdom,2022-10-31,Pharyngula,Embryo,Whole Organism,All anatomical structures
11227,ERR10368638,ERX9900561,ERS13563107,ERP141667,PRJEB56699,RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,E-MTAB-12301,Other,It has been recently shown that SNRNP70  a major component of the spliceosome  as well as other splicing regulators are found in axons. To investigate the role of SNRNP70 in axons  we generated a zebrafish null mutant and found motor connectivity defects that can be partially rescued upon transgenic overexpression of cytoplasmic only human SNRNP70 cyt hSNRNP70. To understand the molecular function of the cytoplasmic pool of this splicing protein  we performed this RNA seq experiment with the aim to identify mRNA transcripts whose expression is regulated by the cytoplasmic pool of SNRNP70. To do that  we crossed heterozygous mutant animals that are also positive for the cyt SNRNP70 transgene. We then split embryos into four groups: i sibling  ii siblings/cyt hSNRNP70  iii null  iv null/cyt hSNRNP70. Total RNA was extracted from each one of the four groups three biological replicates per sample and sequenced.,ENA FIRST PUBLIC:2022 10 31|ENA LAST UPDATE:2022 10 31,,Protocols: Embryos were collected and raised in Danieau's solution together with 2 μΜ 4 OHΤ. Treated embryos were screened for GFP fluorescence at 24hpf and sorted into the four genotypes. Total RNA from whole embryos was isolated from each genotype group at 28hpf using a RNeasy Mini kit and eluted in nuclease free water. Total RNA was purified using Illumina TruSeq Stranded Total RNA Library Prep Ribo Zero Gold,16261X8,SAMEA111469071,Department of Life Sciences University of Bath,ENA FIRST PUBLIC:2022 10 31|ENA LAST UPDATE:2022 10 31|External Id:SAMEA111469071|INSDC center alias:Department of Life Sciences University of Bath|INSDC center name:Department of Life Sciences University of Bath|INSDC first public:2022 10 31T00:16:52Z|INSDC last update:2022 10 31T00:16:52Z|INSDC status:public|Submitter Id:E MTAB 12301:16261X8|age:28|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|disease:normal|genotype:snrnp70  / |organism part:whole organism|sample name:E MTAB 12301:16261X8,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,E MTAB 12301:16261X8 p,16261X8 p,RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,Embryos were collected and raised in Danieau's solution together with 2 μΜ 4 OHΤ. Treated embryos were screened for GFP fluorescence at 24hpf and sorted into the four genotypes. Total RNA from whole embryos was isolated from each genotype group at 28hpf using a RNeasy Mini kit and eluted in nuclease free water. Total RNA was purified using Illumina TruSeq Stranded Total RNA Library Prep Ribo Zero Gold,Experimental Factor: genotype:snrnp70  / ,RNA-Seq,TRANSCRIPTOMIC,Inverse rRNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP141667,Illumina NovaSeq 6000 paired end sequencing; RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,ENA FIRST PUBLIC:2022 10 31|ENA LAST UPDATE:2022 10 31,16261X8_190815_A00421_0101_BHFL23DRXX_S4_L001_R1_001.fastq.gz 16261X8_190815_A00421_0101_BHFL23DRXX_S4_L001_R2_001.fastq.gz,fastq fastq,15003930006.0,147097353.0,E MTAB 12301:16261X8 190815 A00421 0101 BHFL23DRXX S4 L001 R,0:51 1:51,A:3882939949;C:3570150556;G:3520942177;T:4028462946;N:1434378,51,51,,,3882939949,3570150556,3520942177,4028462946,1434378,ERX9900561,ERS13563107,ERA18523376,Department of Life Sciences University of Bath|European Nucleotide Archive,Department of Life Sciences University of Bath|European Nucleotide Archive,2,0.94373,0.94762,0.17954,0.17832,0.70299,0.70207,0.48822,0.48842,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,rrna_depletion,trueseq,bulk,bulk,bulk,,United Kingdom,2022-10-31,Pharyngula,Embryo,Whole Organism,All anatomical structures
11228,ERR10368637,ERX9900560,ERS13563106,ERP141667,PRJEB56699,RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,E-MTAB-12301,Other,It has been recently shown that SNRNP70  a major component of the spliceosome  as well as other splicing regulators are found in axons. To investigate the role of SNRNP70 in axons  we generated a zebrafish null mutant and found motor connectivity defects that can be partially rescued upon transgenic overexpression of cytoplasmic only human SNRNP70 cyt hSNRNP70. To understand the molecular function of the cytoplasmic pool of this splicing protein  we performed this RNA seq experiment with the aim to identify mRNA transcripts whose expression is regulated by the cytoplasmic pool of SNRNP70. To do that  we crossed heterozygous mutant animals that are also positive for the cyt SNRNP70 transgene. We then split embryos into four groups: i sibling  ii siblings/cyt hSNRNP70  iii null  iv null/cyt hSNRNP70. Total RNA was extracted from each one of the four groups three biological replicates per sample and sequenced.,ENA FIRST PUBLIC:2022 10 31|ENA LAST UPDATE:2022 10 31,,Protocols: Embryos were collected and raised in Danieau's solution together with 2 μΜ 4 OHΤ. Treated embryos were screened for GFP fluorescence at 24hpf and sorted into the four genotypes. Total RNA from whole embryos was isolated from each genotype group at 28hpf using a RNeasy Mini kit and eluted in nuclease free water. Total RNA was purified using Illumina TruSeq Stranded Total RNA Library Prep Ribo Zero Gold,16261X7,SAMEA111469070,Department of Life Sciences University of Bath,ENA FIRST PUBLIC:2022 10 31|ENA LAST UPDATE:2022 10 31|External Id:SAMEA111469070|INSDC center alias:Department of Life Sciences University of Bath|INSDC center name:Department of Life Sciences University of Bath|INSDC first public:2022 10 31T00:16:52Z|INSDC last update:2022 10 31T00:16:52Z|INSDC status:public|Submitter Id:E MTAB 12301:16261X7|age:28|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|disease:normal|genotype:snrnp70  / |organism part:whole organism|sample name:E MTAB 12301:16261X7,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,E MTAB 12301:16261X7 p,16261X7 p,RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,Embryos were collected and raised in Danieau's solution together with 2 μΜ 4 OHΤ. Treated embryos were screened for GFP fluorescence at 24hpf and sorted into the four genotypes. Total RNA from whole embryos was isolated from each genotype group at 28hpf using a RNeasy Mini kit and eluted in nuclease free water. Total RNA was purified using Illumina TruSeq Stranded Total RNA Library Prep Ribo Zero Gold,Experimental Factor: genotype:snrnp70  / ,RNA-Seq,TRANSCRIPTOMIC,Inverse rRNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP141667,Illumina NovaSeq 6000 paired end sequencing; RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,ENA FIRST PUBLIC:2022 10 31|ENA LAST UPDATE:2022 10 31|loader:fastq load.py,16261X7_190815_A00421_0101_BHFL23DRXX_S6_L001_R1_001.fastq.gz 16261X7_190815_A00421_0101_BHFL23DRXX_S6_L001_R2_001.fastq.gz,fastq fastq,3806643060.0,37320030.0,E MTAB 12301:16261X7 190815 A00421 0101 BHFL23DRXX S6 L001 R,0:51 1:51,A:971582421;C:919313664;G:905728446;T:1009653865;N:364664,51,51,,,971582421,919313664,905728446,1009653865,364664,ERX9900560,ERS13563106,ERA18523376,Department of Life Sciences University of Bath|European Nucleotide Archive,Department of Life Sciences University of Bath|European Nucleotide Archive,2,0.94035,0.94356,0.1661,0.16393,0.70136,0.70082,0.48294,0.48049,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,rrna_depletion,trueseq,bulk,bulk,bulk,,United Kingdom,2022-10-31,Pharyngula,Embryo,Whole Organism,All anatomical structures
11229,ERR10368636,ERX9900559,ERS13563105,ERP141667,PRJEB56699,RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,E-MTAB-12301,Other,It has been recently shown that SNRNP70  a major component of the spliceosome  as well as other splicing regulators are found in axons. To investigate the role of SNRNP70 in axons  we generated a zebrafish null mutant and found motor connectivity defects that can be partially rescued upon transgenic overexpression of cytoplasmic only human SNRNP70 cyt hSNRNP70. To understand the molecular function of the cytoplasmic pool of this splicing protein  we performed this RNA seq experiment with the aim to identify mRNA transcripts whose expression is regulated by the cytoplasmic pool of SNRNP70. To do that  we crossed heterozygous mutant animals that are also positive for the cyt SNRNP70 transgene. We then split embryos into four groups: i sibling  ii siblings/cyt hSNRNP70  iii null  iv null/cyt hSNRNP70. Total RNA was extracted from each one of the four groups three biological replicates per sample and sequenced.,ENA FIRST PUBLIC:2022 10 31|ENA LAST UPDATE:2022 10 31,,Protocols: Embryos were collected and raised in Danieau's solution together with 2 μΜ 4 OHΤ. Treated embryos were screened for GFP fluorescence at 24hpf and sorted into the four genotypes. Total RNA from whole embryos was isolated from each genotype group at 28hpf using a RNeasy Mini kit and eluted in nuclease free water. Total RNA was purified using Illumina TruSeq Stranded Total RNA Library Prep Ribo Zero Gold,16261X6,SAMEA111469069,Department of Life Sciences University of Bath,ENA FIRST PUBLIC:2022 10 31|ENA LAST UPDATE:2022 10 31|External Id:SAMEA111469069|INSDC center alias:Department of Life Sciences University of Bath|INSDC center name:Department of Life Sciences University of Bath|INSDC first public:2022 10 31T00:16:52Z|INSDC last update:2022 10 31T00:16:52Z|INSDC status:public|Submitter Id:E MTAB 12301:16261X6|age:28|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|disease:normal|genotype:+/cyt hSNRNP70|organism part:whole organism|sample name:E MTAB 12301:16261X6,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,E MTAB 12301:16261X6 p,16261X6 p,RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,Embryos were collected and raised in Danieau's solution together with 2 μΜ 4 OHΤ. Treated embryos were screened for GFP fluorescence at 24hpf and sorted into the four genotypes. Total RNA from whole embryos was isolated from each genotype group at 28hpf using a RNeasy Mini kit and eluted in nuclease free water. Total RNA was purified using Illumina TruSeq Stranded Total RNA Library Prep Ribo Zero Gold,Experimental Factor: genotype:+/cyt hSNRNP70,RNA-Seq,TRANSCRIPTOMIC,Inverse rRNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP141667,Illumina NovaSeq 6000 paired end sequencing; RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,ENA FIRST PUBLIC:2022 10 31|ENA LAST UPDATE:2022 10 31,16261X6_190815_A00421_0101_BHFL23DRXX_S7_L001_R1_001.fastq.gz 16261X6_190815_A00421_0101_BHFL23DRXX_S7_L001_R2_001.fastq.gz,fastq fastq,2875874598.0,28194849.0,E MTAB 12301:16261X6 190815 A00421 0101 BHFL23DRXX S7 L001 R,0:51 1:51,A:745870043;C:683782229;G:673037324;T:772909720;N:275282,51,51,,,745870043,683782229,673037324,772909720,275282,ERX9900559,ERS13563105,ERA18523376,Department of Life Sciences University of Bath|European Nucleotide Archive,Department of Life Sciences University of Bath|European Nucleotide Archive,2,0.9435,0.94737,0.16987,0.16888,0.6983,0.69826,0.47122,0.47409,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,rrna_depletion,trueseq,bulk,bulk,bulk,,United Kingdom,2022-10-31,Pharyngula,Embryo,Whole Organism,All anatomical structures
11230,ERR10368635,ERX9900558,ERS13563104,ERP141667,PRJEB56699,RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,E-MTAB-12301,Other,It has been recently shown that SNRNP70  a major component of the spliceosome  as well as other splicing regulators are found in axons. To investigate the role of SNRNP70 in axons  we generated a zebrafish null mutant and found motor connectivity defects that can be partially rescued upon transgenic overexpression of cytoplasmic only human SNRNP70 cyt hSNRNP70. To understand the molecular function of the cytoplasmic pool of this splicing protein  we performed this RNA seq experiment with the aim to identify mRNA transcripts whose expression is regulated by the cytoplasmic pool of SNRNP70. To do that  we crossed heterozygous mutant animals that are also positive for the cyt SNRNP70 transgene. We then split embryos into four groups: i sibling  ii siblings/cyt hSNRNP70  iii null  iv null/cyt hSNRNP70. Total RNA was extracted from each one of the four groups three biological replicates per sample and sequenced.,ENA FIRST PUBLIC:2022 10 31|ENA LAST UPDATE:2022 10 31,,Protocols: Embryos were collected and raised in Danieau's solution together with 2 μΜ 4 OHΤ. Treated embryos were screened for GFP fluorescence at 24hpf and sorted into the four genotypes. Total RNA from whole embryos was isolated from each genotype group at 28hpf using a RNeasy Mini kit and eluted in nuclease free water. Total RNA was purified using Illumina TruSeq Stranded Total RNA Library Prep Ribo Zero Gold,16261X5,SAMEA111469068,Department of Life Sciences University of Bath,ENA FIRST PUBLIC:2022 10 31|ENA LAST UPDATE:2022 10 31|External Id:SAMEA111469068|INSDC center alias:Department of Life Sciences University of Bath|INSDC center name:Department of Life Sciences University of Bath|INSDC first public:2022 10 31T00:16:52Z|INSDC last update:2022 10 31T00:16:52Z|INSDC status:public|Submitter Id:E MTAB 12301:16261X5|age:28|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|disease:normal|genotype:+/cyt hSNRNP70|organism part:whole organism|sample name:E MTAB 12301:16261X5,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,E MTAB 12301:16261X5 p,16261X5 p,RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,Embryos were collected and raised in Danieau's solution together with 2 μΜ 4 OHΤ. Treated embryos were screened for GFP fluorescence at 24hpf and sorted into the four genotypes. Total RNA from whole embryos was isolated from each genotype group at 28hpf using a RNeasy Mini kit and eluted in nuclease free water. Total RNA was purified using Illumina TruSeq Stranded Total RNA Library Prep Ribo Zero Gold,Experimental Factor: genotype:+/cyt hSNRNP70,RNA-Seq,TRANSCRIPTOMIC,Inverse rRNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP141667,Illumina NovaSeq 6000 paired end sequencing; RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,ENA FIRST PUBLIC:2022 10 31|ENA LAST UPDATE:2022 10 31,16261X5_190815_A00421_0101_BHFL23DRXX_S8_L001_R1_001.fastq.gz 16261X5_190815_A00421_0101_BHFL23DRXX_S8_L001_R2_001.fastq.gz,fastq fastq,2656716072.0,26046236.0,E MTAB 12301:16261X5 190815 A00421 0101 BHFL23DRXX S8 L001 R,0:51 1:51,A:693979046;C:627484571;G:617505105;T:717493108;N:254242,51,51,,,693979046,627484571,617505105,717493108,254242,ERX9900558,ERS13563104,ERA18523376,Department of Life Sciences University of Bath|European Nucleotide Archive,Department of Life Sciences University of Bath|European Nucleotide Archive,2,0.94387,0.94796,0.16299,0.16183,0.69556,0.69581,0.46842,0.47334,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,rrna_depletion,trueseq,bulk,bulk,bulk,,United Kingdom,2022-10-31,Pharyngula,Embryo,Whole Organism,All anatomical structures
11231,ERR10368634,ERX9900557,ERS13563103,ERP141667,PRJEB56699,RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,E-MTAB-12301,Other,It has been recently shown that SNRNP70  a major component of the spliceosome  as well as other splicing regulators are found in axons. To investigate the role of SNRNP70 in axons  we generated a zebrafish null mutant and found motor connectivity defects that can be partially rescued upon transgenic overexpression of cytoplasmic only human SNRNP70 cyt hSNRNP70. To understand the molecular function of the cytoplasmic pool of this splicing protein  we performed this RNA seq experiment with the aim to identify mRNA transcripts whose expression is regulated by the cytoplasmic pool of SNRNP70. To do that  we crossed heterozygous mutant animals that are also positive for the cyt SNRNP70 transgene. We then split embryos into four groups: i sibling  ii siblings/cyt hSNRNP70  iii null  iv null/cyt hSNRNP70. Total RNA was extracted from each one of the four groups three biological replicates per sample and sequenced.,ENA FIRST PUBLIC:2022 10 31|ENA LAST UPDATE:2022 10 31,,Protocols: Embryos were collected and raised in Danieau's solution together with 2 μΜ 4 OHΤ. Treated embryos were screened for GFP fluorescence at 24hpf and sorted into the four genotypes. Total RNA from whole embryos was isolated from each genotype group at 28hpf using a RNeasy Mini kit and eluted in nuclease free water. Total RNA was purified using Illumina TruSeq Stranded Total RNA Library Prep Ribo Zero Gold,16261X4,SAMEA111469067,Department of Life Sciences University of Bath,ENA FIRST PUBLIC:2022 10 31|ENA LAST UPDATE:2022 10 31|External Id:SAMEA111469067|INSDC center alias:Department of Life Sciences University of Bath|INSDC center name:Department of Life Sciences University of Bath|INSDC first public:2022 10 31T00:16:52Z|INSDC last update:2022 10 31T00:16:52Z|INSDC status:public|Submitter Id:E MTAB 12301:16261X4|age:28|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|disease:normal|genotype:+/cyt hSNRNP70|organism part:whole organism|sample name:E MTAB 12301:16261X4,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,E MTAB 12301:16261X4 p,16261X4 p,RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,Embryos were collected and raised in Danieau's solution together with 2 μΜ 4 OHΤ. Treated embryos were screened for GFP fluorescence at 24hpf and sorted into the four genotypes. Total RNA from whole embryos was isolated from each genotype group at 28hpf using a RNeasy Mini kit and eluted in nuclease free water. Total RNA was purified using Illumina TruSeq Stranded Total RNA Library Prep Ribo Zero Gold,Experimental Factor: genotype:+/cyt hSNRNP70,RNA-Seq,TRANSCRIPTOMIC,Inverse rRNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP141667,Illumina NovaSeq 6000 paired end sequencing; RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,ENA FIRST PUBLIC:2022 10 31|ENA LAST UPDATE:2022 10 31,16261X4_190815_A00421_0101_BHFL23DRXX_S9_L001_R1_001.fastq.gz 16261X4_190815_A00421_0101_BHFL23DRXX_S9_L001_R2_001.fastq.gz,fastq fastq,2693177298.0,26403699.0,E MTAB 12301:16261X4 190815 A00421 0101 BHFL23DRXX S9 L001 R,0:51 1:51,A:698547378;C:640687214;G:628869192;T:724816757;N:256757,51,51,,,698547378,640687214,628869192,724816757,256757,ERX9900557,ERS13563103,ERA18523376,Department of Life Sciences University of Bath|European Nucleotide Archive,Department of Life Sciences University of Bath|European Nucleotide Archive,2,0.94101,0.94526,0.17344,0.17201,0.68619,0.68513,0.47366,0.4702,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,rrna_depletion,trueseq,bulk,bulk,bulk,,United Kingdom,2022-10-31,Pharyngula,Embryo,Whole Organism,All anatomical structures
11232,ERR10368633,ERX9900556,ERS13563102,ERP141667,PRJEB56699,RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,E-MTAB-12301,Other,It has been recently shown that SNRNP70  a major component of the spliceosome  as well as other splicing regulators are found in axons. To investigate the role of SNRNP70 in axons  we generated a zebrafish null mutant and found motor connectivity defects that can be partially rescued upon transgenic overexpression of cytoplasmic only human SNRNP70 cyt hSNRNP70. To understand the molecular function of the cytoplasmic pool of this splicing protein  we performed this RNA seq experiment with the aim to identify mRNA transcripts whose expression is regulated by the cytoplasmic pool of SNRNP70. To do that  we crossed heterozygous mutant animals that are also positive for the cyt SNRNP70 transgene. We then split embryos into four groups: i sibling  ii siblings/cyt hSNRNP70  iii null  iv null/cyt hSNRNP70. Total RNA was extracted from each one of the four groups three biological replicates per sample and sequenced.,ENA FIRST PUBLIC:2022 10 31|ENA LAST UPDATE:2022 10 31,,Protocols: Embryos were collected and raised in Danieau's solution together with 2 μΜ 4 OHΤ. Treated embryos were screened for GFP fluorescence at 24hpf and sorted into the four genotypes. Total RNA from whole embryos was isolated from each genotype group at 28hpf using a RNeasy Mini kit and eluted in nuclease free water. Total RNA was purified using Illumina TruSeq Stranded Total RNA Library Prep Ribo Zero Gold,16261X3,SAMEA111469066,Department of Life Sciences University of Bath,ENA FIRST PUBLIC:2022 10 31|ENA LAST UPDATE:2022 10 31|External Id:SAMEA111469066|INSDC center alias:Department of Life Sciences University of Bath|INSDC center name:Department of Life Sciences University of Bath|INSDC first public:2022 10 31T00:16:52Z|INSDC last update:2022 10 31T00:16:52Z|INSDC status:public|Submitter Id:E MTAB 12301:16261X3|age:28|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|disease:normal|genotype:wild type genotype|organism part:whole organism|sample name:E MTAB 12301:16261X3,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,E MTAB 12301:16261X3 p,16261X3 p,RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,Embryos were collected and raised in Danieau's solution together with 2 μΜ 4 OHΤ. Treated embryos were screened for GFP fluorescence at 24hpf and sorted into the four genotypes. Total RNA from whole embryos was isolated from each genotype group at 28hpf using a RNeasy Mini kit and eluted in nuclease free water. Total RNA was purified using Illumina TruSeq Stranded Total RNA Library Prep Ribo Zero Gold,Experimental Factor: genotype:wild type genotype,RNA-Seq,TRANSCRIPTOMIC,Inverse rRNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP141667,Illumina NovaSeq 6000 paired end sequencing; RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,ENA FIRST PUBLIC:2022 10 31|ENA LAST UPDATE:2022 10 31|loader:fastq load.py|options:  dnus,16261X3_190815_A00421_0101_BHFL23DRXX_S10_L001_R1_001.fastq.gz 16261X3_190815_A00421_0101_BHFL23DRXX_S10_L001_R2_001.fastq.gz,fastq fastq,3104796462.0,60878362.0,E MTAB 12301:16261X3 190815 A00421 0101 BHFL23DRXX S10 L001 R,0:51,A:803595677;C:737898133;G:731641815;T:831364716;N:296121,51,,,,803595677,737898133,731641815,831364716,296121,ERX9900556,ERS13563102,ERA18523376,Department of Life Sciences University of Bath|European Nucleotide Archive,Department of Life Sciences University of Bath|European Nucleotide Archive,1,0.94361,,0.16161,,0.69822,,0.4647,,51,,B,,usable mapping rate,illumina,novaseq_era,unknown,rrna_depletion,trueseq,bulk,bulk,bulk,,United Kingdom,2022-10-31,Pharyngula,Embryo,Whole Organism,All anatomical structures
11233,ERR10368632,ERX9900555,ERS13563101,ERP141667,PRJEB56699,RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,E-MTAB-12301,Other,It has been recently shown that SNRNP70  a major component of the spliceosome  as well as other splicing regulators are found in axons. To investigate the role of SNRNP70 in axons  we generated a zebrafish null mutant and found motor connectivity defects that can be partially rescued upon transgenic overexpression of cytoplasmic only human SNRNP70 cyt hSNRNP70. To understand the molecular function of the cytoplasmic pool of this splicing protein  we performed this RNA seq experiment with the aim to identify mRNA transcripts whose expression is regulated by the cytoplasmic pool of SNRNP70. To do that  we crossed heterozygous mutant animals that are also positive for the cyt SNRNP70 transgene. We then split embryos into four groups: i sibling  ii siblings/cyt hSNRNP70  iii null  iv null/cyt hSNRNP70. Total RNA was extracted from each one of the four groups three biological replicates per sample and sequenced.,ENA FIRST PUBLIC:2022 10 31|ENA LAST UPDATE:2022 10 31,,Protocols: Embryos were collected and raised in Danieau's solution together with 2 μΜ 4 OHΤ. Treated embryos were screened for GFP fluorescence at 24hpf and sorted into the four genotypes. Total RNA from whole embryos was isolated from each genotype group at 28hpf using a RNeasy Mini kit and eluted in nuclease free water. Total RNA was purified using Illumina TruSeq Stranded Total RNA Library Prep Ribo Zero Gold,16261X2,SAMEA111469065,Department of Life Sciences University of Bath,ENA FIRST PUBLIC:2022 10 31|ENA LAST UPDATE:2022 10 31|External Id:SAMEA111469065|INSDC center alias:Department of Life Sciences University of Bath|INSDC center name:Department of Life Sciences University of Bath|INSDC first public:2022 10 31T00:16:52Z|INSDC last update:2022 10 31T00:16:52Z|INSDC status:public|Submitter Id:E MTAB 12301:16261X2|age:28|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|disease:normal|genotype:wild type genotype|organism part:whole organism|sample name:E MTAB 12301:16261X2,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,E MTAB 12301:16261X2 p,16261X2 p,RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,Embryos were collected and raised in Danieau's solution together with 2 μΜ 4 OHΤ. Treated embryos were screened for GFP fluorescence at 24hpf and sorted into the four genotypes. Total RNA from whole embryos was isolated from each genotype group at 28hpf using a RNeasy Mini kit and eluted in nuclease free water. Total RNA was purified using Illumina TruSeq Stranded Total RNA Library Prep Ribo Zero Gold,Experimental Factor: genotype:wild type genotype,RNA-Seq,TRANSCRIPTOMIC,Inverse rRNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP141667,Illumina NovaSeq 6000 paired end sequencing; RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,ENA FIRST PUBLIC:2022 10 31|ENA LAST UPDATE:2022 10 31,16261X2_190815_A00421_0101_BHFL23DRXX_S11_L001_R1_001.fastq.gz 16261X2_190815_A00421_0101_BHFL23DRXX_S11_L001_R2_001.fastq.gz,fastq fastq,2935625892.0,28780646.0,E MTAB 12301:16261X2 190815 A00421 0101 BHFL23DRXX S11 L001 R,0:51 1:51,A:759844700;C:699591057;G:694530268;T:781380766;N:279101,51,51,,,759844700,699591057,694530268,781380766,279101,ERX9900555,ERS13563101,ERA18523376,Department of Life Sciences University of Bath|European Nucleotide Archive,Department of Life Sciences University of Bath|European Nucleotide Archive,2,0.93297,0.93744,0.16748,0.16566,0.69929,0.6996,0.4788,0.47875,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,rrna_depletion,trueseq,bulk,bulk,bulk,,United Kingdom,2022-10-31,Pharyngula,Embryo,Whole Organism,All anatomical structures
11234,ERR10368631,ERX9900554,ERS13563100,ERP141667,PRJEB56699,RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,E-MTAB-12301,Other,It has been recently shown that SNRNP70  a major component of the spliceosome  as well as other splicing regulators are found in axons. To investigate the role of SNRNP70 in axons  we generated a zebrafish null mutant and found motor connectivity defects that can be partially rescued upon transgenic overexpression of cytoplasmic only human SNRNP70 cyt hSNRNP70. To understand the molecular function of the cytoplasmic pool of this splicing protein  we performed this RNA seq experiment with the aim to identify mRNA transcripts whose expression is regulated by the cytoplasmic pool of SNRNP70. To do that  we crossed heterozygous mutant animals that are also positive for the cyt SNRNP70 transgene. We then split embryos into four groups: i sibling  ii siblings/cyt hSNRNP70  iii null  iv null/cyt hSNRNP70. Total RNA was extracted from each one of the four groups three biological replicates per sample and sequenced.,ENA FIRST PUBLIC:2022 10 31|ENA LAST UPDATE:2022 10 31,,Protocols: Embryos were collected and raised in Danieau's solution together with 2 μΜ 4 OHΤ. Treated embryos were screened for GFP fluorescence at 24hpf and sorted into the four genotypes. Total RNA from whole embryos was isolated from each genotype group at 28hpf using a RNeasy Mini kit and eluted in nuclease free water. Total RNA was purified using Illumina TruSeq Stranded Total RNA Library Prep Ribo Zero Gold,16261X12,SAMEA111469064,Department of Life Sciences University of Bath,ENA FIRST PUBLIC:2022 10 31|ENA LAST UPDATE:2022 10 31|External Id:SAMEA111469064|INSDC center alias:Department of Life Sciences University of Bath|INSDC center name:Department of Life Sciences University of Bath|INSDC first public:2022 10 31T00:16:52Z|INSDC last update:2022 10 31T00:16:52Z|INSDC status:public|Submitter Id:E MTAB 12301:16261X12|age:28|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|disease:normal|genotype:cyt hSNRNP70/ |organism part:whole organism|sample name:E MTAB 12301:16261X12,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,E MTAB 12301:16261X12 p,16261X12 p,RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,Embryos were collected and raised in Danieau's solution together with 2 μΜ 4 OHΤ. Treated embryos were screened for GFP fluorescence at 24hpf and sorted into the four genotypes. Total RNA from whole embryos was isolated from each genotype group at 28hpf using a RNeasy Mini kit and eluted in nuclease free water. Total RNA was purified using Illumina TruSeq Stranded Total RNA Library Prep Ribo Zero Gold,Experimental Factor: genotype:cyt hSNRNP70/ ,RNA-Seq,TRANSCRIPTOMIC,Inverse rRNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP141667,Illumina NovaSeq 6000 paired end sequencing; RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,ENA FIRST PUBLIC:2022 10 31|ENA LAST UPDATE:2022 10 31,16261X12_190815_A00421_0101_BHFL23DRXX_S3_L001_R1_001.fastq.gz 16261X12_190815_A00421_0101_BHFL23DRXX_S3_L001_R2_001.fastq.gz,fastq fastq,7451469240.0,73053620.0,E MTAB 12301:16261X12 190815 A00421 0101 BHFL23DRXX S3 L001 R,0:51 1:51,A:1950856364;C:1747213644;G:1718730947;T:2033957057;N:711228,51,51,,,1950856364,1747213644,1718730947,2033957057,711228,ERX9900554,ERS13563100,ERA18523376,Department of Life Sciences University of Bath|European Nucleotide Archive,Department of Life Sciences University of Bath|European Nucleotide Archive,2,0.9372,0.94118,0.20267,0.19972,0.69794,0.69735,0.47505,0.4883,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,rrna_depletion,trueseq,bulk,bulk,bulk,,United Kingdom,2022-10-31,Pharyngula,Embryo,Whole Organism,All anatomical structures
11235,ERR10368630,ERX9900553,ERS13563099,ERP141667,PRJEB56699,RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,E-MTAB-12301,Other,It has been recently shown that SNRNP70  a major component of the spliceosome  as well as other splicing regulators are found in axons. To investigate the role of SNRNP70 in axons  we generated a zebrafish null mutant and found motor connectivity defects that can be partially rescued upon transgenic overexpression of cytoplasmic only human SNRNP70 cyt hSNRNP70. To understand the molecular function of the cytoplasmic pool of this splicing protein  we performed this RNA seq experiment with the aim to identify mRNA transcripts whose expression is regulated by the cytoplasmic pool of SNRNP70. To do that  we crossed heterozygous mutant animals that are also positive for the cyt SNRNP70 transgene. We then split embryos into four groups: i sibling  ii siblings/cyt hSNRNP70  iii null  iv null/cyt hSNRNP70. Total RNA was extracted from each one of the four groups three biological replicates per sample and sequenced.,ENA FIRST PUBLIC:2022 10 31|ENA LAST UPDATE:2022 10 31,,Protocols: Embryos were collected and raised in Danieau's solution together with 2 μΜ 4 OHΤ. Treated embryos were screened for GFP fluorescence at 24hpf and sorted into the four genotypes. Total RNA from whole embryos was isolated from each genotype group at 28hpf using a RNeasy Mini kit and eluted in nuclease free water. Total RNA was purified using Illumina TruSeq Stranded Total RNA Library Prep Ribo Zero Gold,16261X11,SAMEA111469063,Department of Life Sciences University of Bath,ENA FIRST PUBLIC:2022 10 31|ENA LAST UPDATE:2022 10 31|External Id:SAMEA111469063|INSDC center alias:Department of Life Sciences University of Bath|INSDC center name:Department of Life Sciences University of Bath|INSDC first public:2022 10 31T00:16:51Z|INSDC last update:2022 10 31T00:16:51Z|INSDC status:public|Submitter Id:E MTAB 12301:16261X11|age:28|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|disease:normal|genotype:cyt hSNRNP70/ |organism part:whole organism|sample name:E MTAB 12301:16261X11,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,E MTAB 12301:16261X11 p,16261X11 p,RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,Embryos were collected and raised in Danieau's solution together with 2 μΜ 4 OHΤ. Treated embryos were screened for GFP fluorescence at 24hpf and sorted into the four genotypes. Total RNA from whole embryos was isolated from each genotype group at 28hpf using a RNeasy Mini kit and eluted in nuclease free water. Total RNA was purified using Illumina TruSeq Stranded Total RNA Library Prep Ribo Zero Gold,Experimental Factor: genotype:cyt hSNRNP70/ ,RNA-Seq,TRANSCRIPTOMIC,Inverse rRNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP141667,Illumina NovaSeq 6000 paired end sequencing; RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,ENA FIRST PUBLIC:2022 10 31|ENA LAST UPDATE:2022 10 31,16261X11_190815_A00421_0101_BHFL23DRXX_S5_L001_R1_001.fastq.gz 16261X11_190815_A00421_0101_BHFL23DRXX_S5_L001_R2_001.fastq.gz,fastq fastq,2754589458.0,27005779.0,E MTAB 12301:16261X11 190815 A00421 0101 BHFL23DRXX S5 L001 R,0:51 1:51,A:715675810;C:652231961;G:640938288;T:745480460;N:262939,51,51,,,715675810,652231961,640938288,745480460,262939,ERX9900553,ERS13563099,ERA18523376,Department of Life Sciences University of Bath|European Nucleotide Archive,Department of Life Sciences University of Bath|European Nucleotide Archive,2,0.93802,0.94247,0.17937,0.17728,0.70195,0.70067,0.48458,0.48364,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,rrna_depletion,trueseq,bulk,bulk,bulk,,United Kingdom,2022-10-31,Pharyngula,Embryo,Whole Organism,All anatomical structures
11236,ERR10368629,ERX9900552,ERS13563098,ERP141667,PRJEB56699,RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,E-MTAB-12301,Other,It has been recently shown that SNRNP70  a major component of the spliceosome  as well as other splicing regulators are found in axons. To investigate the role of SNRNP70 in axons  we generated a zebrafish null mutant and found motor connectivity defects that can be partially rescued upon transgenic overexpression of cytoplasmic only human SNRNP70 cyt hSNRNP70. To understand the molecular function of the cytoplasmic pool of this splicing protein  we performed this RNA seq experiment with the aim to identify mRNA transcripts whose expression is regulated by the cytoplasmic pool of SNRNP70. To do that  we crossed heterozygous mutant animals that are also positive for the cyt SNRNP70 transgene. We then split embryos into four groups: i sibling  ii siblings/cyt hSNRNP70  iii null  iv null/cyt hSNRNP70. Total RNA was extracted from each one of the four groups three biological replicates per sample and sequenced.,ENA FIRST PUBLIC:2022 10 31|ENA LAST UPDATE:2022 10 31,,Protocols: Embryos were collected and raised in Danieau's solution together with 2 μΜ 4 OHΤ. Treated embryos were screened for GFP fluorescence at 24hpf and sorted into the four genotypes. Total RNA from whole embryos was isolated from each genotype group at 28hpf using a RNeasy Mini kit and eluted in nuclease free water. Total RNA was purified using Illumina TruSeq Stranded Total RNA Library Prep Ribo Zero Gold,16261X10,SAMEA111469062,Department of Life Sciences University of Bath,ENA FIRST PUBLIC:2022 10 31|ENA LAST UPDATE:2022 10 31|External Id:SAMEA111469062|INSDC center alias:Department of Life Sciences University of Bath|INSDC center name:Department of Life Sciences University of Bath|INSDC first public:2022 10 31T00:16:51Z|INSDC last update:2022 10 31T00:16:51Z|INSDC status:public|Submitter Id:E MTAB 12301:16261X10|age:28|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|disease:normal|genotype:cyt hSNRNP70/ |organism part:whole organism|sample name:E MTAB 12301:16261X10,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,E MTAB 12301:16261X10 p,16261X10 p,RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,Embryos were collected and raised in Danieau's solution together with 2 μΜ 4 OHΤ. Treated embryos were screened for GFP fluorescence at 24hpf and sorted into the four genotypes. Total RNA from whole embryos was isolated from each genotype group at 28hpf using a RNeasy Mini kit and eluted in nuclease free water. Total RNA was purified using Illumina TruSeq Stranded Total RNA Library Prep Ribo Zero Gold,Experimental Factor: genotype:cyt hSNRNP70/ ,RNA-Seq,TRANSCRIPTOMIC,Inverse rRNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP141667,Illumina NovaSeq 6000 paired end sequencing; RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,ENA FIRST PUBLIC:2022 10 31|ENA LAST UPDATE:2022 10 31|loader:fastq load.py,16261X10_190815_A00421_0101_BHFL23DRXX_S1_L001_R1_001.fastq.gz 16261X10_190815_A00421_0101_BHFL23DRXX_S1_L001_R2_001.fastq.gz,fastq fastq,2319764682.0,22742791.0,E MTAB 12301:16261X10 190815 A00421 0101 BHFL23DRXX S1 L001 R,0:51 1:51,A:596937200;C:555502273;G:546190804;T:620912915;N:221490,51,51,,,596937200,555502273,546190804,620912915,221490,ERX9900552,ERS13563098,ERA18523376,Department of Life Sciences University of Bath|European Nucleotide Archive,Department of Life Sciences University of Bath|European Nucleotide Archive,2,0.94034,0.94451,0.1621,0.16043,0.69406,0.6928,0.4936,0.49757,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,rrna_depletion,trueseq,bulk,bulk,bulk,,United Kingdom,2022-10-31,Pharyngula,Embryo,Whole Organism,All anatomical structures
11237,ERR10368628,ERX9900551,ERS13563097,ERP141667,PRJEB56699,RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,E-MTAB-12301,Other,It has been recently shown that SNRNP70  a major component of the spliceosome  as well as other splicing regulators are found in axons. To investigate the role of SNRNP70 in axons  we generated a zebrafish null mutant and found motor connectivity defects that can be partially rescued upon transgenic overexpression of cytoplasmic only human SNRNP70 cyt hSNRNP70. To understand the molecular function of the cytoplasmic pool of this splicing protein  we performed this RNA seq experiment with the aim to identify mRNA transcripts whose expression is regulated by the cytoplasmic pool of SNRNP70. To do that  we crossed heterozygous mutant animals that are also positive for the cyt SNRNP70 transgene. We then split embryos into four groups: i sibling  ii siblings/cyt hSNRNP70  iii null  iv null/cyt hSNRNP70. Total RNA was extracted from each one of the four groups three biological replicates per sample and sequenced.,ENA FIRST PUBLIC:2022 10 31|ENA LAST UPDATE:2022 10 31,,Protocols: Embryos were collected and raised in Danieau's solution together with 2 μΜ 4 OHΤ. Treated embryos were screened for GFP fluorescence at 24hpf and sorted into the four genotypes. Total RNA from whole embryos was isolated from each genotype group at 28hpf using a RNeasy Mini kit and eluted in nuclease free water. Total RNA was purified using Illumina TruSeq Stranded Total RNA Library Prep Ribo Zero Gold,16261X1,SAMEA111469061,Department of Life Sciences University of Bath,ENA FIRST PUBLIC:2022 10 31|ENA LAST UPDATE:2022 10 31|External Id:SAMEA111469061|INSDC center alias:Department of Life Sciences University of Bath|INSDC center name:Department of Life Sciences University of Bath|INSDC first public:2022 10 31T00:16:51Z|INSDC last update:2022 10 31T00:16:51Z|INSDC status:public|Submitter Id:E MTAB 12301:16261X1|age:28|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|disease:normal|genotype:wild type genotype|organism part:whole organism|sample name:E MTAB 12301:16261X1,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,E MTAB 12301:16261X1 p,16261X1 p,RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,Embryos were collected and raised in Danieau's solution together with 2 μΜ 4 OHΤ. Treated embryos were screened for GFP fluorescence at 24hpf and sorted into the four genotypes. Total RNA from whole embryos was isolated from each genotype group at 28hpf using a RNeasy Mini kit and eluted in nuclease free water. Total RNA was purified using Illumina TruSeq Stranded Total RNA Library Prep Ribo Zero Gold,Experimental Factor: genotype:wild type genotype,RNA-Seq,TRANSCRIPTOMIC,Inverse rRNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP141667,Illumina NovaSeq 6000 paired end sequencing; RNA seq of snrnp70 mutant zebrafish and its rescue by overexpression of cytoplasmic SNRNP70,ENA FIRST PUBLIC:2022 10 31|ENA LAST UPDATE:2022 10 31|loader:fastq load.py,16261X1_190815_A00421_0101_BHFL23DRXX_S12_L001_R1_001.fastq.gz 16261X1_190815_A00421_0101_BHFL23DRXX_S12_L001_R2_001.fastq.gz,fastq fastq,2992675512.0,29339956.0,E MTAB 12301:16261X1 190815 A00421 0101 BHFL23DRXX S12 L001 R,0:51 1:51,A:768607745;C:718646844;G:713246748;T:791888447;N:285728,51,51,,,768607745,718646844,713246748,791888447,285728,ERX9900551,ERS13563097,ERA18523376,Department of Life Sciences University of Bath|European Nucleotide Archive,Department of Life Sciences University of Bath|European Nucleotide Archive,2,0.94414,0.94881,0.16725,0.16648,0.68909,0.68923,0.47873,0.48244,51,51,B,B,biological fallback assumption,illumina,novaseq_era,unknown,rrna_depletion,trueseq,bulk,bulk,bulk,,United Kingdom,2022-10-31,Pharyngula,Embryo,Whole Organism,All anatomical structures
15394,ERR12724517,ERX12099016,ERS18400121,ERP158370,PRJEB73599,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,E-MTAB-13886,Transcriptome Analysis,Bulk tissue RNA sequencing of individual 24hpf zebrafish larvae to compare the gene expression values between wild type and foxg1a nonsense mutants heterozygous and homozygous mutants.   The mutation is a 5bp deletion 32bp from canonical start codon; AAATG deleted.,ENA FIRST PUBLIC:2024 03 29|ENA LAST UPDATE:2024 03 29,,Protocols: Heterozygous mutant 5bp deletion 32 bp from canonical start codon; AAATG foxg1a adult zebrafish in a dlx5 6;GFP background were incrossed and progeny collected. Dlx+ interneuron phenotype was used to identify homozygous no interneurons in telencephalon and heterozygous reduced number of interneurons in telencephalon. Genotyping was confirmed with RNA sequencing reads at the foxg1a gene locus to ensure correct genotyping. RNA was extracted from single 24hpf zebrafish using the Qiagen RNeasy Micro Kit Qiagen  74004. RNA concentration was measured using the Qubit reagent kit and a small sample was tested for RNA integrity using a bioanalyzer instrument. Only samples with an RNA integrity number of 9 or above were used in this experiment. Total RNA Library was repapred using the Illumina TruSeq Stranded Total RNA Library kit. Ribosomal RNAs were depleted using Ribo Zero Gold.,Foxg1 WT 2,E MTAB 13886:Foxg1 WT 2,,isolate:not applicable|organism:Danio rerio|organism:Danio rerio|collection date:not collected|scientific name:Danio rerio|common name:zebrafish|organism part:whole organism|developmental stage:pharyngula prim 5|genotype:Foxg1a WT|geographic location country and/or sea:not collected,,,,,,,,,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,E MTAB 13886:Foxg1 WT 2 p,Foxg1 WT 2 p,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,Heterozygous mutant 5bp deletion 32 bp from canonical start codon; AAATG foxg1a adult zebrafish in a dlx5 6;GFP background were incrossed and progeny collected. Dlx+ interneuron phenotype was used to identify homozygous no interneurons in telencephalon and heterozygous reduced number of interneurons in telencephalon. Genotyping was confirmed with RNA sequencing reads at the foxg1a gene locus to ensure correct genotyping. RNA was extracted from single 24hpf zebrafish using the Qiagen RNeasy Micro Kit Qiagen  74004. RNA concentration was measured using the Qubit reagent kit and a small sample was tested for RNA integrity using a bioanalyzer instrument. Only samples with an RNA integrity number of 9 or above were used in this experiment. Total RNA Library was repapred using the Illumina TruSeq Stranded Total RNA Library kit. Ribosomal RNAs were depleted using Ribo Zero Gold.,,RNA-Seq,TRANSCRIPTOMIC,Inverse rRNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP158370,Illumina NovaSeq 6000 paired end sequencing; RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,ENA FIRST PUBLIC:2024 03 29|ENA LAST UPDATE:2024 03 29,18067X14_200629_A00421_0211_BHN23CDRXX_S26_L001_R1_001.fastq.gz 18067X14_200629_A00421_0211_BHN23CDRXX_S26_L001_R2_001.fastq.gz,fastq fastq,4054926360.0,39754180.0,E MTAB 13886:18067X14 200629 A00421 0211 BHN23CDRXX S26 L001 R,0:51 1:51,A:1027112898;C:978274968;G:992295226;T:1057002684;N:240584,51,51,,,1027112898,978274968,992295226,1057002684,240584,ERX12099016,ERS18400121,ERA29264914,European Bioinformatics Institute|European Nucleotide Archive,European Bioinformatics Institute|European Nucleotide Archive,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,rrna_depletion,trueseq,bulk,bulk,bulk,,United Kingdom,2024-03-29,Pharyngula,Embryo,Whole Organism,All anatomical structures
