rowid,run.accession,experiment.accession,sample.accession,study.accession,bioproject,study.title,study.alias,study.type,study.abstract,study.attributes,study.PMIDs,sample.description,sample.title,sample.alias,sample.centername,sample.attributes,GEOsample.title,GEOsample.dataprocessing,GEOsample.source,GEOsample.treatmentprotocol,GEOsample.extractprotocol,GEOsample.growthprotocol,GEOsample.characteristics,GEOsample.accession,experiment.title,experiment.alias,experiment.library_name,experiment.design_description,experiment.library_construction_protocol,experiment.attributes,experiment.library_strategy,experiment.library_source,experiment.library_selection,experiment.library_layout,experiment.platform,experiment.instrument_model,experiment.spot_descriptor,experiment.study_ref,run.title,run.attributes,run.filename,run.semantic_name,run.total_bases,run.total_spots,run.alias,run.read_lengths,run.base_counts,run.r1_length,run.r2_length,run.r3_length,run.r4_length,run.Acount,run.Ccount,run.Gcount,run.Tcount,run.Ncount,run.experiment,run.pool_member,submission.accession,submission.srasource,submission.bioprojectsource,seqdetective.n_mates,seqdetective.mapping_rate.mate1,seqdetective.mapping_rate.mate2,seqdetective.nofeature_rate.mate1,seqdetective.nofeature_rate.mate2,seqdetective.sparsity.mate1,seqdetective.sparsity.mate2,seqdetective.pos_strand_rate.mate1,seqdetective.pos_strand_rate.mate2,seqdetective.readlen.mate1,seqdetective.readlen.mate2,seqdetective.judgement.mate1,seqdetective.judgement.mate2,seqdetective.judgement.reason,platform_family,instrument_generation,read_bias,selection_class,prep_kit,sc_or_bulk,tech_class,technology,tech_variant,submission.bioprojectsource.country,earliest_date,devstage_curation,devstage_curation_coarse,tissue_curation,tissue_curation_coarse 5027,ERR1706528,ERX1776762,ERS1226979,ERP016002,PRJEB14364,Transcriptome profiling of zebrafish actin prl3 1 transgenic embryos,Transcriptome_profiling_of_zebrafish_actin_prl3_1_transgenic_embryos-sc-4266,Transcriptome Analysis,RNA Seq data was generated from RNA of zebrafish actin:prl3.1 transgenic embryos for transcriptional profiling.,ArrayExpress:E ERAD 507,,,zmp ph260 C5,SAMEA4055869,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Segmentation:26+somites Pharyngula:Prim 5 ZFS:0000028 ZFS:0000050|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 10 24|ENA last update:2016 06 28|External Id:SAMEA4055869|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 10 24T16:33:40Z|INSDC last update:2016 06 28T15:23:35Z|INSDC status:public|Submitter Id:d7a93fb0 2e55 11e6 a63e 3c4a9275d6c8|common name:zebrafish|sample description:RNA from a single zebrafish actin:prl3.1 embryo plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:d7a93fb0 2e55 11e6 a63e 3c4a9275d6c8|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 20417 1#22,17117119,Illumina sequencing of library 17117119 constructed from sample accession ERS1226979 for study accession ERP016002. This is part of an Illumina multiplexed sequencing run 20417 1. This submission includes reads tagged with the sequence GAGTGG.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP016002,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 10 24|ENA LAST UPDATE:2018 11 16,20417_1#22.cram,cram,1375781700.0,9171878.0,SC RUN 20417 1#22,0:75 1:75,A:332899223;C:355056529;G:356526015;T:331162157;N:137776,75,75,,,332899223,355056529,356526015,331162157,137776,ERX1776762,ERS1226979,ERA740537,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96835,0.97046,0.22984,0.22663,0.753,0.75491,0.45383,0.51122,75,75,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-06-28,Multi-stage,Embryo,Whole Organism,All anatomical structures 5028,ERR1706527,ERX1776761,ERS1226967,ERP016002,PRJEB14364,Transcriptome profiling of zebrafish actin prl3 1 transgenic embryos,Transcriptome_profiling_of_zebrafish_actin_prl3_1_transgenic_embryos-sc-4266,Transcriptome