15395,ERR12724511,ERX12099010,ERS18400115,ERP158370,PRJEB73599,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,E-MTAB-13886,Transcriptome Analysis,Bulk tissue RNA sequencing of individual 24hpf zebrafish larvae to compare the gene expression values between wild type and foxg1a nonsense mutants heterozygous and homozygous mutants.   The mutation is a 5bp deletion 32bp from canonical start codon; AAATG deleted.,ENA FIRST PUBLIC:2024 03 29|ENA LAST UPDATE:2024 03 29,,Protocols: Heterozygous mutant 5bp deletion 32 bp from canonical start codon; AAATG foxg1a adult zebrafish in a dlx5 6;GFP background were incrossed and progeny collected. Dlx+ interneuron phenotype was used to identify homozygous no interneurons in telencephalon and heterozygous reduced number of interneurons in telencephalon. Genotyping was confirmed with RNA sequencing reads at the foxg1a gene locus to ensure correct genotyping. RNA was extracted from single 24hpf zebrafish using the Qiagen RNeasy Micro Kit Qiagen  74004. RNA concentration was measured using the Qubit reagent kit and a small sample was tested for RNA integrity using a bioanalyzer instrument. Only samples with an RNA integrity number of 9 or above were used in this experiment. Total RNA Library was repapred using the Illumina TruSeq Stranded Total RNA Library kit. Ribosomal RNAs were depleted using Ribo Zero Gold.,Foxg1 het 9,E MTAB 13886:Foxg1 het 9,,isolate:not applicable|organism:Danio rerio|organism:Danio rerio|collection date:not collected|scientific name:Danio rerio|common name:zebrafish|organism part:whole organism|developmental stage:pharyngula prim 5|genotype:Foxg1a het|geographic location country and/or sea:not collected,,,,,,,,,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,E MTAB 13886:Foxg1 het 9 p,Foxg1 het 9 p,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,Heterozygous mutant 5bp deletion 32 bp from canonical start codon; AAATG foxg1a adult zebrafish in a dlx5 6;GFP background were incrossed and progeny collected. Dlx+ interneuron phenotype was used to identify homozygous no interneurons in telencephalon and heterozygous reduced number of interneurons in telencephalon. Genotyping was confirmed with RNA sequencing reads at the foxg1a gene locus to ensure correct genotyping. RNA was extracted from single 24hpf zebrafish using the Qiagen RNeasy Micro Kit Qiagen  74004. RNA concentration was measured using the Qubit reagent kit and a small sample was tested for RNA integrity using a bioanalyzer instrument. Only samples with an RNA integrity number of 9 or above were used in this experiment. Total RNA Library was repapred using the Illumina TruSeq Stranded Total RNA Library kit. Ribosomal RNAs were depleted using Ribo Zero Gold.,,RNA-Seq,TRANSCRIPTOMIC,Inverse rRNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP158370,Illumina NovaSeq 6000 paired end sequencing; RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,ENA FIRST PUBLIC:2024 03 29|ENA LAST UPDATE:2024 03 29,18067X11_200629_A00421_0211_BHN23CDRXX_S18_L001_R1_001.fastq.gz 18067X11_200629_A00421_0211_BHN23CDRXX_S18_L001_R2_001.fastq.gz,fastq fastq,2866917570.0,28107035.0,E MTAB 13886:18067X11 200629 A00421 0211 BHN23CDRXX S18 L001 R,0:51 1:51,A:725353172;C:688761995;G:699694713;T:752936948;N:170742,51,51,,,725353172,688761995,699694713,752936948,170742,ERX12099010,ERS18400115,ERA29264914,European Bioinformatics Institute|European Nucleotide Archive,European Bioinformatics Institute|European Nucleotide Archive,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,rrna_depletion,trueseq,bulk,bulk,bulk,,United Kingdom,2024-03-29,Pharyngula,Embryo,Whole Organism,All anatomical structures
15396,ERR12724513,ERX12099012,ERS18400117,ERP158370,PRJEB73599,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,E-MTAB-13886,Transcriptome Analysis,Bulk tissue RNA sequencing of individual 24hpf zebrafish larvae to compare the gene expression values between wild type and foxg1a nonsense mutants heterozygous and homozygous mutants.   The mutation is a 5bp deletion 32bp from canonical start codon; AAATG deleted.,ENA FIRST PUBLIC:2024 03 29|ENA LAST UPDATE:2024 03 29,,Protocols: Heterozygous mutant 5bp deletion 32 bp from canonical start codon; AAATG foxg1a adult zebrafish in a dlx5 6;GFP background were incrossed and progeny collected. Dlx+ interneuron phenotype was used to identify homozygous no interneurons in telencephalon and heterozygous reduced number of interneurons in telencephalon. Genotyping was confirmed with RNA sequencing reads at the foxg1a gene locus to ensure correct genotyping. RNA was extracted from single 24hpf zebrafish using the Qiagen RNeasy Micro Kit Qiagen  74004. RNA concentration was measured using the Qubit reagent kit and a small sample was tested for RNA integrity using a bioanalyzer instrument. Only samples with an RNA integrity number of 9 or above were used in this experiment. Total RNA Library was repapred using the Illumina TruSeq Stranded Total RNA Library kit. Ribosomal RNAs were depleted using Ribo Zero Gold.,Foxg1 null 2,E MTAB 13886:Foxg1 null 2,,isolate:not applicable|organism:Danio rerio|organism:Danio rerio|collection date:not collected|scientific name:Danio rerio|common name:zebrafish|organism part:whole organism|developmental stage:pharyngula prim 5|genotype:Foxg1a hom|geographic location country and/or sea:not collected,,,,,,,,,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,E MTAB 13886:Foxg1 null 2 p,Foxg1 null 2 p,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,Heterozygous mutant 5bp deletion 32 bp from canonical start codon; AAATG foxg1a adult zebrafish in a dlx5 6;GFP background were incrossed and progeny collected. Dlx+ interneuron phenotype was used to identify homozygous no interneurons in telencephalon and heterozygous reduced number of interneurons in telencephalon. Genotyping was confirmed with RNA sequencing reads at the foxg1a gene locus to ensure correct genotyping. RNA was extracted from single 24hpf zebrafish using the Qiagen RNeasy Micro Kit Qiagen  74004. RNA concentration was measured using the Qubit reagent kit and a small sample was tested for RNA integrity using a bioanalyzer instrument. Only samples with an RNA integrity number of 9 or above were used in this experiment. Total RNA Library was repapred using the Illumina TruSeq Stranded Total RNA Library kit. Ribosomal RNAs were depleted using Ribo Zero Gold.,,RNA-Seq,TRANSCRIPTOMIC,Inverse rRNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP158370,Illumina NovaSeq 6000 paired end sequencing; RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,ENA FIRST PUBLIC:2024 03 29|ENA LAST UPDATE:2024 03 29,18067X2_200629_A00421_0211_BHN23CDRXX_S27_L001_R1_001.fastq.gz 18067X2_200629_A00421_0211_BHN23CDRXX_S27_L001_R2_001.fastq.gz,fastq fastq,2908778880.0,28517440.0,E MTAB 13886:18067X2 200629 A00421 0211 BHN23CDRXX S27 L001 R,0:51 1:51,A:734785178;C:700849624;G:712519278;T:760452796;N:172004,51,51,,,734785178,700849624,712519278,760452796,172004,ERX12099012,ERS18400117,ERA29264914,European Bioinformatics Institute|European Nucleotide Archive,European Bioinformatics Institute|European Nucleotide Archive,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,rrna_depletion,trueseq,bulk,bulk,bulk,,United Kingdom,2024-03-29,Pharyngula,Embryo,Whole Organism,All anatomical structures
15397,ERR12724507,ERX12099006,ERS18400111,ERP158370,PRJEB73599,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,E-MTAB-13886,Transcriptome Analysis,Bulk tissue RNA sequencing of individual 24hpf zebrafish larvae to compare the gene expression values between wild type and foxg1a nonsense mutants heterozygous and homozygous mutants.   The mutation is a 5bp deletion 32bp from canonical start codon; AAATG deleted.,ENA FIRST PUBLIC:2024 03 29|ENA LAST UPDATE:2024 03 29,,Protocols: Heterozygous mutant 5bp deletion 32 bp from canonical start codon; AAATG foxg1a adult zebrafish in a dlx5 6;GFP background were incrossed and progeny collected. Dlx+ interneuron phenotype was used to identify homozygous no interneurons in telencephalon and heterozygous reduced number of interneurons in telencephalon. Genotyping was confirmed with RNA sequencing reads at the foxg1a gene locus to ensure correct genotyping. RNA was extracted from single 24hpf zebrafish using the Qiagen RNeasy Micro Kit Qiagen  74004. RNA concentration was measured using the Qubit reagent kit and a small sample was tested for RNA integrity using a bioanalyzer instrument. Only samples with an RNA integrity number of 9 or above were used in this experiment. Total RNA Library was repapred using the Illumina TruSeq Stranded Total RNA Library kit. Ribosomal RNAs were depleted using Ribo Zero Gold.,Foxg1 het 5,E MTAB 13886:Foxg1 het 5,,isolate:not applicable|organism:Danio rerio|organism:Danio rerio|collection date:not collected|scientific name:Danio rerio|common name:zebrafish|organism part:whole organism|developmental stage:pharyngula prim 5|genotype:Foxg1a het|geographic location country and/or sea:not collected,,,,,,,,,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,E MTAB 13886:Foxg1 het 5 p,Foxg1 het 5 p,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,Heterozygous mutant 5bp deletion 32 bp from canonical start codon; AAATG foxg1a adult zebrafish in a dlx5 6;GFP background were incrossed and progeny collected. Dlx+ interneuron phenotype was used to identify homozygous no interneurons in telencephalon and heterozygous reduced number of interneurons in telencephalon. Genotyping was confirmed with RNA sequencing reads at the foxg1a gene locus to ensure correct genotyping. RNA was extracted from single 24hpf zebrafish using the Qiagen RNeasy Micro Kit Qiagen  74004. RNA concentration was measured using the Qubit reagent kit and a small sample was tested for RNA integrity using a bioanalyzer instrument. Only samples with an RNA integrity number of 9 or above were used in this experiment. Total RNA Library was repapred using the Illumina TruSeq Stranded Total RNA Library kit. Ribosomal RNAs were depleted using Ribo Zero Gold.,,RNA-Seq,TRANSCRIPTOMIC,Inverse rRNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP158370,Illumina NovaSeq 6000 paired end sequencing; RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,ENA FIRST PUBLIC:2024 03 29|ENA LAST UPDATE:2024 03 29,18067X7_200629_A00421_0211_BHN23CDRXX_S19_L001_R1_001.fastq.gz 18067X7_200629_A00421_0211_BHN23CDRXX_S19_L001_R2_001.fastq.gz,fastq fastq,3111366282.0,30503591.0,E MTAB 13886:18067X7 200629 A00421 0211 BHN23CDRXX S19 L001 R,0:51 1:51,A:780094412;C:754603273;G:768441715;T:808041650;N:185232,51,51,,,780094412,754603273,768441715,808041650,185232,ERX12099006,ERS18400111,ERA29264914,European Bioinformatics Institute|European Nucleotide Archive,European Bioinformatics Institute|European Nucleotide Archive,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,rrna_depletion,trueseq,bulk,bulk,bulk,,United Kingdom,2024-03-29,Pharyngula,Embryo,Whole Organism,All anatomical structures
15398,ERR12724519,ERX12099018,ERS18400123,ERP158370,PRJEB73599,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,E-MTAB-13886,Transcriptome Analysis,Bulk tissue RNA sequencing of individual 24hpf zebrafish larvae to compare the gene expression values between wild type and foxg1a nonsense mutants heterozygous and homozygous mutants.   The mutation is a 5bp deletion 32bp from canonical start codon; AAATG deleted.,ENA FIRST PUBLIC:2024 03 29|ENA LAST UPDATE:2024 03 29,,Protocols: Heterozygous mutant 5bp deletion 32 bp from canonical start codon; AAATG foxg1a adult zebrafish in a dlx5 6;GFP background were incrossed and progeny collected. Dlx+ interneuron phenotype was used to identify homozygous no interneurons in telencephalon and heterozygous reduced number of interneurons in telencephalon. Genotyping was confirmed with RNA sequencing reads at the foxg1a gene locus to ensure correct genotyping. RNA was extracted from single 24hpf zebrafish using the Qiagen RNeasy Micro Kit Qiagen  74004. RNA concentration was measured using the Qubit reagent kit and a small sample was tested for RNA integrity using a bioanalyzer instrument. Only samples with an RNA integrity number of 9 or above were used in this experiment. Total RNA Library was repapred using the Illumina TruSeq Stranded Total RNA Library kit. Ribosomal RNAs were depleted using Ribo Zero Gold.,Foxg1 WT 6,E MTAB 13886:Foxg1 WT 6,,isolate:not applicable|organism:Danio rerio|organism:Danio rerio|collection date:not collected|scientific name:Danio rerio|common name:zebrafish|organism part:whole organism|developmental stage:pharyngula prim 5|genotype:Foxg1a WT|geographic location country and/or sea:not collected,,,,,,,,,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,E MTAB 13886:Foxg1 WT 6 p,Foxg1 WT 6 p,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,Heterozygous mutant 5bp deletion 32 bp from canonical start codon; AAATG foxg1a adult zebrafish in a dlx5 6;GFP background were incrossed and progeny collected. Dlx+ interneuron phenotype was used to identify homozygous no interneurons in telencephalon and heterozygous reduced number of interneurons in telencephalon. Genotyping was confirmed with RNA sequencing reads at the foxg1a gene locus to ensure correct genotyping. RNA was extracted from single 24hpf zebrafish using the Qiagen RNeasy Micro Kit Qiagen  74004. RNA concentration was measured using the Qubit reagent kit and a small sample was tested for RNA integrity using a bioanalyzer instrument. Only samples with an RNA integrity number of 9 or above were used in this experiment. Total RNA Library was repapred using the Illumina TruSeq Stranded Total RNA Library kit. Ribosomal RNAs were depleted using Ribo Zero Gold.,,RNA-Seq,TRANSCRIPTOMIC,Inverse rRNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP158370,Illumina NovaSeq 6000 paired end sequencing; RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,ENA FIRST PUBLIC:2024 03 29|ENA LAST UPDATE:2024 03 29,18067X16_200629_A00421_0211_BHN23CDRXX_S22_L001_R1_001.fastq.gz 18067X16_200629_A00421_0211_BHN23CDRXX_S22_L001_R2_001.fastq.gz,fastq fastq,3030554130.0,29711315.0,E MTAB 13886:18067X16 200629 A00421 0211 BHN23CDRXX S22 L001 R,0:51 1:51,A:770513445;C:725582256;G:737052763;T:797224111;N:181555,51,51,,,770513445,725582256,737052763,797224111,181555,ERX12099018,ERS18400123,ERA29264914,European Bioinformatics Institute|European Nucleotide Archive,European Bioinformatics Institute|European Nucleotide Archive,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,rrna_depletion,trueseq,bulk,bulk,bulk,,United Kingdom,2024-03-29,Pharyngula,Embryo,Whole Organism,All anatomical structures
15399,ERR12724510,ERX12099009,ERS18400114,ERP158370,PRJEB73599,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,E-MTAB-13886,Transcriptome Analysis,Bulk tissue RNA sequencing of individual 24hpf zebrafish larvae to compare the gene expression values between wild type and foxg1a nonsense mutants heterozygous and homozygous mutants.   The mutation is a 5bp deletion 32bp from canonical start codon; AAATG deleted.,ENA FIRST PUBLIC:2024 03 29|ENA LAST UPDATE:2024 03 29,,Protocols: Heterozygous mutant 5bp deletion 32 bp from canonical start codon; AAATG foxg1a adult zebrafish in a dlx5 6;GFP background were incrossed and progeny collected. Dlx+ interneuron phenotype was used to identify homozygous no interneurons in telencephalon and heterozygous reduced number of interneurons in telencephalon. Genotyping was confirmed with RNA sequencing reads at the foxg1a gene locus to ensure correct genotyping. RNA was extracted from single 24hpf zebrafish using the Qiagen RNeasy Micro Kit Qiagen  74004. RNA concentration was measured using the Qubit reagent kit and a small sample was tested for RNA integrity using a bioanalyzer instrument. Only samples with an RNA integrity number of 9 or above were used in this experiment. Total RNA Library was repapred using the Illumina TruSeq Stranded Total RNA Library kit. Ribosomal RNAs were depleted using Ribo Zero Gold.,Foxg1 het 8,E MTAB 13886:Foxg1 het 8,,isolate:not applicable|organism:Danio rerio|organism:Danio rerio|collection date:not collected|scientific name:Danio rerio|common name:zebrafish|organism part:whole organism|developmental stage:pharyngula prim 5|genotype:Foxg1a het|geographic location country and/or sea:not collected,,,,,,,,,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,E MTAB 13886:Foxg1 het 8 p,Foxg1 het 8 p,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,Heterozygous mutant 5bp deletion 32 bp from canonical start codon; AAATG foxg1a adult zebrafish in a dlx5 6;GFP background were incrossed and progeny collected. Dlx+ interneuron phenotype was used to identify homozygous no interneurons in telencephalon and heterozygous reduced number of interneurons in telencephalon. Genotyping was confirmed with RNA sequencing reads at the foxg1a gene locus to ensure correct genotyping. RNA was extracted from single 24hpf zebrafish using the Qiagen RNeasy Micro Kit Qiagen  74004. RNA concentration was measured using the Qubit reagent kit and a small sample was tested for RNA integrity using a bioanalyzer instrument. Only samples with an RNA integrity number of 9 or above were used in this experiment. Total RNA Library was repapred using the Illumina TruSeq Stranded Total RNA Library kit. Ribosomal RNAs were depleted using Ribo Zero Gold.,,RNA-Seq,TRANSCRIPTOMIC,Inverse rRNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP158370,Illumina NovaSeq 6000 paired end sequencing; RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,ENA FIRST PUBLIC:2024 03 29|ENA LAST UPDATE:2024 03 29,18067X10_200629_A00421_0211_BHN23CDRXX_S13_L001_R1_001.fastq.gz 18067X10_200629_A00421_0211_BHN23CDRXX_S13_L001_R2_001.fastq.gz,fastq fastq,3601017894.0,35304097.0,E MTAB 13886:18067X10 200629 A00421 0211 BHN23CDRXX S13 L001 R,0:51 1:51,A:903986531;C:871550198;G:885398218;T:939870481;N:212466,51,51,,,903986531,871550198,885398218,939870481,212466,ERX12099009,ERS18400114,ERA29264914,European Bioinformatics Institute|European Nucleotide Archive,European Bioinformatics Institute|European Nucleotide Archive,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,rrna_depletion,trueseq,bulk,bulk,bulk,,United Kingdom,2024-03-29,Pharyngula,Embryo,Whole Organism,All anatomical structures
15400,ERR12724516,ERX12099015,ERS18400120,ERP158370,PRJEB73599,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,E-MTAB-13886,Transcriptome Analysis,Bulk tissue RNA sequencing of individual 24hpf zebrafish larvae to compare the gene expression values between wild type and foxg1a nonsense mutants heterozygous and homozygous mutants.   The mutation is a 5bp deletion 32bp from canonical start codon; AAATG deleted.,ENA FIRST PUBLIC:2024 03 29|ENA LAST UPDATE:2024 03 29,,Protocols: Heterozygous mutant 5bp deletion 32 bp from canonical start codon; AAATG foxg1a adult zebrafish in a dlx5 6;GFP background were incrossed and progeny collected. Dlx+ interneuron phenotype was used to identify homozygous no interneurons in telencephalon and heterozygous reduced number of interneurons in telencephalon. Genotyping was confirmed with RNA sequencing reads at the foxg1a gene locus to ensure correct genotyping. RNA was extracted from single 24hpf zebrafish using the Qiagen RNeasy Micro Kit Qiagen  74004. RNA concentration was measured using the Qubit reagent kit and a small sample was tested for RNA integrity using a bioanalyzer instrument. Only samples with an RNA integrity number of 9 or above were used in this experiment. Total RNA Library was repapred using the Illumina TruSeq Stranded Total RNA Library kit. Ribosomal RNAs were depleted using Ribo Zero Gold.,Foxg1 WT 1,E MTAB 13886:Foxg1 WT 1,,isolate:not applicable|organism:Danio rerio|organism:Danio rerio|collection date:not collected|scientific name:Danio rerio|common name:zebrafish|organism part:whole organism|developmental stage:pharyngula prim 5|genotype:Foxg1a WT|geographic location country and/or sea:not collected,,,,,,,,,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,E MTAB 13886:Foxg1 WT 1 p,Foxg1 WT 1 p,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,Heterozygous mutant 5bp deletion 32 bp from canonical start codon; AAATG foxg1a adult zebrafish in a dlx5 6;GFP background were incrossed and progeny collected. Dlx+ interneuron phenotype was used to identify homozygous no interneurons in telencephalon and heterozygous reduced number of interneurons in telencephalon. Genotyping was confirmed with RNA sequencing reads at the foxg1a gene locus to ensure correct genotyping. RNA was extracted from single 24hpf zebrafish using the Qiagen RNeasy Micro Kit Qiagen  74004. RNA concentration was measured using the Qubit reagent kit and a small sample was tested for RNA integrity using a bioanalyzer instrument. Only samples with an RNA integrity number of 9 or above were used in this experiment. Total RNA Library was repapred using the Illumina TruSeq Stranded Total RNA Library kit. Ribosomal RNAs were depleted using Ribo Zero Gold.,,RNA-Seq,TRANSCRIPTOMIC,Inverse rRNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP158370,Illumina NovaSeq 6000 paired end sequencing; RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,ENA FIRST PUBLIC:2024 03 29|ENA LAST UPDATE:2024 03 29,18067X13_200629_A00421_0211_BHN23CDRXX_S14_L001_R1_001.fastq.gz 18067X13_200629_A00421_0211_BHN23CDRXX_S14_L001_R2_001.fastq.gz,fastq fastq,4252867662.0,41694781.0,E MTAB 13886:18067X13 200629 A00421 0211 BHN23CDRXX S14 L001 R,0:51 1:51,A:1069523245;C:1031533375;G:1047047746;T:1104513602;N:249694,51,51,,,1069523245,1031533375,1047047746,1104513602,249694,ERX12099015,ERS18400120,ERA29264914,European Bioinformatics Institute|European Nucleotide Archive,European Bioinformatics Institute|European Nucleotide Archive,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,rrna_depletion,trueseq,bulk,bulk,bulk,,United Kingdom,2024-03-29,Pharyngula,Embryo,Whole Organism,All anatomical structures
15401,ERR12724505,ERX12099004,ERS18400109,ERP158370,PRJEB73599,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,E-MTAB-13886,Transcriptome Analysis,Bulk tissue RNA sequencing of individual 24hpf zebrafish larvae to compare the gene expression values between wild type and foxg1a nonsense mutants heterozygous and homozygous mutants.   The mutation is a 5bp deletion 32bp from canonical start codon; AAATG deleted.,ENA FIRST PUBLIC:2024 03 29|ENA LAST UPDATE:2024 03 29,,Protocols: Heterozygous mutant 5bp deletion 32 bp from canonical start codon; AAATG foxg1a adult zebrafish in a dlx5 6;GFP background were incrossed and progeny collected. Dlx+ interneuron phenotype was used to identify homozygous no interneurons in telencephalon and heterozygous reduced number of interneurons in telencephalon. Genotyping was confirmed with RNA sequencing reads at the foxg1a gene locus to ensure correct genotyping. RNA was extracted from single 24hpf zebrafish using the Qiagen RNeasy Micro Kit Qiagen  74004. RNA concentration was measured using the Qubit reagent kit and a small sample was tested for RNA integrity using a bioanalyzer instrument. Only samples with an RNA integrity number of 9 or above were used in this experiment. Total RNA Library was repapred using the Illumina TruSeq Stranded Total RNA Library kit. Ribosomal RNAs were depleted using Ribo Zero Gold.,Foxg1 het 2,E MTAB 13886:Foxg1 het 2,,isolate:not applicable|organism:Danio rerio|organism:Danio rerio|collection date:not collected|scientific name:Danio rerio|common name:zebrafish|organism part:whole organism|developmental stage:pharyngula prim 5|genotype:Foxg1a het|geographic location country and/or sea:not collected,,,,,,,,,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,E MTAB 13886:Foxg1 het 2 p,Foxg1 het 2 p,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,Heterozygous mutant 5bp deletion 32 bp from canonical start codon; AAATG foxg1a adult zebrafish in a dlx5 6;GFP background were incrossed and progeny collected. Dlx+ interneuron phenotype was used to identify homozygous no interneurons in telencephalon and heterozygous reduced number of interneurons in telencephalon. Genotyping was confirmed with RNA sequencing reads at the foxg1a gene locus to ensure correct genotyping. RNA was extracted from single 24hpf zebrafish using the Qiagen RNeasy Micro Kit Qiagen  74004. RNA concentration was measured using the Qubit reagent kit and a small sample was tested for RNA integrity using a bioanalyzer instrument. Only samples with an RNA integrity number of 9 or above were used in this experiment. Total RNA Library was repapred using the Illumina TruSeq Stranded Total RNA Library kit. Ribosomal RNAs were depleted using Ribo Zero Gold.,,RNA-Seq,TRANSCRIPTOMIC,Inverse rRNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP158370,Illumina NovaSeq 6000 paired end sequencing; RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,ENA FIRST PUBLIC:2024 03 29|ENA LAST UPDATE:2024 03 29,18067X5_200629_A00421_0211_BHN23CDRXX_S21_L001_R1_001.fastq.gz 18067X5_200629_A00421_0211_BHN23CDRXX_S21_L001_R2_001.fastq.gz,fastq fastq,3490870236.0,34224218.0,E MTAB 13886:18067X5 200629 A00421 0211 BHN23CDRXX S21 L001 R,0:51 1:51,A:868722737;C:853509703;G:868564192;T:899868487;N:205117,51,51,,,868722737,853509703,868564192,899868487,205117,ERX12099004,ERS18400109,ERA29264914,European Bioinformatics Institute|European Nucleotide Archive,European Bioinformatics Institute|European Nucleotide Archive,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,rrna_depletion,trueseq,bulk,bulk,bulk,,United Kingdom,2024-03-29,Pharyngula,Embryo,Whole Organism,All anatomical structures
15402,ERR12724509,ERX12099008,ERS18400113,ERP158370,PRJEB73599,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,E-MTAB-13886,Transcriptome Analysis,Bulk tissue RNA sequencing of individual 24hpf zebrafish larvae to compare the gene expression values between wild type and foxg1a nonsense mutants heterozygous and homozygous mutants.   The mutation is a 5bp deletion 32bp from canonical start codon; AAATG deleted.,ENA FIRST PUBLIC:2024 03 29|ENA LAST UPDATE:2024 03 29,,Protocols: Heterozygous mutant 5bp deletion 32 bp from canonical start codon; AAATG foxg1a adult zebrafish in a dlx5 6;GFP background were incrossed and progeny collected. Dlx+ interneuron phenotype was used to identify homozygous no interneurons in telencephalon and heterozygous reduced number of interneurons in telencephalon. Genotyping was confirmed with RNA sequencing reads at the foxg1a gene locus to ensure correct genotyping. RNA was extracted from single 24hpf zebrafish using the Qiagen RNeasy Micro Kit Qiagen  74004. RNA concentration was measured using the Qubit reagent kit and a small sample was tested for RNA integrity using a bioanalyzer instrument. Only samples with an RNA integrity number of 9 or above were used in this experiment. Total RNA Library was repapred using the Illumina TruSeq Stranded Total RNA Library kit. Ribosomal RNAs were depleted using Ribo Zero Gold.,Foxg1 het 7,E MTAB 13886:Foxg1 het 7,,isolate:not applicable|organism:Danio rerio|organism:Danio rerio|collection date:not collected|scientific name:Danio rerio|common name:zebrafish|organism part:whole organism|developmental stage:pharyngula prim 5|genotype:Foxg1a het|geographic location country and/or sea:not collected,,,,,,,,,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,E MTAB 13886:Foxg1 het 7 p,Foxg1 het 7 p,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,Heterozygous mutant 5bp deletion 32 bp from canonical start codon; AAATG foxg1a adult zebrafish in a dlx5 6;GFP background were incrossed and progeny collected. Dlx+ interneuron phenotype was used to identify homozygous no interneurons in telencephalon and heterozygous reduced number of interneurons in telencephalon. Genotyping was confirmed with RNA sequencing reads at the foxg1a gene locus to ensure correct genotyping. RNA was extracted from single 24hpf zebrafish using the Qiagen RNeasy Micro Kit Qiagen  74004. RNA concentration was measured using the Qubit reagent kit and a small sample was tested for RNA integrity using a bioanalyzer instrument. Only samples with an RNA integrity number of 9 or above were used in this experiment. Total RNA Library was repapred using the Illumina TruSeq Stranded Total RNA Library kit. Ribosomal RNAs were depleted using Ribo Zero Gold.,,RNA-Seq,TRANSCRIPTOMIC,Inverse rRNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP158370,Illumina NovaSeq 6000 paired end sequencing; RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,ENA FIRST PUBLIC:2024 03 29|ENA LAST UPDATE:2024 03 29,18067X9_200629_A00421_0211_BHN23CDRXX_S15_L001_R1_001.fastq.gz 18067X9_200629_A00421_0211_BHN23CDRXX_S15_L001_R2_001.fastq.gz,fastq fastq,3288698484.0,32242142.0,E MTAB 13886:18067X9 200629 A00421 0211 BHN23CDRXX S15 L001 R,0:51 1:51,A:849623075;C:775307492;G:786016403;T:877557952;N:193562,51,51,,,849623075,775307492,786016403,877557952,193562,ERX12099008,ERS18400113,ERA29264914,European Bioinformatics Institute|European Nucleotide Archive,European Bioinformatics Institute|European Nucleotide Archive,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,rrna_depletion,trueseq,bulk,bulk,bulk,,United Kingdom,2024-03-29,Pharyngula,Embryo,Whole Organism,All anatomical structures
15403,ERR12724512,ERX12099011,ERS18400116,ERP158370,PRJEB73599,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,E-MTAB-13886,Transcriptome Analysis,Bulk tissue RNA sequencing of individual 24hpf zebrafish larvae to compare the gene expression values between wild type and foxg1a nonsense mutants heterozygous and homozygous mutants.   The mutation is a 5bp deletion 32bp from canonical start codon; AAATG deleted.,ENA FIRST PUBLIC:2024 03 29|ENA LAST UPDATE:2024 03 29,,Protocols: Heterozygous mutant 5bp deletion 32 bp from canonical start codon; AAATG foxg1a adult zebrafish in a dlx5 6;GFP background were incrossed and progeny collected. Dlx+ interneuron phenotype was used to identify homozygous no interneurons in telencephalon and heterozygous reduced number of interneurons in telencephalon. Genotyping was confirmed with RNA sequencing reads at the foxg1a gene locus to ensure correct genotyping. RNA was extracted from single 24hpf zebrafish using the Qiagen RNeasy Micro Kit Qiagen  74004. RNA concentration was measured using the Qubit reagent kit and a small sample was tested for RNA integrity using a bioanalyzer instrument. Only samples with an RNA integrity number of 9 or above were used in this experiment. Total RNA Library was repapred using the Illumina TruSeq Stranded Total RNA Library kit. Ribosomal RNAs were depleted using Ribo Zero Gold.,Foxg1 null 1,E MTAB 13886:Foxg1 null 1,,isolate:not applicable|organism:Danio rerio|organism:Danio rerio|collection date:not collected|scientific name:Danio rerio|common name:zebrafish|organism part:whole organism|developmental stage:pharyngula prim 5|genotype:Foxg1a hom|geographic location country and/or sea:not collected,,,,,,,,,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,E MTAB 13886:Foxg1 null 1 p,Foxg1 null 1 p,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,Heterozygous mutant 5bp deletion 32 bp from canonical start codon; AAATG foxg1a adult zebrafish in a dlx5 6;GFP background were incrossed and progeny collected. Dlx+ interneuron phenotype was used to identify homozygous no interneurons in telencephalon and heterozygous reduced number of interneurons in telencephalon. Genotyping was confirmed with RNA sequencing reads at the foxg1a gene locus to ensure correct genotyping. RNA was extracted from single 24hpf zebrafish using the Qiagen RNeasy Micro Kit Qiagen  74004. RNA concentration was measured using the Qubit reagent kit and a small sample was tested for RNA integrity using a bioanalyzer instrument. Only samples with an RNA integrity number of 9 or above were used in this experiment. Total RNA Library was repapred using the Illumina TruSeq Stranded Total RNA Library kit. Ribosomal RNAs were depleted using Ribo Zero Gold.,,RNA-Seq,TRANSCRIPTOMIC,Inverse rRNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP158370,Illumina NovaSeq 6000 paired end sequencing; RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,ENA FIRST PUBLIC:2024 03 29|ENA LAST UPDATE:2024 03 29,18067X1_200629_A00421_0211_BHN23CDRXX_S28_L001_R1_001.fastq.gz 18067X1_200629_A00421_0211_BHN23CDRXX_S28_L001_R2_001.fastq.gz,fastq fastq,3735665544.0,36624172.0,E MTAB 13886:18067X1 200629 A00421 0211 BHN23CDRXX S28 L001 R,0:51 1:51,A:930463361;C:914183345;G:929494372;T:961303244;N:221222,51,51,,,930463361,914183345,929494372,961303244,221222,ERX12099011,ERS18400116,ERA29264914,European Bioinformatics Institute|European Nucleotide Archive,European Bioinformatics Institute|European Nucleotide Archive,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,rrna_depletion,trueseq,bulk,bulk,bulk,,United Kingdom,2024-03-29,Pharyngula,Embryo,Whole Organism,All anatomical structures
15404,ERR12724514,ERX12099013,ERS18400118,ERP158370,PRJEB73599,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,E-MTAB-13886,Transcriptome Analysis,Bulk tissue RNA sequencing of individual 24hpf zebrafish larvae to compare the gene expression values between wild type and foxg1a nonsense mutants heterozygous and homozygous mutants.   The mutation is a 5bp deletion 32bp from canonical start codon; AAATG deleted.,ENA FIRST PUBLIC:2024 03 29|ENA LAST UPDATE:2024 03 29,,Protocols: Heterozygous mutant 5bp deletion 32 bp from canonical start codon; AAATG foxg1a adult zebrafish in a dlx5 6;GFP background were incrossed and progeny collected. Dlx+ interneuron phenotype was used to identify homozygous no interneurons in telencephalon and heterozygous reduced number of interneurons in telencephalon. Genotyping was confirmed with RNA sequencing reads at the foxg1a gene locus to ensure correct genotyping. RNA was extracted from single 24hpf zebrafish using the Qiagen RNeasy Micro Kit Qiagen  74004. RNA concentration was measured using the Qubit reagent kit and a small sample was tested for RNA integrity using a bioanalyzer instrument. Only samples with an RNA integrity number of 9 or above were used in this experiment. Total RNA Library was repapred using the Illumina TruSeq Stranded Total RNA Library kit. Ribosomal RNAs were depleted using Ribo Zero Gold.,Foxg1 null 3,E MTAB 13886:Foxg1 null 3,,isolate:not applicable|organism:Danio rerio|organism:Danio rerio|collection date:not collected|scientific name:Danio rerio|common name:zebrafish|organism part:whole organism|developmental stage:pharyngula prim 5|genotype:Foxg1a hom|geographic location country and/or sea:not collected,,,,,,,,,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,E MTAB 13886:Foxg1 null 3 p,Foxg1 null 3 p,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,Heterozygous mutant 5bp deletion 32 bp from canonical start codon; AAATG foxg1a adult zebrafish in a dlx5 6;GFP background were incrossed and progeny collected. Dlx+ interneuron phenotype was used to identify homozygous no interneurons in telencephalon and heterozygous reduced number of interneurons in telencephalon. Genotyping was confirmed with RNA sequencing reads at the foxg1a gene locus to ensure correct genotyping. RNA was extracted from single 24hpf zebrafish using the Qiagen RNeasy Micro Kit Qiagen  74004. RNA concentration was measured using the Qubit reagent kit and a small sample was tested for RNA integrity using a bioanalyzer instrument. Only samples with an RNA integrity number of 9 or above were used in this experiment. Total RNA Library was repapred using the Illumina TruSeq Stranded Total RNA Library kit. Ribosomal RNAs were depleted using Ribo Zero Gold.,,RNA-Seq,TRANSCRIPTOMIC,Inverse rRNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP158370,Illumina NovaSeq 6000 paired end sequencing; RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,ENA FIRST PUBLIC:2024 03 29|ENA LAST UPDATE:2024 03 29,18067X3_200629_A00421_0211_BHN23CDRXX_S25_L001_R1_001.fastq.gz 18067X3_200629_A00421_0211_BHN23CDRXX_S25_L001_R2_001.fastq.gz,fastq fastq,3581623512.0,35113956.0,E MTAB 13886:18067X3 200629 A00421 0211 BHN23CDRXX S25 L001 R,0:51 1:51,A:901782474;C:866330420;G:882309046;T:930988392;N:213180,51,51,,,901782474,866330420,882309046,930988392,213180,ERX12099013,ERS18400118,ERA29264914,European Bioinformatics Institute|European Nucleotide Archive,European Bioinformatics Institute|European Nucleotide Archive,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,rrna_depletion,trueseq,bulk,bulk,bulk,,United Kingdom,2024-03-29,Pharyngula,Embryo,Whole Organism,All anatomical structures
15405,ERR12724504,ERX12099003,ERS18400108,ERP158370,PRJEB73599,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,E-MTAB-13886,Transcriptome Analysis,Bulk tissue RNA sequencing of individual 24hpf zebrafish larvae to compare the gene expression values between wild type and foxg1a nonsense mutants heterozygous and homozygous mutants.   The mutation is a 5bp deletion 32bp from canonical start codon; AAATG deleted.,ENA FIRST PUBLIC:2024 03 29|ENA LAST UPDATE:2024 03 29,,Protocols: Heterozygous mutant 5bp deletion 32 bp from canonical start codon; AAATG foxg1a adult zebrafish in a dlx5 6;GFP background were incrossed and progeny collected. Dlx+ interneuron phenotype was used to identify homozygous no interneurons in telencephalon and heterozygous reduced number of interneurons in telencephalon. Genotyping was confirmed with RNA sequencing reads at the foxg1a gene locus to ensure correct genotyping. RNA was extracted from single 24hpf zebrafish using the Qiagen RNeasy Micro Kit Qiagen  74004. RNA concentration was measured using the Qubit reagent kit and a small sample was tested for RNA integrity using a bioanalyzer instrument. Only samples with an RNA integrity number of 9 or above were used in this experiment. Total RNA Library was repapred using the Illumina TruSeq Stranded Total RNA Library kit. Ribosomal RNAs were depleted using Ribo Zero Gold.,Foxg1 het 13,E MTAB 13886:Foxg1 het 13,,isolate:not applicable|organism:Danio rerio|organism:Danio rerio|collection date:not collected|scientific name:Danio rerio|common name:zebrafish|organism part:whole organism|developmental stage:pharyngula prim 5|genotype:Foxg1a het|geographic location country and/or sea:not collected,,,,,,,,,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,E MTAB 13886:Foxg1 het 13 p,Foxg1 het 13 p,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,Heterozygous mutant 5bp deletion 32 bp from canonical start codon; AAATG foxg1a adult zebrafish in a dlx5 6;GFP background were incrossed and progeny collected. Dlx+ interneuron phenotype was used to identify homozygous no interneurons in telencephalon and heterozygous reduced number of interneurons in telencephalon. Genotyping was confirmed with RNA sequencing reads at the foxg1a gene locus to ensure correct genotyping. RNA was extracted from single 24hpf zebrafish using the Qiagen RNeasy Micro Kit Qiagen  74004. RNA concentration was measured using the Qubit reagent kit and a small sample was tested for RNA integrity using a bioanalyzer instrument. Only samples with an RNA integrity number of 9 or above were used in this experiment. Total RNA Library was repapred using the Illumina TruSeq Stranded Total RNA Library kit. Ribosomal RNAs were depleted using Ribo Zero Gold.,,RNA-Seq,TRANSCRIPTOMIC,Inverse rRNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP158370,Illumina NovaSeq 6000 paired end sequencing; RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,ENA FIRST PUBLIC:2024 03 29|ENA LAST UPDATE:2024 03 29,18067X12_200629_A00421_0211_BHN23CDRXX_S16_L001_R1_001.fastq.gz 18067X12_200629_A00421_0211_BHN23CDRXX_S16_L001_R2_001.fastq.gz,fastq fastq,3198417570.0,31357035.0,E MTAB 13886:18067X12 200629 A00421 0211 BHN23CDRXX S16 L001 R,0:51 1:51,A:806440222;C:774073728;G:785492238;T:832222984;N:188398,51,51,,,806440222,774073728,785492238,832222984,188398,ERX12099003,ERS18400108,ERA29264914,European Bioinformatics Institute|European Nucleotide Archive,European Bioinformatics Institute|European Nucleotide Archive,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,rrna_depletion,trueseq,bulk,bulk,bulk,,United Kingdom,2024-03-29,Pharyngula,Embryo,Whole Organism,All anatomical structures
15406,ERR12724508,ERX12099007,ERS18400112,ERP158370,PRJEB73599,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,E-MTAB-13886,Transcriptome Analysis,Bulk tissue RNA sequencing of individual 24hpf zebrafish larvae to compare the gene expression values between wild type and foxg1a nonsense mutants heterozygous and homozygous mutants.   The mutation is a 5bp deletion 32bp from canonical start codon; AAATG deleted.,ENA FIRST PUBLIC:2024 03 29|ENA LAST UPDATE:2024 03 29,,Protocols: Heterozygous mutant 5bp deletion 32 bp from canonical start codon; AAATG foxg1a adult zebrafish in a dlx5 6;GFP background were incrossed and progeny collected. Dlx+ interneuron phenotype was used to identify homozygous no interneurons in telencephalon and heterozygous reduced number of interneurons in telencephalon. Genotyping was confirmed with RNA sequencing reads at the foxg1a gene locus to ensure correct genotyping. RNA was extracted from single 24hpf zebrafish using the Qiagen RNeasy Micro Kit Qiagen  74004. RNA concentration was measured using the Qubit reagent kit and a small sample was tested for RNA integrity using a bioanalyzer instrument. Only samples with an RNA integrity number of 9 or above were used in this experiment. Total RNA Library was repapred using the Illumina TruSeq Stranded Total RNA Library kit. Ribosomal RNAs were depleted using Ribo Zero Gold.,Foxg1 het 6,E MTAB 13886:Foxg1 het 6,,isolate:not applicable|organism:Danio rerio|organism:Danio rerio|collection date:not collected|scientific name:Danio rerio|common name:zebrafish|organism part:whole organism|developmental stage:pharyngula prim 5|genotype:Foxg1a het|geographic location country and/or sea:not collected,,,,,,,,,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,E MTAB 13886:Foxg1 het 6 p,Foxg1 het 6 p,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,Heterozygous mutant 5bp deletion 32 bp from canonical start codon; AAATG foxg1a adult zebrafish in a dlx5 6;GFP background were incrossed and progeny collected. Dlx+ interneuron phenotype was used to identify homozygous no interneurons in telencephalon and heterozygous reduced number of interneurons in telencephalon. Genotyping was confirmed with RNA sequencing reads at the foxg1a gene locus to ensure correct genotyping. RNA was extracted from single 24hpf zebrafish using the Qiagen RNeasy Micro Kit Qiagen  74004. RNA concentration was measured using the Qubit reagent kit and a small sample was tested for RNA integrity using a bioanalyzer instrument. Only samples with an RNA integrity number of 9 or above were used in this experiment. Total RNA Library was repapred using the Illumina TruSeq Stranded Total RNA Library kit. Ribosomal RNAs were depleted using Ribo Zero Gold.,,RNA-Seq,TRANSCRIPTOMIC,Inverse rRNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP158370,Illumina NovaSeq 6000 paired end sequencing; RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,ENA FIRST PUBLIC:2024 03 29|ENA LAST UPDATE:2024 03 29,18067X8_200629_A00421_0211_BHN23CDRXX_S17_L001_R1_001.fastq.gz 18067X8_200629_A00421_0211_BHN23CDRXX_S17_L001_R2_001.fastq.gz,fastq fastq,2829840366.0,27743533.0,E MTAB 13886:18067X8 200629 A00421 0211 BHN23CDRXX S17 L001 R,0:51 1:51,A:712954704;C:683604864;G:696251651;T:736863084;N:166063,51,51,,,712954704,683604864,696251651,736863084,166063,ERX12099007,ERS18400112,ERA29264914,European Bioinformatics Institute|European Nucleotide Archive,European Bioinformatics Institute|European Nucleotide Archive,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,rrna_depletion,trueseq,bulk,bulk,bulk,,United Kingdom,2024-03-29,Pharyngula,Embryo,Whole Organism,All anatomical structures
15407,ERR12724506,ERX12099005,ERS18400110,ERP158370,PRJEB73599,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,E-MTAB-13886,Transcriptome Analysis,Bulk tissue RNA sequencing of individual 24hpf zebrafish larvae to compare the gene expression values between wild type and foxg1a nonsense mutants heterozygous and homozygous mutants.   The mutation is a 5bp deletion 32bp from canonical start codon; AAATG deleted.,ENA FIRST PUBLIC:2024 03 29|ENA LAST UPDATE:2024 03 29,,Protocols: Heterozygous mutant 5bp deletion 32 bp from canonical start codon; AAATG foxg1a adult zebrafish in a dlx5 6;GFP background were incrossed and progeny collected. Dlx+ interneuron phenotype was used to identify homozygous no interneurons in telencephalon and heterozygous reduced number of interneurons in telencephalon. Genotyping was confirmed with RNA sequencing reads at the foxg1a gene locus to ensure correct genotyping. RNA was extracted from single 24hpf zebrafish using the Qiagen RNeasy Micro Kit Qiagen  74004. RNA concentration was measured using the Qubit reagent kit and a small sample was tested for RNA integrity using a bioanalyzer instrument. Only samples with an RNA integrity number of 9 or above were used in this experiment. Total RNA Library was repapred using the Illumina TruSeq Stranded Total RNA Library kit. Ribosomal RNAs were depleted using Ribo Zero Gold.,Foxg1 het 3,E MTAB 13886:Foxg1 het 3,,isolate:not applicable|organism:Danio rerio|organism:Danio rerio|collection date:not collected|scientific name:Danio rerio|common name:zebrafish|organism part:whole organism|developmental stage:pharyngula prim 5|genotype:Foxg1a het|geographic location country and/or sea:not collected,,,,,,,,,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,E MTAB 13886:Foxg1 het 3 p,Foxg1 het 3 p,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,Heterozygous mutant 5bp deletion 32 bp from canonical start codon; AAATG foxg1a adult zebrafish in a dlx5 6;GFP background were incrossed and progeny collected. Dlx+ interneuron phenotype was used to identify homozygous no interneurons in telencephalon and heterozygous reduced number of interneurons in telencephalon. Genotyping was confirmed with RNA sequencing reads at the foxg1a gene locus to ensure correct genotyping. RNA was extracted from single 24hpf zebrafish using the Qiagen RNeasy Micro Kit Qiagen  74004. RNA concentration was measured using the Qubit reagent kit and a small sample was tested for RNA integrity using a bioanalyzer instrument. Only samples with an RNA integrity number of 9 or above were used in this experiment. Total RNA Library was repapred using the Illumina TruSeq Stranded Total RNA Library kit. Ribosomal RNAs were depleted using Ribo Zero Gold.,,RNA-Seq,TRANSCRIPTOMIC,Inverse rRNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP158370,Illumina NovaSeq 6000 paired end sequencing; RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,ENA FIRST PUBLIC:2024 03 29|ENA LAST UPDATE:2024 03 29,18067X6_200629_A00421_0211_BHN23CDRXX_S20_L001_R1_001.fastq.gz 18067X6_200629_A00421_0211_BHN23CDRXX_S20_L001_R2_001.fastq.gz,fastq fastq,2947992168.0,28901884.0,E MTAB 13886:18067X6 200629 A00421 0211 BHN23CDRXX S20 L001 R,0:51 1:51,A:745555818;C:709342231;G:720902928;T:772016275;N:174916,51,51,,,745555818,709342231,720902928,772016275,174916,ERX12099005,ERS18400110,ERA29264914,European Bioinformatics Institute|European Nucleotide Archive,European Bioinformatics Institute|European Nucleotide Archive,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,rrna_depletion,trueseq,bulk,bulk,bulk,,United Kingdom,2024-03-29,Pharyngula,Embryo,Whole Organism,All anatomical structures
15408,ERR12724515,ERX12099014,ERS18400119,ERP158370,PRJEB73599,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,E-MTAB-13886,Transcriptome Analysis,Bulk tissue RNA sequencing of individual 24hpf zebrafish larvae to compare the gene expression values between wild type and foxg1a nonsense mutants heterozygous and homozygous mutants.   The mutation is a 5bp deletion 32bp from canonical start codon; AAATG deleted.,ENA FIRST PUBLIC:2024 03 29|ENA LAST UPDATE:2024 03 29,,Protocols: Heterozygous mutant 5bp deletion 32 bp from canonical start codon; AAATG foxg1a adult zebrafish in a dlx5 6;GFP background were incrossed and progeny collected. Dlx+ interneuron phenotype was used to identify homozygous no interneurons in telencephalon and heterozygous reduced number of interneurons in telencephalon. Genotyping was confirmed with RNA sequencing reads at the foxg1a gene locus to ensure correct genotyping. RNA was extracted from single 24hpf zebrafish using the Qiagen RNeasy Micro Kit Qiagen  74004. RNA concentration was measured using the Qubit reagent kit and a small sample was tested for RNA integrity using a bioanalyzer instrument. Only samples with an RNA integrity number of 9 or above were used in this experiment. Total RNA Library was repapred using the Illumina TruSeq Stranded Total RNA Library kit. Ribosomal RNAs were depleted using Ribo Zero Gold.,Foxg1 null 6,E MTAB 13886:Foxg1 null 6,,isolate:not applicable|organism:Danio rerio|organism:Danio rerio|collection date:not collected|scientific name:Danio rerio|common name:zebrafish|organism part:whole organism|developmental stage:pharyngula prim 5|genotype:Foxg1a hom|geographic location country and/or sea:not collected,,,,,,,,,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,E MTAB 13886:Foxg1 null 6 p,Foxg1 null 6 p,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,Heterozygous mutant 5bp deletion 32 bp from canonical start codon; AAATG foxg1a adult zebrafish in a dlx5 6;GFP background were incrossed and progeny collected. Dlx+ interneuron phenotype was used to identify homozygous no interneurons in telencephalon and heterozygous reduced number of interneurons in telencephalon. Genotyping was confirmed with RNA sequencing reads at the foxg1a gene locus to ensure correct genotyping. RNA was extracted from single 24hpf zebrafish using the Qiagen RNeasy Micro Kit Qiagen  74004. RNA concentration was measured using the Qubit reagent kit and a small sample was tested for RNA integrity using a bioanalyzer instrument. Only samples with an RNA integrity number of 9 or above were used in this experiment. Total RNA Library was repapred using the Illumina TruSeq Stranded Total RNA Library kit. Ribosomal RNAs were depleted using Ribo Zero Gold.,,RNA-Seq,TRANSCRIPTOMIC,Inverse rRNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP158370,Illumina NovaSeq 6000 paired end sequencing; RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,ENA FIRST PUBLIC:2024 03 29|ENA LAST UPDATE:2024 03 29,18067X4_200629_A00421_0211_BHN23CDRXX_S23_L001_R1_001.fastq.gz 18067X4_200629_A00421_0211_BHN23CDRXX_S23_L001_R2_001.fastq.gz,fastq fastq,3166535838.0,31044469.0,E MTAB 13886:18067X4 200629 A00421 0211 BHN23CDRXX S23 L001 R,0:51 1:51,A:781063082;C:780685132;G:798403519;T:806197923;N:186182,51,51,,,781063082,780685132,798403519,806197923,186182,ERX12099014,ERS18400119,ERA29264914,European Bioinformatics Institute|European Nucleotide Archive,European Bioinformatics Institute|European Nucleotide Archive,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,rrna_depletion,trueseq,bulk,bulk,bulk,,United Kingdom,2024-03-29,Pharyngula,Embryo,Whole Organism,All anatomical structures
15409,ERR12724518,ERX12099017,ERS18400122,ERP158370,PRJEB73599,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,E-MTAB-13886,Transcriptome Analysis,Bulk tissue RNA sequencing of individual 24hpf zebrafish larvae to compare the gene expression values between wild type and foxg1a nonsense mutants heterozygous and homozygous mutants.   The mutation is a 5bp deletion 32bp from canonical start codon; AAATG deleted.,ENA FIRST PUBLIC:2024 03 29|ENA LAST UPDATE:2024 03 29,,Protocols: Heterozygous mutant 5bp deletion 32 bp from canonical start codon; AAATG foxg1a adult zebrafish in a dlx5 6;GFP background were incrossed and progeny collected. Dlx+ interneuron phenotype was used to identify homozygous no interneurons in telencephalon and heterozygous reduced number of interneurons in telencephalon. Genotyping was confirmed with RNA sequencing reads at the foxg1a gene locus to ensure correct genotyping. RNA was extracted from single 24hpf zebrafish using the Qiagen RNeasy Micro Kit Qiagen  74004. RNA concentration was measured using the Qubit reagent kit and a small sample was tested for RNA integrity using a bioanalyzer instrument. Only samples with an RNA integrity number of 9 or above were used in this experiment. Total RNA Library was repapred using the Illumina TruSeq Stranded Total RNA Library kit. Ribosomal RNAs were depleted using Ribo Zero Gold.,Foxg1 WT 5,E MTAB 13886:Foxg1 WT 5,,isolate:not applicable|organism:Danio rerio|organism:Danio rerio|collection date:not collected|scientific name:Danio rerio|common name:zebrafish|organism part:whole organism|developmental stage:pharyngula prim 5|genotype:Foxg1a WT|geographic location country and/or sea:not collected,,,,,,,,,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,E MTAB 13886:Foxg1 WT 5 p,Foxg1 WT 5 p,RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,Heterozygous mutant 5bp deletion 32 bp from canonical start codon; AAATG foxg1a adult zebrafish in a dlx5 6;GFP background were incrossed and progeny collected. Dlx+ interneuron phenotype was used to identify homozygous no interneurons in telencephalon and heterozygous reduced number of interneurons in telencephalon. Genotyping was confirmed with RNA sequencing reads at the foxg1a gene locus to ensure correct genotyping. RNA was extracted from single 24hpf zebrafish using the Qiagen RNeasy Micro Kit Qiagen  74004. RNA concentration was measured using the Qubit reagent kit and a small sample was tested for RNA integrity using a bioanalyzer instrument. Only samples with an RNA integrity number of 9 or above were used in this experiment. Total RNA Library was repapred using the Illumina TruSeq Stranded Total RNA Library kit. Ribosomal RNAs were depleted using Ribo Zero Gold.,,RNA-Seq,TRANSCRIPTOMIC,Inverse rRNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP158370,Illumina NovaSeq 6000 paired end sequencing; RNA seq of 24hpf Zebrafish larvae comparing foxg1a mutants to WT siblings,ENA FIRST PUBLIC:2024 03 29|ENA LAST UPDATE:2024 03 29,18067X15_200629_A00421_0211_BHN23CDRXX_S24_L001_R1_001.fastq.gz 18067X15_200629_A00421_0211_BHN23CDRXX_S24_L001_R2_001.fastq.gz,fastq fastq,3253306932.0,31895166.0,E MTAB 13886:18067X15 200629 A00421 0211 BHN23CDRXX S24 L001 R,0:51 1:51,A:822636212;C:784647591;G:797221431;T:848609081;N:192617,51,51,,,822636212,784647591,797221431,848609081,192617,ERX12099017,ERS18400122,ERA29264914,European Bioinformatics Institute|European Nucleotide Archive,European Bioinformatics Institute|European Nucleotide Archive,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,rrna_depletion,trueseq,bulk,bulk,bulk,,United Kingdom,2024-03-29,Pharyngula,Embryo,Whole Organism,All anatomical structures
29025,SRR26974567,SRX22668017,SRS19663577,SRP474706,PRJNA1046144,Nlrc3 signaling is required for hematopoietic stem cell emergence by activating Notch signaling in vertebrates,GSE248871,Transcriptome Analysis,Purpose: Since Nlrc3 signaling is imperative for HSPCs production in zebrafish  to further determine the regulatory mechanism by which nlrc3 signaling regulates HSPCs. Bulk RNA sequencing analysis is performed to dissect the function and molecular mechanism between the control groups and the nlrc3 morphants groups. Methods: The GFP+ cells in Tgfli1a:eGFP zebrafish embryos at 28 hpf were sorted  which is the stage that EHT occurs in the VDA and the site of hemogenic endothelial cells onset. The mRNA profiles of these cells in wild type WT and Nlrc3 knockdown were deep sequencing  in triplicate  using Illumina GAIIx. The sequence reads that passed quality filters were analyzed at the transcript isoform level with two methods: Burrows–Wheeler Aligner BWA followed by ANOVA ANOVA and TopHat followed by Cufflinks. qRT–PCR validation was performed using TaqMan and SYBR Green assays. Results: Using an optimized data analysis workflow  we mapped about 35 million sequence reads per sample and identified 4153 transcripts showing differential expression between the of WT and  Nlrc3 morphants  with a fold change =1.5 and p value <0.05. Based on the results of RNA seq  some signaling pathways essential for  the the Nlrc3 regulates the onset of HSPCs in vertebrate are dissected. Including Notch  WNT  NF kB. Conclusions: Hemogenic endothelial cells mRNA profiles of WT groups and Nlrc3 knockdown groups were deep sequenced and anlysis. Based on the results of RNA seq  we performed  experiments to validate the up and downstream pathway involved in the the Nlrc3 regulates the onset of HSCPs in vertebrate. Overall design: mRNA profiling by high throughput sequencing to dissect the function and molecular mechanism by which nlrc3 signaling regulates the HSPCs in vertebrate.,,pubmed:38172511,,samples in nlrc3 MO rep3,GSM7921554,,source name:zebrafish embryos|tissue:GFP+ cells in Tgfli1a:eGFP|passage:28 hpf embryos|culture:no culture|geo loc name:missing|collection date:missing,samples in nlrc3 MO rep3,Illunima Casava 1.8 software used for basecalling. Sequenced reads were trimmed for adaptor sequence  and masked for low complexity or low quality sequence  then mapped to mm8 whole genome using bowtie v0.12.2 with parameters  q  p 4  e 100  y  a  m 10   best   strata Reads Per Kilobase of exon per Megabase of library size RPKM were calculated using a protocol from Chepelev et al.  Nucleic Acids Research  2009. In short  exons from all isoforms of a gene were merged to create one meta transcript. The number of reads falling in the exons of this meta transcript were counted and normalized by the size of the meta transcript and by the size of the library. Supplementary files format and content: FPKM values for each Sample.,zebrafish embryos,,Total RNA was extracted using Trizol reagent Invitrogen  CA  USA following the manufacturer's procedure. Total RNA quantity and purity were analyzed by Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit Agilent  CA  USA with RIN number >7.0. RNA libraries were prepared for sequencing using standard Illumina protocols,,tissue:GFP+ cells in Tgfli1a:eGFP|passage:28 hpf embryos|culture:no culture,GSM7921554,GSM7921554: samples in nlrc3 MO rep3; Danio rerio; RNA Seq,GSM7921554 r1,GSM7921554,1,Total RNA was extracted using Trizol reagent Invitrogen  CA  USA following the manufacturer's procedure. Total RNA quantity and purity were analyzed by Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit Agilent  CA  USA with RIN number >7.0. RNA libraries were prepared for sequencing using standard Illumina protocols,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP474706,,loader:fastq load.py,Mo3_Clean_Data2.fq.gz Mo3_Clean_Data1.fq.gz,fastq fastq,5520729146.0,19885310.0,GSM7921554 r1,0:138.82 1:138.81,A:1394113679;C:1363204261;G:1378651437;T:1384757621;N:2148,138,138,,,1394113679,1363204261,1378651437,1384757621,2148,SRX22668017,SRS19663577,SRA1759375,Zhejiang university,Zhejiang university,2,0.9435,0.94469,0.05163,0.05105,0.7601,0.75958,0.46104,0.46669,141,141,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,bulk,bulk,bulk,,China,2023-11-28,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures
29026,SRR26974568,SRX22668016,SRS19663576,SRP474706,PRJNA1046144,Nlrc3 signaling is required for hematopoietic stem cell emergence by activating Notch signaling in vertebrates,GSE248871,Transcriptome Analysis,Purpose: Since Nlrc3 signaling is imperative for HSPCs production in zebrafish  to further determine the regulatory mechanism by which nlrc3 signaling regulates HSPCs. Bulk RNA sequencing analysis is performed to dissect the function and molecular mechanism between the control groups and the nlrc3 morphants groups. Methods: The GFP+ cells in Tgfli1a:eGFP zebrafish embryos at 28 hpf were sorted  which is the stage that EHT occurs in the VDA and the site of hemogenic endothelial cells onset. The mRNA profiles of these cells in wild type WT and Nlrc3 knockdown were deep sequencing  in triplicate  using Illumina GAIIx. The sequence reads that passed quality filters were analyzed at the transcript isoform level with two methods: Burrows–Wheeler Aligner BWA followed by ANOVA ANOVA and TopHat followed by Cufflinks. qRT–PCR validation was performed using TaqMan and SYBR Green assays. Results: Using an optimized data analysis workflow  we mapped about 35 million sequence reads per sample and identified 4153 transcripts showing differential expression between the of WT and  Nlrc3 morphants  with a fold change =1.5 and p value <0.05. Based on the results of RNA seq  some signaling pathways essential for  the the Nlrc3 regulates the onset of HSPCs in vertebrate are dissected. Including Notch  WNT  NF kB. Conclusions: Hemogenic endothelial cells mRNA profiles of WT groups and Nlrc3 knockdown groups were deep sequenced and anlysis. Based on the results of RNA seq  we performed  experiments to validate the up and downstream pathway involved in the the Nlrc3 regulates the onset of HSCPs in vertebrate. Overall design: mRNA profiling by high throughput sequencing to dissect the function and molecular mechanism by which nlrc3 signaling regulates the HSPCs in vertebrate.,,pubmed:38172511,,samples in nlrc3 MO rep2,GSM7921553,,source name:zebrafish embryos|tissue:GFP+ cells in Tgfli1a:eGFP|passage:28 hpf embryos|culture:no culture|geo loc name:missing|collection date:missing,samples in nlrc3 MO rep2,Illunima Casava 1.8 software used for basecalling. Sequenced reads were trimmed for adaptor sequence  and masked for low complexity or low quality sequence  then mapped to mm8 whole genome using bowtie v0.12.2 with parameters  q  p 4  e 100  y  a  m 10   best   strata Reads Per Kilobase of exon per Megabase of library size RPKM were calculated using a protocol from Chepelev et al.  Nucleic Acids Research  2009. In short  exons from all isoforms of a gene were merged to create one meta transcript. The number of reads falling in the exons of this meta transcript were counted and normalized by the size of the meta transcript and by the size of the library. Supplementary files format and content: FPKM values for each Sample.,zebrafish embryos,,Total RNA was extracted using Trizol reagent Invitrogen  CA  USA following the manufacturer's procedure. Total RNA quantity and purity were analyzed by Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit Agilent  CA  USA with RIN number >7.0. RNA libraries were prepared for sequencing using standard Illumina protocols,,tissue:GFP+ cells in Tgfli1a:eGFP|passage:28 hpf embryos|culture:no culture,GSM7921553,GSM7921553: samples in nlrc3 MO rep2; Danio rerio; RNA Seq,GSM7921553 r1,GSM7921553,1,Total RNA was extracted using Trizol reagent Invitrogen  CA  USA following the manufacturer's procedure. Total RNA quantity and purity were analyzed by Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit Agilent  CA  USA with RIN number >7.0. RNA libraries were prepared for sequencing using standard Illumina protocols,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP474706,,loader:fastq load.py,Mo2_Clean_Data1.fq.gz Mo2_Clean_Data2.fq.gz,fastq fastq,6532296488.0,23367662.0,GSM7921553 r1,0:139.78 1:139.77,A:1648685612;C:1610899197;G:1630932563;T:1641776735;N:2381,139,139,,,1648685612,1610899197,1630932563,1641776735,2381,SRX22668016,SRS19663576,SRA1759375,Zhejiang university,Zhejiang university,2,0.94588,0.94696,0.05065,0.05045,0.75891,0.75854,0.47315,0.47431,141,141,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,bulk,bulk,bulk,,China,2023-11-28,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures
29027,SRR26974569,SRX22668015,SRS19663575,SRP474706,PRJNA1046144,Nlrc3 signaling is required for hematopoietic stem cell emergence by activating Notch signaling in vertebrates,GSE248871,Transcriptome Analysis,Purpose: Since Nlrc3 signaling is imperative for HSPCs production in zebrafish  to further determine the regulatory mechanism by which nlrc3 signaling regulates HSPCs. Bulk RNA sequencing analysis is performed to dissect the function and molecular mechanism between the control groups and the nlrc3 morphants groups. Methods: The GFP+ cells in Tgfli1a:eGFP zebrafish embryos at 28 hpf were sorted  which is the stage that EHT occurs in the VDA and the site of hemogenic endothelial cells onset. The mRNA profiles of these cells in wild type WT and Nlrc3 knockdown were deep sequencing  in triplicate  using Illumina GAIIx. The sequence reads that passed quality filters were analyzed at the transcript isoform level with two methods: Burrows–Wheeler Aligner BWA followed by ANOVA ANOVA and TopHat followed by Cufflinks. qRT–PCR validation was performed using TaqMan and SYBR Green assays. Results: Using an optimized data analysis workflow  we mapped about 35 million sequence reads per sample and identified 4153 transcripts showing differential expression between the of WT and  Nlrc3 morphants  with a fold change =1.5 and p value <0.05. Based on the results of RNA seq  some signaling pathways essential for  the the Nlrc3 regulates the onset of HSPCs in vertebrate are dissected. Including Notch  WNT  NF kB. Conclusions: Hemogenic endothelial cells mRNA profiles of WT groups and Nlrc3 knockdown groups were deep sequenced and anlysis. Based on the results of RNA seq  we performed  experiments to validate the up and downstream pathway involved in the the Nlrc3 regulates the onset of HSCPs in vertebrate. Overall design: mRNA profiling by high throughput sequencing to dissect the function and molecular mechanism by which nlrc3 signaling regulates the HSPCs in vertebrate.,,pubmed:38172511,,samples in nlrc3 MO rep1,GSM7921552,,source name:zebrafish embryos|tissue:GFP+ cells in Tgfli1a:eGFP|passage:28 hpf embryos|culture:no culture|geo loc name:missing|collection date:missing,samples in nlrc3 MO rep1,Illunima Casava 1.8 software used for basecalling. Sequenced reads were trimmed for adaptor sequence  and masked for low complexity or low quality sequence  then mapped to mm8 whole genome using bowtie v0.12.2 with parameters  q  p 4  e 100  y  a  m 10   best   strata Reads Per Kilobase of exon per Megabase of library size RPKM were calculated using a protocol from Chepelev et al.  Nucleic Acids Research  2009. In short  exons from all isoforms of a gene were merged to create one meta transcript. The number of reads falling in the exons of this meta transcript were counted and normalized by the size of the meta transcript and by the size of the library. Supplementary files format and content: FPKM values for each Sample.,zebrafish embryos,,Total RNA was extracted using Trizol reagent Invitrogen  CA  USA following the manufacturer's procedure. Total RNA quantity and purity were analyzed by Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit Agilent  CA  USA with RIN number >7.0. RNA libraries were prepared for sequencing using standard Illumina protocols,,tissue:GFP+ cells in Tgfli1a:eGFP|passage:28 hpf embryos|culture:no culture,GSM7921552,GSM7921552: samples in nlrc3 MO rep1; Danio rerio; RNA Seq,GSM7921552 r1,GSM7921552,1,Total RNA was extracted using Trizol reagent Invitrogen  CA  USA following the manufacturer's procedure. Total RNA quantity and purity were analyzed by Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit Agilent  CA  USA with RIN number >7.0. RNA libraries were prepared for sequencing using standard Illumina protocols,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP474706,,loader:fastq load.py,Mo1_Clean_Data1.fq.gz Mo1_Clean_Data2.fq.gz,fastq fastq,5812795813.0,20780108.0,GSM7921552 r1,0:139.86 1:139.87,A:1453223147;C:1447175836;G:1465655085;T:1446739519;N:2226,139,139,,,1453223147,1447175836,1465655085,1446739519,2226,SRX22668015,SRS19663575,SRA1759375,Zhejiang university,Zhejiang university,2,0.94733,0.94831,0.05436,0.05351,0.76059,0.76063,0.47936,0.47664,141,141,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,bulk,bulk,bulk,,China,2023-11-28,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures
29028,SRR26974570,SRX22668014,SRS19663574,SRP474706,PRJNA1046144,Nlrc3 signaling is required for hematopoietic stem cell emergence by activating Notch signaling in vertebrates,GSE248871,Transcriptome Analysis,Purpose: Since Nlrc3 signaling is imperative for HSPCs production in zebrafish  to further determine the regulatory mechanism by which nlrc3 signaling regulates HSPCs. Bulk RNA sequencing analysis is performed to dissect the function and molecular mechanism between the control groups and the nlrc3 morphants groups. Methods: The GFP+ cells in Tgfli1a:eGFP zebrafish embryos at 28 hpf were sorted  which is the stage that EHT occurs in the VDA and the site of hemogenic endothelial cells onset. The mRNA profiles of these cells in wild type WT and Nlrc3 knockdown were deep sequencing  in triplicate  using Illumina GAIIx. The sequence reads that passed quality filters were analyzed at the transcript isoform level with two methods: Burrows–Wheeler Aligner BWA followed by ANOVA ANOVA and TopHat followed by Cufflinks. qRT–PCR validation was performed using TaqMan and SYBR Green assays. Results: Using an optimized data analysis workflow  we mapped about 35 million sequence reads per sample and identified 4153 transcripts showing differential expression between the of WT and  Nlrc3 morphants  with a fold change =1.5 and p value <0.05. Based on the results of RNA seq  some signaling pathways essential for  the the Nlrc3 regulates the onset of HSPCs in vertebrate are dissected. Including Notch  WNT  NF kB. Conclusions: Hemogenic endothelial cells mRNA profiles of WT groups and Nlrc3 knockdown groups were deep sequenced and anlysis. Based on the results of RNA seq  we performed  experiments to validate the up and downstream pathway involved in the the Nlrc3 regulates the onset of HSCPs in vertebrate. Overall design: mRNA profiling by high throughput sequencing to dissect the function and molecular mechanism by which nlrc3 signaling regulates the HSPCs in vertebrate.,,pubmed:38172511,,samples in control MO rep3,GSM7921551,,source name:zebrafish embryos|tissue:GFP+ cells in Tgfli1a:eGFP|passage:28 hpf embryos|culture:no culture|geo loc name:missing|collection date:missing,samples in control MO rep3,Illunima Casava 1.8 software used for basecalling. Sequenced reads were trimmed for adaptor sequence  and masked for low complexity or low quality sequence  then mapped to mm8 whole genome using bowtie v0.12.2 with parameters  q  p 4  e 100  y  a  m 10   best   strata Reads Per Kilobase of exon per Megabase of library size RPKM were calculated using a protocol from Chepelev et al.  Nucleic Acids Research  2009. In short  exons from all isoforms of a gene were merged to create one meta transcript. The number of reads falling in the exons of this meta transcript were counted and normalized by the size of the meta transcript and by the size of the library. Supplementary files format and content: FPKM values for each Sample.,zebrafish embryos,,Total RNA was extracted using Trizol reagent Invitrogen  CA  USA following the manufacturer's procedure. Total RNA quantity and purity were analyzed by Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit Agilent  CA  USA with RIN number >7.0. RNA libraries were prepared for sequencing using standard Illumina protocols,,tissue:GFP+ cells in Tgfli1a:eGFP|passage:28 hpf embryos|culture:no culture,GSM7921551,GSM7921551: samples in control MO rep3; Danio rerio; RNA Seq,GSM7921551 r1,GSM7921551,1,Total RNA was extracted using Trizol reagent Invitrogen  CA  USA following the manufacturer's procedure. Total RNA quantity and purity were analyzed by Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit Agilent  CA  USA with RIN number >7.0. RNA libraries were prepared for sequencing using standard Illumina protocols,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP474706,,loader:fastq load.py,S3_Clean_Data1.fq.gz S3_Clean_Data2.fq.gz,fastq fastq,5643732705.0,20272868.0,GSM7921551 r1,0:139.20 1:139.19,A:1466198749;C:1349499199;G:1367008013;T:1461024521;N:2223,139,139,,,1466198749,1349499199,1367008013,1461024521,2223,SRX22668014,SRS19663574,SRA1759375,Zhejiang university,Zhejiang university,2,0.95103,0.95208,0.07142,0.07068,0.73428,0.73371,0.47064,0.47197,141,141,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,bulk,bulk,bulk,,China,2023-11-28,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures
29029,SRR26974571,SRX22668013,SRS19663573,SRP474706,PRJNA1046144,Nlrc3 signaling is required for hematopoietic stem cell emergence by activating Notch signaling in vertebrates,GSE248871,Transcriptome Analysis,Purpose: Since Nlrc3 signaling is imperative for HSPCs production in zebrafish  to further determine the regulatory mechanism by which nlrc3 signaling regulates HSPCs. Bulk RNA sequencing analysis is performed to dissect the function and molecular mechanism between the control groups and the nlrc3 morphants groups. Methods: The GFP+ cells in Tgfli1a:eGFP zebrafish embryos at 28 hpf were sorted  which is the stage that EHT occurs in the VDA and the site of hemogenic endothelial cells onset. The mRNA profiles of these cells in wild type WT and Nlrc3 knockdown were deep sequencing  in triplicate  using Illumina GAIIx. The sequence reads that passed quality filters were analyzed at the transcript isoform level with two methods: Burrows–Wheeler Aligner BWA followed by ANOVA ANOVA and TopHat followed by Cufflinks. qRT–PCR validation was performed using TaqMan and SYBR Green assays. Results: Using an optimized data analysis workflow  we mapped about 35 million sequence reads per sample and identified 4153 transcripts showing differential expression between the of WT and  Nlrc3 morphants  with a fold change =1.5 and p value <0.05. Based on the results of RNA seq  some signaling pathways essential for  the the Nlrc3 regulates the onset of HSPCs in vertebrate are dissected. Including Notch  WNT  NF kB. Conclusions: Hemogenic endothelial cells mRNA profiles of WT groups and Nlrc3 knockdown groups were deep sequenced and anlysis. Based on the results of RNA seq  we performed  experiments to validate the up and downstream pathway involved in the the Nlrc3 regulates the onset of HSCPs in vertebrate. Overall design: mRNA profiling by high throughput sequencing to dissect the function and molecular mechanism by which nlrc3 signaling regulates the HSPCs in vertebrate.,,pubmed:38172511,,samples in control MO rep2,GSM7921550,,source name:zebrafish embryos|tissue:GFP+ cells in Tgfli1a:eGFP|passage:28 hpf embryos|culture:no culture|geo loc name:missing|collection date:missing,samples in control MO rep2,Illunima Casava 1.8 software used for basecalling. Sequenced reads were trimmed for adaptor sequence  and masked for low complexity or low quality sequence  then mapped to mm8 whole genome using bowtie v0.12.2 with parameters  q  p 4  e 100  y  a  m 10   best   strata Reads Per Kilobase of exon per Megabase of library size RPKM were calculated using a protocol from Chepelev et al.  Nucleic Acids Research  2009. In short  exons from all isoforms of a gene were merged to create one meta transcript. The number of reads falling in the exons of this meta transcript were counted and normalized by the size of the meta transcript and by the size of the library. Supplementary files format and content: FPKM values for each Sample.,zebrafish embryos,,Total RNA was extracted using Trizol reagent Invitrogen  CA  USA following the manufacturer's procedure. Total RNA quantity and purity were analyzed by Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit Agilent  CA  USA with RIN number >7.0. RNA libraries were prepared for sequencing using standard Illumina protocols,,tissue:GFP+ cells in Tgfli1a:eGFP|passage:28 hpf embryos|culture:no culture,GSM7921550,GSM7921550: samples in control MO rep2; Danio rerio; RNA Seq,GSM7921550 r1,GSM7921550,1,Total RNA was extracted using Trizol reagent Invitrogen  CA  USA following the manufacturer's procedure. Total RNA quantity and purity were analyzed by Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit Agilent  CA  USA with RIN number >7.0. RNA libraries were prepared for sequencing using standard Illumina protocols,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP474706,,loader:fastq load.py,S2_Clean_Data1.fq.gz S2_Clean_Data2.fq.gz,fastq fastq,4436220529.0,15923512.0,GSM7921550 r1,0:139.30 1:139.29,A:1152960918;C:1060020216;G:1074069001;T:1149168714;N:1680,139,139,,,1152960918,1060020216,1074069001,1149168714,1680,SRX22668013,SRS19663573,SRA1759375,Zhejiang university,Zhejiang university,2,0.94868,0.94952,0.07127,0.07083,0.73438,0.73403,0.46822,0.46865,141,141,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,bulk,bulk,bulk,,China,2023-11-28,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures
29030,SRR26974572,SRX22668012,SRS19663572,SRP474706,PRJNA1046144,Nlrc3 signaling is required for hematopoietic stem cell emergence by activating Notch signaling in vertebrates,GSE248871,Transcriptome Analysis,Purpose: Since Nlrc3 signaling is imperative for HSPCs production in zebrafish  to further determine the regulatory mechanism by which nlrc3 signaling regulates HSPCs. Bulk RNA sequencing analysis is performed to dissect the function and molecular mechanism between the control groups and the nlrc3 morphants groups. Methods: The GFP+ cells in Tgfli1a:eGFP zebrafish embryos at 28 hpf were sorted  which is the stage that EHT occurs in the VDA and the site of hemogenic endothelial cells onset. The mRNA profiles of these cells in wild type WT and Nlrc3 knockdown were deep sequencing  in triplicate  using Illumina GAIIx. The sequence reads that passed quality filters were analyzed at the transcript isoform level with two methods: Burrows–Wheeler Aligner BWA followed by ANOVA ANOVA and TopHat followed by Cufflinks. qRT–PCR validation was performed using TaqMan and SYBR Green assays. Results: Using an optimized data analysis workflow  we mapped about 35 million sequence reads per sample and identified 4153 transcripts showing differential expression between the of WT and  Nlrc3 morphants  with a fold change =1.5 and p value <0.05. Based on the results of RNA seq  some signaling pathways essential for  the the Nlrc3 regulates the onset of HSPCs in vertebrate are dissected. Including Notch  WNT  NF kB. Conclusions: Hemogenic endothelial cells mRNA profiles of WT groups and Nlrc3 knockdown groups were deep sequenced and anlysis. Based on the results of RNA seq  we performed  experiments to validate the up and downstream pathway involved in the the Nlrc3 regulates the onset of HSCPs in vertebrate. Overall design: mRNA profiling by high throughput sequencing to dissect the function and molecular mechanism by which nlrc3 signaling regulates the HSPCs in vertebrate.,,pubmed:38172511,,samples in control MO rep1,GSM7921549,,source name:zebrafish embryos|tissue:GFP+ cells in Tgfli1a:eGFP|passage:28 hpf embryos|culture:no culture|geo loc name:missing|collection date:missing,samples in control MO rep1,Illunima Casava 1.8 software used for basecalling. Sequenced reads were trimmed for adaptor sequence  and masked for low complexity or low quality sequence  then mapped to mm8 whole genome using bowtie v0.12.2 with parameters  q  p 4  e 100  y  a  m 10   best   strata Reads Per Kilobase of exon per Megabase of library size RPKM were calculated using a protocol from Chepelev et al.  Nucleic Acids Research  2009. In short  exons from all isoforms of a gene were merged to create one meta transcript. The number of reads falling in the exons of this meta transcript were counted and normalized by the size of the meta transcript and by the size of the library. Supplementary files format and content: FPKM values for each Sample.,zebrafish embryos,,Total RNA was extracted using Trizol reagent Invitrogen  CA  USA following the manufacturer's procedure. Total RNA quantity and purity were analyzed by Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit Agilent  CA  USA with RIN number >7.0. RNA libraries were prepared for sequencing using standard Illumina protocols,,tissue:GFP+ cells in Tgfli1a:eGFP|passage:28 hpf embryos|culture:no culture,GSM7921549,GSM7921549: samples in control MO rep1; Danio rerio; RNA Seq,GSM7921549 r1,GSM7921549,1,Total RNA was extracted using Trizol reagent Invitrogen  CA  USA following the manufacturer's procedure. Total RNA quantity and purity were analyzed by Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit Agilent  CA  USA with RIN number >7.0. RNA libraries were prepared for sequencing using standard Illumina protocols,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP474706,,loader:fastq load.py,S1_Clean_Data1.fq.gz S1_Clean_Data2.fq.gz,fastq fastq,6121313766.0,21997860.0,GSM7921549 r1,0:139.14 1:139.13,A:1591232135;C:1462847585;G:1481777440;T:1585450214;N:6392,139,139,,,1591232135,1462847585,1481777440,1585450214,6392,SRX22668012,SRS19663572,SRA1759375,Zhejiang university,Zhejiang university,2,0.95177,0.95291,0.07145,0.07064,0.73322,0.73306,0.47372,0.47734,141,141,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,unknown,bulk,bulk,bulk,,China,2023-11-28,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures
30018,SRR27988043,SRX23641260,SRS20476222,SRP485064,PRJNA1067370,zebrafish embryo for scRNA seq and bulk RNA seq,PRJNA1067370,Other,Hepcidin hamp is a key regulator for the maintenance of iron metabolism. How hamp affects the mechanism of zebrafish hematopoiesis is still largely unknown. Here  we have generated a stable hamp mutant zebrafish model by using the CRISPR/Cas9 system.We found that iron overload occurred in several tissues of zebrafish  and the hemoglobin content decreased significantly during embryonic development.Single cell profiling demonstrated that hematopoietic actors were aberrantly expressed  and hematopoietic progenitor cells appeared a group of cell clusters with relatively delayed development  accompanied by ferroptosis.,,,,hamp /   36 hpf blood,zebrafish hamp /  36 hpf blood replicate 3,,strain:not applicable|isolate:not collected|breed:Danio|cultivar:not applicable|ecotype:not applicable|age:36 hpf|dev stage:36 hpf|collection date:2022 10|geo loc name:not applicable|sex:not applicable|tissue:blood|genotype:hamp knockdown|sample type:tissue sample|treatment:replicate 3|BioSampleModel:Model organism or animal,,,,,,,,,RNA seq  hamp /   36 hpf blood  replicate 3,B 6,B 6,bulk RNA seq,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP485064,,,KO-3_R2_001.fastq.gz KO-3_R1_001.fastq.gz,fastq fastq,8752665900.0,29175553.0,KO 3 R1 001.fastq.gz,0:150 1:150,A:2204170575;C:2174083961;G:2224694970;T:2149603712;N:112682,150,150,,,2204170575,2174083961,2224694970,2149603712,112682,SRX23641260,SRS20476222,SRA1803422,Shanghai Ocean University|College of Fisheries and Life,Shanghai Ocean University,2,0.91553,0.91645,0.01276,0.01288,0.85884,0.85839,0.35101,0.40996,150,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,sc_generic,bulk,bulk,,China,2024-02-16,Pharyngula,Embryo,Blood,Hematopoietic System
30019,SRR27988044,SRX23641259,SRS20476221,SRP485064,PRJNA1067370,zebrafish embryo for scRNA seq and bulk RNA seq,PRJNA1067370,Other,Hepcidin hamp is a key regulator for the maintenance of iron metabolism. How hamp affects the mechanism of zebrafish hematopoiesis is still largely unknown. Here  we have generated a stable hamp mutant zebrafish model by using the CRISPR/Cas9 system.We found that iron overload occurred in several tissues of zebrafish  and the hemoglobin content decreased significantly during embryonic development.Single cell profiling demonstrated that hematopoietic actors were aberrantly expressed  and hematopoietic progenitor cells appeared a group of cell clusters with relatively delayed development  accompanied by ferroptosis.,,,,hamp /   36 hpf blood,zebrafish hamp /  36 hpf blood replicate 2,,strain:not applicable|isolate:not collected|breed:Danio|cultivar:not applicable|ecotype:not applicable|age:36 hpf|dev stage:36 hpf|collection date:2022 10|geo loc name:not applicable|sex:not applicable|tissue:blood|genotype:hamp knockdown|sample type:tissue sample|treatment:replicate 2|BioSampleModel:Model organism or animal,,,,,,,,,RNA seq  hamp /   36 hpf blood  replicate 2,B 5,B 5,bulk RNA seq,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP485064,,,KO-2_R1_001.fastq.gz KO-2_R2_001.fastq.gz,fastq fastq,8060498700.0,26868329.0,KO 2 R1 001.fastq.gz,0:150 1:150,A:2045797336;C:1985847523;G:2035528018;T:1993222840;N:102983,150,150,,,2045797336,1985847523,2035528018,1993222840,102983,SRX23641259,SRS20476221,SRA1803422,Shanghai Ocean University|College of Fisheries and Life,Shanghai Ocean University,2,0.9213,0.92027,0.0167,0.01676,0.8242,0.82475,0.41081,0.41111,150,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,sc_generic,bulk,bulk,,China,2024-02-16,Pharyngula,Embryo,Blood,Hematopoietic System
30020,SRR27988045,SRX23641258,SRS20476220,SRP485064,PRJNA1067370,zebrafish embryo for scRNA seq and bulk RNA seq,PRJNA1067370,Other,Hepcidin hamp is a key regulator for the maintenance of iron metabolism. How hamp affects the mechanism of zebrafish hematopoiesis is still largely unknown. Here  we have generated a stable hamp mutant zebrafish model by using the CRISPR/Cas9 system.We found that iron overload occurred in several tissues of zebrafish  and the hemoglobin content decreased significantly during embryonic development.Single cell profiling demonstrated that hematopoietic actors were aberrantly expressed  and hematopoietic progenitor cells appeared a group of cell clusters with relatively delayed development  accompanied by ferroptosis.,,,,hamp /   36 hpf blood,zebrafish hamp /  36 hpf blood replicate 1,,strain:not applicable|isolate:not collected|breed:Danio|cultivar:not applicable|ecotype:not applicable|age:36 hpf|dev stage:36 hpf|collection date:2022 10|geo loc name:not applicable|sex:not applicable|tissue:blood|genotype:hamp knockdown|sample type:tissue sample|treatment:replicate 1|BioSampleModel:Model organism or animal,,,,,,,,,RNA seq  hamp /   36 hpf blood  replicate 1,B 4,B 4,bulk RNA seq,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP485064,,,KO-1_R1_001.fastq.gz KO-1_R2_001.fastq.gz,fastq fastq,8707637700.0,29025459.0,KO 1 R1 001.fastq.gz,0:150 1:150,A:2222026435;C:2133480283;G:2182087972;T:2169932447;N:110563,150,150,,,2222026435,2133480283,2182087972,2169932447,110563,SRX23641258,SRS20476220,SRA1803422,Shanghai Ocean University|College of Fisheries and Life,Shanghai Ocean University,2,0.91531,0.91359,0.02185,0.0221,0.81213,0.8128,0.37868,0.42351,150,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,sc_generic,bulk,bulk,,China,2024-02-16,Pharyngula,Embryo,Blood,Hematopoietic System
30021,SRR27988046,SRX23641257,SRS20476219,SRP485064,PRJNA1067370,zebrafish embryo for scRNA seq and bulk RNA seq,PRJNA1067370,Other,Hepcidin hamp is a key regulator for the maintenance of iron metabolism. How hamp affects the mechanism of zebrafish hematopoiesis is still largely unknown. Here  we have generated a stable hamp mutant zebrafish model by using the CRISPR/Cas9 system.We found that iron overload occurred in several tissues of zebrafish  and the hemoglobin content decreased significantly during embryonic development.Single cell profiling demonstrated that hematopoietic actors were aberrantly expressed  and hematopoietic progenitor cells appeared a group of cell clusters with relatively delayed development  accompanied by ferroptosis.,,,,wild type 36 hpf blood,zebrafish wild type 36 hpf blood replicate 3,,strain:not applicable|isolate:not collected|breed:Danio|cultivar:not applicable|ecotype:not applicable|age:36 hpf|dev stage:36 hpf|collection date:2022 10|geo loc name:not applicable|sex:not applicable|tissue:blood|genotype:wild type|sample type:tissue sample|treatment:replicate 3|BioSampleModel:Model organism or animal,,,,,,,,,RNA seq  wild type  36 hpf blood  replicate 3,B 3,B 3,bulk RNA seq,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP485064,,,WT-3_R1_001.fastq.gz WT-3_R2_001.fastq.gz,fastq fastq,8829371400.0,29431238.0,WT 3 R1 001.fastq.gz,0:150 1:150,A:2278837675;C:2141723937;G:2193442375;T:2215253519;N:113894,150,150,,,2278837675,2141723937,2193442375,2215253519,113894,SRX23641257,SRS20476219,SRA1803422,Shanghai Ocean University|College of Fisheries and Life,Shanghai Ocean University,2,0.90531,0.9043,0.03015,0.03017,0.8101,0.8112,0.43085,0.43002,150,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,sc_generic,bulk,bulk,,China,2024-02-16,Pharyngula,Embryo,Blood,Hematopoietic System
30022,SRR27988047,SRX23641256,SRS20476218,SRP485064,PRJNA1067370,zebrafish embryo for scRNA seq and bulk RNA seq,PRJNA1067370,Other,Hepcidin hamp is a key regulator for the maintenance of iron metabolism. How hamp affects the mechanism of zebrafish hematopoiesis is still largely unknown. Here  we have generated a stable hamp mutant zebrafish model by using the CRISPR/Cas9 system.We found that iron overload occurred in several tissues of zebrafish  and the hemoglobin content decreased significantly during embryonic development.Single cell profiling demonstrated that hematopoietic actors were aberrantly expressed  and hematopoietic progenitor cells appeared a group of cell clusters with relatively delayed development  accompanied by ferroptosis.,,,,wild type 36 hpf blood,zebrafish wild type 36 hpf blood replicate 2,,strain:not applicable|isolate:not collected|breed:Danio|cultivar:not applicable|ecotype:not applicable|age:36 hpf|dev stage:36 hpf|collection date:2022 10|geo loc name:not applicable|sex:not applicable|tissue:blood|genotype:wild type|sample type:tissue sample|treatment:replicate 2|BioSampleModel:Model organism or animal,,,,,,,,,RNA seq  wild type  36 hpf blood  replicate 2,B 2,B 2,bulk RNA seq,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP485064,,,WT-2_R1_001.fastq.gz WT-2_R2_001.fastq.gz,fastq fastq,7365643800.0,24552146.0,WT 2 R1 001.fastq.gz,0:150 1:150,A:1867985067;C:1819016430;G:1870006707;T:1808540769;N:94827,150,150,,,1867985067,1819016430,1870006707,1808540769,94827,SRX23641256,SRS20476218,SRA1803422,Shanghai Ocean University|College of Fisheries and Life,Shanghai Ocean University,2,0.90612,0.90536,0.01714,0.01746,0.88109,0.88156,0.32469,0.39232,150,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,sc_generic,bulk,bulk,,China,2024-02-16,Pharyngula,Embryo,Blood,Hematopoietic System
30023,SRR27988048,SRX23641255,SRS20476217,SRP485064,PRJNA1067370,zebrafish embryo for scRNA seq and bulk RNA seq,PRJNA1067370,Other,Hepcidin hamp is a key regulator for the maintenance of iron metabolism. How hamp affects the mechanism of zebrafish hematopoiesis is still largely unknown. Here  we have generated a stable hamp mutant zebrafish model by using the CRISPR/Cas9 system.We found that iron overload occurred in several tissues of zebrafish  and the hemoglobin content decreased significantly during embryonic development.Single cell profiling demonstrated that hematopoietic actors were aberrantly expressed  and hematopoietic progenitor cells appeared a group of cell clusters with relatively delayed development  accompanied by ferroptosis.,,,,wild type 36 hpf blood,zebrafish wild type 36 hpf blood replicate 1,,strain:not applicable|isolate:not collected|breed:Danio|cultivar:not applicable|ecotype:not applicable|age:36 hpf|dev stage:36 hpf|collection date:2022 10|geo loc name:not applicable|sex:not applicable|tissue:blood|genotype:wild type|sample type:tissue sample|treatment:replicate 1|BioSampleModel:Model organism or animal,,,,,,,,,RNA seq  wild type  36 hpf blood  replicate 1,B 1,B 1,bulk RNA seq,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP485064,,,WT-1_R1_001.fastq.gz WT-1_R2_001.fastq.gz,fastq fastq,8631863400.0,28772878.0,WT 1 R1 001.fastq.gz,0:150 1:150,A:2186212554;C:2135990723;G:2179142081;T:2130408485;N:109557,150,150,,,2186212554,2135990723,2179142081,2130408485,109557,SRX23641255,SRS20476217,SRA1803422,Shanghai Ocean University|College of Fisheries and Life,Shanghai Ocean University,2,0.90461,0.90281,0.01388,0.01365,0.83871,0.83895,0.36511,0.41074,150,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,sc_generic,bulk,bulk,,China,2024-02-16,Pharyngula,Embryo,Blood,Hematopoietic System
30024,SRR27732020,SRX23397628,SRS20258469,SRP485064,PRJNA1067370,zebrafish embryo for scRNA seq and bulk RNA seq,PRJNA1067370,Other,Hepcidin hamp is a key regulator for the maintenance of iron metabolism. How hamp affects the mechanism of zebrafish hematopoiesis is still largely unknown. Here  we have generated a stable hamp mutant zebrafish model by using the CRISPR/Cas9 system.We found that iron overload occurred in several tissues of zebrafish  and the hemoglobin content decreased significantly during embryonic development.Single cell profiling demonstrated that hematopoietic actors were aberrantly expressed  and hematopoietic progenitor cells appeared a group of cell clusters with relatively delayed development  accompanied by ferroptosis.,,,,wild type 36 hpf embryo,zebrafish embryo 36hpf replicate 1,,strain:not applicable|isolate:not collected|breed:Danio|cultivar:not applicable|ecotype:not applicable|dev stage:36 hpf|collection date:2022 10|geo loc name:not applicable|sex:not applicable|tissue:embryo|genotype:wild type|sample type:whole organism|treatment:replicate 1|BioSampleModel:Model organism or animal,,,,,,,,,RNA Seq of Danio rerio: 36hpf embryo,W 13,W 13,bulk RNA seq,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP485064,,,WT36h-1_1.fq.gz WT36h-1_2.fq.gz,fastq fastq,7292758500.0,24309195.0,WT36h 1 1.fq.gz,0:150 1:150,A:1908273664;C:1731632674;G:1760624671;T:1892167502;N:59989,150,150,,,1908273664,1731632674,1760624671,1892167502,59989,SRX23397628,SRS20258469,SRA1791946,Shanghai Ocean University|College of Fisheries and Life,Shanghai Ocean University,2,0.94269,0.94089,0.07258,0.07222,0.69978,0.70143,0.45682,0.45348,150,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,sc_generic,bulk,bulk,,China,2024-01-26,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures
30025,SRR27732021,SRX23397627,SRS20258468,SRP485064,PRJNA1067370,zebrafish embryo for scRNA seq and bulk RNA seq,PRJNA1067370,Other,Hepcidin hamp is a key regulator for the maintenance of iron metabolism. How hamp affects the mechanism of zebrafish hematopoiesis is still largely unknown. Here  we have generated a stable hamp mutant zebrafish model by using the CRISPR/Cas9 system.We found that iron overload occurred in several tissues of zebrafish  and the hemoglobin content decreased significantly during embryonic development.Single cell profiling demonstrated that hematopoietic actors were aberrantly expressed  and hematopoietic progenitor cells appeared a group of cell clusters with relatively delayed development  accompanied by ferroptosis.,,,,wild type 24 hpf embryo,zebrafish embryo 24hpf replicate 3,,strain:not applicable|isolate:not collected|breed:Danio|cultivar:not applicable|ecotype:not applicable|dev stage:24 hpf|collection date:2022 10|geo loc name:not applicable|sex:not applicable|tissue:embryo|genotype:wild type|sample type:whole organism|treatment:replicate 3|BioSampleModel:Model organism or animal,,,,,,,,,RNA Seq of Danio rerio: 24hpf embryo,W 12,W 12,bulk RNA seq,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP485064,,,WT24h-3_1.fq.gz WT24h-3_2.fq.gz,fastq fastq,6515838900.0,21719463.0,WT24h 3 1.fq.gz,0:150 1:150,A:1713953613;C:1537571365;G:1564392828;T:1699697009;N:224085,150,150,,,1713953613,1537571365,1564392828,1699697009,224085,SRX23397627,SRS20258468,SRA1791946,Shanghai Ocean University|College of Fisheries and Life,Shanghai Ocean University,2,0.93632,0.9362,0.06541,0.06556,0.69992,0.70094,0.46899,0.46674,150,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,sc_generic,bulk,bulk,,China,2024-01-26,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures
30026,SRR27732022,SRX23397626,SRS20258467,SRP485064,PRJNA1067370,zebrafish embryo for scRNA seq and bulk RNA seq,PRJNA1067370,Other,Hepcidin hamp is a key regulator for the maintenance of iron metabolism. How hamp affects the mechanism of zebrafish hematopoiesis is still largely unknown. Here  we have generated a stable hamp mutant zebrafish model by using the CRISPR/Cas9 system.We found that iron overload occurred in several tissues of zebrafish  and the hemoglobin content decreased significantly during embryonic development.Single cell profiling demonstrated that hematopoietic actors were aberrantly expressed  and hematopoietic progenitor cells appeared a group of cell clusters with relatively delayed development  accompanied by ferroptosis.,,,,wild type 24 hpf embryo,zebrafish embryo 24hpf replicate 2,,strain:not applicable|isolate:not collected|breed:Danio|cultivar:not applicable|ecotype:not applicable|dev stage:24 hpf|collection date:2022 10|geo loc name:not applicable|sex:not applicable|tissue:embryo|genotype:wild type|sample type:whole organism|treatment:replicate 2|BioSampleModel:Model organism or animal,,,,,,,,,RNA Seq of Danio rerio: 24hpf embryo,W 11,W 11,bulk RNA seq,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP485064,,,WT24h-2_1.fq.gz WT24h-2_2.fq.gz,fastq fastq,7161020400.0,23870068.0,WT24h 2 1.fq.gz,0:150 1:150,A:1879362459;C:1692535178;G:1727934369;T:1860947917;N:240477,150,150,,,1879362459,1692535178,1727934369,1860947917,240477,SRX23397626,SRS20258467,SRA1791946,Shanghai Ocean University|College of Fisheries and Life,Shanghai Ocean University,2,0.93727,0.93618,0.06477,0.06473,0.69546,0.69534,0.46029,0.46325,150,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,sc_generic,bulk,bulk,,China,2024-01-26,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures
30027,SRR27732023,SRX23397625,SRS20258466,SRP485064,PRJNA1067370,zebrafish embryo for scRNA seq and bulk RNA seq,PRJNA1067370,Other,Hepcidin hamp is a key regulator for the maintenance of iron metabolism. How hamp affects the mechanism of zebrafish hematopoiesis is still largely unknown. Here  we have generated a stable hamp mutant zebrafish model by using the CRISPR/Cas9 system.We found that iron overload occurred in several tissues of zebrafish  and the hemoglobin content decreased significantly during embryonic development.Single cell profiling demonstrated that hematopoietic actors were aberrantly expressed  and hematopoietic progenitor cells appeared a group of cell clusters with relatively delayed development  accompanied by ferroptosis.,,,,wild type 24 hpf embryo,zebrafish embryo 24hpf replicate 1,,strain:not applicable|isolate:not collected|breed:Danio|cultivar:not applicable|ecotype:not applicable|dev stage:24 hpf|collection date:2022 10|geo loc name:not applicable|sex:not applicable|tissue:embryo|genotype:wild type|sample type:whole organism|treatment:replicate 1|BioSampleModel:Model organism or animal,,,,,,,,,RNA Seq of Danio rerio: 24hpf embryo,W 10,W 10,bulk RNA seq,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP485064,,,WT24h-1_1.fq.gz WT24h-1_2.fq.gz,fastq fastq,6174518700.0,20581729.0,WT24h 1 1.fq.gz,0:150 1:150,A:1622124267;C:1458396393;G:1486147186;T:1607751720;N:99134,150,150,,,1622124267,1458396393,1486147186,1607751720,99134,SRX23397625,SRS20258466,SRA1791946,Shanghai Ocean University|College of Fisheries and Life,Shanghai Ocean University,2,0.93835,0.93534,0.06486,0.06373,0.69934,0.70041,0.45483,0.45986,150,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,sc_generic,bulk,bulk,,China,2024-01-26,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures
30038,SRR27732034,SRX23397614,SRS20258455,SRP485064,PRJNA1067370,zebrafish embryo for scRNA seq and bulk RNA seq,PRJNA1067370,Other,Hepcidin hamp is a key regulator for the maintenance of iron metabolism. How hamp affects the mechanism of zebrafish hematopoiesis is still largely unknown. Here  we have generated a stable hamp mutant zebrafish model by using the CRISPR/Cas9 system.We found that iron overload occurred in several tissues of zebrafish  and the hemoglobin content decreased significantly during embryonic development.Single cell profiling demonstrated that hematopoietic actors were aberrantly expressed  and hematopoietic progenitor cells appeared a group of cell clusters with relatively delayed development  accompanied by ferroptosis.,,,,wild type 36 hpf embryo,zebrafish embryo 36hpf replicate 3,,strain:not applicable|isolate:not collected|breed:Danio|cultivar:not applicable|ecotype:not applicable|dev stage:36 hpf|collection date:2022 10|geo loc name:not applicable|sex:not applicable|tissue:embryo|genotype:wild type|sample type:whole organism|treatment:replicate 3|BioSampleModel:Model organism or animal,,,,,,,,,RNA Seq of Danio rerio: 36hpf embryo,W 15,W 15,bulk RNA seq,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP485064,,,WT36h-3_1.fq.gz WT36h-3_2.fq.gz,fastq fastq,6607629600.0,22025432.0,WT36h 3 1.fq.gz,0:150 1:150,A:1740033364;C:1558025307;G:1585024036;T:1724491752;N:55141,150,150,,,1740033364,1558025307,1585024036,1724491752,55141,SRX23397614,SRS20258455,SRA1791946,Shanghai Ocean University|College of Fisheries and Life,Shanghai Ocean University,2,0.94036,0.93863,0.07395,0.07343,0.69723,0.6994,0.46045,0.46325,150,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,sc_generic,bulk,bulk,,China,2024-01-26,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures
30039,SRR27732035,SRX23397613,SRS20258454,SRP485064,PRJNA1067370,zebrafish embryo for scRNA seq and bulk RNA seq,PRJNA1067370,Other,Hepcidin hamp is a key regulator for the maintenance of iron metabolism. How hamp affects the mechanism of zebrafish hematopoiesis is still largely unknown. Here  we have generated a stable hamp mutant zebrafish model by using the CRISPR/Cas9 system.We found that iron overload occurred in several tissues of zebrafish  and the hemoglobin content decreased significantly during embryonic development.Single cell profiling demonstrated that hematopoietic actors were aberrantly expressed  and hematopoietic progenitor cells appeared a group of cell clusters with relatively delayed development  accompanied by ferroptosis.,,,,wild type 36 hpf embryo,zebrafish embryo 36hpf replicate 2,,strain:not applicable|isolate:not collected|breed:Danio|cultivar:not applicable|ecotype:not applicable|dev stage:36 hpf|collection date:2022 10|geo loc name:not applicable|sex:not applicable|tissue:embryo|genotype:wild type|sample type:whole organism|treatment:replicate 2|BioSampleModel:Model organism or animal,,,,,,,,,RNA Seq of Danio rerio: 36hpf embryo,W 14,W 14,bulk RNA seq,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP485064,,,WT36h-2_1.fq.gz WT36h-2_2.fq.gz,fastq fastq,7848879900.0,26162933.0,WT36h 2 1.fq.gz,0:150 1:150,A:2065200572;C:1853008494;G:1880402891;T:2050169369;N:98574,150,150,,,2065200572,1853008494,1880402891,2050169369,98574,SRX23397613,SRS20258454,SRA1791946,Shanghai Ocean University|College of Fisheries and Life,Shanghai Ocean University,2,0.9395,0.93639,0.07562,0.07383,0.6969,0.69814,0.46478,0.45495,150,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,sc_generic,bulk,bulk,,China,2024-01-26,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures
30042,SRR27730705,SRX23396353,SRS20257267,SRP485064,PRJNA1067370,zebrafish embryo for scRNA seq and bulk RNA seq,PRJNA1067370,Other,Hepcidin hamp is a key regulator for the maintenance of iron metabolism. How hamp affects the mechanism of zebrafish hematopoiesis is still largely unknown. Here  we have generated a stable hamp mutant zebrafish model by using the CRISPR/Cas9 system.We found that iron overload occurred in several tissues of zebrafish  and the hemoglobin content decreased significantly during embryonic development.Single cell profiling demonstrated that hematopoietic actors were aberrantly expressed  and hematopoietic progenitor cells appeared a group of cell clusters with relatively delayed development  accompanied by ferroptosis.,,,,hamp /  24 hpf embryo,zebrafish embryo hamp /  24hpf replicate 1,,strain:not applicable|isolate:not collected|breed:Danio|cultivar:not applicable|ecotype:not applicable|dev stage:24 hpf|collection date:2022 10|geo loc name:not applicable|sex:not applicable|tissue:embryo|genotype:hamp / |sample type:whole organism|treatment:replicate 1|BioSampleModel:Model organism or animal,,,,,,,,,RNA Seq of Danio rerio: 24hpf embryo,W 31,W 31,bulk RNA seq,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP485064,,,hamp24h-1_1.fq.gz hamp24h-1_2.fq.gz,fastq fastq,6643634100.0,22145447.0,hamp24h 1 1.fq.gz,0:150 1:150,A:1742210141;C:1573249075;G:1600079934;T:1727989339;N:105611,150,150,,,1742210141,1573249075,1600079934,1727989339,105611,SRX23396353,SRS20257267,SRA1791861,Shanghai Ocean University|College of Fisheries and Life,Shanghai Ocean University,2,0.93899,0.93556,0.06108,0.0602,0.6997,0.70179,0.47261,0.47417,150,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,sc_generic,bulk,bulk,,China,2024-01-25,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures
30056,SRR27730719,SRX23396339,SRS20257253,SRP485064,PRJNA1067370,zebrafish embryo for scRNA seq and bulk RNA seq,PRJNA1067370,Other,Hepcidin hamp is a key regulator for the maintenance of iron metabolism. How hamp affects the mechanism of zebrafish hematopoiesis is still largely unknown. Here  we have generated a stable hamp mutant zebrafish model by using the CRISPR/Cas9 system.We found that iron overload occurred in several tissues of zebrafish  and the hemoglobin content decreased significantly during embryonic development.Single cell profiling demonstrated that hematopoietic actors were aberrantly expressed  and hematopoietic progenitor cells appeared a group of cell clusters with relatively delayed development  accompanied by ferroptosis.,,,,hamp /  36 hpf embryo,zebrafish embryo hamp /  36hpf replicate 3,,strain:not applicable|isolate:not collected|breed:Danio|cultivar:not applicable|ecotype:not applicable|dev stage:36 hpf|collection date:2022 10|geo loc name:not applicable|sex:not applicable|tissue:embryo|genotype:hamp / |sample type:whole organism|treatment:replicate 3|BioSampleModel:Model organism or animal,,,,,,,,,RNA Seq of Danio rerio: 36hpf embryo,W 36,W 36,bulk RNA seq,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP485064,,,hamp36h-3_1.fq.gz hamp36h-3_2.fq.gz,fastq fastq,6442851300.0,21476171.0,hamp36h 3 1.fq.gz,0:150 1:150,A:1696209844;C:1521086149;G:1542365512;T:1683136288;N:53507,150,150,,,1696209844,1521086149,1542365512,1683136288,53507,SRX23396339,SRS20257253,SRA1791861,Shanghai Ocean University|College of Fisheries and Life,Shanghai Ocean University,2,0.9446,0.94399,0.07193,0.07106,0.6955,0.69729,0.46483,0.46399,150,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,sc_generic,bulk,bulk,,China,2024-01-25,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures
30057,SRR27730720,SRX23396338,SRS20257252,SRP485064,PRJNA1067370,zebrafish embryo for scRNA seq and bulk RNA seq,PRJNA1067370,Other,Hepcidin hamp is a key regulator for the maintenance of iron metabolism. How hamp affects the mechanism of zebrafish hematopoiesis is still largely unknown. Here  we have generated a stable hamp mutant zebrafish model by using the CRISPR/Cas9 system.We found that iron overload occurred in several tissues of zebrafish  and the hemoglobin content decreased significantly during embryonic development.Single cell profiling demonstrated that hematopoietic actors were aberrantly expressed  and hematopoietic progenitor cells appeared a group of cell clusters with relatively delayed development  accompanied by ferroptosis.,,,,hamp /  36 hpf embryo,zebrafish embryo hamp /  36hpf replicate 2,,strain:not applicable|isolate:not collected|breed:Danio|cultivar:not applicable|ecotype:not applicable|dev stage:36 hpf|collection date:2022 10|geo loc name:not applicable|sex:not applicable|tissue:embryo|genotype:hamp / |sample type:whole organism|treatment:replicate 2|BioSampleModel:Model organism or animal,,,,,,,,,RNA Seq of Danio rerio: 36hpf embryo,W 35,W 35,bulk RNA seq,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP485064,,,hamp36h-2_1.fq.gz hamp36h-2_2.fq.gz,fastq fastq,8020366200.0,26734554.0,hamp36h 2 1.fq.gz,0:150 1:150,A:2103699528;C:1897760189;G:1928753070;T:2090039533;N:113880,150,150,,,2103699528,1897760189,1928753070,2090039533,113880,SRX23396338,SRS20257252,SRA1791861,Shanghai Ocean University|College of Fisheries and Life,Shanghai Ocean University,2,0.94805,0.94701,0.07022,0.06985,0.69585,0.69777,0.46182,0.45694,150,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,sc_generic,bulk,bulk,,China,2024-01-25,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures
30058,SRR27730721,SRX23396337,SRS20257251,SRP485064,PRJNA1067370,zebrafish embryo for scRNA seq and bulk RNA seq,PRJNA1067370,Other,Hepcidin hamp is a key regulator for the maintenance of iron metabolism. How hamp affects the mechanism of zebrafish hematopoiesis is still largely unknown. Here  we have generated a stable hamp mutant zebrafish model by using the CRISPR/Cas9 system.We found that iron overload occurred in several tissues of zebrafish  and the hemoglobin content decreased significantly during embryonic development.Single cell profiling demonstrated that hematopoietic actors were aberrantly expressed  and hematopoietic progenitor cells appeared a group of cell clusters with relatively delayed development  accompanied by ferroptosis.,,,,hamp /  36 hpf embryo,zebrafish embryo hamp /  36hpf replicate 1,,strain:not applicable|isolate:not collected|breed:Danio|cultivar:not applicable|ecotype:not applicable|dev stage:36 hpf|collection date:2022 10|geo loc name:not applicable|sex:not applicable|tissue:embryo|genotype:hamp / |sample type:whole organism|treatment:replicate 1|BioSampleModel:Model organism or animal,,,,,,,,,RNA Seq of Danio rerio: 36hpf embryo,W 34,W 34,bulk RNA seq,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP485064,,,hamp36h-1_1.fq.gz hamp36h-1_2.fq.gz,fastq fastq,7319492100.0,24398307.0,hamp36h 1 1.fq.gz,0:150 1:150,A:1924726816;C:1727922135;G:1762476592;T:1904305780;N:60777,150,150,,,1924726816,1727922135,1762476592,1904305780,60777,SRX23396337,SRS20257251,SRA1791861,Shanghai Ocean University|College of Fisheries and Life,Shanghai Ocean University,2,0.93938,0.93967,0.07121,0.07085,0.69581,0.69755,0.45448,0.45541,150,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,sc_generic,bulk,bulk,,China,2024-01-25,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures
30059,SRR27730722,SRX23396336,SRS20257250,SRP485064,PRJNA1067370,zebrafish embryo for scRNA seq and bulk RNA seq,PRJNA1067370,Other,Hepcidin hamp is a key regulator for the maintenance of iron metabolism. How hamp affects the mechanism of zebrafish hematopoiesis is still largely unknown. Here  we have generated a stable hamp mutant zebrafish model by using the CRISPR/Cas9 system.We found that iron overload occurred in several tissues of zebrafish  and the hemoglobin content decreased significantly during embryonic development.Single cell profiling demonstrated that hematopoietic actors were aberrantly expressed  and hematopoietic progenitor cells appeared a group of cell clusters with relatively delayed development  accompanied by ferroptosis.,,,,hamp /  24 hpf embryo,zebrafish embryo hamp /  24hpf replicate 3,,strain:not applicable|isolate:not collected|breed:Danio|cultivar:not applicable|ecotype:not applicable|dev stage:24 hpf|collection date:2022 10|geo loc name:not applicable|sex:not applicable|tissue:embryo|genotype:hamp / |sample type:whole organism|treatment:replicate 3|BioSampleModel:Model organism or animal,,,,,,,,,RNA Seq of Danio rerio: 24hpf embryo,W 33,W 33,bulk RNA seq,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP485064,,,hamp24h-3_1.fq.gz hamp24h-3_2.fq.gz,fastq fastq,6470874300.0,21569581.0,hamp24h 3 1.fq.gz,0:150 1:150,A:1698655936;C:1530916678;G:1555607788;T:1685479625;N:214273,150,150,,,1698655936,1530916678,1555607788,1685479625,214273,SRX23396336,SRS20257250,SRA1791861,Shanghai Ocean University|College of Fisheries and Life,Shanghai Ocean University,2,0.93644,0.93637,0.06179,0.06156,0.70011,0.70134,0.47098,0.4709,150,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,sc_generic,bulk,bulk,,China,2024-01-25,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures
30060,SRR27730723,SRX23396335,SRS20257249,SRP485064,PRJNA1067370,zebrafish embryo for scRNA seq and bulk RNA seq,PRJNA1067370,Other,Hepcidin hamp is a key regulator for the maintenance of iron metabolism. How hamp affects the mechanism of zebrafish hematopoiesis is still largely unknown. Here  we have generated a stable hamp mutant zebrafish model by using the CRISPR/Cas9 system.We found that iron overload occurred in several tissues of zebrafish  and the hemoglobin content decreased significantly during embryonic development.Single cell profiling demonstrated that hematopoietic actors were aberrantly expressed  and hematopoietic progenitor cells appeared a group of cell clusters with relatively delayed development  accompanied by ferroptosis.,,,,hamp /  24 hpf embryo,zebrafish embryo hamp /  24hpf replicate 2,,strain:not applicable|isolate:not collected|breed:Danio|cultivar:not applicable|ecotype:not applicable|dev stage:24 hpf|collection date:2022 10|geo loc name:not applicable|sex:not applicable|tissue:embryo|genotype:hamp / |sample type:whole organism|treatment:replicate 2|BioSampleModel:Model organism or animal,,,,,,,,,RNA Seq of Danio rerio: 24hpf embryo,W 32,W 32,bulk RNA seq,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP485064,,,hamp24h-2_1.fq.gz hamp24h-2_2.fq.gz,fastq fastq,5875188900.0,19583963.0,hamp24h 2 1.fq.gz,0:150 1:150,A:1553428887;C:1379148744;G:1400831429;T:1541584152;N:195688,150,150,,,1553428887,1379148744,1400831429,1541584152,195688,SRX23396335,SRS20257249,SRA1791861,Shanghai Ocean University|College of Fisheries and Life,Shanghai Ocean University,2,0.9351,0.93566,0.06624,0.06643,0.69739,0.69875,0.47055,0.47049,150,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,sc_generic,bulk,bulk,,China,2024-01-25,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures
32138,SRR29068704,SRX24593115,SRS21331205,SRP508364,PRJNA1112809,tp53 R217H and R242H Mutant Zebrafish Display Dysfunctional p53 Hallmarks and Recapitulate LFS Phenotypes [RNA seq],GSE267760,Transcriptome Analysis,Li Fraumeni syndrome LFS is a hereditary cancer predisposition syndrome associated with a highly penetrant and diverse tumor spectrum characterized by germline mutations in the TP53 tumor suppressor gene. To better understand how TP53 mutations predispose individuals with LFS to cancer development  we characterized tp53 R217H and R242H zebrafish lines as the first zebrafish p53 hotspot mutants human R248 and R273H. These mutants have lost several key wildtype p53 functions and recapitulate many LFS phenotypes. Specifically  we have shown that the R217H and R242H alleles result in partial to no activation of key p53 target genes  are resistant to apoptosis in a dominant negative manner and exhibit a defective G1 cell cycle checkpoint in vivo. The loss of these wildtype p53 functions predisposed the fish to develop spontaneous tumors as early as 6 month of age. Tumor histology resembles human sarcomas  a predominant LFS tumor type. tp53 R242H mutants developed tumors earlier with a higher lifetime incidence than tp53 null or R217H mutants  suggesting it is a more aggressive mutation  while the R217H allele may be hypomorphic. Additionally  we observed mutation specific differences both in the tumor type and sex bias across tp53 null  R217H  and R242H genotypes with associated diverse transcriptomic and DNA methylome profiles  impacting metabolism  cell signalling  and biological macromolecule synthesis and degradation. These tp53 zebrafish mutants demonstrate fidelity to their human counterparts and provide new insights into underlying tumorigenesis mechanisms and kinetics  which may inform more tailored tumor surveillance approaches and novel therapeutic targets in LFS. Overall design: We generated tp53 zebrafish mutants representing two of the most common mutation residues found in human cancers  tp53 R217H and R242H human R248 and R273 using CRISPR to knock in the mutations and also obtained a CG1 tp53 null line from the Langenau lab Ignatius et al.  2018. We also used the transparent casper strain as a comparison to zebrafish with wildtype p53. Of note  the tp53 null fish are in the CG1 background while the casper  tp53 R217H  and tp53 R242H fish are in the AB background. We performed bulk RNA sequencing on homozygous pooled samples with fifty 30 hpf larvae exposed to 0 or 30 Gy of irradiation at xxx hpf. We had three biological replicate for each genotype and treatment group for a total of 8 different groups with 24 samples total casper 0 Gy  casper 30 Gy  tp53 null 0 Gy  tp53 null 30 Gy  tp53 R217H 0 Gy  tp53 R217H 30 Gy  tp53 R242H 0 Gy  tp53 R242H 30 Gy.,,,,tp53 R242H/R242H 0 Gy  biol rep 3,GSM8275261,,source name:whole embryo|tissue:whole embryo|Stage:30 hpf|strain:AB|genotype:tp53 R242H/R242H|treatment:0 Gy|geo loc name:missing|collection date:missing,tp53 R242H/R242H 0 Gy  biol rep 3,The RNA Seq data were mapped with STAR v2.7 to generate BAM files and transcripts were quantified with RSEM using the zebrafish V4.3.2 transcript annotation. Assembly: GRCz11 Supplementary files format and content: tab delinated text file includes count matrix with each sample,whole embryo,Larvae were exposed to either 0 or 30 Gy of irradiation at xxx hpf.,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,Larvae were maintained at 28C and samples were collected at 30 hpf.,tissue:whole embryo|Stage:30 hpf|strain:AB|genotype:tp53 R242H/R242H|treatment:0 Gy,GSM8275261,GSM8275261: tp53 R242H/R242H 0 Gy  biol rep 3; Danio rerio; RNA Seq,GSM8275261 r1,GSM8275261,1,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP508364,,loader:fastq load.py,242N-3_R1_001.fastq.gz 242N-3_R2_001.fastq.gz,fastq fastq,3756026400.0,12520088.0,GSM8275261 r1,0:150 1:150,A:1041832393;C:829828422;G:875135132;T:1008888364;N:342089,150,150,,,1041832393,829828422,875135132,1008888364,342089,SRX24593115,SRS21331205,,,"Berman Lab, Children's Hospital of Eastern Ontario Research Institute",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,bulk,bulk,bulk,,Canada,2024-05-17,Pharyngula,Embryo,Whole Organism,All anatomical structures
32139,SRR29068705,SRX24593114,SRS21331204,SRP508364,PRJNA1112809,tp53 R217H and R242H Mutant Zebrafish Display Dysfunctional p53 Hallmarks and Recapitulate LFS Phenotypes [RNA seq],GSE267760,Transcriptome Analysis,Li Fraumeni syndrome LFS is a hereditary cancer predisposition syndrome associated with a highly penetrant and diverse tumor spectrum characterized by germline mutations in the TP53 tumor suppressor gene. To better understand how TP53 mutations predispose individuals with LFS to cancer development  we characterized tp53 R217H and R242H zebrafish lines as the first zebrafish p53 hotspot mutants human R248 and R273H. These mutants have lost several key wildtype p53 functions and recapitulate many LFS phenotypes. Specifically  we have shown that the R217H and R242H alleles result in partial to no activation of key p53 target genes  are resistant to apoptosis in a dominant negative manner and exhibit a defective G1 cell cycle checkpoint in vivo. The loss of these wildtype p53 functions predisposed the fish to develop spontaneous tumors as early as 6 month of age. Tumor histology resembles human sarcomas  a predominant LFS tumor type. tp53 R242H mutants developed tumors earlier with a higher lifetime incidence than tp53 null or R217H mutants  suggesting it is a more aggressive mutation  while the R217H allele may be hypomorphic. Additionally  we observed mutation specific differences both in the tumor type and sex bias across tp53 null  R217H  and R242H genotypes with associated diverse transcriptomic and DNA methylome profiles  impacting metabolism  cell signalling  and biological macromolecule synthesis and degradation. These tp53 zebrafish mutants demonstrate fidelity to their human counterparts and provide new insights into underlying tumorigenesis mechanisms and kinetics  which may inform more tailored tumor surveillance approaches and novel therapeutic targets in LFS. Overall design: We generated tp53 zebrafish mutants representing two of the most common mutation residues found in human cancers  tp53 R217H and R242H human R248 and R273 using CRISPR to knock in the mutations and also obtained a CG1 tp53 null line from the Langenau lab Ignatius et al.  2018. We also used the transparent casper strain as a comparison to zebrafish with wildtype p53. Of note  the tp53 null fish are in the CG1 background while the casper  tp53 R217H  and tp53 R242H fish are in the AB background. We performed bulk RNA sequencing on homozygous pooled samples with fifty 30 hpf larvae exposed to 0 or 30 Gy of irradiation at xxx hpf. We had three biological replicate for each genotype and treatment group for a total of 8 different groups with 24 samples total casper 0 Gy  casper 30 Gy  tp53 null 0 Gy  tp53 null 30 Gy  tp53 R217H 0 Gy  tp53 R217H 30 Gy  tp53 R242H 0 Gy  tp53 R242H 30 Gy.,,,,tp53 R242H/R242H 0 Gy  biol rep 2,GSM8275260,,source name:whole embryo|tissue:whole embryo|Stage:30 hpf|strain:AB|genotype:tp53 R242H/R242H|treatment:0 Gy|geo loc name:missing|collection date:missing,tp53 R242H/R242H 0 Gy  biol rep 2,The RNA Seq data were mapped with STAR v2.7 to generate BAM files and transcripts were quantified with RSEM using the zebrafish V4.3.2 transcript annotation. Assembly: GRCz11 Supplementary files format and content: tab delinated text file includes count matrix with each sample,whole embryo,Larvae were exposed to either 0 or 30 Gy of irradiation at xxx hpf.,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,Larvae were maintained at 28C and samples were collected at 30 hpf.,tissue:whole embryo|Stage:30 hpf|strain:AB|genotype:tp53 R242H/R242H|treatment:0 Gy,GSM8275260,GSM8275260: tp53 R242H/R242H 0 Gy  biol rep 2; Danio rerio; RNA Seq,GSM8275260 r1,GSM8275260,1,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP508364,,loader:fastq load.py,242N-2_R1_001.fastq.gz 242N-2_R2_001.fastq.gz,fastq fastq,11625588300.0,38751961.0,GSM8275260 r1,0:150 1:150,A:3060988139;C:2752201460;G:2833688238;T:2978620952;N:89511,150,150,,,3060988139,2752201460,2833688238,2978620952,89511,SRX24593114,SRS21331204,,,"Berman Lab, Children's Hospital of Eastern Ontario Research Institute",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,bulk,bulk,bulk,,Canada,2024-05-17,Pharyngula,Embryo,Whole Organism,All anatomical structures
32140,SRR29068706,SRX24593113,SRS21331203,SRP508364,PRJNA1112809,tp53 R217H and R242H Mutant Zebrafish Display Dysfunctional p53 Hallmarks and Recapitulate LFS Phenotypes [RNA seq],GSE267760,Transcriptome Analysis,Li Fraumeni syndrome LFS is a hereditary cancer predisposition syndrome associated with a highly penetrant and diverse tumor spectrum characterized by germline mutations in the TP53 tumor suppressor gene. To better understand how TP53 mutations predispose individuals with LFS to cancer development  we characterized tp53 R217H and R242H zebrafish lines as the first zebrafish p53 hotspot mutants human R248 and R273H. These mutants have lost several key wildtype p53 functions and recapitulate many LFS phenotypes. Specifically  we have shown that the R217H and R242H alleles result in partial to no activation of key p53 target genes  are resistant to apoptosis in a dominant negative manner and exhibit a defective G1 cell cycle checkpoint in vivo. The loss of these wildtype p53 functions predisposed the fish to develop spontaneous tumors as early as 6 month of age. Tumor histology resembles human sarcomas  a predominant LFS tumor type. tp53 R242H mutants developed tumors earlier with a higher lifetime incidence than tp53 null or R217H mutants  suggesting it is a more aggressive mutation  while the R217H allele may be hypomorphic. Additionally  we observed mutation specific differences both in the tumor type and sex bias across tp53 null  R217H  and R242H genotypes with associated diverse transcriptomic and DNA methylome profiles  impacting metabolism  cell signalling  and biological macromolecule synthesis and degradation. These tp53 zebrafish mutants demonstrate fidelity to their human counterparts and provide new insights into underlying tumorigenesis mechanisms and kinetics  which may inform more tailored tumor surveillance approaches and novel therapeutic targets in LFS. Overall design: We generated tp53 zebrafish mutants representing two of the most common mutation residues found in human cancers  tp53 R217H and R242H human R248 and R273 using CRISPR to knock in the mutations and also obtained a CG1 tp53 null line from the Langenau lab Ignatius et al.  2018. We also used the transparent casper strain as a comparison to zebrafish with wildtype p53. Of note  the tp53 null fish are in the CG1 background while the casper  tp53 R217H  and tp53 R242H fish are in the AB background. We performed bulk RNA sequencing on homozygous pooled samples with fifty 30 hpf larvae exposed to 0 or 30 Gy of irradiation at xxx hpf. We had three biological replicate for each genotype and treatment group for a total of 8 different groups with 24 samples total casper 0 Gy  casper 30 Gy  tp53 null 0 Gy  tp53 null 30 Gy  tp53 R217H 0 Gy  tp53 R217H 30 Gy  tp53 R242H 0 Gy  tp53 R242H 30 Gy.,,,,tp53 R242H/R242H 0 Gy  biol rep 1,GSM8275259,,source name:whole embryo|tissue:whole embryo|Stage:30 hpf|strain:AB|genotype:tp53 R242H/R242H|treatment:0 Gy|geo loc name:missing|collection date:missing,tp53 R242H/R242H 0 Gy  biol rep 1,The RNA Seq data were mapped with STAR v2.7 to generate BAM files and transcripts were quantified with RSEM using the zebrafish V4.3.2 transcript annotation. Assembly: GRCz11 Supplementary files format and content: tab delinated text file includes count matrix with each sample,whole embryo,Larvae were exposed to either 0 or 30 Gy of irradiation at xxx hpf.,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,Larvae were maintained at 28C and samples were collected at 30 hpf.,tissue:whole embryo|Stage:30 hpf|strain:AB|genotype:tp53 R242H/R242H|treatment:0 Gy,GSM8275259,GSM8275259: tp53 R242H/R242H 0 Gy  biol rep 1; Danio rerio; RNA Seq,GSM8275259 r1,GSM8275259,1,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP508364,,loader:fastq load.py,242N-1_R1_001.fastq.gz 242N-1_R2_001.fastq.gz,fastq fastq,16753656300.0,55845521.0,GSM8275259 r1,0:150 1:150,A:4617320633;C:3760731037;G:3904182758;T:4471291288;N:130584,150,150,,,4617320633,3760731037,3904182758,4471291288,130584,SRX24593113,SRS21331203,,,"Berman Lab, Children's Hospital of Eastern Ontario Research Institute",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,bulk,bulk,bulk,,Canada,2024-05-17,Pharyngula,Embryo,Whole Organism,All anatomical structures
32141,SRR29068707,SRX24593112,SRS21331202,SRP508364,PRJNA1112809,tp53 R217H and R242H Mutant Zebrafish Display Dysfunctional p53 Hallmarks and Recapitulate LFS Phenotypes [RNA seq],GSE267760,Transcriptome Analysis,Li Fraumeni syndrome LFS is a hereditary cancer predisposition syndrome associated with a highly penetrant and diverse tumor spectrum characterized by germline mutations in the TP53 tumor suppressor gene. To better understand how TP53 mutations predispose individuals with LFS to cancer development  we characterized tp53 R217H and R242H zebrafish lines as the first zebrafish p53 hotspot mutants human R248 and R273H. These mutants have lost several key wildtype p53 functions and recapitulate many LFS phenotypes. Specifically  we have shown that the R217H and R242H alleles result in partial to no activation of key p53 target genes  are resistant to apoptosis in a dominant negative manner and exhibit a defective G1 cell cycle checkpoint in vivo. The loss of these wildtype p53 functions predisposed the fish to develop spontaneous tumors as early as 6 month of age. Tumor histology resembles human sarcomas  a predominant LFS tumor type. tp53 R242H mutants developed tumors earlier with a higher lifetime incidence than tp53 null or R217H mutants  suggesting it is a more aggressive mutation  while the R217H allele may be hypomorphic. Additionally  we observed mutation specific differences both in the tumor type and sex bias across tp53 null  R217H  and R242H genotypes with associated diverse transcriptomic and DNA methylome profiles  impacting metabolism  cell signalling  and biological macromolecule synthesis and degradation. These tp53 zebrafish mutants demonstrate fidelity to their human counterparts and provide new insights into underlying tumorigenesis mechanisms and kinetics  which may inform more tailored tumor surveillance approaches and novel therapeutic targets in LFS. Overall design: We generated tp53 zebrafish mutants representing two of the most common mutation residues found in human cancers  tp53 R217H and R242H human R248 and R273 using CRISPR to knock in the mutations and also obtained a CG1 tp53 null line from the Langenau lab Ignatius et al.  2018. We also used the transparent casper strain as a comparison to zebrafish with wildtype p53. Of note  the tp53 null fish are in the CG1 background while the casper  tp53 R217H  and tp53 R242H fish are in the AB background. We performed bulk RNA sequencing on homozygous pooled samples with fifty 30 hpf larvae exposed to 0 or 30 Gy of irradiation at xxx hpf. We had three biological replicate for each genotype and treatment group for a total of 8 different groups with 24 samples total casper 0 Gy  casper 30 Gy  tp53 null 0 Gy  tp53 null 30 Gy  tp53 R217H 0 Gy  tp53 R217H 30 Gy  tp53 R242H 0 Gy  tp53 R242H 30 Gy.,,,,tp53 R242H/R242H 30 Gy  biol rep 3,GSM8275258,,source name:whole embryo|tissue:whole embryo|Stage:30 hpf|strain:AB|genotype:tp53 R242H/R242H|treatment:30 Gy|geo loc name:missing|collection date:missing,tp53 R242H/R242H 30 Gy  biol rep 3,The RNA Seq data were mapped with STAR v2.7 to generate BAM files and transcripts were quantified with RSEM using the zebrafish V4.3.2 transcript annotation. Assembly: GRCz11 Supplementary files format and content: tab delinated text file includes count matrix with each sample,whole embryo,Larvae were exposed to either 0 or 30 Gy of irradiation at xxx hpf.,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,Larvae were maintained at 28C and samples were collected at 30 hpf.,tissue:whole embryo|Stage:30 hpf|strain:AB|genotype:tp53 R242H/R242H|treatment:30 Gy,GSM8275258,GSM8275258: tp53 R242H/R242H 30 Gy  biol rep 3; Danio rerio; RNA Seq,GSM8275258 r1,GSM8275258,1,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP508364,,loader:fastq load.py,242I-3_R1_001.fastq.gz 242I-3_R2_001.fastq.gz,fastq fastq,9248979000.0,30829930.0,GSM8275258 r1,0:150 1:150,A:2490790601;C:2140065573;G:2202142508;T:2415909359;N:70959,150,150,,,2490790601,2140065573,2202142508,2415909359,70959,SRX24593112,SRS21331202,,,"Berman Lab, Children's Hospital of Eastern Ontario Research Institute",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,bulk,bulk,bulk,,Canada,2024-05-17,Pharyngula,Embryo,Whole Organism,All anatomical structures
32142,SRR29068708,SRX24593111,SRS21331201,SRP508364,PRJNA1112809,tp53 R217H and R242H Mutant Zebrafish Display Dysfunctional p53 Hallmarks and Recapitulate LFS Phenotypes [RNA seq],GSE267760,Transcriptome Analysis,Li Fraumeni syndrome LFS is a hereditary cancer predisposition syndrome associated with a highly penetrant and diverse tumor spectrum characterized by germline mutations in the TP53 tumor suppressor gene. To better understand how TP53 mutations predispose individuals with LFS to cancer development  we characterized tp53 R217H and R242H zebrafish lines as the first zebrafish p53 hotspot mutants human R248 and R273H. These mutants have lost several key wildtype p53 functions and recapitulate many LFS phenotypes. Specifically  we have shown that the R217H and R242H alleles result in partial to no activation of key p53 target genes  are resistant to apoptosis in a dominant negative manner and exhibit a defective G1 cell cycle checkpoint in vivo. The loss of these wildtype p53 functions predisposed the fish to develop spontaneous tumors as early as 6 month of age. Tumor histology resembles human sarcomas  a predominant LFS tumor type. tp53 R242H mutants developed tumors earlier with a higher lifetime incidence than tp53 null or R217H mutants  suggesting it is a more aggressive mutation  while the R217H allele may be hypomorphic. Additionally  we observed mutation specific differences both in the tumor type and sex bias across tp53 null  R217H  and R242H genotypes with associated diverse transcriptomic and DNA methylome profiles  impacting metabolism  cell signalling  and biological macromolecule synthesis and degradation. These tp53 zebrafish mutants demonstrate fidelity to their human counterparts and provide new insights into underlying tumorigenesis mechanisms and kinetics  which may inform more tailored tumor surveillance approaches and novel therapeutic targets in LFS. Overall design: We generated tp53 zebrafish mutants representing two of the most common mutation residues found in human cancers  tp53 R217H and R242H human R248 and R273 using CRISPR to knock in the mutations and also obtained a CG1 tp53 null line from the Langenau lab Ignatius et al.  2018. We also used the transparent casper strain as a comparison to zebrafish with wildtype p53. Of note  the tp53 null fish are in the CG1 background while the casper  tp53 R217H  and tp53 R242H fish are in the AB background. We performed bulk RNA sequencing on homozygous pooled samples with fifty 30 hpf larvae exposed to 0 or 30 Gy of irradiation at xxx hpf. We had three biological replicate for each genotype and treatment group for a total of 8 different groups with 24 samples total casper 0 Gy  casper 30 Gy  tp53 null 0 Gy  tp53 null 30 Gy  tp53 R217H 0 Gy  tp53 R217H 30 Gy  tp53 R242H 0 Gy  tp53 R242H 30 Gy.,,,,tp53 R242H/R242H 30 Gy  biol rep 2,GSM8275257,,source name:whole embryo|tissue:whole embryo|Stage:30 hpf|strain:AB|genotype:tp53 R242H/R242H|treatment:30 Gy|geo loc name:missing|collection date:missing,tp53 R242H/R242H 30 Gy  biol rep 2,The RNA Seq data were mapped with STAR v2.7 to generate BAM files and transcripts were quantified with RSEM using the zebrafish V4.3.2 transcript annotation. Assembly: GRCz11 Supplementary files format and content: tab delinated text file includes count matrix with each sample,whole embryo,Larvae were exposed to either 0 or 30 Gy of irradiation at xxx hpf.,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,Larvae were maintained at 28C and samples were collected at 30 hpf.,tissue:whole embryo|Stage:30 hpf|strain:AB|genotype:tp53 R242H/R242H|treatment:30 Gy,GSM8275257,GSM8275257: tp53 R242H/R242H 30 Gy  biol rep 2; Danio rerio; RNA Seq,GSM8275257 r1,GSM8275257,1,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP508364,,loader:fastq load.py,242I-2_R1_001.fastq.gz 242I-2_R2_001.fastq.gz,fastq fastq,14876409900.0,49588033.0,GSM8275257 r1,0:150 1:150,A:4155568434;C:3275443734;G:3414514883;T:4028089617;N:2793232,150,150,,,4155568434,3275443734,3414514883,4028089617,2793232,SRX24593111,SRS21331201,,,"Berman Lab, Children's Hospital of Eastern Ontario Research Institute",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,bulk,bulk,bulk,,Canada,2024-05-17,Pharyngula,Embryo,Whole Organism,All anatomical structures
32143,SRR29068709,SRX24593110,SRS21331200,SRP508364,PRJNA1112809,tp53 R217H and R242H Mutant Zebrafish Display Dysfunctional p53 Hallmarks and Recapitulate LFS Phenotypes [RNA seq],GSE267760,Transcriptome Analysis,Li Fraumeni syndrome LFS is a hereditary cancer predisposition syndrome associated with a highly penetrant and diverse tumor spectrum characterized by germline mutations in the TP53 tumor suppressor gene. To better understand how TP53 mutations predispose individuals with LFS to cancer development  we characterized tp53 R217H and R242H zebrafish lines as the first zebrafish p53 hotspot mutants human R248 and R273H. These mutants have lost several key wildtype p53 functions and recapitulate many LFS phenotypes. Specifically  we have shown that the R217H and R242H alleles result in partial to no activation of key p53 target genes  are resistant to apoptosis in a dominant negative manner and exhibit a defective G1 cell cycle checkpoint in vivo. The loss of these wildtype p53 functions predisposed the fish to develop spontaneous tumors as early as 6 month of age. Tumor histology resembles human sarcomas  a predominant LFS tumor type. tp53 R242H mutants developed tumors earlier with a higher lifetime incidence than tp53 null or R217H mutants  suggesting it is a more aggressive mutation  while the R217H allele may be hypomorphic. Additionally  we observed mutation specific differences both in the tumor type and sex bias across tp53 null  R217H  and R242H genotypes with associated diverse transcriptomic and DNA methylome profiles  impacting metabolism  cell signalling  and biological macromolecule synthesis and degradation. These tp53 zebrafish mutants demonstrate fidelity to their human counterparts and provide new insights into underlying tumorigenesis mechanisms and kinetics  which may inform more tailored tumor surveillance approaches and novel therapeutic targets in LFS. Overall design: We generated tp53 zebrafish mutants representing two of the most common mutation residues found in human cancers  tp53 R217H and R242H human R248 and R273 using CRISPR to knock in the mutations and also obtained a CG1 tp53 null line from the Langenau lab Ignatius et al.  2018. We also used the transparent casper strain as a comparison to zebrafish with wildtype p53. Of note  the tp53 null fish are in the CG1 background while the casper  tp53 R217H  and tp53 R242H fish are in the AB background. We performed bulk RNA sequencing on homozygous pooled samples with fifty 30 hpf larvae exposed to 0 or 30 Gy of irradiation at xxx hpf. We had three biological replicate for each genotype and treatment group for a total of 8 different groups with 24 samples total casper 0 Gy  casper 30 Gy  tp53 null 0 Gy  tp53 null 30 Gy  tp53 R217H 0 Gy  tp53 R217H 30 Gy  tp53 R242H 0 Gy  tp53 R242H 30 Gy.,,,,tp53 R242H/R242H 30 Gy  biol rep 1,GSM8275256,,source name:whole embryo|tissue:whole embryo|Stage:30 hpf|strain:AB|genotype:tp53 R242H/R242H|treatment:30 Gy|geo loc name:missing|collection date:missing,tp53 R242H/R242H 30 Gy  biol rep 1,The RNA Seq data were mapped with STAR v2.7 to generate BAM files and transcripts were quantified with RSEM using the zebrafish V4.3.2 transcript annotation. Assembly: GRCz11 Supplementary files format and content: tab delinated text file includes count matrix with each sample,whole embryo,Larvae were exposed to either 0 or 30 Gy of irradiation at xxx hpf.,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,Larvae were maintained at 28C and samples were collected at 30 hpf.,tissue:whole embryo|Stage:30 hpf|strain:AB|genotype:tp53 R242H/R242H|treatment:30 Gy,GSM8275256,GSM8275256: tp53 R242H/R242H 30 Gy  biol rep 1; Danio rerio; RNA Seq,GSM8275256 r1,GSM8275256,1,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP508364,,loader:fastq load.py,242I-1_R1_001.fastq.gz 242I-1_R2_001.fastq.gz,fastq fastq,13181905500.0,43939685.0,GSM8275256 r1,0:150 1:150,A:3680992920;C:2900884646;G:3025183249;T:3572297095;N:2547590,150,150,,,3680992920,2900884646,3025183249,3572297095,2547590,SRX24593110,SRS21331200,,,"Berman Lab, Children's Hospital of Eastern Ontario Research Institute",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,bulk,bulk,bulk,,Canada,2024-05-17,Pharyngula,Embryo,Whole Organism,All anatomical structures
32144,SRR29068710,SRX24593109,SRS21331199,SRP508364,PRJNA1112809,tp53 R217H and R242H Mutant Zebrafish Display Dysfunctional p53 Hallmarks and Recapitulate LFS Phenotypes [RNA seq],GSE267760,Transcriptome Analysis,Li Fraumeni syndrome LFS is a hereditary cancer predisposition syndrome associated with a highly penetrant and diverse tumor spectrum characterized by germline mutations in the TP53 tumor suppressor gene. To better understand how TP53 mutations predispose individuals with LFS to cancer development  we characterized tp53 R217H and R242H zebrafish lines as the first zebrafish p53 hotspot mutants human R248 and R273H. These mutants have lost several key wildtype p53 functions and recapitulate many LFS phenotypes. Specifically  we have shown that the R217H and R242H alleles result in partial to no activation of key p53 target genes  are resistant to apoptosis in a dominant negative manner and exhibit a defective G1 cell cycle checkpoint in vivo. The loss of these wildtype p53 functions predisposed the fish to develop spontaneous tumors as early as 6 month of age. Tumor histology resembles human sarcomas  a predominant LFS tumor type. tp53 R242H mutants developed tumors earlier with a higher lifetime incidence than tp53 null or R217H mutants  suggesting it is a more aggressive mutation  while the R217H allele may be hypomorphic. Additionally  we observed mutation specific differences both in the tumor type and sex bias across tp53 null  R217H  and R242H genotypes with associated diverse transcriptomic and DNA methylome profiles  impacting metabolism  cell signalling  and biological macromolecule synthesis and degradation. These tp53 zebrafish mutants demonstrate fidelity to their human counterparts and provide new insights into underlying tumorigenesis mechanisms and kinetics  which may inform more tailored tumor surveillance approaches and novel therapeutic targets in LFS. Overall design: We generated tp53 zebrafish mutants representing two of the most common mutation residues found in human cancers  tp53 R217H and R242H human R248 and R273 using CRISPR to knock in the mutations and also obtained a CG1 tp53 null line from the Langenau lab Ignatius et al.  2018. We also used the transparent casper strain as a comparison to zebrafish with wildtype p53. Of note  the tp53 null fish are in the CG1 background while the casper  tp53 R217H  and tp53 R242H fish are in the AB background. We performed bulk RNA sequencing on homozygous pooled samples with fifty 30 hpf larvae exposed to 0 or 30 Gy of irradiation at xxx hpf. We had three biological replicate for each genotype and treatment group for a total of 8 different groups with 24 samples total casper 0 Gy  casper 30 Gy  tp53 null 0 Gy  tp53 null 30 Gy  tp53 R217H 0 Gy  tp53 R217H 30 Gy  tp53 R242H 0 Gy  tp53 R242H 30 Gy.,,,,tp53 R217H/R217H 0 Gy  biol rep 3,GSM8275255,,source name:whole embryo|tissue:whole embryo|Stage:30 hpf|strain:AB|genotype:tp53 R217H/R217H|treatment:0 Gy|geo loc name:missing|collection date:missing,tp53 R217H/R217H 0 Gy  biol rep 3,The RNA Seq data were mapped with STAR v2.7 to generate BAM files and transcripts were quantified with RSEM using the zebrafish V4.3.2 transcript annotation. Assembly: GRCz11 Supplementary files format and content: tab delinated text file includes count matrix with each sample,whole embryo,Larvae were exposed to either 0 or 30 Gy of irradiation at xxx hpf.,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,Larvae were maintained at 28C and samples were collected at 30 hpf.,tissue:whole embryo|Stage:30 hpf|strain:AB|genotype:tp53 R217H/R217H|treatment:0 Gy,GSM8275255,GSM8275255: tp53 R217H/R217H 0 Gy  biol rep 3; Danio rerio; RNA Seq,GSM8275255 r1,GSM8275255,1,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP508364,,loader:fastq load.py,217N-3_R1_001.fastq.gz 217N-3_R2_001.fastq.gz,fastq fastq,15270830700.0,50902769.0,GSM8275255 r1,0:150 1:150,A:4143520783;C:3507470789;G:3602468084;T:4017251797;N:119247,150,150,,,4143520783,3507470789,3602468084,4017251797,119247,SRX24593109,SRS21331199,,,"Berman Lab, Children's Hospital of Eastern Ontario Research Institute",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,bulk,bulk,bulk,,Canada,2024-05-17,Pharyngula,Embryo,Whole Organism,All anatomical structures
32145,SRR29068711,SRX24593108,SRS21331198,SRP508364,PRJNA1112809,tp53 R217H and R242H Mutant Zebrafish Display Dysfunctional p53 Hallmarks and Recapitulate LFS Phenotypes [RNA seq],GSE267760,Transcriptome Analysis,Li Fraumeni syndrome LFS is a hereditary cancer predisposition syndrome associated with a highly penetrant and diverse tumor spectrum characterized by germline mutations in the TP53 tumor suppressor gene. To better understand how TP53 mutations predispose individuals with LFS to cancer development  we characterized tp53 R217H and R242H zebrafish lines as the first zebrafish p53 hotspot mutants human R248 and R273H. These mutants have lost several key wildtype p53 functions and recapitulate many LFS phenotypes. Specifically  we have shown that the R217H and R242H alleles result in partial to no activation of key p53 target genes  are resistant to apoptosis in a dominant negative manner and exhibit a defective G1 cell cycle checkpoint in vivo. The loss of these wildtype p53 functions predisposed the fish to develop spontaneous tumors as early as 6 month of age. Tumor histology resembles human sarcomas  a predominant LFS tumor type. tp53 R242H mutants developed tumors earlier with a higher lifetime incidence than tp53 null or R217H mutants  suggesting it is a more aggressive mutation  while the R217H allele may be hypomorphic. Additionally  we observed mutation specific differences both in the tumor type and sex bias across tp53 null  R217H  and R242H genotypes with associated diverse transcriptomic and DNA methylome profiles  impacting metabolism  cell signalling  and biological macromolecule synthesis and degradation. These tp53 zebrafish mutants demonstrate fidelity to their human counterparts and provide new insights into underlying tumorigenesis mechanisms and kinetics  which may inform more tailored tumor surveillance approaches and novel therapeutic targets in LFS. Overall design: We generated tp53 zebrafish mutants representing two of the most common mutation residues found in human cancers  tp53 R217H and R242H human R248 and R273 using CRISPR to knock in the mutations and also obtained a CG1 tp53 null line from the Langenau lab Ignatius et al.  2018. We also used the transparent casper strain as a comparison to zebrafish with wildtype p53. Of note  the tp53 null fish are in the CG1 background while the casper  tp53 R217H  and tp53 R242H fish are in the AB background. We performed bulk RNA sequencing on homozygous pooled samples with fifty 30 hpf larvae exposed to 0 or 30 Gy of irradiation at xxx hpf. We had three biological replicate for each genotype and treatment group for a total of 8 different groups with 24 samples total casper 0 Gy  casper 30 Gy  tp53 null 0 Gy  tp53 null 30 Gy  tp53 R217H 0 Gy  tp53 R217H 30 Gy  tp53 R242H 0 Gy  tp53 R242H 30 Gy.,,,,tp53 R217H/R217H 0 Gy  biol rep 2,GSM8275254,,source name:whole embryo|tissue:whole embryo|Stage:30 hpf|strain:AB|genotype:tp53 R217H/R217H|treatment:0 Gy|geo loc name:missing|collection date:missing,tp53 R217H/R217H 0 Gy  biol rep 2,The RNA Seq data were mapped with STAR v2.7 to generate BAM files and transcripts were quantified with RSEM using the zebrafish V4.3.2 transcript annotation. Assembly: GRCz11 Supplementary files format and content: tab delinated text file includes count matrix with each sample,whole embryo,Larvae were exposed to either 0 or 30 Gy of irradiation at xxx hpf.,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,Larvae were maintained at 28C and samples were collected at 30 hpf.,tissue:whole embryo|Stage:30 hpf|strain:AB|genotype:tp53 R217H/R217H|treatment:0 Gy,GSM8275254,GSM8275254: tp53 R217H/R217H 0 Gy  biol rep 2; Danio rerio; RNA Seq,GSM8275254 r1,GSM8275254,1,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP508364,,loader:fastq load.py,217N-2_R1_001.fastq.gz 217N-2_R2_001.fastq.gz,fastq fastq,11979598500.0,39931995.0,GSM8275254 r1,0:150 1:150,A:3377772889;C:2602459474;G:2731248324;T:3266053178;N:2064635,150,150,,,3377772889,2602459474,2731248324,3266053178,2064635,SRX24593108,SRS21331198,,,"Berman Lab, Children's Hospital of Eastern Ontario Research Institute",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,bulk,bulk,bulk,,Canada,2024-05-17,Pharyngula,Embryo,Whole Organism,All anatomical structures
32146,SRR29068712,SRX24593107,SRS21331197,SRP508364,PRJNA1112809,tp53 R217H and R242H Mutant Zebrafish Display Dysfunctional p53 Hallmarks and Recapitulate LFS Phenotypes [RNA seq],GSE267760,Transcriptome Analysis,Li Fraumeni syndrome LFS is a hereditary cancer predisposition syndrome associated with a highly penetrant and diverse tumor spectrum characterized by germline mutations in the TP53 tumor suppressor gene. To better understand how TP53 mutations predispose individuals with LFS to cancer development  we characterized tp53 R217H and R242H zebrafish lines as the first zebrafish p53 hotspot mutants human R248 and R273H. These mutants have lost several key wildtype p53 functions and recapitulate many LFS phenotypes. Specifically  we have shown that the R217H and R242H alleles result in partial to no activation of key p53 target genes  are resistant to apoptosis in a dominant negative manner and exhibit a defective G1 cell cycle checkpoint in vivo. The loss of these wildtype p53 functions predisposed the fish to develop spontaneous tumors as early as 6 month of age. Tumor histology resembles human sarcomas  a predominant LFS tumor type. tp53 R242H mutants developed tumors earlier with a higher lifetime incidence than tp53 null or R217H mutants  suggesting it is a more aggressive mutation  while the R217H allele may be hypomorphic. Additionally  we observed mutation specific differences both in the tumor type and sex bias across tp53 null  R217H  and R242H genotypes with associated diverse transcriptomic and DNA methylome profiles  impacting metabolism  cell signalling  and biological macromolecule synthesis and degradation. These tp53 zebrafish mutants demonstrate fidelity to their human counterparts and provide new insights into underlying tumorigenesis mechanisms and kinetics  which may inform more tailored tumor surveillance approaches and novel therapeutic targets in LFS. Overall design: We generated tp53 zebrafish mutants representing two of the most common mutation residues found in human cancers  tp53 R217H and R242H human R248 and R273 using CRISPR to knock in the mutations and also obtained a CG1 tp53 null line from the Langenau lab Ignatius et al.  2018. We also used the transparent casper strain as a comparison to zebrafish with wildtype p53. Of note  the tp53 null fish are in the CG1 background while the casper  tp53 R217H  and tp53 R242H fish are in the AB background. We performed bulk RNA sequencing on homozygous pooled samples with fifty 30 hpf larvae exposed to 0 or 30 Gy of irradiation at xxx hpf. We had three biological replicate for each genotype and treatment group for a total of 8 different groups with 24 samples total casper 0 Gy  casper 30 Gy  tp53 null 0 Gy  tp53 null 30 Gy  tp53 R217H 0 Gy  tp53 R217H 30 Gy  tp53 R242H 0 Gy  tp53 R242H 30 Gy.,,,,tp53 R217H/R217H 0 Gy  biol rep 1,GSM8275253,,source name:whole embryo|tissue:whole embryo|Stage:30 hpf|strain:AB|genotype:tp53 R217H/R217H|treatment:0 Gy|geo loc name:missing|collection date:missing,tp53 R217H/R217H 0 Gy  biol rep 1,The RNA Seq data were mapped with STAR v2.7 to generate BAM files and transcripts were quantified with RSEM using the zebrafish V4.3.2 transcript annotation. Assembly: GRCz11 Supplementary files format and content: tab delinated text file includes count matrix with each sample,whole embryo,Larvae were exposed to either 0 or 30 Gy of irradiation at xxx hpf.,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,Larvae were maintained at 28C and samples were collected at 30 hpf.,tissue:whole embryo|Stage:30 hpf|strain:AB|genotype:tp53 R217H/R217H|treatment:0 Gy,GSM8275253,GSM8275253: tp53 R217H/R217H 0 Gy  biol rep 1; Danio rerio; RNA Seq,GSM8275253 r1,GSM8275253,1,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP508364,,loader:fastq load.py,217N-1_R1_001.fastq.gz 217N-1_R2_001.fastq.gz,fastq fastq,15189213300.0,50630711.0,GSM8275253 r1,0:150 1:150,A:3119274866;C:4485924650;G:4554332809;T:3029563736;N:117239,150,150,,,3119274866,4485924650,4554332809,3029563736,117239,SRX24593107,SRS21331197,,,"Berman Lab, Children's Hospital of Eastern Ontario Research Institute",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,bulk,bulk,bulk,,Canada,2024-05-17,Pharyngula,Embryo,Whole Organism,All anatomical structures
32147,SRR29068713,SRX24593106,SRS21331196,SRP508364,PRJNA1112809,tp53 R217H and R242H Mutant Zebrafish Display Dysfunctional p53 Hallmarks and Recapitulate LFS Phenotypes [RNA seq],GSE267760,Transcriptome Analysis,Li Fraumeni syndrome LFS is a hereditary cancer predisposition syndrome associated with a highly penetrant and diverse tumor spectrum characterized by germline mutations in the TP53 tumor suppressor gene. To better understand how TP53 mutations predispose individuals with LFS to cancer development  we characterized tp53 R217H and R242H zebrafish lines as the first zebrafish p53 hotspot mutants human R248 and R273H. These mutants have lost several key wildtype p53 functions and recapitulate many LFS phenotypes. Specifically  we have shown that the R217H and R242H alleles result in partial to no activation of key p53 target genes  are resistant to apoptosis in a dominant negative manner and exhibit a defective G1 cell cycle checkpoint in vivo. The loss of these wildtype p53 functions predisposed the fish to develop spontaneous tumors as early as 6 month of age. Tumor histology resembles human sarcomas  a predominant LFS tumor type. tp53 R242H mutants developed tumors earlier with a higher lifetime incidence than tp53 null or R217H mutants  suggesting it is a more aggressive mutation  while the R217H allele may be hypomorphic. Additionally  we observed mutation specific differences both in the tumor type and sex bias across tp53 null  R217H  and R242H genotypes with associated diverse transcriptomic and DNA methylome profiles  impacting metabolism  cell signalling  and biological macromolecule synthesis and degradation. These tp53 zebrafish mutants demonstrate fidelity to their human counterparts and provide new insights into underlying tumorigenesis mechanisms and kinetics  which may inform more tailored tumor surveillance approaches and novel therapeutic targets in LFS. Overall design: We generated tp53 zebrafish mutants representing two of the most common mutation residues found in human cancers  tp53 R217H and R242H human R248 and R273 using CRISPR to knock in the mutations and also obtained a CG1 tp53 null line from the Langenau lab Ignatius et al.  2018. We also used the transparent casper strain as a comparison to zebrafish with wildtype p53. Of note  the tp53 null fish are in the CG1 background while the casper  tp53 R217H  and tp53 R242H fish are in the AB background. We performed bulk RNA sequencing on homozygous pooled samples with fifty 30 hpf larvae exposed to 0 or 30 Gy of irradiation at xxx hpf. We had three biological replicate for each genotype and treatment group for a total of 8 different groups with 24 samples total casper 0 Gy  casper 30 Gy  tp53 null 0 Gy  tp53 null 30 Gy  tp53 R217H 0 Gy  tp53 R217H 30 Gy  tp53 R242H 0 Gy  tp53 R242H 30 Gy.,,,,tp53 R217H/R217H 30 Gy  biol rep 3,GSM8275252,,source name:whole embryo|tissue:whole embryo|Stage:30 hpf|strain:AB|genotype:tp53 R217H/R217H|treatment:30 Gy|geo loc name:missing|collection date:missing,tp53 R217H/R217H 30 Gy  biol rep 3,The RNA Seq data were mapped with STAR v2.7 to generate BAM files and transcripts were quantified with RSEM using the zebrafish V4.3.2 transcript annotation. Assembly: GRCz11 Supplementary files format and content: tab delinated text file includes count matrix with each sample,whole embryo,Larvae were exposed to either 0 or 30 Gy of irradiation at xxx hpf.,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,Larvae were maintained at 28C and samples were collected at 30 hpf.,tissue:whole embryo|Stage:30 hpf|strain:AB|genotype:tp53 R217H/R217H|treatment:30 Gy,GSM8275252,GSM8275252: tp53 R217H/R217H 30 Gy  biol rep 3; Danio rerio; RNA Seq,GSM8275252 r1,GSM8275252,1,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP508364,,loader:fastq load.py,217I-3_R1_001.fastq.gz 217I-3_R2_001.fastq.gz,fastq fastq,9626255400.0,32087518.0,GSM8275252 r1,0:150 1:150,A:2534842583;C:2272553595;G:2345492999;T:2473292717;N:73506,150,150,,,2534842583,2272553595,2345492999,2473292717,73506,SRX24593106,SRS21331196,,,"Berman Lab, Children's Hospital of Eastern Ontario Research Institute",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,bulk,bulk,bulk,,Canada,2024-05-17,Pharyngula,Embryo,Whole Organism,All anatomical structures
32148,SRR29068714,SRX24593105,SRS21331195,SRP508364,PRJNA1112809,tp53 R217H and R242H Mutant Zebrafish Display Dysfunctional p53 Hallmarks and Recapitulate LFS Phenotypes [RNA seq],GSE267760,Transcriptome Analysis,Li Fraumeni syndrome LFS is a hereditary cancer predisposition syndrome associated with a highly penetrant and diverse tumor spectrum characterized by germline mutations in the TP53 tumor suppressor gene. To better understand how TP53 mutations predispose individuals with LFS to cancer development  we characterized tp53 R217H and R242H zebrafish lines as the first zebrafish p53 hotspot mutants human R248 and R273H. These mutants have lost several key wildtype p53 functions and recapitulate many LFS phenotypes. Specifically  we have shown that the R217H and R242H alleles result in partial to no activation of key p53 target genes  are resistant to apoptosis in a dominant negative manner and exhibit a defective G1 cell cycle checkpoint in vivo. The loss of these wildtype p53 functions predisposed the fish to develop spontaneous tumors as early as 6 month of age. Tumor histology resembles human sarcomas  a predominant LFS tumor type. tp53 R242H mutants developed tumors earlier with a higher lifetime incidence than tp53 null or R217H mutants  suggesting it is a more aggressive mutation  while the R217H allele may be hypomorphic. Additionally  we observed mutation specific differences both in the tumor type and sex bias across tp53 null  R217H  and R242H genotypes with associated diverse transcriptomic and DNA methylome profiles  impacting metabolism  cell signalling  and biological macromolecule synthesis and degradation. These tp53 zebrafish mutants demonstrate fidelity to their human counterparts and provide new insights into underlying tumorigenesis mechanisms and kinetics  which may inform more tailored tumor surveillance approaches and novel therapeutic targets in LFS. Overall design: We generated tp53 zebrafish mutants representing two of the most common mutation residues found in human cancers  tp53 R217H and R242H human R248 and R273 using CRISPR to knock in the mutations and also obtained a CG1 tp53 null line from the Langenau lab Ignatius et al.  2018. We also used the transparent casper strain as a comparison to zebrafish with wildtype p53. Of note  the tp53 null fish are in the CG1 background while the casper  tp53 R217H  and tp53 R242H fish are in the AB background. We performed bulk RNA sequencing on homozygous pooled samples with fifty 30 hpf larvae exposed to 0 or 30 Gy of irradiation at xxx hpf. We had three biological replicate for each genotype and treatment group for a total of 8 different groups with 24 samples total casper 0 Gy  casper 30 Gy  tp53 null 0 Gy  tp53 null 30 Gy  tp53 R217H 0 Gy  tp53 R217H 30 Gy  tp53 R242H 0 Gy  tp53 R242H 30 Gy.,,,,tp53 R217H/R217H 30 Gy  biol rep 2,GSM8275251,,source name:whole embryo|tissue:whole embryo|Stage:30 hpf|strain:AB|genotype:tp53 R217H/R217H|treatment:30 Gy|geo loc name:missing|collection date:missing,tp53 R217H/R217H 30 Gy  biol rep 2,The RNA Seq data were mapped with STAR v2.7 to generate BAM files and transcripts were quantified with RSEM using the zebrafish V4.3.2 transcript annotation. Assembly: GRCz11 Supplementary files format and content: tab delinated text file includes count matrix with each sample,whole embryo,Larvae were exposed to either 0 or 30 Gy of irradiation at xxx hpf.,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,Larvae were maintained at 28C and samples were collected at 30 hpf.,tissue:whole embryo|Stage:30 hpf|strain:AB|genotype:tp53 R217H/R217H|treatment:30 Gy,GSM8275251,GSM8275251: tp53 R217H/R217H 30 Gy  biol rep 2; Danio rerio; RNA Seq,GSM8275251 r1,GSM8275251,1,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP508364,,loader:fastq load.py,217I-2_R1_001.fastq.gz 217I-2_R2_001.fastq.gz,fastq fastq,13102529400.0,43675098.0,GSM8275251 r1,0:150 1:150,A:3679606150;C:2816108752;G:3037629807;T:3569081166;N:103525,150,150,,,3679606150,2816108752,3037629807,3569081166,103525,SRX24593105,SRS21331195,,,"Berman Lab, Children's Hospital of Eastern Ontario Research Institute",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,bulk,bulk,bulk,,Canada,2024-05-17,Pharyngula,Embryo,Whole Organism,All anatomical structures
32149,SRR29068715,SRX24593104,SRS21331194,SRP508364,PRJNA1112809,tp53 R217H and R242H Mutant Zebrafish Display Dysfunctional p53 Hallmarks and Recapitulate LFS Phenotypes [RNA seq],GSE267760,Transcriptome Analysis,Li Fraumeni syndrome LFS is a hereditary cancer predisposition syndrome associated with a highly penetrant and diverse tumor spectrum characterized by germline mutations in the TP53 tumor suppressor gene. To better understand how TP53 mutations predispose individuals with LFS to cancer development  we characterized tp53 R217H and R242H zebrafish lines as the first zebrafish p53 hotspot mutants human R248 and R273H. These mutants have lost several key wildtype p53 functions and recapitulate many LFS phenotypes. Specifically  we have shown that the R217H and R242H alleles result in partial to no activation of key p53 target genes  are resistant to apoptosis in a dominant negative manner and exhibit a defective G1 cell cycle checkpoint in vivo. The loss of these wildtype p53 functions predisposed the fish to develop spontaneous tumors as early as 6 month of age. Tumor histology resembles human sarcomas  a predominant LFS tumor type. tp53 R242H mutants developed tumors earlier with a higher lifetime incidence than tp53 null or R217H mutants  suggesting it is a more aggressive mutation  while the R217H allele may be hypomorphic. Additionally  we observed mutation specific differences both in the tumor type and sex bias across tp53 null  R217H  and R242H genotypes with associated diverse transcriptomic and DNA methylome profiles  impacting metabolism  cell signalling  and biological macromolecule synthesis and degradation. These tp53 zebrafish mutants demonstrate fidelity to their human counterparts and provide new insights into underlying tumorigenesis mechanisms and kinetics  which may inform more tailored tumor surveillance approaches and novel therapeutic targets in LFS. Overall design: We generated tp53 zebrafish mutants representing two of the most common mutation residues found in human cancers  tp53 R217H and R242H human R248 and R273 using CRISPR to knock in the mutations and also obtained a CG1 tp53 null line from the Langenau lab Ignatius et al.  2018. We also used the transparent casper strain as a comparison to zebrafish with wildtype p53. Of note  the tp53 null fish are in the CG1 background while the casper  tp53 R217H  and tp53 R242H fish are in the AB background. We performed bulk RNA sequencing on homozygous pooled samples with fifty 30 hpf larvae exposed to 0 or 30 Gy of irradiation at xxx hpf. We had three biological replicate for each genotype and treatment group for a total of 8 different groups with 24 samples total casper 0 Gy  casper 30 Gy  tp53 null 0 Gy  tp53 null 30 Gy  tp53 R217H 0 Gy  tp53 R217H 30 Gy  tp53 R242H 0 Gy  tp53 R242H 30 Gy.,,,,tp53 R217H/R217H 30 Gy  biol rep 1,GSM8275250,,source name:whole embryo|tissue:whole embryo|Stage:30 hpf|strain:AB|genotype:tp53 R217H/R217H|treatment:30 Gy|geo loc name:missing|collection date:missing,tp53 R217H/R217H 30 Gy  biol rep 1,The RNA Seq data were mapped with STAR v2.7 to generate BAM files and transcripts were quantified with RSEM using the zebrafish V4.3.2 transcript annotation. Assembly: GRCz11 Supplementary files format and content: tab delinated text file includes count matrix with each sample,whole embryo,Larvae were exposed to either 0 or 30 Gy of irradiation at xxx hpf.,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,Larvae were maintained at 28C and samples were collected at 30 hpf.,tissue:whole embryo|Stage:30 hpf|strain:AB|genotype:tp53 R217H/R217H|treatment:30 Gy,GSM8275250,GSM8275250: tp53 R217H/R217H 30 Gy  biol rep 1; Danio rerio; RNA Seq,GSM8275250 r1,GSM8275250,1,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP508364,,loader:fastq load.py,217I-1_R1_001.fastq.gz 217I-1_R2_001.fastq.gz,fastq fastq,14318813100.0,47729377.0,GSM8275250 r1,0:150 1:150,A:4016220509;C:3121053092;G:3260389642;T:3917828243;N:3321614,150,150,,,4016220509,3121053092,3260389642,3917828243,3321614,SRX24593104,SRS21331194,,,"Berman Lab, Children's Hospital of Eastern Ontario Research Institute",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,bulk,bulk,bulk,,Canada,2024-05-17,Pharyngula,Embryo,Whole Organism,All anatomical structures
32150,SRR29068716,SRX24593103,SRS21331193,SRP508364,PRJNA1112809,tp53 R217H and R242H Mutant Zebrafish Display Dysfunctional p53 Hallmarks and Recapitulate LFS Phenotypes [RNA seq],GSE267760,Transcriptome Analysis,Li Fraumeni syndrome LFS is a hereditary cancer predisposition syndrome associated with a highly penetrant and diverse tumor spectrum characterized by germline mutations in the TP53 tumor suppressor gene. To better understand how TP53 mutations predispose individuals with LFS to cancer development  we characterized tp53 R217H and R242H zebrafish lines as the first zebrafish p53 hotspot mutants human R248 and R273H. These mutants have lost several key wildtype p53 functions and recapitulate many LFS phenotypes. Specifically  we have shown that the R217H and R242H alleles result in partial to no activation of key p53 target genes  are resistant to apoptosis in a dominant negative manner and exhibit a defective G1 cell cycle checkpoint in vivo. The loss of these wildtype p53 functions predisposed the fish to develop spontaneous tumors as early as 6 month of age. Tumor histology resembles human sarcomas  a predominant LFS tumor type. tp53 R242H mutants developed tumors earlier with a higher lifetime incidence than tp53 null or R217H mutants  suggesting it is a more aggressive mutation  while the R217H allele may be hypomorphic. Additionally  we observed mutation specific differences both in the tumor type and sex bias across tp53 null  R217H  and R242H genotypes with associated diverse transcriptomic and DNA methylome profiles  impacting metabolism  cell signalling  and biological macromolecule synthesis and degradation. These tp53 zebrafish mutants demonstrate fidelity to their human counterparts and provide new insights into underlying tumorigenesis mechanisms and kinetics  which may inform more tailored tumor surveillance approaches and novel therapeutic targets in LFS. Overall design: We generated tp53 zebrafish mutants representing two of the most common mutation residues found in human cancers  tp53 R217H and R242H human R248 and R273 using CRISPR to knock in the mutations and also obtained a CG1 tp53 null line from the Langenau lab Ignatius et al.  2018. We also used the transparent casper strain as a comparison to zebrafish with wildtype p53. Of note  the tp53 null fish are in the CG1 background while the casper  tp53 R217H  and tp53 R242H fish are in the AB background. We performed bulk RNA sequencing on homozygous pooled samples with fifty 30 hpf larvae exposed to 0 or 30 Gy of irradiation at xxx hpf. We had three biological replicate for each genotype and treatment group for a total of 8 different groups with 24 samples total casper 0 Gy  casper 30 Gy  tp53 null 0 Gy  tp53 null 30 Gy  tp53 R217H 0 Gy  tp53 R217H 30 Gy  tp53 R242H 0 Gy  tp53 R242H 30 Gy.,,,,tp53 null/null 0 Gy  biol rep 3,GSM8275249,,source name:whole embryo|tissue:whole embryo|Stage:30 hpf|strain:CG1|genotype:tp53 null/null|treatment:0 Gy|geo loc name:missing|collection date:missing,tp53 null/null 0 Gy  biol rep 3,The RNA Seq data were mapped with STAR v2.7 to generate BAM files and transcripts were quantified with RSEM using the zebrafish V4.3.2 transcript annotation. Assembly: GRCz11 Supplementary files format and content: tab delinated text file includes count matrix with each sample,whole embryo,Larvae were exposed to either 0 or 30 Gy of irradiation at xxx hpf.,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,Larvae were maintained at 28C and samples were collected at 30 hpf.,tissue:whole embryo|Stage:30 hpf|strain:CG1|genotype:tp53 null/null|treatment:0 Gy,GSM8275249,GSM8275249: tp53 null/null 0 Gy  biol rep 3; Danio rerio; RNA Seq,GSM8275249 r1,GSM8275249,1,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP508364,,loader:fastq load.py,NN-3_R1_001.fastq.gz NN-3_R2_001.fastq.gz,fastq fastq,9280014900.0,30933383.0,GSM8275249 r1,0:150 1:150,A:2579418683;C:2021325576;G:2174123842;T:2505074465;N:72334,150,150,,,2579418683,2021325576,2174123842,2505074465,72334,SRX24593103,SRS21331193,,,"Berman Lab, Children's Hospital of Eastern Ontario Research Institute",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,bulk,bulk,bulk,,Canada,2024-05-17,Pharyngula,Embryo,Whole Organism,All anatomical structures
32151,SRR29068717,SRX24593102,SRS21331192,SRP508364,PRJNA1112809,tp53 R217H and R242H Mutant Zebrafish Display Dysfunctional p53 Hallmarks and Recapitulate LFS Phenotypes [RNA seq],GSE267760,Transcriptome Analysis,Li Fraumeni syndrome LFS is a hereditary cancer predisposition syndrome associated with a highly penetrant and diverse tumor spectrum characterized by germline mutations in the TP53 tumor suppressor gene. To better understand how TP53 mutations predispose individuals with LFS to cancer development  we characterized tp53 R217H and R242H zebrafish lines as the first zebrafish p53 hotspot mutants human R248 and R273H. These mutants have lost several key wildtype p53 functions and recapitulate many LFS phenotypes. Specifically  we have shown that the R217H and R242H alleles result in partial to no activation of key p53 target genes  are resistant to apoptosis in a dominant negative manner and exhibit a defective G1 cell cycle checkpoint in vivo. The loss of these wildtype p53 functions predisposed the fish to develop spontaneous tumors as early as 6 month of age. Tumor histology resembles human sarcomas  a predominant LFS tumor type. tp53 R242H mutants developed tumors earlier with a higher lifetime incidence than tp53 null or R217H mutants  suggesting it is a more aggressive mutation  while the R217H allele may be hypomorphic. Additionally  we observed mutation specific differences both in the tumor type and sex bias across tp53 null  R217H  and R242H genotypes with associated diverse transcriptomic and DNA methylome profiles  impacting metabolism  cell signalling  and biological macromolecule synthesis and degradation. These tp53 zebrafish mutants demonstrate fidelity to their human counterparts and provide new insights into underlying tumorigenesis mechanisms and kinetics  which may inform more tailored tumor surveillance approaches and novel therapeutic targets in LFS. Overall design: We generated tp53 zebrafish mutants representing two of the most common mutation residues found in human cancers  tp53 R217H and R242H human R248 and R273 using CRISPR to knock in the mutations and also obtained a CG1 tp53 null line from the Langenau lab Ignatius et al.  2018. We also used the transparent casper strain as a comparison to zebrafish with wildtype p53. Of note  the tp53 null fish are in the CG1 background while the casper  tp53 R217H  and tp53 R242H fish are in the AB background. We performed bulk RNA sequencing on homozygous pooled samples with fifty 30 hpf larvae exposed to 0 or 30 Gy of irradiation at xxx hpf. We had three biological replicate for each genotype and treatment group for a total of 8 different groups with 24 samples total casper 0 Gy  casper 30 Gy  tp53 null 0 Gy  tp53 null 30 Gy  tp53 R217H 0 Gy  tp53 R217H 30 Gy  tp53 R242H 0 Gy  tp53 R242H 30 Gy.,,,,tp53 null/null 0 Gy  biol rep 2,GSM8275248,,source name:whole embryo|tissue:whole embryo|Stage:30 hpf|strain:CG1|genotype:tp53 null/null|treatment:0 Gy|geo loc name:missing|collection date:missing,tp53 null/null 0 Gy  biol rep 2,The RNA Seq data were mapped with STAR v2.7 to generate BAM files and transcripts were quantified with RSEM using the zebrafish V4.3.2 transcript annotation. Assembly: GRCz11 Supplementary files format and content: tab delinated text file includes count matrix with each sample,whole embryo,Larvae were exposed to either 0 or 30 Gy of irradiation at xxx hpf.,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,Larvae were maintained at 28C and samples were collected at 30 hpf.,tissue:whole embryo|Stage:30 hpf|strain:CG1|genotype:tp53 null/null|treatment:0 Gy,GSM8275248,GSM8275248: tp53 null/null 0 Gy  biol rep 2; Danio rerio; RNA Seq,GSM8275248 r1,GSM8275248,1,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP508364,,loader:fastq load.py,NN-2_R1_001.fastq.gz NN-2_R2_001.fastq.gz,fastq fastq,10707389700.0,35691299.0,GSM8275248 r1,0:150 1:150,A:2996008142;C:2309486822;G:2484070965;T:2917739315;N:84456,150,150,,,2996008142,2309486822,2484070965,2917739315,84456,SRX24593102,SRS21331192,,,"Berman Lab, Children's Hospital of Eastern Ontario Research Institute",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,bulk,bulk,bulk,,Canada,2024-05-17,Pharyngula,Embryo,Whole Organism,All anatomical structures
32152,SRR29068718,SRX24593101,SRS21331191,SRP508364,PRJNA1112809,tp53 R217H and R242H Mutant Zebrafish Display Dysfunctional p53 Hallmarks and Recapitulate LFS Phenotypes [RNA seq],GSE267760,Transcriptome Analysis,Li Fraumeni syndrome LFS is a hereditary cancer predisposition syndrome associated with a highly penetrant and diverse tumor spectrum characterized by germline mutations in the TP53 tumor suppressor gene. To better understand how TP53 mutations predispose individuals with LFS to cancer development  we characterized tp53 R217H and R242H zebrafish lines as the first zebrafish p53 hotspot mutants human R248 and R273H. These mutants have lost several key wildtype p53 functions and recapitulate many LFS phenotypes. Specifically  we have shown that the R217H and R242H alleles result in partial to no activation of key p53 target genes  are resistant to apoptosis in a dominant negative manner and exhibit a defective G1 cell cycle checkpoint in vivo. The loss of these wildtype p53 functions predisposed the fish to develop spontaneous tumors as early as 6 month of age. Tumor histology resembles human sarcomas  a predominant LFS tumor type. tp53 R242H mutants developed tumors earlier with a higher lifetime incidence than tp53 null or R217H mutants  suggesting it is a more aggressive mutation  while the R217H allele may be hypomorphic. Additionally  we observed mutation specific differences both in the tumor type and sex bias across tp53 null  R217H  and R242H genotypes with associated diverse transcriptomic and DNA methylome profiles  impacting metabolism  cell signalling  and biological macromolecule synthesis and degradation. These tp53 zebrafish mutants demonstrate fidelity to their human counterparts and provide new insights into underlying tumorigenesis mechanisms and kinetics  which may inform more tailored tumor surveillance approaches and novel therapeutic targets in LFS. Overall design: We generated tp53 zebrafish mutants representing two of the most common mutation residues found in human cancers  tp53 R217H and R242H human R248 and R273 using CRISPR to knock in the mutations and also obtained a CG1 tp53 null line from the Langenau lab Ignatius et al.  2018. We also used the transparent casper strain as a comparison to zebrafish with wildtype p53. Of note  the tp53 null fish are in the CG1 background while the casper  tp53 R217H  and tp53 R242H fish are in the AB background. We performed bulk RNA sequencing on homozygous pooled samples with fifty 30 hpf larvae exposed to 0 or 30 Gy of irradiation at xxx hpf. We had three biological replicate for each genotype and treatment group for a total of 8 different groups with 24 samples total casper 0 Gy  casper 30 Gy  tp53 null 0 Gy  tp53 null 30 Gy  tp53 R217H 0 Gy  tp53 R217H 30 Gy  tp53 R242H 0 Gy  tp53 R242H 30 Gy.,,,,tp53 null/null 0 Gy  biol rep 1,GSM8275247,,source name:whole embryo|tissue:whole embryo|Stage:30 hpf|strain:CG1|genotype:tp53 null/null|treatment:0 Gy|geo loc name:missing|collection date:missing,tp53 null/null 0 Gy  biol rep 1,The RNA Seq data were mapped with STAR v2.7 to generate BAM files and transcripts were quantified with RSEM using the zebrafish V4.3.2 transcript annotation. Assembly: GRCz11 Supplementary files format and content: tab delinated text file includes count matrix with each sample,whole embryo,Larvae were exposed to either 0 or 30 Gy of irradiation at xxx hpf.,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,Larvae were maintained at 28C and samples were collected at 30 hpf.,tissue:whole embryo|Stage:30 hpf|strain:CG1|genotype:tp53 null/null|treatment:0 Gy,GSM8275247,GSM8275247: tp53 null/null 0 Gy  biol rep 1; Danio rerio; RNA Seq,GSM8275247 r1,GSM8275247,1,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP508364,,loader:fastq load.py,NN-1_R1_001.fastq.gz NN-1_R2_001.fastq.gz,fastq fastq,7135635900.0,23785453.0,GSM8275247 r1,0:150 1:150,A:2013858781;C:1536736753;G:1635489625;T:1949495108;N:55633,150,150,,,2013858781,1536736753,1635489625,1949495108,55633,SRX24593101,SRS21331191,,,"Berman Lab, Children's Hospital of Eastern Ontario Research Institute",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,bulk,bulk,bulk,,Canada,2024-05-17,Pharyngula,Embryo,Whole Organism,All anatomical structures
32153,SRR29068719,SRX24593100,SRS21331190,SRP508364,PRJNA1112809,tp53 R217H and R242H Mutant Zebrafish Display Dysfunctional p53 Hallmarks and Recapitulate LFS Phenotypes [RNA seq],GSE267760,Transcriptome Analysis,Li Fraumeni syndrome LFS is a hereditary cancer predisposition syndrome associated with a highly penetrant and diverse tumor spectrum characterized by germline mutations in the TP53 tumor suppressor gene. To better understand how TP53 mutations predispose individuals with LFS to cancer development  we characterized tp53 R217H and R242H zebrafish lines as the first zebrafish p53 hotspot mutants human R248 and R273H. These mutants have lost several key wildtype p53 functions and recapitulate many LFS phenotypes. Specifically  we have shown that the R217H and R242H alleles result in partial to no activation of key p53 target genes  are resistant to apoptosis in a dominant negative manner and exhibit a defective G1 cell cycle checkpoint in vivo. The loss of these wildtype p53 functions predisposed the fish to develop spontaneous tumors as early as 6 month of age. Tumor histology resembles human sarcomas  a predominant LFS tumor type. tp53 R242H mutants developed tumors earlier with a higher lifetime incidence than tp53 null or R217H mutants  suggesting it is a more aggressive mutation  while the R217H allele may be hypomorphic. Additionally  we observed mutation specific differences both in the tumor type and sex bias across tp53 null  R217H  and R242H genotypes with associated diverse transcriptomic and DNA methylome profiles  impacting metabolism  cell signalling  and biological macromolecule synthesis and degradation. These tp53 zebrafish mutants demonstrate fidelity to their human counterparts and provide new insights into underlying tumorigenesis mechanisms and kinetics  which may inform more tailored tumor surveillance approaches and novel therapeutic targets in LFS. Overall design: We generated tp53 zebrafish mutants representing two of the most common mutation residues found in human cancers  tp53 R217H and R242H human R248 and R273 using CRISPR to knock in the mutations and also obtained a CG1 tp53 null line from the Langenau lab Ignatius et al.  2018. We also used the transparent casper strain as a comparison to zebrafish with wildtype p53. Of note  the tp53 null fish are in the CG1 background while the casper  tp53 R217H  and tp53 R242H fish are in the AB background. We performed bulk RNA sequencing on homozygous pooled samples with fifty 30 hpf larvae exposed to 0 or 30 Gy of irradiation at xxx hpf. We had three biological replicate for each genotype and treatment group for a total of 8 different groups with 24 samples total casper 0 Gy  casper 30 Gy  tp53 null 0 Gy  tp53 null 30 Gy  tp53 R217H 0 Gy  tp53 R217H 30 Gy  tp53 R242H 0 Gy  tp53 R242H 30 Gy.,,,,tp53 null/null 30 Gy  biol rep 3,GSM8275246,,source name:whole embryo|tissue:whole embryo|Stage:30 hpf|strain:CG1|genotype:tp53 null/null|treatment:30 Gy|geo loc name:missing|collection date:missing,tp53 null/null 30 Gy  biol rep 3,The RNA Seq data were mapped with STAR v2.7 to generate BAM files and transcripts were quantified with RSEM using the zebrafish V4.3.2 transcript annotation. Assembly: GRCz11 Supplementary files format and content: tab delinated text file includes count matrix with each sample,whole embryo,Larvae were exposed to either 0 or 30 Gy of irradiation at xxx hpf.,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,Larvae were maintained at 28C and samples were collected at 30 hpf.,tissue:whole embryo|Stage:30 hpf|strain:CG1|genotype:tp53 null/null|treatment:30 Gy,GSM8275246,GSM8275246: tp53 null/null 30 Gy  biol rep 3; Danio rerio; RNA Seq,GSM8275246 r1,GSM8275246,1,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP508364,,loader:fastq load.py,NI-3_R1_001.fastq.gz NI-3_R2_001.fastq.gz,fastq fastq,8705985900.0,29019953.0,GSM8275246 r1,0:150 1:150,A:2451599576;C:1903967773;G:1979058961;T:2371292759;N:66831,150,150,,,2451599576,1903967773,1979058961,2371292759,66831,SRX24593100,SRS21331190,,,"Berman Lab, Children's Hospital of Eastern Ontario Research Institute",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,bulk,bulk,bulk,,Canada,2024-05-17,Pharyngula,Embryo,Whole Organism,All anatomical structures
32154,SRR29068720,SRX24593099,SRS21331189,SRP508364,PRJNA1112809,tp53 R217H and R242H Mutant Zebrafish Display Dysfunctional p53 Hallmarks and Recapitulate LFS Phenotypes [RNA seq],GSE267760,Transcriptome Analysis,Li Fraumeni syndrome LFS is a hereditary cancer predisposition syndrome associated with a highly penetrant and diverse tumor spectrum characterized by germline mutations in the TP53 tumor suppressor gene. To better understand how TP53 mutations predispose individuals with LFS to cancer development  we characterized tp53 R217H and R242H zebrafish lines as the first zebrafish p53 hotspot mutants human R248 and R273H. These mutants have lost several key wildtype p53 functions and recapitulate many LFS phenotypes. Specifically  we have shown that the R217H and R242H alleles result in partial to no activation of key p53 target genes  are resistant to apoptosis in a dominant negative manner and exhibit a defective G1 cell cycle checkpoint in vivo. The loss of these wildtype p53 functions predisposed the fish to develop spontaneous tumors as early as 6 month of age. Tumor histology resembles human sarcomas  a predominant LFS tumor type. tp53 R242H mutants developed tumors earlier with a higher lifetime incidence than tp53 null or R217H mutants  suggesting it is a more aggressive mutation  while the R217H allele may be hypomorphic. Additionally  we observed mutation specific differences both in the tumor type and sex bias across tp53 null  R217H  and R242H genotypes with associated diverse transcriptomic and DNA methylome profiles  impacting metabolism  cell signalling  and biological macromolecule synthesis and degradation. These tp53 zebrafish mutants demonstrate fidelity to their human counterparts and provide new insights into underlying tumorigenesis mechanisms and kinetics  which may inform more tailored tumor surveillance approaches and novel therapeutic targets in LFS. Overall design: We generated tp53 zebrafish mutants representing two of the most common mutation residues found in human cancers  tp53 R217H and R242H human R248 and R273 using CRISPR to knock in the mutations and also obtained a CG1 tp53 null line from the Langenau lab Ignatius et al.  2018. We also used the transparent casper strain as a comparison to zebrafish with wildtype p53. Of note  the tp53 null fish are in the CG1 background while the casper  tp53 R217H  and tp53 R242H fish are in the AB background. We performed bulk RNA sequencing on homozygous pooled samples with fifty 30 hpf larvae exposed to 0 or 30 Gy of irradiation at xxx hpf. We had three biological replicate for each genotype and treatment group for a total of 8 different groups with 24 samples total casper 0 Gy  casper 30 Gy  tp53 null 0 Gy  tp53 null 30 Gy  tp53 R217H 0 Gy  tp53 R217H 30 Gy  tp53 R242H 0 Gy  tp53 R242H 30 Gy.,,,,tp53 null/null 30 Gy  biol rep 2,GSM8275245,,source name:whole embryo|tissue:whole embryo|Stage:30 hpf|strain:CG1|genotype:tp53 null/null|treatment:30 Gy|geo loc name:missing|collection date:missing,tp53 null/null 30 Gy  biol rep 2,The RNA Seq data were mapped with STAR v2.7 to generate BAM files and transcripts were quantified with RSEM using the zebrafish V4.3.2 transcript annotation. Assembly: GRCz11 Supplementary files format and content: tab delinated text file includes count matrix with each sample,whole embryo,Larvae were exposed to either 0 or 30 Gy of irradiation at xxx hpf.,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,Larvae were maintained at 28C and samples were collected at 30 hpf.,tissue:whole embryo|Stage:30 hpf|strain:CG1|genotype:tp53 null/null|treatment:30 Gy,GSM8275245,GSM8275245: tp53 null/null 30 Gy  biol rep 2; Danio rerio; RNA Seq,GSM8275245 r1,GSM8275245,1,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP508364,,loader:fastq load.py,NI-2_R1_001.fastq.gz NI-2_R2_001.fastq.gz,fastq fastq,4040556000.0,13468520.0,GSM8275245 r1,0:150 1:150,A:1064729231;C:885920482;G:1092301122;T:997572075;N:33090,150,150,,,1064729231,885920482,1092301122,997572075,33090,SRX24593099,SRS21331189,,,"Berman Lab, Children's Hospital of Eastern Ontario Research Institute",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,bulk,bulk,bulk,,Canada,2024-05-17,Pharyngula,Embryo,Whole Organism,All anatomical structures
32155,SRR29068721,SRX24593098,SRS21331188,SRP508364,PRJNA1112809,tp53 R217H and R242H Mutant Zebrafish Display Dysfunctional p53 Hallmarks and Recapitulate LFS Phenotypes [RNA seq],GSE267760,Transcriptome Analysis,Li Fraumeni syndrome LFS is a hereditary cancer predisposition syndrome associated with a highly penetrant and diverse tumor spectrum characterized by germline mutations in the TP53 tumor suppressor gene. To better understand how TP53 mutations predispose individuals with LFS to cancer development  we characterized tp53 R217H and R242H zebrafish lines as the first zebrafish p53 hotspot mutants human R248 and R273H. These mutants have lost several key wildtype p53 functions and recapitulate many LFS phenotypes. Specifically  we have shown that the R217H and R242H alleles result in partial to no activation of key p53 target genes  are resistant to apoptosis in a dominant negative manner and exhibit a defective G1 cell cycle checkpoint in vivo. The loss of these wildtype p53 functions predisposed the fish to develop spontaneous tumors as early as 6 month of age. Tumor histology resembles human sarcomas  a predominant LFS tumor type. tp53 R242H mutants developed tumors earlier with a higher lifetime incidence than tp53 null or R217H mutants  suggesting it is a more aggressive mutation  while the R217H allele may be hypomorphic. Additionally  we observed mutation specific differences both in the tumor type and sex bias across tp53 null  R217H  and R242H genotypes with associated diverse transcriptomic and DNA methylome profiles  impacting metabolism  cell signalling  and biological macromolecule synthesis and degradation. These tp53 zebrafish mutants demonstrate fidelity to their human counterparts and provide new insights into underlying tumorigenesis mechanisms and kinetics  which may inform more tailored tumor surveillance approaches and novel therapeutic targets in LFS. Overall design: We generated tp53 zebrafish mutants representing two of the most common mutation residues found in human cancers  tp53 R217H and R242H human R248 and R273 using CRISPR to knock in the mutations and also obtained a CG1 tp53 null line from the Langenau lab Ignatius et al.  2018. We also used the transparent casper strain as a comparison to zebrafish with wildtype p53. Of note  the tp53 null fish are in the CG1 background while the casper  tp53 R217H  and tp53 R242H fish are in the AB background. We performed bulk RNA sequencing on homozygous pooled samples with fifty 30 hpf larvae exposed to 0 or 30 Gy of irradiation at xxx hpf. We had three biological replicate for each genotype and treatment group for a total of 8 different groups with 24 samples total casper 0 Gy  casper 30 Gy  tp53 null 0 Gy  tp53 null 30 Gy  tp53 R217H 0 Gy  tp53 R217H 30 Gy  tp53 R242H 0 Gy  tp53 R242H 30 Gy.,,,,tp53 null/null 30 Gy  biol rep 1,GSM8275244,,source name:whole embryo|tissue:whole embryo|Stage:30 hpf|strain:CG1|genotype:tp53 null/null|treatment:30 Gy|geo loc name:missing|collection date:missing,tp53 null/null 30 Gy  biol rep 1,The RNA Seq data were mapped with STAR v2.7 to generate BAM files and transcripts were quantified with RSEM using the zebrafish V4.3.2 transcript annotation. Assembly: GRCz11 Supplementary files format and content: tab delinated text file includes count matrix with each sample,whole embryo,Larvae were exposed to either 0 or 30 Gy of irradiation at xxx hpf.,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,Larvae were maintained at 28C and samples were collected at 30 hpf.,tissue:whole embryo|Stage:30 hpf|strain:CG1|genotype:tp53 null/null|treatment:30 Gy,GSM8275244,GSM8275244: tp53 null/null 30 Gy  biol rep 1; Danio rerio; RNA Seq,GSM8275244 r1,GSM8275244,1,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP508364,,loader:fastq load.py,NI-1_R1_001.fastq.gz NI-1_R2_001.fastq.gz,fastq fastq,13228044600.0,44093482.0,GSM8275244 r1,0:150 1:150,A:3648277896;C:2853778984;G:3204527446;T:3521354654;N:105620,150,150,,,3648277896,2853778984,3204527446,3521354654,105620,SRX24593098,SRS21331188,,,"Berman Lab, Children's Hospital of Eastern Ontario Research Institute",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,bulk,bulk,bulk,,Canada,2024-05-17,Pharyngula,Embryo,Whole Organism,All anatomical structures
32156,SRR29068722,SRX24593097,SRS21331187,SRP508364,PRJNA1112809,tp53 R217H and R242H Mutant Zebrafish Display Dysfunctional p53 Hallmarks and Recapitulate LFS Phenotypes [RNA seq],GSE267760,Transcriptome Analysis,Li Fraumeni syndrome LFS is a hereditary cancer predisposition syndrome associated with a highly penetrant and diverse tumor spectrum characterized by germline mutations in the TP53 tumor suppressor gene. To better understand how TP53 mutations predispose individuals with LFS to cancer development  we characterized tp53 R217H and R242H zebrafish lines as the first zebrafish p53 hotspot mutants human R248 and R273H. These mutants have lost several key wildtype p53 functions and recapitulate many LFS phenotypes. Specifically  we have shown that the R217H and R242H alleles result in partial to no activation of key p53 target genes  are resistant to apoptosis in a dominant negative manner and exhibit a defective G1 cell cycle checkpoint in vivo. The loss of these wildtype p53 functions predisposed the fish to develop spontaneous tumors as early as 6 month of age. Tumor histology resembles human sarcomas  a predominant LFS tumor type. tp53 R242H mutants developed tumors earlier with a higher lifetime incidence than tp53 null or R217H mutants  suggesting it is a more aggressive mutation  while the R217H allele may be hypomorphic. Additionally  we observed mutation specific differences both in the tumor type and sex bias across tp53 null  R217H  and R242H genotypes with associated diverse transcriptomic and DNA methylome profiles  impacting metabolism  cell signalling  and biological macromolecule synthesis and degradation. These tp53 zebrafish mutants demonstrate fidelity to their human counterparts and provide new insights into underlying tumorigenesis mechanisms and kinetics  which may inform more tailored tumor surveillance approaches and novel therapeutic targets in LFS. Overall design: We generated tp53 zebrafish mutants representing two of the most common mutation residues found in human cancers  tp53 R217H and R242H human R248 and R273 using CRISPR to knock in the mutations and also obtained a CG1 tp53 null line from the Langenau lab Ignatius et al.  2018. We also used the transparent casper strain as a comparison to zebrafish with wildtype p53. Of note  the tp53 null fish are in the CG1 background while the casper  tp53 R217H  and tp53 R242H fish are in the AB background. We performed bulk RNA sequencing on homozygous pooled samples with fifty 30 hpf larvae exposed to 0 or 30 Gy of irradiation at xxx hpf. We had three biological replicate for each genotype and treatment group for a total of 8 different groups with 24 samples total casper 0 Gy  casper 30 Gy  tp53 null 0 Gy  tp53 null 30 Gy  tp53 R217H 0 Gy  tp53 R217H 30 Gy  tp53 R242H 0 Gy  tp53 R242H 30 Gy.,,,,casper 0 Gy  biol rep 3,GSM8275243,,source name:whole embryo|tissue:whole embryo|Stage:30 hpf|strain:AB|genotype:casper|treatment:0 Gy|geo loc name:missing|collection date:missing,casper 0 Gy  biol rep 3,The RNA Seq data were mapped with STAR v2.7 to generate BAM files and transcripts were quantified with RSEM using the zebrafish V4.3.2 transcript annotation. Assembly: GRCz11 Supplementary files format and content: tab delinated text file includes count matrix with each sample,whole embryo,Larvae were exposed to either 0 or 30 Gy of irradiation at xxx hpf.,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,Larvae were maintained at 28C and samples were collected at 30 hpf.,tissue:whole embryo|Stage:30 hpf|strain:AB|genotype:casper|treatment:0 Gy,GSM8275243,GSM8275243: casper 0 Gy  biol rep 3; Danio rerio; RNA Seq,GSM8275243 r1,GSM8275243,1,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP508364,,loader:fastq load.py,CN-3_R1_001.fastq.gz CN-3_R2_001.fastq.gz,fastq fastq,17305790400.0,57685968.0,GSM8275243 r1,0:150 1:150,A:4943405723;C:3677509037;G:3849406622;T:4830939454;N:4529564,150,150,,,4943405723,3677509037,3849406622,4830939454,4529564,SRX24593097,SRS21331187,,,"Berman Lab, Children's Hospital of Eastern Ontario Research Institute",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,bulk,bulk,bulk,,Canada,2024-05-17,Pharyngula,Embryo,Whole Organism,All anatomical structures
32157,SRR29068723,SRX24593096,SRS21331186,SRP508364,PRJNA1112809,tp53 R217H and R242H Mutant Zebrafish Display Dysfunctional p53 Hallmarks and Recapitulate LFS Phenotypes [RNA seq],GSE267760,Transcriptome Analysis,Li Fraumeni syndrome LFS is a hereditary cancer predisposition syndrome associated with a highly penetrant and diverse tumor spectrum characterized by germline mutations in the TP53 tumor suppressor gene. To better understand how TP53 mutations predispose individuals with LFS to cancer development  we characterized tp53 R217H and R242H zebrafish lines as the first zebrafish p53 hotspot mutants human R248 and R273H. These mutants have lost several key wildtype p53 functions and recapitulate many LFS phenotypes. Specifically  we have shown that the R217H and R242H alleles result in partial to no activation of key p53 target genes  are resistant to apoptosis in a dominant negative manner and exhibit a defective G1 cell cycle checkpoint in vivo. The loss of these wildtype p53 functions predisposed the fish to develop spontaneous tumors as early as 6 month of age. Tumor histology resembles human sarcomas  a predominant LFS tumor type. tp53 R242H mutants developed tumors earlier with a higher lifetime incidence than tp53 null or R217H mutants  suggesting it is a more aggressive mutation  while the R217H allele may be hypomorphic. Additionally  we observed mutation specific differences both in the tumor type and sex bias across tp53 null  R217H  and R242H genotypes with associated diverse transcriptomic and DNA methylome profiles  impacting metabolism  cell signalling  and biological macromolecule synthesis and degradation. These tp53 zebrafish mutants demonstrate fidelity to their human counterparts and provide new insights into underlying tumorigenesis mechanisms and kinetics  which may inform more tailored tumor surveillance approaches and novel therapeutic targets in LFS. Overall design: We generated tp53 zebrafish mutants representing two of the most common mutation residues found in human cancers  tp53 R217H and R242H human R248 and R273 using CRISPR to knock in the mutations and also obtained a CG1 tp53 null line from the Langenau lab Ignatius et al.  2018. We also used the transparent casper strain as a comparison to zebrafish with wildtype p53. Of note  the tp53 null fish are in the CG1 background while the casper  tp53 R217H  and tp53 R242H fish are in the AB background. We performed bulk RNA sequencing on homozygous pooled samples with fifty 30 hpf larvae exposed to 0 or 30 Gy of irradiation at xxx hpf. We had three biological replicate for each genotype and treatment group for a total of 8 different groups with 24 samples total casper 0 Gy  casper 30 Gy  tp53 null 0 Gy  tp53 null 30 Gy  tp53 R217H 0 Gy  tp53 R217H 30 Gy  tp53 R242H 0 Gy  tp53 R242H 30 Gy.,,,,casper 0 Gy  biol rep 2,GSM8275242,,source name:whole embryo|tissue:whole embryo|Stage:30 hpf|strain:AB|genotype:casper|treatment:0 Gy|geo loc name:missing|collection date:missing,casper 0 Gy  biol rep 2,The RNA Seq data were mapped with STAR v2.7 to generate BAM files and transcripts were quantified with RSEM using the zebrafish V4.3.2 transcript annotation. Assembly: GRCz11 Supplementary files format and content: tab delinated text file includes count matrix with each sample,whole embryo,Larvae were exposed to either 0 or 30 Gy of irradiation at xxx hpf.,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,Larvae were maintained at 28C and samples were collected at 30 hpf.,tissue:whole embryo|Stage:30 hpf|strain:AB|genotype:casper|treatment:0 Gy,GSM8275242,GSM8275242: casper 0 Gy  biol rep 2; Danio rerio; RNA Seq,GSM8275242 r1,GSM8275242,1,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP508364,,loader:fastq load.py,CN-2_R1_001.fastq.gz CN-2_R2_001.fastq.gz,fastq fastq,7856126700.0,26187089.0,GSM8275242 r1,0:150 1:150,A:2181800519;C:1712717950;G:1835053315;T:2126491645;N:63271,150,150,,,2181800519,1712717950,1835053315,2126491645,63271,SRX24593096,SRS21331186,,,"Berman Lab, Children's Hospital of Eastern Ontario Research Institute",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,bulk,bulk,bulk,,Canada,2024-05-17,Pharyngula,Embryo,Whole Organism,All anatomical structures
32158,SRR29068724,SRX24593095,SRS21331185,SRP508364,PRJNA1112809,tp53 R217H and R242H Mutant Zebrafish Display Dysfunctional p53 Hallmarks and Recapitulate LFS Phenotypes [RNA seq],GSE267760,Transcriptome Analysis,Li Fraumeni syndrome LFS is a hereditary cancer predisposition syndrome associated with a highly penetrant and diverse tumor spectrum characterized by germline mutations in the TP53 tumor suppressor gene. To better understand how TP53 mutations predispose individuals with LFS to cancer development  we characterized tp53 R217H and R242H zebrafish lines as the first zebrafish p53 hotspot mutants human R248 and R273H. These mutants have lost several key wildtype p53 functions and recapitulate many LFS phenotypes. Specifically  we have shown that the R217H and R242H alleles result in partial to no activation of key p53 target genes  are resistant to apoptosis in a dominant negative manner and exhibit a defective G1 cell cycle checkpoint in vivo. The loss of these wildtype p53 functions predisposed the fish to develop spontaneous tumors as early as 6 month of age. Tumor histology resembles human sarcomas  a predominant LFS tumor type. tp53 R242H mutants developed tumors earlier with a higher lifetime incidence than tp53 null or R217H mutants  suggesting it is a more aggressive mutation  while the R217H allele may be hypomorphic. Additionally  we observed mutation specific differences both in the tumor type and sex bias across tp53 null  R217H  and R242H genotypes with associated diverse transcriptomic and DNA methylome profiles  impacting metabolism  cell signalling  and biological macromolecule synthesis and degradation. These tp53 zebrafish mutants demonstrate fidelity to their human counterparts and provide new insights into underlying tumorigenesis mechanisms and kinetics  which may inform more tailored tumor surveillance approaches and novel therapeutic targets in LFS. Overall design: We generated tp53 zebrafish mutants representing two of the most common mutation residues found in human cancers  tp53 R217H and R242H human R248 and R273 using CRISPR to knock in the mutations and also obtained a CG1 tp53 null line from the Langenau lab Ignatius et al.  2018. We also used the transparent casper strain as a comparison to zebrafish with wildtype p53. Of note  the tp53 null fish are in the CG1 background while the casper  tp53 R217H  and tp53 R242H fish are in the AB background. We performed bulk RNA sequencing on homozygous pooled samples with fifty 30 hpf larvae exposed to 0 or 30 Gy of irradiation at xxx hpf. We had three biological replicate for each genotype and treatment group for a total of 8 different groups with 24 samples total casper 0 Gy  casper 30 Gy  tp53 null 0 Gy  tp53 null 30 Gy  tp53 R217H 0 Gy  tp53 R217H 30 Gy  tp53 R242H 0 Gy  tp53 R242H 30 Gy.,,,,casper 0 Gy  biol rep 1,GSM8275241,,source name:whole embryo|tissue:whole embryo|Stage:30 hpf|strain:AB|genotype:casper|treatment:0 Gy|geo loc name:missing|collection date:missing,casper 0 Gy  biol rep 1,The RNA Seq data were mapped with STAR v2.7 to generate BAM files and transcripts were quantified with RSEM using the zebrafish V4.3.2 transcript annotation. Assembly: GRCz11 Supplementary files format and content: tab delinated text file includes count matrix with each sample,whole embryo,Larvae were exposed to either 0 or 30 Gy of irradiation at xxx hpf.,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,Larvae were maintained at 28C and samples were collected at 30 hpf.,tissue:whole embryo|Stage:30 hpf|strain:AB|genotype:casper|treatment:0 Gy,GSM8275241,GSM8275241: casper 0 Gy  biol rep 1; Danio rerio; RNA Seq,GSM8275241 r1,GSM8275241,1,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP508364,,loader:fastq load.py,CN-1_R1_001.fastq.gz CN-1_R2_001.fastq.gz,fastq fastq,17854583700.0,59515279.0,GSM8275241 r1,0:150 1:150,A:5047426493;C:3817702039;G:4070868393;T:4913755567;N:4831208,150,150,,,5047426493,3817702039,4070868393,4913755567,4831208,SRX24593095,SRS21331185,,,"Berman Lab, Children's Hospital of Eastern Ontario Research Institute",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,bulk,bulk,bulk,,Canada,2024-05-17,Pharyngula,Embryo,Whole Organism,All anatomical structures
32159,SRR29068725,SRX24593094,SRS21331184,SRP508364,PRJNA1112809,tp53 R217H and R242H Mutant Zebrafish Display Dysfunctional p53 Hallmarks and Recapitulate LFS Phenotypes [RNA seq],GSE267760,Transcriptome Analysis,Li Fraumeni syndrome LFS is a hereditary cancer predisposition syndrome associated with a highly penetrant and diverse tumor spectrum characterized by germline mutations in the TP53 tumor suppressor gene. To better understand how TP53 mutations predispose individuals with LFS to cancer development  we characterized tp53 R217H and R242H zebrafish lines as the first zebrafish p53 hotspot mutants human R248 and R273H. These mutants have lost several key wildtype p53 functions and recapitulate many LFS phenotypes. Specifically  we have shown that the R217H and R242H alleles result in partial to no activation of key p53 target genes  are resistant to apoptosis in a dominant negative manner and exhibit a defective G1 cell cycle checkpoint in vivo. The loss of these wildtype p53 functions predisposed the fish to develop spontaneous tumors as early as 6 month of age. Tumor histology resembles human sarcomas  a predominant LFS tumor type. tp53 R242H mutants developed tumors earlier with a higher lifetime incidence than tp53 null or R217H mutants  suggesting it is a more aggressive mutation  while the R217H allele may be hypomorphic. Additionally  we observed mutation specific differences both in the tumor type and sex bias across tp53 null  R217H  and R242H genotypes with associated diverse transcriptomic and DNA methylome profiles  impacting metabolism  cell signalling  and biological macromolecule synthesis and degradation. These tp53 zebrafish mutants demonstrate fidelity to their human counterparts and provide new insights into underlying tumorigenesis mechanisms and kinetics  which may inform more tailored tumor surveillance approaches and novel therapeutic targets in LFS. Overall design: We generated tp53 zebrafish mutants representing two of the most common mutation residues found in human cancers  tp53 R217H and R242H human R248 and R273 using CRISPR to knock in the mutations and also obtained a CG1 tp53 null line from the Langenau lab Ignatius et al.  2018. We also used the transparent casper strain as a comparison to zebrafish with wildtype p53. Of note  the tp53 null fish are in the CG1 background while the casper  tp53 R217H  and tp53 R242H fish are in the AB background. We performed bulk RNA sequencing on homozygous pooled samples with fifty 30 hpf larvae exposed to 0 or 30 Gy of irradiation at xxx hpf. We had three biological replicate for each genotype and treatment group for a total of 8 different groups with 24 samples total casper 0 Gy  casper 30 Gy  tp53 null 0 Gy  tp53 null 30 Gy  tp53 R217H 0 Gy  tp53 R217H 30 Gy  tp53 R242H 0 Gy  tp53 R242H 30 Gy.,,,,casper 30 Gy  biol rep 3,GSM8275240,,source name:whole embryo|tissue:whole embryo|Stage:30 hpf|strain:AB|genotype:casper|treatment:30 Gy|geo loc name:missing|collection date:missing,casper 30 Gy  biol rep 3,The RNA Seq data were mapped with STAR v2.7 to generate BAM files and transcripts were quantified with RSEM using the zebrafish V4.3.2 transcript annotation. Assembly: GRCz11 Supplementary files format and content: tab delinated text file includes count matrix with each sample,whole embryo,Larvae were exposed to either 0 or 30 Gy of irradiation at xxx hpf.,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,Larvae were maintained at 28C and samples were collected at 30 hpf.,tissue:whole embryo|Stage:30 hpf|strain:AB|genotype:casper|treatment:30 Gy,GSM8275240,GSM8275240: casper 30 Gy  biol rep 3; Danio rerio; RNA Seq,GSM8275240 r1,GSM8275240,1,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP508364,,loader:fastq load.py,CI-3_R1_001.fastq.gz CI-3_R2_001.fastq.gz,fastq fastq,7459084200.0,24863614.0,GSM8275240 r1,0:150 1:150,A:2017184252;C:1711102783;G:1772264422;T:1958475306;N:57437,150,150,,,2017184252,1711102783,1772264422,1958475306,57437,SRX24593094,SRS21331184,,,"Berman Lab, Children's Hospital of Eastern Ontario Research Institute",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,bulk,bulk,bulk,,Canada,2024-05-17,Pharyngula,Embryo,Whole Organism,All anatomical structures
32160,SRR29068726,SRX24593093,SRS21331183,SRP508364,PRJNA1112809,tp53 R217H and R242H Mutant Zebrafish Display Dysfunctional p53 Hallmarks and Recapitulate LFS Phenotypes [RNA seq],GSE267760,Transcriptome Analysis,Li Fraumeni syndrome LFS is a hereditary cancer predisposition syndrome associated with a highly penetrant and diverse tumor spectrum characterized by germline mutations in the TP53 tumor suppressor gene. To better understand how TP53 mutations predispose individuals with LFS to cancer development  we characterized tp53 R217H and R242H zebrafish lines as the first zebrafish p53 hotspot mutants human R248 and R273H. These mutants have lost several key wildtype p53 functions and recapitulate many LFS phenotypes. Specifically  we have shown that the R217H and R242H alleles result in partial to no activation of key p53 target genes  are resistant to apoptosis in a dominant negative manner and exhibit a defective G1 cell cycle checkpoint in vivo. The loss of these wildtype p53 functions predisposed the fish to develop spontaneous tumors as early as 6 month of age. Tumor histology resembles human sarcomas  a predominant LFS tumor type. tp53 R242H mutants developed tumors earlier with a higher lifetime incidence than tp53 null or R217H mutants  suggesting it is a more aggressive mutation  while the R217H allele may be hypomorphic. Additionally  we observed mutation specific differences both in the tumor type and sex bias across tp53 null  R217H  and R242H genotypes with associated diverse transcriptomic and DNA methylome profiles  impacting metabolism  cell signalling  and biological macromolecule synthesis and degradation. These tp53 zebrafish mutants demonstrate fidelity to their human counterparts and provide new insights into underlying tumorigenesis mechanisms and kinetics  which may inform more tailored tumor surveillance approaches and novel therapeutic targets in LFS. Overall design: We generated tp53 zebrafish mutants representing two of the most common mutation residues found in human cancers  tp53 R217H and R242H human R248 and R273 using CRISPR to knock in the mutations and also obtained a CG1 tp53 null line from the Langenau lab Ignatius et al.  2018. We also used the transparent casper strain as a comparison to zebrafish with wildtype p53. Of note  the tp53 null fish are in the CG1 background while the casper  tp53 R217H  and tp53 R242H fish are in the AB background. We performed bulk RNA sequencing on homozygous pooled samples with fifty 30 hpf larvae exposed to 0 or 30 Gy of irradiation at xxx hpf. We had three biological replicate for each genotype and treatment group for a total of 8 different groups with 24 samples total casper 0 Gy  casper 30 Gy  tp53 null 0 Gy  tp53 null 30 Gy  tp53 R217H 0 Gy  tp53 R217H 30 Gy  tp53 R242H 0 Gy  tp53 R242H 30 Gy.,,,,casper 30 Gy  biol rep 2,GSM8275239,,source name:whole embryo|tissue:whole embryo|Stage:30 hpf|strain:AB|genotype:casper|treatment:30 Gy|geo loc name:missing|collection date:missing,casper 30 Gy  biol rep 2,The RNA Seq data were mapped with STAR v2.7 to generate BAM files and transcripts were quantified with RSEM using the zebrafish V4.3.2 transcript annotation. Assembly: GRCz11 Supplementary files format and content: tab delinated text file includes count matrix with each sample,whole embryo,Larvae were exposed to either 0 or 30 Gy of irradiation at xxx hpf.,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,Larvae were maintained at 28C and samples were collected at 30 hpf.,tissue:whole embryo|Stage:30 hpf|strain:AB|genotype:casper|treatment:30 Gy,GSM8275239,GSM8275239: casper 30 Gy  biol rep 2; Danio rerio; RNA Seq,GSM8275239 r1,GSM8275239,1,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP508364,,loader:fastq load.py,CI-2_R1_001.fastq.gz CI-2_R2_001.fastq.gz,fastq fastq,9754545900.0,32515153.0,GSM8275239 r1,0:150 1:150,A:2528054076;C:2339919668;G:2442835629;T:2443659385;N:77142,150,150,,,2528054076,2339919668,2442835629,2443659385,77142,SRX24593093,SRS21331183,,,"Berman Lab, Children's Hospital of Eastern Ontario Research Institute",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,bulk,bulk,bulk,,Canada,2024-05-17,Pharyngula,Embryo,Whole Organism,All anatomical structures
32161,SRR29068727,SRX24593092,SRS21331182,SRP508364,PRJNA1112809,tp53 R217H and R242H Mutant Zebrafish Display Dysfunctional p53 Hallmarks and Recapitulate LFS Phenotypes [RNA seq],GSE267760,Transcriptome Analysis,Li Fraumeni syndrome LFS is a hereditary cancer predisposition syndrome associated with a highly penetrant and diverse tumor spectrum characterized by germline mutations in the TP53 tumor suppressor gene. To better understand how TP53 mutations predispose individuals with LFS to cancer development  we characterized tp53 R217H and R242H zebrafish lines as the first zebrafish p53 hotspot mutants human R248 and R273H. These mutants have lost several key wildtype p53 functions and recapitulate many LFS phenotypes. Specifically  we have shown that the R217H and R242H alleles result in partial to no activation of key p53 target genes  are resistant to apoptosis in a dominant negative manner and exhibit a defective G1 cell cycle checkpoint in vivo. The loss of these wildtype p53 functions predisposed the fish to develop spontaneous tumors as early as 6 month of age. Tumor histology resembles human sarcomas  a predominant LFS tumor type. tp53 R242H mutants developed tumors earlier with a higher lifetime incidence than tp53 null or R217H mutants  suggesting it is a more aggressive mutation  while the R217H allele may be hypomorphic. Additionally  we observed mutation specific differences both in the tumor type and sex bias across tp53 null  R217H  and R242H genotypes with associated diverse transcriptomic and DNA methylome profiles  impacting metabolism  cell signalling  and biological macromolecule synthesis and degradation. These tp53 zebrafish mutants demonstrate fidelity to their human counterparts and provide new insights into underlying tumorigenesis mechanisms and kinetics  which may inform more tailored tumor surveillance approaches and novel therapeutic targets in LFS. Overall design: We generated tp53 zebrafish mutants representing two of the most common mutation residues found in human cancers  tp53 R217H and R242H human R248 and R273 using CRISPR to knock in the mutations and also obtained a CG1 tp53 null line from the Langenau lab Ignatius et al.  2018. We also used the transparent casper strain as a comparison to zebrafish with wildtype p53. Of note  the tp53 null fish are in the CG1 background while the casper  tp53 R217H  and tp53 R242H fish are in the AB background. We performed bulk RNA sequencing on homozygous pooled samples with fifty 30 hpf larvae exposed to 0 or 30 Gy of irradiation at xxx hpf. We had three biological replicate for each genotype and treatment group for a total of 8 different groups with 24 samples total casper 0 Gy  casper 30 Gy  tp53 null 0 Gy  tp53 null 30 Gy  tp53 R217H 0 Gy  tp53 R217H 30 Gy  tp53 R242H 0 Gy  tp53 R242H 30 Gy.,,,,casper 30 Gy  biol rep 1,GSM8275238,,source name:whole embryo|tissue:whole embryo|Stage:30 hpf|strain:AB|genotype:casper|treatment:30 Gy|geo loc name:missing|collection date:missing,casper 30 Gy  biol rep 1,The RNA Seq data were mapped with STAR v2.7 to generate BAM files and transcripts were quantified with RSEM using the zebrafish V4.3.2 transcript annotation. Assembly: GRCz11 Supplementary files format and content: tab delinated text file includes count matrix with each sample,whole embryo,Larvae were exposed to either 0 or 30 Gy of irradiation at xxx hpf.,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,Larvae were maintained at 28C and samples were collected at 30 hpf.,tissue:whole embryo|Stage:30 hpf|strain:AB|genotype:casper|treatment:30 Gy,GSM8275238,GSM8275238: casper 30 Gy  biol rep 1; Danio rerio; RNA Seq,GSM8275238 r1,GSM8275238,1,Each RNA sample was extracted from 50 zebrafish embryos anesthetized with tricaine MS 222 and homogenized in 500μL TRIzol reagent Life Technologies  15596026 using a 1mL syringe and 23G needle. Lysed samples were purified and DNAse treated using the Direct zol RNA MicroPrep kit Zymo Research Corperation  R2060. 4ug of total RNA from each sample were sent for RNA sequencing. RNA Libraries were constructed for standard paired read RNA sequencing by GeneWiz.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP508364,,loader:fastq load.py,CI-1_R1_001.fastq.gz CI-1_R2_001.fastq.gz,fastq fastq,8075614200.0,26918714.0,GSM8275238 r1,0:150 1:150,A:2167921413;C:1845510317;G:1962119169;T:2100000616;N:62685,150,150,,,2167921413,1845510317,1962119169,2100000616,62685,SRX24593092,SRS21331182,,,"Berman Lab, Children's Hospital of Eastern Ontario Research Institute",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,bulk,bulk,bulk,,Canada,2024-05-17,Pharyngula,Embryo,Whole Organism,All anatomical structures
34040,SRR31033347,SRX26418803,SRS22938435,SRP539223,PRJNA1174207,Rbm24 dictates mRNA recruitment for germ plasm assembly,GSE279756,Transcriptome Analysis,Ribonucleoprotein RNP granules are the most common membrane less biomolecular condensates. However  the mechanisms underlying their assembly are largely unknown. The aggregation of germ plasm determines the fate of primordial germ cells PGCs and serves as a model for RNP granule assembly. Here  we show that maternal RNA binding protein Rbm24a is the key factor governing specific sorting of mRNAs. Mechanistically  Rbm24a complexes with Buc and interacts to dictate the specific grasp of germ plasm mRNAs into phase separated condensates. Germ plasm particles lacking Rbm24a and mRNAs fail to undergo kinesin dependent transport towards the cleavage furrows where small granules fuse into large aggregates. Therefore  the loss of maternal Rbm24a causes a complete degradation of germ plasm and the disappearance of PGCs. These findings demonstrate that Rbm24a functions as a nucleating organizer of the germ plasm  highlighting an emerging mechanism for RNA binding proteins in reading and recruiting RNA components into the phase separated protein scaffold. Overall design: To examine the global transcriptome alterations following the loss of maternal Rbm24a  we conducted bulk RNA seq analysis on Mrbm24a and their sibling embyos at 4 cell  sphere stage and 24 hpf.,,,,Zebrafish  RNAseq  M 24HPF 4,GSM8579726,,source name:whole embryo|tissue:whole embryo|Stage:24 hpf stage|cell type:embryonic cell|genotype:Mrbm24a|geo loc name:missing|collection date:missing,Zebrafish  RNAseq  M 24HPF 4,Each library was amplified by a 11 cycle PCR  and 150 bp paired end sequencing was subjected to Illumina HiSeq 2000 to obtain the raw data. Assembly: GRCz10 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text file includes FPKM values for each Sample,whole embryo,,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage  using TRIzol reagent Invitrogen  and were precipitated by cold isopropanol 50%  v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction  followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions.,Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C,tissue:whole embryo|Stage:24 hpf stage|cell type:embryonic cell|genotype:Mrbm24a,GSM8579726,GSM8579726: Zebrafish  RNAseq  M 24HPF 4; Danio rerio; RNA Seq,GSM8579726 r1,GSM8579726,1,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage  using TRIzol reagent Invitrogen  and were precipitated by cold isopropanol 50%  v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction  followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,SRP539223,,,M-24HPF-4_L1_1.fq.gz M-24HPF-4_L1_2.fq.gz,fastq fastq,7509691500.0,25032305.0,GSM8579726 r1,0:150 1:150,A:2051155577;C:1703307330;G:1761930893;T:1993247939;N:49761,150,150,,,2051155577,1703307330,1761930893,1993247939,49761,SRX26418803,SRS22938435,SRA1993092,Shandong university,Shandong university,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,unknown,bulk,bulk,bulk,,China,2024-10-17,Pharyngula,Embryo,Whole Organism,All anatomical structures
34041,SRR31033348,SRX26418802,SRS22938442,SRP539223,PRJNA1174207,Rbm24 dictates mRNA recruitment for germ plasm assembly,GSE279756,Transcriptome Analysis,Ribonucleoprotein RNP granules are the most common membrane less biomolecular condensates. However  the mechanisms underlying their assembly are largely unknown. The aggregation of germ plasm determines the fate of primordial germ cells PGCs and serves as a model for RNP granule assembly. Here  we show that maternal RNA binding protein Rbm24a is the key factor governing specific sorting of mRNAs. Mechanistically  Rbm24a complexes with Buc and interacts to dictate the specific grasp of germ plasm mRNAs into phase separated condensates. Germ plasm particles lacking Rbm24a and mRNAs fail to undergo kinesin dependent transport towards the cleavage furrows where small granules fuse into large aggregates. Therefore  the loss of maternal Rbm24a causes a complete degradation of germ plasm and the disappearance of PGCs. These findings demonstrate that Rbm24a functions as a nucleating organizer of the germ plasm  highlighting an emerging mechanism for RNA binding proteins in reading and recruiting RNA components into the phase separated protein scaffold. Overall design: To examine the global transcriptome alterations following the loss of maternal Rbm24a  we conducted bulk RNA seq analysis on Mrbm24a and their sibling embyos at 4 cell  sphere stage and 24 hpf.,,,,Zebrafish  RNAseq  M 24HPF 2,GSM8579724,,source name:whole embryo|tissue:whole embryo|Stage:24 hpf stage|cell type:embryonic cell|genotype:Mrbm24a|geo loc name:missing|collection date:missing,Zebrafish  RNAseq  M 24HPF 2,Each library was amplified by a 11 cycle PCR  and 150 bp paired end sequencing was subjected to Illumina HiSeq 2000 to obtain the raw data. Assembly: GRCz10 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text file includes FPKM values for each Sample,whole embryo,,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage  using TRIzol reagent Invitrogen  and were precipitated by cold isopropanol 50%  v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction  followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions.,Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C,tissue:whole embryo|Stage:24 hpf stage|cell type:embryonic cell|genotype:Mrbm24a,GSM8579724,GSM8579724: Zebrafish  RNAseq  M 24HPF 2; Danio rerio; RNA Seq,GSM8579724 r1,GSM8579724,1,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage  using TRIzol reagent Invitrogen  and were precipitated by cold isopropanol 50%  v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction  followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,SRP539223,,,M-24HPF-2_L1_1.fq.gz M-24HPF-2_L1_2.fq.gz,fastq fastq,7108870200.0,23696234.0,GSM8579724 r1,0:150 1:150,A:1938248034;C:1616546428;G:1672221476;T:1881804827;N:49435,150,150,,,1938248034,1616546428,1672221476,1881804827,49435,SRX26418802,SRS22938442,SRA1993092,Shandong university,Shandong university,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,unknown,bulk,bulk,bulk,,China,2024-10-17,Pharyngula,Embryo,Whole Organism,All anatomical structures
34042,SRR31033349,SRX26418801,SRS22938437,SRP539223,PRJNA1174207,Rbm24 dictates mRNA recruitment for germ plasm assembly,GSE279756,Transcriptome Analysis,Ribonucleoprotein RNP granules are the most common membrane less biomolecular condensates. However  the mechanisms underlying their assembly are largely unknown. The aggregation of germ plasm determines the fate of primordial germ cells PGCs and serves as a model for RNP granule assembly. Here  we show that maternal RNA binding protein Rbm24a is the key factor governing specific sorting of mRNAs. Mechanistically  Rbm24a complexes with Buc and interacts to dictate the specific grasp of germ plasm mRNAs into phase separated condensates. Germ plasm particles lacking Rbm24a and mRNAs fail to undergo kinesin dependent transport towards the cleavage furrows where small granules fuse into large aggregates. Therefore  the loss of maternal Rbm24a causes a complete degradation of germ plasm and the disappearance of PGCs. These findings demonstrate that Rbm24a functions as a nucleating organizer of the germ plasm  highlighting an emerging mechanism for RNA binding proteins in reading and recruiting RNA components into the phase separated protein scaffold. Overall design: To examine the global transcriptome alterations following the loss of maternal Rbm24a  we conducted bulk RNA seq analysis on Mrbm24a and their sibling embyos at 4 cell  sphere stage and 24 hpf.,,,,Zebrafish  RNAseq  M 24HPF 3,GSM8579725,,source name:whole embryo|tissue:whole embryo|Stage:24 hpf stage|cell type:embryonic cell|genotype:Mrbm24a|geo loc name:missing|collection date:missing,Zebrafish  RNAseq  M 24HPF 3,Each library was amplified by a 11 cycle PCR  and 150 bp paired end sequencing was subjected to Illumina HiSeq 2000 to obtain the raw data. Assembly: GRCz10 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text file includes FPKM values for each Sample,whole embryo,,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage  using TRIzol reagent Invitrogen  and were precipitated by cold isopropanol 50%  v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction  followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions.,Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C,tissue:whole embryo|Stage:24 hpf stage|cell type:embryonic cell|genotype:Mrbm24a,GSM8579725,GSM8579725: Zebrafish  RNAseq  M 24HPF 3; Danio rerio; RNA Seq,GSM8579725 r1,GSM8579725,1,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage  using TRIzol reagent Invitrogen  and were precipitated by cold isopropanol 50%  v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction  followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,SRP539223,,,M-24HPF-3_L1_1.fq.gz M-24HPF-3_L1_2.fq.gz,fastq fastq,6652426200.0,22174754.0,GSM8579725 r1,0:150 1:150,A:1801675309;C:1524819778;G:1581222646;T:1744664175;N:44292,150,150,,,1801675309,1524819778,1581222646,1744664175,44292,SRX26418801,SRS22938437,SRA1993092,Shandong university,Shandong university,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,unknown,bulk,bulk,bulk,,China,2024-10-17,Pharyngula,Embryo,Whole Organism,All anatomical structures
34043,SRR31033353,SRX26418800,SRS22938434,SRP539223,PRJNA1174207,Rbm24 dictates mRNA recruitment for germ plasm assembly,GSE279756,Transcriptome Analysis,Ribonucleoprotein RNP granules are the most common membrane less biomolecular condensates. However  the mechanisms underlying their assembly are largely unknown. The aggregation of germ plasm determines the fate of primordial germ cells PGCs and serves as a model for RNP granule assembly. Here  we show that maternal RNA binding protein Rbm24a is the key factor governing specific sorting of mRNAs. Mechanistically  Rbm24a complexes with Buc and interacts to dictate the specific grasp of germ plasm mRNAs into phase separated condensates. Germ plasm particles lacking Rbm24a and mRNAs fail to undergo kinesin dependent transport towards the cleavage furrows where small granules fuse into large aggregates. Therefore  the loss of maternal Rbm24a causes a complete degradation of germ plasm and the disappearance of PGCs. These findings demonstrate that Rbm24a functions as a nucleating organizer of the germ plasm  highlighting an emerging mechanism for RNA binding proteins in reading and recruiting RNA components into the phase separated protein scaffold. Overall design: To examine the global transcriptome alterations following the loss of maternal Rbm24a  we conducted bulk RNA seq analysis on Mrbm24a and their sibling embyos at 4 cell  sphere stage and 24 hpf.,,,,Zebrafish  RNAseq  M 24HPF 1,GSM8579723,,source name:whole embryo|tissue:whole embryo|Stage:24 hpf stage|cell type:embryonic cell|genotype:Mrbm24a|geo loc name:missing|collection date:missing,Zebrafish  RNAseq  M 24HPF 1,Each library was amplified by a 11 cycle PCR  and 150 bp paired end sequencing was subjected to Illumina HiSeq 2000 to obtain the raw data. Assembly: GRCz10 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text file includes FPKM values for each Sample,whole embryo,,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage  using TRIzol reagent Invitrogen  and were precipitated by cold isopropanol 50%  v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction  followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions.,Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C,tissue:whole embryo|Stage:24 hpf stage|cell type:embryonic cell|genotype:Mrbm24a,GSM8579723,GSM8579723: Zebrafish  RNAseq  M 24HPF 1; Danio rerio; RNA Seq,GSM8579723 r1,GSM8579723,1,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage  using TRIzol reagent Invitrogen  and were precipitated by cold isopropanol 50%  v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction  followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,SRP539223,,,M-24HPF-1_L1_1.fq.gz M-24HPF-1_L1_2.fq.gz,fastq fastq,5665772400.0,18885908.0,GSM8579723 r1,0:150 1:150,A:1531867787;C:1299623555;G:1349456236;T:1484786200;N:38622,150,150,,,1531867787,1299623555,1349456236,1484786200,38622,SRX26418800,SRS22938434,SRA1993092,Shandong university,Shandong university,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,unknown,bulk,bulk,bulk,,China,2024-10-17,Pharyngula,Embryo,Whole Organism,All anatomical structures
34050,SRR31033357,SRX26418793,SRS22938426,SRP539223,PRJNA1174207,Rbm24 dictates mRNA recruitment for germ plasm assembly,GSE279756,Transcriptome Analysis,Ribonucleoprotein RNP granules are the most common membrane less biomolecular condensates. However  the mechanisms underlying their assembly are largely unknown. The aggregation of germ plasm determines the fate of primordial germ cells PGCs and serves as a model for RNP granule assembly. Here  we show that maternal RNA binding protein Rbm24a is the key factor governing specific sorting of mRNAs. Mechanistically  Rbm24a complexes with Buc and interacts to dictate the specific grasp of germ plasm mRNAs into phase separated condensates. Germ plasm particles lacking Rbm24a and mRNAs fail to undergo kinesin dependent transport towards the cleavage furrows where small granules fuse into large aggregates. Therefore  the loss of maternal Rbm24a causes a complete degradation of germ plasm and the disappearance of PGCs. These findings demonstrate that Rbm24a functions as a nucleating organizer of the germ plasm  highlighting an emerging mechanism for RNA binding proteins in reading and recruiting RNA components into the phase separated protein scaffold. Overall design: To examine the global transcriptome alterations following the loss of maternal Rbm24a  we conducted bulk RNA seq analysis on Mrbm24a and their sibling embyos at 4 cell  sphere stage and 24 hpf.,,,,Zebrafish  RNAseq  lSibling 24HPF 5,GSM8579716,,source name:whole embryo|tissue:whole embryo|Stage:24 hpf stage|cell type:embryonic cell|genotype:wild type|geo loc name:missing|collection date:missing,Zebrafish  RNAseq  lSibling 24HPF 5,Each library was amplified by a 11 cycle PCR  and 150 bp paired end sequencing was subjected to Illumina HiSeq 2000 to obtain the raw data. Assembly: GRCz10 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text file includes FPKM values for each Sample,whole embryo,,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage  using TRIzol reagent Invitrogen  and were precipitated by cold isopropanol 50%  v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction  followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions.,Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C,tissue:whole embryo|Stage:24 hpf stage|cell type:embryonic cell|genotype:wild type,GSM8579716,GSM8579716: Zebrafish  RNAseq  lSibling 24HPF 5; Danio rerio; RNA Seq,GSM8579716 r1,GSM8579716,1,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage  using TRIzol reagent Invitrogen  and were precipitated by cold isopropanol 50%  v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction  followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,SRP539223,,,Sibling-24HPF-5_L1_1.fq.gz Sibling-24HPF-5_L1_2.fq.gz,fastq fastq,6064473600.0,20214912.0,GSM8579716 r1,0:150 1:150,A:1656555504;C:1376598854;G:1427079525;T:1604199064;N:40653,150,150,,,1656555504,1376598854,1427079525,1604199064,40653,SRX26418793,SRS22938426,SRA1993092,Shandong university,Shandong university,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,unknown,bulk,bulk,bulk,,China,2024-10-17,Pharyngula,Embryo,Whole Organism,All anatomical structures
34051,SRR31033361,SRX26418792,SRS22938432,SRP539223,PRJNA1174207,Rbm24 dictates mRNA recruitment for germ plasm assembly,GSE279756,Transcriptome Analysis,Ribonucleoprotein RNP granules are the most common membrane less biomolecular condensates. However  the mechanisms underlying their assembly are largely unknown. The aggregation of germ plasm determines the fate of primordial germ cells PGCs and serves as a model for RNP granule assembly. Here  we show that maternal RNA binding protein Rbm24a is the key factor governing specific sorting of mRNAs. Mechanistically  Rbm24a complexes with Buc and interacts to dictate the specific grasp of germ plasm mRNAs into phase separated condensates. Germ plasm particles lacking Rbm24a and mRNAs fail to undergo kinesin dependent transport towards the cleavage furrows where small granules fuse into large aggregates. Therefore  the loss of maternal Rbm24a causes a complete degradation of germ plasm and the disappearance of PGCs. These findings demonstrate that Rbm24a functions as a nucleating organizer of the germ plasm  highlighting an emerging mechanism for RNA binding proteins in reading and recruiting RNA components into the phase separated protein scaffold. Overall design: To examine the global transcriptome alterations following the loss of maternal Rbm24a  we conducted bulk RNA seq analysis on Mrbm24a and their sibling embyos at 4 cell  sphere stage and 24 hpf.,,,,Zebrafish  RNAseq  lSibling 24HPF 4,GSM8579715,,source name:whole embryo|tissue:whole embryo|Stage:24 hpf stage|cell type:embryonic cell|genotype:wild type|geo loc name:missing|collection date:missing,Zebrafish  RNAseq  lSibling 24HPF 4,Each library was amplified by a 11 cycle PCR  and 150 bp paired end sequencing was subjected to Illumina HiSeq 2000 to obtain the raw data. Assembly: GRCz10 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text file includes FPKM values for each Sample,whole embryo,,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage  using TRIzol reagent Invitrogen  and were precipitated by cold isopropanol 50%  v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction  followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions.,Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C,tissue:whole embryo|Stage:24 hpf stage|cell type:embryonic cell|genotype:wild type,GSM8579715,GSM8579715: Zebrafish  RNAseq  lSibling 24HPF 4; Danio rerio; RNA Seq,GSM8579715 r1,GSM8579715,1,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage  using TRIzol reagent Invitrogen  and were precipitated by cold isopropanol 50%  v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction  followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,SRP539223,,,Sibling-24HPF-4_L1_1.fq.gz Sibling-24HPF-4_L1_2.fq.gz,fastq fastq,7707809400.0,25692698.0,GSM8579715 r1,0:150 1:150,A:2085012024;C:1773253808;G:1833941298;T:2015550481;N:51789,150,150,,,2085012024,1773253808,1833941298,2015550481,51789,SRX26418792,SRS22938432,SRA1993092,Shandong university,Shandong university,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,unknown,bulk,bulk,bulk,,China,2024-10-17,Pharyngula,Embryo,Whole Organism,All anatomical structures
34052,SRR31033362,SRX26418791,SRS22938427,SRP539223,PRJNA1174207,Rbm24 dictates mRNA recruitment for germ plasm assembly,GSE279756,Transcriptome Analysis,Ribonucleoprotein RNP granules are the most common membrane less biomolecular condensates. However  the mechanisms underlying their assembly are largely unknown. The aggregation of germ plasm determines the fate of primordial germ cells PGCs and serves as a model for RNP granule assembly. Here  we show that maternal RNA binding protein Rbm24a is the key factor governing specific sorting of mRNAs. Mechanistically  Rbm24a complexes with Buc and interacts to dictate the specific grasp of germ plasm mRNAs into phase separated condensates. Germ plasm particles lacking Rbm24a and mRNAs fail to undergo kinesin dependent transport towards the cleavage furrows where small granules fuse into large aggregates. Therefore  the loss of maternal Rbm24a causes a complete degradation of germ plasm and the disappearance of PGCs. These findings demonstrate that Rbm24a functions as a nucleating organizer of the germ plasm  highlighting an emerging mechanism for RNA binding proteins in reading and recruiting RNA components into the phase separated protein scaffold. Overall design: To examine the global transcriptome alterations following the loss of maternal Rbm24a  we conducted bulk RNA seq analysis on Mrbm24a and their sibling embyos at 4 cell  sphere stage and 24 hpf.,,,,Zebrafish  RNAseq  lSibling 24HPF 3,GSM8579714,,source name:whole embryo|tissue:whole embryo|Stage:24 hpf stage|cell type:embryonic cell|genotype:wild type|geo loc name:missing|collection date:missing,Zebrafish  RNAseq  lSibling 24HPF 3,Each library was amplified by a 11 cycle PCR  and 150 bp paired end sequencing was subjected to Illumina HiSeq 2000 to obtain the raw data. Assembly: GRCz10 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text file includes FPKM values for each Sample,whole embryo,,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage  using TRIzol reagent Invitrogen  and were precipitated by cold isopropanol 50%  v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction  followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions.,Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C,tissue:whole embryo|Stage:24 hpf stage|cell type:embryonic cell|genotype:wild type,GSM8579714,GSM8579714: Zebrafish  RNAseq  lSibling 24HPF 3; Danio rerio; RNA Seq,GSM8579714 r1,GSM8579714,1,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage  using TRIzol reagent Invitrogen  and were precipitated by cold isopropanol 50%  v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction  followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,SRP539223,,,Sibling-24HPF-3_L1_1.fq.gz Sibling-24HPF-3_L1_2.fq.gz,fastq fastq,6177886500.0,20592955.0,GSM8579714 r1,0:150 1:150,A:1693766114;C:1396254520;G:1447264824;T:1640559782;N:41260,150,150,,,1693766114,1396254520,1447264824,1640559782,41260,SRX26418791,SRS22938427,SRA1993092,Shandong university,Shandong university,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,unknown,bulk,bulk,bulk,,China,2024-10-17,Pharyngula,Embryo,Whole Organism,All anatomical structures
36377,SRR499867,SRX148957,SRS334486,SRP013309,PRJNA167302,Transcriptomic profiles of zebrafish embryos exposed to silver nanoparticles  bulk and ions using HT SuperSAGE in a Illumina GA2 platform,GSE38125,Other,Silver nanoparticles cause toxicity in exposed organisms and are an environmental health concern. The mechanisms of silver nanoparticle toxicity  however  remain unclear. We examined the effects of exposure to silver in nano   bulk  and ionic forms on zebrafish embryos Danio rerio using a Next Generation Sequencing approach in an Illumina platform High Throughput SuperSAGE. Significant alterations in gene expression were found for all treatments and many of the gene pathways affected  most notably those associated with oxidative phosphorylation and protein synthesis  overlapped strongly between the three treatments indicating similar mechanisms of toxicity for the three forms of silver studied. Changes in oxidative phosphorylation indicated a down regulation of this pathway at 24h of exposure  but with a recovery at 48h. This finding was consistent with a dose dependent decrease in oxygen consumption at 24h  but not at 48h  following exposure to silver ions. Overall  our data provide support for the hypothesis that the toxicity caused by silver nanoparticles is principally associated with bioavailable silver ions in exposed zebrafish embryos. These findings are important in the evaluation of the risk that silver particles may pose to exposed vertebrate organisms. Overall design: mRNA profiles of whole zebrafish embryos at 24 hpf and 48 hpf exposed to silver in nano  bulk and ionic forms were generated by deep sequencing using HT SuperSAGE Illumina GA2.,,pubmed:23758687,,Dre 24h silver ions,GSM935119,,source name:Dre 24h silver ions|strain:wild type WIK strain|tissue:whole embryos|developmental stage:24 hpf|treatment:silver ions 0.25 µg/L of silver nitrate|barcode:GCTA,Dre 24h silver ions,FASTQ/A Barcode splitter from the FASTX Toolkit http://hannonlab.cshl.edu/fastx toolkit/download.html was used to separate the samples from each lane using the 4 base barcode. FASTQ to FASTA from the FASTX Toolkit was used to convert the fastq files to fasta files. FASTQ/A trimmer from the FASTX Toolkit was used to remove the barcodes the first 4 bases from the sequence. A Perl script was used to remove all bases post the last occurence of CATG NlaIII restriction site  used for sequence tag preparation in each of the sequences FASTX collapser was used to collapse the sequences and calculate the frequency of unique sequence tags unitags in each library Supplementary files format and content: tabulated text files include frequency of all unitags in the treatment library,Dre 24h silver ions,Stock solutions for Ag NP  Ag Bulk and silver nitrate were made up in ultrapure water  and sonicated for 1 h to ensure dispersal of the particles. Exposures were conducted in glass chambers  at 28+/  1°C with a 12h light: dark photoperiod. Immediately prior to the start of the exposures  glass chambers received 400 mL of ISO water  prepared according to OECD guidelines for zebrafish embryo experiments http://www.oecd.org/  containing 5 µg/L of 10nm Ag NP  5  µg/L of Ag Bulk or 0.25  µg/L of silver nitrate. A control chamber was set up containing water alone.  Solutions were replaced every 12h during the exposure period  and dead embryos were removed at the times of replacement of the exposure water. At 24h and 48h  3 pools of 50 embryos were removed from each exposure tank  immediately frozen in liquid nitrogen and stored at  80°C for analysis of gene expression. The experiment was terminated at 48 hpf.,High throughput HT SuperSAGE libraries were prepared as described in Matsumura et al 2010  PLoS ONE 58:e12010. Samples were multiplexed on each lane of the Illumina flow cell.,Adult WIK zebrafish were kept in the aquarium facilites at the University of Exeter according to the protocols described in Paull et al.  2008 Aquat Toxicol. 872:115 26. Fish were allowed to breed naturally and eggs were collected in glass egg chambers  approximately 1 hpf. Eggs were then cleaned and unfertilised embryos were removed prior to the exposures.,strain:wild type WIK strain|tissue:whole embryos|developmental stage:24 hpf|treatment:silver ions 0.25 µg/L of silver nitrate|barcode:GCTA,GSM935119,GSM935119: Dre 24h silver ions; Danio rerio; OTHER,GSM935119 1,GSM935119: Dre 24h silver ions,1,,GEO Accession:GSM935119,OTHER,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina Genome Analyzer II,<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>36</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>,SRP013309,,,Dre_24h_ag.gz,fastq,57745404.0,1604039.0,GSM935119 r1,0:36,A:11280863;C:17795869;G:15444087;T:13175334;N:49251,36,,,,11280863,17795869,15444087,13175334,49251,SRX148957,SRS334486,SRA053074,GEO,"van Aerle Lab, Biosciences, College of Life and Environmental Sciences, University of Exeter",1,0.10143,,0.00773,,0.96435,,0.60432,,36,,B,,usable mapping rate,illumina,early_illumina,unknown,other,unknown,bulk,bulk,bulk,,United Kingdom,2012-05-22,Pharyngula,Embryo,Whole Organism,All anatomical structures
36378,SRR499866,SRX148956,SRS334485,SRP013309,PRJNA167302,Transcriptomic profiles of zebrafish embryos exposed to silver nanoparticles  bulk and ions using HT SuperSAGE in a Illumina GA2 platform,GSE38125,Other,Silver nanoparticles cause toxicity in exposed organisms and are an environmental health concern. The mechanisms of silver nanoparticle toxicity  however  remain unclear. We examined the effects of exposure to silver in nano   bulk  and ionic forms on zebrafish embryos Danio rerio using a Next Generation Sequencing approach in an Illumina platform High Throughput SuperSAGE. Significant alterations in gene expression were found for all treatments and many of the gene pathways affected  most notably those associated with oxidative phosphorylation and protein synthesis  overlapped strongly between the three treatments indicating similar mechanisms of toxicity for the three forms of silver studied. Changes in oxidative phosphorylation indicated a down regulation of this pathway at 24h of exposure  but with a recovery at 48h. This finding was consistent with a dose dependent decrease in oxygen consumption at 24h  but not at 48h  following exposure to silver ions. Overall  our data provide support for the hypothesis that the toxicity caused by silver nanoparticles is principally associated with bioavailable silver ions in exposed zebrafish embryos. These findings are important in the evaluation of the risk that silver particles may pose to exposed vertebrate organisms. Overall design: mRNA profiles of whole zebrafish embryos at 24 hpf and 48 hpf exposed to silver in nano  bulk and ionic forms were generated by deep sequencing using HT SuperSAGE Illumina GA2.,,pubmed:23758687,,Dre 24h silver bulk,GSM935118,,source name:Dre 24h silver bulk|strain:wild type WIK strain|tissue:whole embryos|developmental stage:24 hpf|treatment:silver bulk 0.6 1.6µm; 5 µg/L|barcode:GCTC,Dre 24h silver bulk,FASTQ/A Barcode splitter from the FASTX Toolkit http://hannonlab.cshl.edu/fastx toolkit/download.html was used to separate the samples from each lane using the 4 base barcode. FASTQ to FASTA from the FASTX Toolkit was used to convert the fastq files to fasta files. FASTQ/A trimmer from the FASTX Toolkit was used to remove the barcodes the first 4 bases from the sequence. A Perl script was used to remove all bases post the last occurence of CATG NlaIII restriction site  used for sequence tag preparation in each of the sequences FASTX collapser was used to collapse the sequences and calculate the frequency of unique sequence tags unitags in each library Supplementary files format and content: tabulated text files include frequency of all unitags in the treatment library,Dre 24h silver bulk,Stock solutions for Ag NP  Ag Bulk and silver nitrate were made up in ultrapure water  and sonicated for 1 h to ensure dispersal of the particles. Exposures were conducted in glass chambers  at 28+/  1°C with a 12h light: dark photoperiod. Immediately prior to the start of the exposures  glass chambers received 400 mL of ISO water  prepared according to OECD guidelines for zebrafish embryo experiments http://www.oecd.org/  containing 5 µg/L of 10nm Ag NP  5  µg/L of Ag Bulk or 0.25  µg/L of silver nitrate. A control chamber was set up containing water alone.  Solutions were replaced every 12h during the exposure period  and dead embryos were removed at the times of replacement of the exposure water. At 24h and 48h  3 pools of 50 embryos were removed from each exposure tank  immediately frozen in liquid nitrogen and stored at  80°C for analysis of gene expression. The experiment was terminated at 48 hpf.,High throughput HT SuperSAGE libraries were prepared as described in Matsumura et al 2010  PLoS ONE 58:e12010. Samples were multiplexed on each lane of the Illumina flow cell.,Adult WIK zebrafish were kept in the aquarium facilites at the University of Exeter according to the protocols described in Paull et al.  2008 Aquat Toxicol. 872:115 26. Fish were allowed to breed naturally and eggs were collected in glass egg chambers  approximately 1 hpf. Eggs were then cleaned and unfertilised embryos were removed prior to the exposures.,strain:wild type WIK strain|tissue:whole embryos|developmental stage:24 hpf|treatment:silver bulk 0.6 1.6µm; 5 µg/L|barcode:GCTC,GSM935118,GSM935118: Dre 24h silver bulk; Danio rerio; OTHER,GSM935118 1,GSM935118: Dre 24h silver bulk,1,,GEO Accession:GSM935118,OTHER,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina Genome Analyzer II,<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>36</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>,SRP013309,,,Dre_24h_bulk.gz,fastq,53296632.0,1480462.0,GSM935118 r1,0:36,A:8986044;C:17367907;G:13631579;T:13181001;N:130101,36,,,,8986044,17367907,13631579,13181001,130101,SRX148956,SRS334485,SRA053074,GEO,"van Aerle Lab, Biosciences, College of Life and Environmental Sciences, University of Exeter",1,0.078,,0.00708,,0.96877,,0.4609,,36,,B,,usable mapping rate,illumina,early_illumina,unknown,other,unknown,bulk,bulk,bulk,,United Kingdom,2012-05-22,Pharyngula,Embryo,Whole Organism,All anatomical structures
36379,SRR499865,SRX148955,SRS334484,SRP013309,PRJNA167302,Transcriptomic profiles of zebrafish embryos exposed to silver nanoparticles  bulk and ions using HT SuperSAGE in a Illumina GA2 platform,GSE38125,Other,Silver nanoparticles cause toxicity in exposed organisms and are an environmental health concern. The mechanisms of silver nanoparticle toxicity  however  remain unclear. We examined the effects of exposure to silver in nano   bulk  and ionic forms on zebrafish embryos Danio rerio using a Next Generation Sequencing approach in an Illumina platform High Throughput SuperSAGE. Significant alterations in gene expression were found for all treatments and many of the gene pathways affected  most notably those associated with oxidative phosphorylation and protein synthesis  overlapped strongly between the three treatments indicating similar mechanisms of toxicity for the three forms of silver studied. Changes in oxidative phosphorylation indicated a down regulation of this pathway at 24h of exposure  but with a recovery at 48h. This finding was consistent with a dose dependent decrease in oxygen consumption at 24h  but not at 48h  following exposure to silver ions. Overall  our data provide support for the hypothesis that the toxicity caused by silver nanoparticles is principally associated with bioavailable silver ions in exposed zebrafish embryos. These findings are important in the evaluation of the risk that silver particles may pose to exposed vertebrate organisms. Overall design: mRNA profiles of whole zebrafish embryos at 24 hpf and 48 hpf exposed to silver in nano  bulk and ionic forms were generated by deep sequencing using HT SuperSAGE Illumina GA2.,,pubmed:23758687,,Dre 24h silver NP,GSM935117,,source name:Dre 24h silver NP|strain:wild type WIK strain|tissue:whole embryos|developmental stage:24 hpf|treatment:silver nanoparticles 10nm; 5µg/L|barcode:GCAG,Dre 24h silver NP,FASTQ/A Barcode splitter from the FASTX Toolkit http://hannonlab.cshl.edu/fastx toolkit/download.html was used to separate the samples from each lane using the 4 base barcode. FASTQ to FASTA from the FASTX Toolkit was used to convert the fastq files to fasta files. FASTQ/A trimmer from the FASTX Toolkit was used to remove the barcodes the first 4 bases from the sequence. A Perl script was used to remove all bases post the last occurence of CATG NlaIII restriction site  used for sequence tag preparation in each of the sequences FASTX collapser was used to collapse the sequences and calculate the frequency of unique sequence tags unitags in each library Supplementary files format and content: tabulated text files include frequency of all unitags in the treatment library,Dre 24h silver NP,Stock solutions for Ag NP  Ag Bulk and silver nitrate were made up in ultrapure water  and sonicated for 1 h to ensure dispersal of the particles. Exposures were conducted in glass chambers  at 28+/  1°C with a 12h light: dark photoperiod. Immediately prior to the start of the exposures  glass chambers received 400 mL of ISO water  prepared according to OECD guidelines for zebrafish embryo experiments http://www.oecd.org/  containing 5 µg/L of 10nm Ag NP  5  µg/L of Ag Bulk or 0.25  µg/L of silver nitrate. A control chamber was set up containing water alone.  Solutions were replaced every 12h during the exposure period  and dead embryos were removed at the times of replacement of the exposure water. At 24h and 48h  3 pools of 50 embryos were removed from each exposure tank  immediately frozen in liquid nitrogen and stored at  80°C for analysis of gene expression. The experiment was terminated at 48 hpf.,High throughput HT SuperSAGE libraries were prepared as described in Matsumura et al 2010  PLoS ONE 58:e12010. Samples were multiplexed on each lane of the Illumina flow cell.,Adult WIK zebrafish were kept in the aquarium facilites at the University of Exeter according to the protocols described in Paull et al.  2008 Aquat Toxicol. 872:115 26. Fish were allowed to breed naturally and eggs were collected in glass egg chambers  approximately 1 hpf. Eggs were then cleaned and unfertilised embryos were removed prior to the exposures.,strain:wild type WIK strain|tissue:whole embryos|developmental stage:24 hpf|treatment:silver nanoparticles 10nm; 5µg/L|barcode:GCAG,GSM935117,GSM935117: Dre 24h silver NP; Danio rerio; OTHER,GSM935117 1,GSM935117: Dre 24h silver NP,1,,GEO Accession:GSM935117,OTHER,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina Genome Analyzer II,<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>36</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>,SRP013309,,,Dre_24h_NP.gz,fastq,103827096.0,2884086.0,GSM935117 r1,0:36,A:22437552;C:29017806;G:28385826;T:23907583;N:78329,36,,,,22437552,29017806,28385826,23907583,78329,SRX148955,SRS334484,SRA053074,GEO,"van Aerle Lab, Biosciences, College of Life and Environmental Sciences, University of Exeter",1,0.16321,,0.01606,,0.94631,,0.45783,,36,,B,,usable mapping rate,illumina,early_illumina,unknown,other,unknown,bulk,bulk,bulk,,United Kingdom,2012-05-22,Pharyngula,Embryo,Whole Organism,All anatomical structures
36380,SRR499864,SRX148954,SRS334483,SRP013309,PRJNA167302,Transcriptomic profiles of zebrafish embryos exposed to silver nanoparticles  bulk and ions using HT SuperSAGE in a Illumina GA2 platform,GSE38125,Other,Silver nanoparticles cause toxicity in exposed organisms and are an environmental health concern. The mechanisms of silver nanoparticle toxicity  however  remain unclear. We examined the effects of exposure to silver in nano   bulk  and ionic forms on zebrafish embryos Danio rerio using a Next Generation Sequencing approach in an Illumina platform High Throughput SuperSAGE. Significant alterations in gene expression were found for all treatments and many of the gene pathways affected  most notably those associated with oxidative phosphorylation and protein synthesis  overlapped strongly between the three treatments indicating similar mechanisms of toxicity for the three forms of silver studied. Changes in oxidative phosphorylation indicated a down regulation of this pathway at 24h of exposure  but with a recovery at 48h. This finding was consistent with a dose dependent decrease in oxygen consumption at 24h  but not at 48h  following exposure to silver ions. Overall  our data provide support for the hypothesis that the toxicity caused by silver nanoparticles is principally associated with bioavailable silver ions in exposed zebrafish embryos. These findings are important in the evaluation of the risk that silver particles may pose to exposed vertebrate organisms. Overall design: mRNA profiles of whole zebrafish embryos at 24 hpf and 48 hpf exposed to silver in nano  bulk and ionic forms were generated by deep sequencing using HT SuperSAGE Illumina GA2.,,pubmed:23758687,,Dre 24h control,GSM935116,,source name:Dre 24h control|strain:wild type WIK strain|tissue:whole embryos|developmental stage:24 hpf|treatment:control|barcode:GCAT,Dre 24h control,FASTQ/A Barcode splitter from the FASTX Toolkit http://hannonlab.cshl.edu/fastx toolkit/download.html was used to separate the samples from each lane using the 4 base barcode. FASTQ to FASTA from the FASTX Toolkit was used to convert the fastq files to fasta files. FASTQ/A trimmer from the FASTX Toolkit was used to remove the barcodes the first 4 bases from the sequence. A Perl script was used to remove all bases post the last occurence of CATG NlaIII restriction site  used for sequence tag preparation in each of the sequences FASTX collapser was used to collapse the sequences and calculate the frequency of unique sequence tags unitags in each library Supplementary files format and content: tabulated text files include frequency of all unitags in the treatment library,Dre 24h control,Stock solutions for Ag NP  Ag Bulk and silver nitrate were made up in ultrapure water  and sonicated for 1 h to ensure dispersal of the particles. Exposures were conducted in glass chambers  at 28+/  1°C with a 12h light: dark photoperiod. Immediately prior to the start of the exposures  glass chambers received 400 mL of ISO water  prepared according to OECD guidelines for zebrafish embryo experiments http://www.oecd.org/  containing 5 µg/L of 10nm Ag NP  5  µg/L of Ag Bulk or 0.25  µg/L of silver nitrate. A control chamber was set up containing water alone.  Solutions were replaced every 12h during the exposure period  and dead embryos were removed at the times of replacement of the exposure water. At 24h and 48h  3 pools of 50 embryos were removed from each exposure tank  immediately frozen in liquid nitrogen and stored at  80°C for analysis of gene expression. The experiment was terminated at 48 hpf.,High throughput HT SuperSAGE libraries were prepared as described in Matsumura et al 2010  PLoS ONE 58:e12010. Samples were multiplexed on each lane of the Illumina flow cell.,Adult WIK zebrafish were kept in the aquarium facilites at the University of Exeter according to the protocols described in Paull et al.  2008 Aquat Toxicol. 872:115 26. Fish were allowed to breed naturally and eggs were collected in glass egg chambers  approximately 1 hpf. Eggs were then cleaned and unfertilised embryos were removed prior to the exposures.,strain:wild type WIK strain|tissue:whole embryos|developmental stage:24 hpf|treatment:control|barcode:GCAT,GSM935116,GSM935116: Dre 24h control; Danio rerio; OTHER,GSM935116 1,GSM935116: Dre 24h control,1,,GEO Accession:GSM935116,OTHER,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina Genome Analyzer II,<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>36</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>,SRP013309,,,Dre_24h_control.gz,fastq,85032468.0,2362013.0,GSM935116 r1,0:36,A:16524315;C:24822030;G:21632275;T:21837611;N:216237,36,,,,16524315,24822030,21632275,21837611,216237,SRX148954,SRS334483,SRA053074,GEO,"van Aerle Lab, Biosciences, College of Life and Environmental Sciences, University of Exeter",1,0.13983,,0.01175,,0.95966,,0.52467,,36,,B,,usable mapping rate,illumina,early_illumina,unknown,other,unknown,bulk,bulk,bulk,,United Kingdom,2012-05-22,Pharyngula,Embryo,Whole Organism,All anatomical structures
36641,SRR700539,SRX233125,SRS393099,SRP018538,PRJNA189226,Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos,GSE44233,Transcriptome Analysis,The Gata4 transcription factor is essential for normal heart development  but the molecular basis for its function remain poorly understood.  We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos.  Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited.  Three replicate control samples and three replicate Gata4 morphant samples were analyzed.,,pubmed:23850773,,Seq15,GSM1081113,,tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant,Seq15,Basecalls  demultiplexing  and filtering of reads was  performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb  version: development 20110921150240 with the following parameters: Ambiguity threshold = 1  Max Number Gap Opens = 1  Max Number Gap Extensions =  1. Differential expression was generated with the DESEQ package with native goby support using gobyweb  version: development 20110921150240 with the following parameters: q value threshold = 1.0  weight adjustment = none  Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1  a log2 fold change > 1 for WT/G4  and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb  version: development20110921150240.  Additional supplementary .xlsx file containing RPKM  counts  and statistical values was exported from gobyweb and processed in excel.,sorted cardiomyocytes,Embryos were injected with morpholino before the 4 cell stage of development.  2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo.  At 24 hpf  batches of approximately 200 embryos were pooled into 1.5 ml tube.  Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube  trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS  0.8mM CaCl2  50U/ml penicillin  and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies  and stored at  80C until RNA isolation.,RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase  the solution was transferred to an RNeasy minElute column Qiagen.  On column DNase digestion  subsequent washing  and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries.  Libraries were prepared for RNA sequencing using the mRNA Seq seq1  seq5  and seq11 or TruSeq Kit seq13  seq14  and seq15 according to the Illumina's recommended protocol.,Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes.  25 ml of E3 buffer was used per 50 60 embryos in each dish.,developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant,GSM1081113,GSM1081113: Seq15; Danio rerio; RNA Seq,GSM1081113 1,,1,,GEO Accession:GSM1081113,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP018538,,,,,1505008521.0,29509971.0,GSM1081113 r1,0:51,A:394410844;C:370013758;G:356489603;T:384055071;N:39245,51,,,,394410844,370013758,356489603,384055071,39245,SRX233125,SRS393099,SRA066447,GEO,"Todd Evans Lab, Cell and Developmental Biology, Weill Cornell",1,0.9123,,0.07373,,0.71346,,0.47555,,51,,B,,usable mapping rate,illumina,hiseq_era,full_length,random_priming,trueseq,bulk,bulk,bulk,,United States,2013-02-11,Pharyngula,Embryo,Heart,Cardiovascular System
36642,SRR700538,SRX233124,SRS393098,SRP018538,PRJNA189226,Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos,GSE44233,Transcriptome Analysis,The Gata4 transcription factor is essential for normal heart development  but the molecular basis for its function remain poorly understood.  We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos.  Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited.  Three replicate control samples and three replicate Gata4 morphant samples were analyzed.,,pubmed:23850773,,Seq14,GSM1081112,,tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant,Seq14,Basecalls  demultiplexing  and filtering of reads was  performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb  version: development 20110921150240 with the following parameters: Ambiguity threshold = 1  Max Number Gap Opens = 1  Max Number Gap Extensions =  1. Differential expression was generated with the DESEQ package with native goby support using gobyweb  version: development 20110921150240 with the following parameters: q value threshold = 1.0  weight adjustment = none  Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1  a log2 fold change > 1 for WT/G4  and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb  version: development20110921150240.  Additional supplementary .xlsx file containing RPKM  counts  and statistical values was exported from gobyweb and processed in excel.,sorted cardiomyocytes,Embryos were injected with morpholino before the 4 cell stage of development.  2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo.  At 24 hpf  batches of approximately 200 embryos were pooled into 1.5 ml tube.  Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube  trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS  0.8mM CaCl2  50U/ml penicillin  and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies  and stored at  80C until RNA isolation.,RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase  the solution was transferred to an RNeasy minElute column Qiagen.  On column DNase digestion  subsequent washing  and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries.  Libraries were prepared for RNA sequencing using the mRNA Seq seq1  seq5  and seq11 or TruSeq Kit seq13  seq14  and seq15 according to the Illumina's recommended protocol.,Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes.  25 ml of E3 buffer was used per 50 60 embryos in each dish.,developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant,GSM1081112,GSM1081112: Seq14; Danio rerio; RNA Seq,GSM1081112 1,,1,,GEO Accession:GSM1081112,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP018538,,,seq14.txt.gz,fastq,3144425502.0,61655402.0,GSM1081112 r1,0:51,A:825172912;C:756354008;G:742919584;T:819897573;N:81425,51,,,,825172912,756354008,742919584,819897573,81425,SRX233124,SRS393098,SRA066447,GEO,"Todd Evans Lab, Cell and Developmental Biology, Weill Cornell",1,0.93659,,0.0806,,0.73716,,0.47614,,51,,B,,usable mapping rate,illumina,hiseq_era,full_length,random_priming,trueseq,bulk,bulk,bulk,,United States,2013-02-11,Pharyngula,Embryo,Heart,Cardiovascular System
36643,SRR700537,SRX233123,SRS393097,SRP018538,PRJNA189226,Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos,GSE44233,Transcriptome Analysis,The Gata4 transcription factor is essential for normal heart development  but the molecular basis for its function remain poorly understood.  We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos.  Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited.  Three replicate control samples and three replicate Gata4 morphant samples were analyzed.,,pubmed:23850773,,Seq11,GSM1081111,,tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant,Seq11,Basecalls  demultiplexing  and filtering of reads was  performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb  version: development 20110921150240 with the following parameters: Ambiguity threshold = 1  Max Number Gap Opens = 1  Max Number Gap Extensions =  1. Differential expression was generated with the DESEQ package with native goby support using gobyweb  version: development 20110921150240 with the following parameters: q value threshold = 1.0  weight adjustment = none  Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1  a log2 fold change > 1 for WT/G4  and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb  version: development20110921150240.  Additional supplementary .xlsx file containing RPKM  counts  and statistical values was exported from gobyweb and processed in excel.,sorted cardiomyocytes,Embryos were injected with morpholino before the 4 cell stage of development.  2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo.  At 24 hpf  batches of approximately 200 embryos were pooled into 1.5 ml tube.  Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube  trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS  0.8mM CaCl2  50U/ml penicillin  and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies  and stored at  80C until RNA isolation.,RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase  the solution was transferred to an RNeasy minElute column Qiagen.  On column DNase digestion  subsequent washing  and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries.  Libraries were prepared for RNA sequencing using the mRNA Seq seq1  seq5  and seq11 or TruSeq Kit seq13  seq14  and seq15 according to the Illumina's recommended protocol.,Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes.  25 ml of E3 buffer was used per 50 60 embryos in each dish.,developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant,GSM1081111,GSM1081111: Seq11; Danio rerio; RNA Seq,GSM1081111 1,,1,,GEO Accession:GSM1081111,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina Genome Analyzer II,,SRP018538,,,,,1364181264.0,37893924.0,GSM1081111 r1,0:36,A:362442341;C:297159061;G:406723961;T:297355968;N:499933,36,,,,362442341,297159061,406723961,297355968,499933,SRX233123,SRS393097,SRA066447,GEO,"Todd Evans Lab, Cell and Developmental Biology, Weill Cornell",1,0.67174,,0.07612,,0.74416,,0.48016,,36,,B,,usable mapping rate,illumina,early_illumina,full_length,random_priming,trueseq,bulk,bulk,bulk,,United States,2013-02-11,Pharyngula,Embryo,Heart,Cardiovascular System
36644,SRR700536,SRX233122,SRS393096,SRP018538,PRJNA189226,Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos,GSE44233,Transcriptome Analysis,The Gata4 transcription factor is essential for normal heart development  but the molecular basis for its function remain poorly understood.  We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos.  Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited.  Three replicate control samples and three replicate Gata4 morphant samples were analyzed.,,pubmed:23850773,,Seq13,GSM1081110,,tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype,Seq13,Basecalls  demultiplexing  and filtering of reads was  performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb  version: development 20110921150240 with the following parameters: Ambiguity threshold = 1  Max Number Gap Opens = 1  Max Number Gap Extensions =  1. Differential expression was generated with the DESEQ package with native goby support using gobyweb  version: development 20110921150240 with the following parameters: q value threshold = 1.0  weight adjustment = none  Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1  a log2 fold change > 1 for WT/G4  and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb  version: development20110921150240.  Additional supplementary .xlsx file containing RPKM  counts  and statistical values was exported from gobyweb and processed in excel.,sorted cardiomyocytes,Embryos were injected with morpholino before the 4 cell stage of development.  2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo.  At 24 hpf  batches of approximately 200 embryos were pooled into 1.5 ml tube.  Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube  trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS  0.8mM CaCl2  50U/ml penicillin  and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies  and stored at  80C until RNA isolation.,RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase  the solution was transferred to an RNeasy minElute column Qiagen.  On column DNase digestion  subsequent washing  and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries.  Libraries were prepared for RNA sequencing using the mRNA Seq seq1  seq5  and seq11 or TruSeq Kit seq13  seq14  and seq15 according to the Illumina's recommended protocol.,Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes.  25 ml of E3 buffer was used per 50 60 embryos in each dish.,developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype,GSM1081110,GSM1081110: Seq13; Danio rerio; RNA Seq,GSM1081110 1,,1,,GEO Accession:GSM1081110,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP018538,,,seq13.txt.gz,fastq,1693675269.0,33209319.0,GSM1081110 r1,0:51,A:443719209;C:411369010;G:404182982;T:434361031;N:43037,51,,,,443719209,411369010,404182982,434361031,43037,SRX233122,SRS393096,SRA066447,GEO,"Todd Evans Lab, Cell and Developmental Biology, Weill Cornell",1,0.91781,,0.08107,,0.74976,,0.46528,,51,,B,,usable mapping rate,illumina,hiseq_era,full_length,random_priming,trueseq,bulk,bulk,bulk,,United States,2013-02-11,Pharyngula,Embryo,Heart,Cardiovascular System
36645,SRR700535,SRX233121,SRS393095,SRP018538,PRJNA189226,Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos,GSE44233,Transcriptome Analysis,The Gata4 transcription factor is essential for normal heart development  but the molecular basis for its function remain poorly understood.  We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos.  Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited.  Three replicate control samples and three replicate Gata4 morphant samples were analyzed.,,pubmed:23850773,,Seq5,GSM1081109,,tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype,Seq5,Basecalls  demultiplexing  and filtering of reads was  performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb  version: development 20110921150240 with the following parameters: Ambiguity threshold = 1  Max Number Gap Opens = 1  Max Number Gap Extensions =  1. Differential expression was generated with the DESEQ package with native goby support using gobyweb  version: development 20110921150240 with the following parameters: q value threshold = 1.0  weight adjustment = none  Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1  a log2 fold change > 1 for WT/G4  and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb  version: development20110921150240.  Additional supplementary .xlsx file containing RPKM  counts  and statistical values was exported from gobyweb and processed in excel.,sorted cardiomyocytes,Embryos were injected with morpholino before the 4 cell stage of development.  2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo.  At 24 hpf  batches of approximately 200 embryos were pooled into 1.5 ml tube.  Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube  trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS  0.8mM CaCl2  50U/ml penicillin  and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies  and stored at  80C until RNA isolation.,RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase  the solution was transferred to an RNeasy minElute column Qiagen.  On column DNase digestion  subsequent washing  and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries.  Libraries were prepared for RNA sequencing using the mRNA Seq seq1  seq5  and seq11 or TruSeq Kit seq13  seq14  and seq15 according to the Illumina's recommended protocol.,Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes.  25 ml of E3 buffer was used per 50 60 embryos in each dish.,developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype,GSM1081109,GSM1081109: Seq5; Danio rerio; RNA Seq,GSM1081109 1,,1,,GEO Accession:GSM1081109,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina Genome Analyzer II,,SRP018538,,,seq5.txt.gz,fastq,1245644280.0,34601230.0,GSM1081109 r1,0:36,A:334131135;C:287707996;G:288492153;T:334895459;N:417537,36,,,,334131135,287707996,288492153,334895459,417537,SRX233121,SRS393095,SRA066447,GEO,"Todd Evans Lab, Cell and Developmental Biology, Weill Cornell",1,0.89495,,0.1058,,0.74247,,0.46422,,36,,B,,usable mapping rate,illumina,early_illumina,full_length,random_priming,trueseq,bulk,bulk,bulk,,United States,2013-02-11,Pharyngula,Embryo,Heart,Cardiovascular System
36646,SRR700534,SRX233120,SRS393094,SRP018538,PRJNA189226,Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos,GSE44233,Transcriptome Analysis,The Gata4 transcription factor is essential for normal heart development  but the molecular basis for its function remain poorly understood.  We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos.  Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited.  Three replicate control samples and three replicate Gata4 morphant samples were analyzed.,,pubmed:23850773,,Seq1,GSM1081108,,tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype,Seq1,Basecalls  demultiplexing  and filtering of reads was  performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb  version: development 20110921150240 with the following parameters: Ambiguity threshold = 1  Max Number Gap Opens = 1  Max Number Gap Extensions =  1. Differential expression was generated with the DESEQ package with native goby support using gobyweb  version: development 20110921150240 with the following parameters: q value threshold = 1.0  weight adjustment = none  Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1  a log2 fold change > 1 for WT/G4  and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb  version: development20110921150240.  Additional supplementary .xlsx file containing RPKM  counts  and statistical values was exported from gobyweb and processed in excel.,sorted cardiomyocytes,Embryos were injected with morpholino before the 4 cell stage of development.  2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo.  At 24 hpf  batches of approximately 200 embryos were pooled into 1.5 ml tube.  Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube  trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS  0.8mM CaCl2  50U/ml penicillin  and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies  and stored at  80C until RNA isolation.,RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase  the solution was transferred to an RNeasy minElute column Qiagen.  On column DNase digestion  subsequent washing  and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries.  Libraries were prepared for RNA sequencing using the mRNA Seq seq1  seq5  and seq11 or TruSeq Kit seq13  seq14  and seq15 according to the Illumina's recommended protocol.,Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes.  25 ml of E3 buffer was used per 50 60 embryos in each dish.,developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype,GSM1081108,GSM1081108: Seq1; Danio rerio; RNA Seq,GSM1081108 1,,1,,GEO Accession:GSM1081108,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina Genome Analyzer II,,SRP018538,,,seq1.txt.gz,fastq,929284704.0,25813464.0,GSM1081108 r1,0:36,A:244730361;C:220466820;G:213037296;T:250386569;N:663658,36,,,,244730361,220466820,213037296,250386569,663658,SRX233120,SRS393094,SRA066447,GEO,"Todd Evans Lab, Cell and Developmental Biology, Weill Cornell",1,0.87436,,0.11629,,0.73302,,0.46999,,36,,B,,usable mapping rate,illumina,early_illumina,full_length,random_priming,trueseq,bulk,bulk,bulk,,United States,2013-02-11,Pharyngula,Embryo,Heart,Cardiovascular System
39771,SRR2136297,SRX1125768,SRS1017739,SRP061855,PRJNA291531,Identification of qkia/c target genes,GSE71573,Transcriptome Analysis,Quaking are RNA binding proteins  which are known to regulate the expression of different genes at the post transcriptional level. Genetic interference with quaking a qkia and quaking c qkic leads to major myofibril defects during zebrafish development  without xxx early muscle differentiation. In order to understand how qkia and qkic jointly regulate myofibril formation  we performed a comparative analysis of the transcriptome of qkia/qkic qkia mutant injected with qkic morpholino versus control embryos. We show that Quaking activity is required for accumulation of the muscle specific tropomyosin 3 transcript  tpm3.1. Whereas interference with tmp3.1 function disrupts myofibril formation  reintroducing tpm3.1 transcripts into embryos with reduced Quaking activity can restore structured myofibrils. Thus  we identify tropomyosin as an essential component in the process of myofibril formation and as a relay downstream of the regulator proteins Quaking. Overall design: Transcriptome of control versus qkia/qkic embryos at 24 26hpf. Biological triplicate were prepared for both condition 3x2 samples.,,pubmed:28867488,,Qkiac 3,GSM1838798,,tissue:trunk|Stage:embryo 24 26hpf|genotype:qkia / |injection:qkic morpholino,Qkiac 3,Before mapping  poly N read tails were trimmed  reads ≤40 bases were removed  and reads with quality mean ≤30 were discarded. To obtain the counts on the exon features  reads were then aligned against the genome using Bowtie version 0.12.9 with arguments  n 2  l 34  e 70  k 2   best. To obtain the counts on the gene features  reads were then aligned against the genome using STAR version 2.4.0j and Ensembl annotation v78. Alignments from reads matching more than once on the reference genome were removed using Java version of samtools. To compute gene expression  Danio rerio Zv9 GFF3 genome annotation version 78 from Ensembl database was used. All overlapping regions between alignments and referenced exons were counted using HTSeq count 0.5.3. To obtain the counts on the exon features  we used the bowtie alignments  excluding the junction reads. HTSeq count was used with arguments: genomictype=exon  attributeid=Name  stranded=no  overlapmode=union  removeambiguouscases=false. To obtain the counts on the gene features  we used the STAR alignments  including the junction reads. HTSeq count was used with arguments: genomictype=exon  stranded=no  overlapmode=union  removeambiguouscases=false and attributeid=Alias where Alias was the corresponding parent gene ID. The sample counts were normalized using DESeq 1.8.3. Statistical treatments and differential analyses were also performed using DESeq 1.8.3 with arguments: disp.est.method=pooled  disp.est.sharing.mode=maximum  disp.est.fit.type=parametric Genome build: Danio rerio Zv9 Supplementary files format and content: tab delimited text files include normalized reads counts for each Sample using DESeq 1.8.3 with arguments: disp.est.method=pooled  disp.est.sharing.mode=maximum  disp.est.fit.type=parametric.,trunk,Zebrafish trunks at 24 26hpf were dissected removal of head and yolk  flash frozen on dry ice and stored at  80°C until RNA extraction.,total RNA was extracted using the RNeasy Plus Universal Mini kit Qiagen and treated with Dnase. Messenger polyA+ RNAs were purified from 0.7 µg of total RNA using oligodT. Libraries were prepared using the strand non specific RNA Seq library preparation TruSeq RNA Sample Prep v2 kit Illumina. Libraries were multiplexed by 6 on 2 flowcell lanes. A 50 bp read sequencing was performed on a HiSeq 1500 device Illumina. A mean of 27459238  ± 1611623 million passing Illumina quality filter reads was obtained for each of the 6 samples.,Embryos resulting from crossing between qkia+/  fish were injected at a cell stage with qkic morpholino or control morpholino 0 6pmol. We let them develop until 24 26hpf  stage where we could morphologically identify control embryos sibling qkia+/+ or qkia+/  with control morpholino and double qkia/c loss of function embryos qkia /  with qkic morpholino.,Stage:embryo 24 26hpf|genotype:qkia / |injection:qkic morpholino,GSM1838798,GSM1838798: Qkiac 3; Danio rerio; RNA Seq,GSM1838798,,1,total RNA was extracted using the RNeasy Plus Universal Mini kit Qiagen and treated with Dnase. Messenger polyA+ RNAs were purified from 0.7 µg of total RNA using oligodT. Libraries were prepared using the strand non specific RNA Seq library preparation TruSeq RNA Sample Prep v2 kit Illumina. Libraries were multiplexed by 6 on 2 flowcell lanes. A 50 bp read sequencing was performed on a HiSeq 1500 device Illumina. A mean of 27459238  ± 1611623 million passing Illumina quality filter reads was obtained for each of the 6 samples.,GEO Accession:GSM1838798,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 1500,,SRP061855,,,Sample6_CTTGTA.fastq.bz2,fastq,2507001849.0,49156899.0,GSM1838798 r1,0:51,A:683306529;C:570965534;G:570449436;T:679826815;N:2453535,51,,,,683306529,570965534,570449436,679826815,2453535,SRX1125768,SRS1017739,SRA281148,GEO,"Plateforme transcriptome, Biologie, Ecole Normale Supérieure",1,0.92678,,0.08779,,0.72892,,0.48795,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,bulk,bulk,,France,2015-07-30,Pharyngula,Embryo,Trunk,Surface Structure
39772,SRR2136296,SRX1125767,SRS1017740,SRP061855,PRJNA291531,Identification of qkia/c target genes,GSE71573,Transcriptome Analysis,Quaking are RNA binding proteins  which are known to regulate the expression of different genes at the post transcriptional level. Genetic interference with quaking a qkia and quaking c qkic leads to major myofibril defects during zebrafish development  without xxx early muscle differentiation. In order to understand how qkia and qkic jointly regulate myofibril formation  we performed a comparative analysis of the transcriptome of qkia/qkic qkia mutant injected with qkic morpholino versus control embryos. We show that Quaking activity is required for accumulation of the muscle specific tropomyosin 3 transcript  tpm3.1. Whereas interference with tmp3.1 function disrupts myofibril formation  reintroducing tpm3.1 transcripts into embryos with reduced Quaking activity can restore structured myofibrils. Thus  we identify tropomyosin as an essential component in the process of myofibril formation and as a relay downstream of the regulator proteins Quaking. Overall design: Transcriptome of control versus qkia/qkic embryos at 24 26hpf. Biological triplicate were prepared for both condition 3x2 samples.,,pubmed:28867488,,Qkiac 2,GSM1838797,,tissue:trunk|Stage:embryo 24 26hpf|genotype:qkia / |injection:qkic morpholino,Qkiac 2,Before mapping  poly N read tails were trimmed  reads ≤40 bases were removed  and reads with quality mean ≤30 were discarded. To obtain the counts on the exon features  reads were then aligned against the genome using Bowtie version 0.12.9 with arguments  n 2  l 34  e 70  k 2   best. To obtain the counts on the gene features  reads were then aligned against the genome using STAR version 2.4.0j and Ensembl annotation v78. Alignments from reads matching more than once on the reference genome were removed using Java version of samtools. To compute gene expression  Danio rerio Zv9 GFF3 genome annotation version 78 from Ensembl database was used. All overlapping regions between alignments and referenced exons were counted using HTSeq count 0.5.3. To obtain the counts on the exon features  we used the bowtie alignments  excluding the junction reads. HTSeq count was used with arguments: genomictype=exon  attributeid=Name  stranded=no  overlapmode=union  removeambiguouscases=false. To obtain the counts on the gene features  we used the STAR alignments  including the junction reads. HTSeq count was used with arguments: genomictype=exon  stranded=no  overlapmode=union  removeambiguouscases=false and attributeid=Alias where Alias was the corresponding parent gene ID. The sample counts were normalized using DESeq 1.8.3. Statistical treatments and differential analyses were also performed using DESeq 1.8.3 with arguments: disp.est.method=pooled  disp.est.sharing.mode=maximum  disp.est.fit.type=parametric Genome build: Danio rerio Zv9 Supplementary files format and content: tab delimited text files include normalized reads counts for each Sample using DESeq 1.8.3 with arguments: disp.est.method=pooled  disp.est.sharing.mode=maximum  disp.est.fit.type=parametric.,trunk,Zebrafish trunks at 24 26hpf were dissected removal of head and yolk  flash frozen on dry ice and stored at  80°C until RNA extraction.,total RNA was extracted using the RNeasy Plus Universal Mini kit Qiagen and treated with Dnase. Messenger polyA+ RNAs were purified from 0.7 µg of total RNA using oligodT. Libraries were prepared using the strand non specific RNA Seq library preparation TruSeq RNA Sample Prep v2 kit Illumina. Libraries were multiplexed by 6 on 2 flowcell lanes. A 50 bp read sequencing was performed on a HiSeq 1500 device Illumina. A mean of 27459238  ± 1611623 million passing Illumina quality filter reads was obtained for each of the 6 samples.,Embryos resulting from crossing between qkia+/  fish were injected at a cell stage with qkic morpholino or control morpholino 0 6pmol. We let them develop until 24 26hpf  stage where we could morphologically identify control embryos sibling qkia+/+ or qkia+/  with control morpholino and double qkia/c loss of function embryos qkia /  with qkic morpholino.,Stage:embryo 24 26hpf|genotype:qkia / |injection:qkic morpholino,GSM1838797,GSM1838797: Qkiac 2; Danio rerio; RNA Seq,GSM1838797,,1,total RNA was extracted using the RNeasy Plus Universal Mini kit Qiagen and treated with Dnase. Messenger polyA+ RNAs were purified from 0.7 µg of total RNA using oligodT. Libraries were prepared using the strand non specific RNA Seq library preparation TruSeq RNA Sample Prep v2 kit Illumina. Libraries were multiplexed by 6 on 2 flowcell lanes. A 50 bp read sequencing was performed on a HiSeq 1500 device Illumina. A mean of 27459238  ± 1611623 million passing Illumina quality filter reads was obtained for each of the 6 samples.,GEO Accession:GSM1838797,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 1500,,SRP061855,,,Sample5_CAGATC.fastq.bz2,fastq,2850272086.0,55887688.0,GSM1838797 r1,0:51.00,A:775475703;C:648531668;G:652753738;T:770730439;N:2780538,51,,,,775475703,648531668,652753738,770730439,2780538,SRX1125767,SRS1017740,SRA281148,GEO,"Plateforme transcriptome, Biologie, Ecole Normale Supérieure",1,0.92802,,0.08465,,0.72744,,0.48656,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,bulk,bulk,,France,2015-07-30,Pharyngula,Embryo,Trunk,Surface Structure
39773,SRR2136295,SRX1125766,SRS1017741,SRP061855,PRJNA291531,Identification of qkia/c target genes,GSE71573,Transcriptome Analysis,Quaking are RNA binding proteins  which are known to regulate the expression of different genes at the post transcriptional level. Genetic interference with quaking a qkia and quaking c qkic leads to major myofibril defects during zebrafish development  without xxx early muscle differentiation. In order to understand how qkia and qkic jointly regulate myofibril formation  we performed a comparative analysis of the transcriptome of qkia/qkic qkia mutant injected with qkic morpholino versus control embryos. We show that Quaking activity is required for accumulation of the muscle specific tropomyosin 3 transcript  tpm3.1. Whereas interference with tmp3.1 function disrupts myofibril formation  reintroducing tpm3.1 transcripts into embryos with reduced Quaking activity can restore structured myofibrils. Thus  we identify tropomyosin as an essential component in the process of myofibril formation and as a relay downstream of the regulator proteins Quaking. Overall design: Transcriptome of control versus qkia/qkic embryos at 24 26hpf. Biological triplicate were prepared for both condition 3x2 samples.,,pubmed:28867488,,Qkiac 1,GSM1838796,,tissue:trunk|Stage:embryo 24 26hpf|genotype:qkia / |injection:qkic morpholino,Qkiac 1,Before mapping  poly N read tails were trimmed  reads ≤40 bases were removed  and reads with quality mean ≤30 were discarded. To obtain the counts on the exon features  reads were then aligned against the genome using Bowtie version 0.12.9 with arguments  n 2  l 34  e 70  k 2   best. To obtain the counts on the gene features  reads were then aligned against the genome using STAR version 2.4.0j and Ensembl annotation v78. Alignments from reads matching more than once on the reference genome were removed using Java version of samtools. To compute gene expression  Danio rerio Zv9 GFF3 genome annotation version 78 from Ensembl database was used. All overlapping regions between alignments and referenced exons were counted using HTSeq count 0.5.3. To obtain the counts on the exon features  we used the bowtie alignments  excluding the junction reads. HTSeq count was used with arguments: genomictype=exon  attributeid=Name  stranded=no  overlapmode=union  removeambiguouscases=false. To obtain the counts on the gene features  we used the STAR alignments  including the junction reads. HTSeq count was used with arguments: genomictype=exon  stranded=no  overlapmode=union  removeambiguouscases=false and attributeid=Alias where Alias was the corresponding parent gene ID. The sample counts were normalized using DESeq 1.8.3. Statistical treatments and differential analyses were also performed using DESeq 1.8.3 with arguments: disp.est.method=pooled  disp.est.sharing.mode=maximum  disp.est.fit.type=parametric Genome build: Danio rerio Zv9 Supplementary files format and content: tab delimited text files include normalized reads counts for each Sample using DESeq 1.8.3 with arguments: disp.est.method=pooled  disp.est.sharing.mode=maximum  disp.est.fit.type=parametric.,trunk,Zebrafish trunks at 24 26hpf were dissected removal of head and yolk  flash frozen on dry ice and stored at  80°C until RNA extraction.,total RNA was extracted using the RNeasy Plus Universal Mini kit Qiagen and treated with Dnase. Messenger polyA+ RNAs were purified from 0.7 µg of total RNA using oligodT. Libraries were prepared using the strand non specific RNA Seq library preparation TruSeq RNA Sample Prep v2 kit Illumina. Libraries were multiplexed by 6 on 2 flowcell lanes. A 50 bp read sequencing was performed on a HiSeq 1500 device Illumina. A mean of 27459238  ± 1611623 million passing Illumina quality filter reads was obtained for each of the 6 samples.,Embryos resulting from crossing between qkia+/  fish were injected at a cell stage with qkic morpholino or control morpholino 0 6pmol. We let them develop until 24 26hpf  stage where we could morphologically identify control embryos sibling qkia+/+ or qkia+/  with control morpholino and double qkia/c loss of function embryos qkia /  with qkic morpholino.,Stage:embryo 24 26hpf|genotype:qkia / |injection:qkic morpholino,GSM1838796,GSM1838796: Qkiac 1; Danio rerio; RNA Seq,GSM1838796,,1,total RNA was extracted using the RNeasy Plus Universal Mini kit Qiagen and treated with Dnase. Messenger polyA+ RNAs were purified from 0.7 µg of total RNA using oligodT. Libraries were prepared using the strand non specific RNA Seq library preparation TruSeq RNA Sample Prep v2 kit Illumina. Libraries were multiplexed by 6 on 2 flowcell lanes. A 50 bp read sequencing was performed on a HiSeq 1500 device Illumina. A mean of 27459238  ± 1611623 million passing Illumina quality filter reads was obtained for each of the 6 samples.,GEO Accession:GSM1838796,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 1500,,SRP061855,,,Sample4_GCCAAT.fastq.bz2,fastq,2881827420.0,56506420.0,GSM1838796 r1,0:51,A:782512581;C:658453854;G:659856487;T:778195522;N:2808976,51,,,,782512581,658453854,659856487,778195522,2808976,SRX1125766,SRS1017741,SRA281148,GEO,"Plateforme transcriptome, Biologie, Ecole Normale Supérieure",1,0.92629,,0.08316,,0.7276,,0.47801,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,bulk,bulk,,France,2015-07-30,Pharyngula,Embryo,Trunk,Surface Structure
39774,SRR2136294,SRX1125765,SRS1017742,SRP061855,PRJNA291531,Identification of qkia/c target genes,GSE71573,Transcriptome Analysis,Quaking are RNA binding proteins  which are known to regulate the expression of different genes at the post transcriptional level. Genetic interference with quaking a qkia and quaking c qkic leads to major myofibril defects during zebrafish development  without xxx early muscle differentiation. In order to understand how qkia and qkic jointly regulate myofibril formation  we performed a comparative analysis of the transcriptome of qkia/qkic qkia mutant injected with qkic morpholino versus control embryos. We show that Quaking activity is required for accumulation of the muscle specific tropomyosin 3 transcript  tpm3.1. Whereas interference with tmp3.1 function disrupts myofibril formation  reintroducing tpm3.1 transcripts into embryos with reduced Quaking activity can restore structured myofibrils. Thus  we identify tropomyosin as an essential component in the process of myofibril formation and as a relay downstream of the regulator proteins Quaking. Overall design: Transcriptome of control versus qkia/qkic embryos at 24 26hpf. Biological triplicate were prepared for both condition 3x2 samples.,,pubmed:28867488,,Control 3,GSM1838795,,tissue:trunk|Stage:embryo 24 26hpf|genotype:qkia+/+ or qkia+/ |injection:control morpholino,Control 3,Before mapping  poly N read tails were trimmed  reads ≤40 bases were removed  and reads with quality mean ≤30 were discarded. To obtain the counts on the exon features  reads were then aligned against the genome using Bowtie version 0.12.9 with arguments  n 2  l 34  e 70  k 2   best. To obtain the counts on the gene features  reads were then aligned against the genome using STAR version 2.4.0j and Ensembl annotation v78. Alignments from reads matching more than once on the reference genome were removed using Java version of samtools. To compute gene expression  Danio rerio Zv9 GFF3 genome annotation version 78 from Ensembl database was used. All overlapping regions between alignments and referenced exons were counted using HTSeq count 0.5.3. To obtain the counts on the exon features  we used the bowtie alignments  excluding the junction reads. HTSeq count was used with arguments: genomictype=exon  attributeid=Name  stranded=no  overlapmode=union  removeambiguouscases=false. To obtain the counts on the gene features  we used the STAR alignments  including the junction reads. HTSeq count was used with arguments: genomictype=exon  stranded=no  overlapmode=union  removeambiguouscases=false and attributeid=Alias where Alias was the corresponding parent gene ID. The sample counts were normalized using DESeq 1.8.3. Statistical treatments and differential analyses were also performed using DESeq 1.8.3 with arguments: disp.est.method=pooled  disp.est.sharing.mode=maximum  disp.est.fit.type=parametric Genome build: Danio rerio Zv9 Supplementary files format and content: tab delimited text files include normalized reads counts for each Sample using DESeq 1.8.3 with arguments: disp.est.method=pooled  disp.est.sharing.mode=maximum  disp.est.fit.type=parametric.,trunk,Zebrafish trunks at 24 26hpf were dissected removal of head and yolk  flash frozen on dry ice and stored at  80°C until RNA extraction.,total RNA was extracted using the RNeasy Plus Universal Mini kit Qiagen and treated with Dnase. Messenger polyA+ RNAs were purified from 0.7 µg of total RNA using oligodT. Libraries were prepared using the strand non specific RNA Seq library preparation TruSeq RNA Sample Prep v2 kit Illumina. Libraries were multiplexed by 6 on 2 flowcell lanes. A 50 bp read sequencing was performed on a HiSeq 1500 device Illumina. A mean of 27459238  ± 1611623 million passing Illumina quality filter reads was obtained for each of the 6 samples.,Embryos resulting from crossing between qkia+/  fish were injected at a cell stage with qkic morpholino or control morpholino 0 6pmol. We let them develop until 24 26hpf  stage where we could morphologically identify control embryos sibling qkia+/+ or qkia+/  with control morpholino and double qkia/c loss of function embryos qkia /  with qkic morpholino.,Stage:embryo 24 26hpf|genotype:qkia+/+ or qkia+/ |injection:control morpholino,GSM1838795,GSM1838795: Control 3; Danio rerio; RNA Seq,GSM1838795,,1,total RNA was extracted using the RNeasy Plus Universal Mini kit Qiagen and treated with Dnase. Messenger polyA+ RNAs were purified from 0.7 µg of total RNA using oligodT. Libraries were prepared using the strand non specific RNA Seq library preparation TruSeq RNA Sample Prep v2 kit Illumina. Libraries were multiplexed by 6 on 2 flowcell lanes. A 50 bp read sequencing was performed on a HiSeq 1500 device Illumina. A mean of 27459238  ± 1611623 million passing Illumina quality filter reads was obtained for each of the 6 samples.,GEO Accession:GSM1838795,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 1500,,SRP061855,,,Sample3_ACAGTG.fastq.bz2,fastq,2611892782.0,51213584.0,GSM1838795 r1,0:51.00,A:707525221;C:599202602;G:597562199;T:705047589;N:2555171,51,,,,707525221,599202602,597562199,705047589,2555171,SRX1125765,SRS1017742,SRA281148,GEO,"Plateforme transcriptome, Biologie, Ecole Normale Supérieure",1,0.9282,,0.09007,,0.72147,,0.47387,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,bulk,bulk,,France,2015-07-30,Pharyngula,Embryo,Trunk,Surface Structure
39775,SRR2136293,SRX1125764,SRS1017743,SRP061855,PRJNA291531,Identification of qkia/c target genes,GSE71573,Transcriptome Analysis,Quaking are RNA binding proteins  which are known to regulate the expression of different genes at the post transcriptional level. Genetic interference with quaking a qkia and quaking c qkic leads to major myofibril defects during zebrafish development  without xxx early muscle differentiation. In order to understand how qkia and qkic jointly regulate myofibril formation  we performed a comparative analysis of the transcriptome of qkia/qkic qkia mutant injected with qkic morpholino versus control embryos. We show that Quaking activity is required for accumulation of the muscle specific tropomyosin 3 transcript  tpm3.1. Whereas interference with tmp3.1 function disrupts myofibril formation  reintroducing tpm3.1 transcripts into embryos with reduced Quaking activity can restore structured myofibrils. Thus  we identify tropomyosin as an essential component in the process of myofibril formation and as a relay downstream of the regulator proteins Quaking. Overall design: Transcriptome of control versus qkia/qkic embryos at 24 26hpf. Biological triplicate were prepared for both condition 3x2 samples.,,pubmed:28867488,,Control 2,GSM1838794,,tissue:trunk|Stage:embryo 24 26hpf|genotype:qkia+/+ or qkia+/ |injection:control morpholino,Control 2,Before mapping  poly N read tails were trimmed  reads ≤40 bases were removed  and reads with quality mean ≤30 were discarded. To obtain the counts on the exon features  reads were then aligned against the genome using Bowtie version 0.12.9 with arguments  n 2  l 34  e 70  k 2   best. To obtain the counts on the gene features  reads were then aligned against the genome using STAR version 2.4.0j and Ensembl annotation v78. Alignments from reads matching more than once on the reference genome were removed using Java version of samtools. To compute gene expression  Danio rerio Zv9 GFF3 genome annotation version 78 from Ensembl database was used. All overlapping regions between alignments and referenced exons were counted using HTSeq count 0.5.3. To obtain the counts on the exon features  we used the bowtie alignments  excluding the junction reads. HTSeq count was used with arguments: genomictype=exon  attributeid=Name  stranded=no  overlapmode=union  removeambiguouscases=false. To obtain the counts on the gene features  we used the STAR alignments  including the junction reads. HTSeq count was used with arguments: genomictype=exon  stranded=no  overlapmode=union  removeambiguouscases=false and attributeid=Alias where Alias was the corresponding parent gene ID. The sample counts were normalized using DESeq 1.8.3. Statistical treatments and differential analyses were also performed using DESeq 1.8.3 with arguments: disp.est.method=pooled  disp.est.sharing.mode=maximum  disp.est.fit.type=parametric Genome build: Danio rerio Zv9 Supplementary files format and content: tab delimited text files include normalized reads counts for each Sample using DESeq 1.8.3 with arguments: disp.est.method=pooled  disp.est.sharing.mode=maximum  disp.est.fit.type=parametric.,trunk,Zebrafish trunks at 24 26hpf were dissected removal of head and yolk  flash frozen on dry ice and stored at  80°C until RNA extraction.,total RNA was extracted using the RNeasy Plus Universal Mini kit Qiagen and treated with Dnase. Messenger polyA+ RNAs were purified from 0.7 µg of total RNA using oligodT. Libraries were prepared using the strand non specific RNA Seq library preparation TruSeq RNA Sample Prep v2 kit Illumina. Libraries were multiplexed by 6 on 2 flowcell lanes. A 50 bp read sequencing was performed on a HiSeq 1500 device Illumina. A mean of 27459238  ± 1611623 million passing Illumina quality filter reads was obtained for each of the 6 samples.,Embryos resulting from crossing between qkia+/  fish were injected at a cell stage with qkic morpholino or control morpholino 0 6pmol. We let them develop until 24 26hpf  stage where we could morphologically identify control embryos sibling qkia+/+ or qkia+/  with control morpholino and double qkia/c loss of function embryos qkia /  with qkic morpholino.,Stage:embryo 24 26hpf|genotype:qkia+/+ or qkia+/ |injection:control morpholino,GSM1838794,GSM1838794: Control 2; Danio rerio; RNA Seq,GSM1838794,,1,total RNA was extracted using the RNeasy Plus Universal Mini kit Qiagen and treated with Dnase. Messenger polyA+ RNAs were purified from 0.7 µg of total RNA using oligodT. Libraries were prepared using the strand non specific RNA Seq library preparation TruSeq RNA Sample Prep v2 kit Illumina. Libraries were multiplexed by 6 on 2 flowcell lanes. A 50 bp read sequencing was performed on a HiSeq 1500 device Illumina. A mean of 27459238  ± 1611623 million passing Illumina quality filter reads was obtained for each of the 6 samples.,GEO Accession:GSM1838794,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 1500,,SRP061855,,,Sample2_TGACCA.fastq.bz2,fastq,2686989417.0,52686067.0,GSM1838794 r1,0:51,A:728607816;C:615847292;G:614033432;T:725881768;N:2619109,51,,,,728607816,615847292,614033432,725881768,2619109,SRX1125764,SRS1017743,SRA281148,GEO,"Plateforme transcriptome, Biologie, Ecole Normale Supérieure",1,0.92483,,0.09787,,0.7203,,0.45884,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,bulk,bulk,,France,2015-07-30,Pharyngula,Embryo,Trunk,Surface Structure
39776,SRR2136292,SRX1125763,SRS1017744,SRP061855,PRJNA291531,Identification of qkia/c target genes,GSE71573,Transcriptome Analysis,Quaking are RNA binding proteins  which are known to regulate the expression of different genes at the post transcriptional level. Genetic interference with quaking a qkia and quaking c qkic leads to major myofibril defects during zebrafish development  without xxx early muscle differentiation. In order to understand how qkia and qkic jointly regulate myofibril formation  we performed a comparative analysis of the transcriptome of qkia/qkic qkia mutant injected with qkic morpholino versus control embryos. We show that Quaking activity is required for accumulation of the muscle specific tropomyosin 3 transcript  tpm3.1. Whereas interference with tmp3.1 function disrupts myofibril formation  reintroducing tpm3.1 transcripts into embryos with reduced Quaking activity can restore structured myofibrils. Thus  we identify tropomyosin as an essential component in the process of myofibril formation and as a relay downstream of the regulator proteins Quaking. Overall design: Transcriptome of control versus qkia/qkic embryos at 24 26hpf. Biological triplicate were prepared for both condition 3x2 samples.,,pubmed:28867488,,Control 1,GSM1838793,,tissue:trunk|Stage:embryo 24 26hpf|genotype:qkia+/+ or qkia+/ |injection:control morpholino,Control 1,Before mapping  poly N read tails were trimmed  reads ≤40 bases were removed  and reads with quality mean ≤30 were discarded. To obtain the counts on the exon features  reads were then aligned against the genome using Bowtie version 0.12.9 with arguments  n 2  l 34  e 70  k 2   best. To obtain the counts on the gene features  reads were then aligned against the genome using STAR version 2.4.0j and Ensembl annotation v78. Alignments from reads matching more than once on the reference genome were removed using Java version of samtools. To compute gene expression  Danio rerio Zv9 GFF3 genome annotation version 78 from Ensembl database was used. All overlapping regions between alignments and referenced exons were counted using HTSeq count 0.5.3. To obtain the counts on the exon features  we used the bowtie alignments  excluding the junction reads. HTSeq count was used with arguments: genomictype=exon  attributeid=Name  stranded=no  overlapmode=union  removeambiguouscases=false. To obtain the counts on the gene features  we used the STAR alignments  including the junction reads. HTSeq count was used with arguments: genomictype=exon  stranded=no  overlapmode=union  removeambiguouscases=false and attributeid=Alias where Alias was the corresponding parent gene ID. The sample counts were normalized using DESeq 1.8.3. Statistical treatments and differential analyses were also performed using DESeq 1.8.3 with arguments: disp.est.method=pooled  disp.est.sharing.mode=maximum  disp.est.fit.type=parametric Genome build: Danio rerio Zv9 Supplementary files format and content: tab delimited text files include normalized reads counts for each Sample using DESeq 1.8.3 with arguments: disp.est.method=pooled  disp.est.sharing.mode=maximum  disp.est.fit.type=parametric.,trunk,Zebrafish trunks at 24 26hpf were dissected removal of head and yolk  flash frozen on dry ice and stored at  80°C until RNA extraction.,total RNA was extracted using the RNeasy Plus Universal Mini kit Qiagen and treated with Dnase. Messenger polyA+ RNAs were purified from 0.7 µg of total RNA using oligodT. Libraries were prepared using the strand non specific RNA Seq library preparation TruSeq RNA Sample Prep v2 kit Illumina. Libraries were multiplexed by 6 on 2 flowcell lanes. A 50 bp read sequencing was performed on a HiSeq 1500 device Illumina. A mean of 27459238  ± 1611623 million passing Illumina quality filter reads was obtained for each of the 6 samples.,Embryos resulting from crossing between qkia+/  fish were injected at a cell stage with qkic morpholino or control morpholino 0 6pmol. We let them develop until 24 26hpf  stage where we could morphologically identify control embryos sibling qkia+/+ or qkia+/  with control morpholino and double qkia/c loss of function embryos qkia /  with qkic morpholino.,Stage:embryo 24 26hpf|genotype:qkia+/+ or qkia+/ |injection:control morpholino,GSM1838793,GSM1838793: Control 1; Danio rerio; RNA Seq,GSM1838793,,1,total RNA was extracted using the RNeasy Plus Universal Mini kit Qiagen and treated with Dnase. Messenger polyA+ RNAs were purified from 0.7 µg of total RNA using oligodT. Libraries were prepared using the strand non specific RNA Seq library preparation TruSeq RNA Sample Prep v2 kit Illumina. Libraries were multiplexed by 6 on 2 flowcell lanes. A 50 bp read sequencing was performed on a HiSeq 1500 device Illumina. A mean of 27459238  ± 1611623 million passing Illumina quality filter reads was obtained for each of the 6 samples.,GEO Accession:GSM1838793,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 1500,,SRP061855,,,Sample1_CGATGT.fastq.bz2,fastq,2920348075.0,57261727.0,GSM1838793 r1,0:51.00,A:788971393;C:671861209;G:669575375;T:787095383;N:2844715,51,,,,788971393,671861209,669575375,787095383,2844715,SRX1125763,SRS1017744,SRA281148,GEO,"Plateforme transcriptome, Biologie, Ecole Normale Supérieure",1,0.92794,,0.09884,,0.71711,,0.4721,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,bulk,bulk,,France,2015-07-30,Pharyngula,Embryo,Trunk,Surface Structure
41511,SRR5004963,SRX2336797,SRS1790193,SRP092907,PRJNA352850,Transcriptomics analysis of gene expressions  m6A enrichment levels and ythdf2 binding targets in control and mettl3 or ythdf2 morphants zebrafish embryos,GSE89655,Other,RNA was isolated from control and mettl3 or ythdf2 morphants zebrafish cells using the TRIzol Invitrogen reagent by following the company manual. For all samples the RNA integrity was checked using an Agilent Bioanalyzer 2100. All samples showed a RIN RNA integrity number of higher than 9. Approximately 2.5 µg of total RNA was then used for library preparation using a TruSeq™ RNA Sample Prep Kit v2 Illumina  San Diego  CA  USA according to the manufacturer’s protocol.The libraries were sequenced using HiSeq2500 or HiSeq 3000 Illumina in paired read mode  creating reads with a length of 101 or 151 bp. Sequencing chemistry v2 Illumina was used. Overall design: Examination of gene expressive levels  m6A enrichment levels  m6A single uncleotide sites and ythdf2 binding targets in normal and mettl3 or ythdf2 morphants zebrafish cells,,pubmed:28869969,,zebrafish embryos ythdf2 RIP rep2,GSM2386192,,source name:zebrafish embryos|genotype/variation:normal|cell type:embryos cells|age:28hpf|tissue:trunk,zebrafish embryos ythdf2 RIP rep2,Reads were aligned to the zv9 genome assembly using TopHat v2.0.9 For each sample  reads counts of all genes were computed using HTSeq v0.5.3p9 Genome build: zv9 Supplementary files format and content: reads count HTSeq.xls: Reads count for each gene of all samples Supplementary files format and content: ythdf2 binding target.xls: ythdf2 binding targets identified by macs2 software,zebrafish embryos,,For RIP seq  RNA was isolate from ythdf2 Flag mRNA injected zebrafish embryos and the RNA integrity was checked using an Agilent Bioanalyzer 2100. Approximately 2.5 µg of total RNA was then used for library preparation using a TruSeq™ RNA Sample Prep Kit v2 Illumina  San Diego  CA  USA according to the manufacturer’s protocol.The libraries were sequenced using HiSeq3000 Illumina in paired read mode  creating reads with a length of 101 bp.,,genotype/variation:normal|cell type:embryos cells|age:28hpf|tissue:trunk,GSM2386192,GSM2386192: zebrafish embryos ythdf2 RIP rep2; Danio rerio; RIP Seq,GSM2386192,,1,For RIP seq  RNA was isolate from ythdf2 Flag mRNA injected zebrafish embryos and the RNA integrity was checked using an Agilent Bioanalyzer 2100. Approximately 2.5 µg of total RNA was then used for library preparation using a TruSeq™ RNA Sample Prep Kit v2 Illumina  San Diego  CA  USA according to the manufacturer’s protocol.The libraries were sequenced using HiSeq3000 Illumina in paired read mode  creating reads with a length of 101 bp.,GEO Accession:GSM2386192,RIP-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 3000,,SRP092907,,,ythdf2_RIP_rep2_1.fastq.gz ythdf2_RIP_rep2_2.fastq.gz,fastq fastq,4007024510.0,19836755.0,GSM2386192 r1,0:101 1:101,A:769487104;C:1245093129;G:1251328145;T:740377823;N:738309,101,101,,,769487104,1245093129,1251328145,740377823,738309,SRX2336797,SRS1790193,SRA491654,GEO,Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS),2,0.97768,0.97802,0.22786,0.21743,0.89885,0.89968,0.77584,0.83808,101,101,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,trueseq,bulk,bulk,bulk,,China,2016-11-08,Pharyngula,Embryo,Trunk,Surface Structure