Analysis,RNA Seq data was generated from RNA of zebrafish actin:prl3.1 transgenic embryos for transcriptional profiling.,ArrayExpress:E ERAD 507,,,zmp ph260 C4,SAMEA4055857,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Segmentation:26+somites Pharyngula:Prim 5 ZFS:0000028 ZFS:0000049|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 10 24|ENA last update:2016 06 28|External Id:SAMEA4055857|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 10 24T16:33:40Z|INSDC last update:2016 06 28T15:23:22Z|INSDC status:public|Submitter Id:d7a1c5a0 2e55 11e6 a63e 3c4a9275d6c8|common name:zebrafish|sample description:RNA from a single zebrafish actin:prl3.1 embryo plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:d7a1c5a0 2e55 11e6 a63e 3c4a9275d6c8|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 20417 1#21,17117107,Illumina sequencing of library 17117107 constructed from sample accession ERS1226967 for study accession ERP016002. This is part of an Illumina multiplexed sequencing run 20417 1. This submission includes reads tagged with the sequence CGTACG.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP016002,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 10 24|ENA LAST UPDATE:2018 11 16,20417_1#21.cram,cram,1984245000.0,13228300.0,SC RUN 20417 1#21,0:75 1:75,A:468564557;C:523118317;G:524896332;T:467470998;N:194796,75,75,,,468564557,523118317,524896332,467470998,194796,ERX1776761,ERS1226967,ERA740537,European Nucleotide Archive,Wellcome Sanger Institute,2,0.97058,0.97302,0.22668,0.22361,0.76122,0.76319,0.6447,0.64941,75,75,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-06-28,Multi-stage,Embryo,Whole Organism,All anatomical structures 5030,ERR1706525,ERX1776759,ERS1226947,ERP016002,PRJEB14364,Transcriptome profiling of zebrafish actin prl3 1 transgenic embryos,Transcriptome_profiling_of_zebrafish_actin_prl3_1_transgenic_embryos-sc-4266,Transcriptome Analysis,RNA Seq data was generated from RNA of zebrafish actin:prl3.1 transgenic embryos for transcriptional profiling.,ArrayExpress:E ERAD 507,,,zmp ph260 B11,SAMEA4055837,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Segmentation:26+somites Pharyngula:Prim 5 ZFS:0000028 ZFS:0000047|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 10 24|ENA last update:2016 06 28|External Id:SAMEA4055837|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 10 24T16:33:40Z|INSDC last update:2016 06 28T15:23:00Z|INSDC status:public|Submitter Id:d7920e30 2e55 11e6 a63e 3c4a9275d6c8|common name:zebrafish|sample description:RNA from a single zebrafish actin:prl3.1 embryo plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:d7920e30 2e55 11e6 a63e 3c4a9275d6c8|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 20417 1#19,17117083,Illumina sequencing of library 17117083 constructed from sample accession ERS1226947 for study accession ERP016002. This is part of an Illumina multiplexed sequencing run 20417 1. This submission includes reads tagged with the sequence GTGGCC.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP016002,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 10 24|ENA LAST UPDATE:2018 11 16,20417_1#19.cram,cram,1177752450.0,7851683.0,SC RUN 20417 1#19,0:75 1:75,A:311936666;C:276917229;G:278564226;T:310217446;N:116883,75,75,,,311936666,276917229,278564226,310217446,116883,ERX1776759,ERS1226947,ERA740537,European Nucleotide Archive,Wellcome Sanger Institute,2,0.95807,0.96101,0.1671,0.16592,0.72389,0.72521,0.53692,0.53083,75,75,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-06-28,Multi-stage,Embryo,Whole Organism,All anatomical structures 5031,ERR1706524,ERX1776758,ERS1226939,ERP016002,PRJEB14364,Transcriptome profiling of zebrafish actin prl3 1 transgenic embryos,Transcriptome_profiling_of_zebrafish_actin_prl3_1_transgenic_embryos-sc-4266,Transcriptome Analysis,RNA Seq data was generated from RNA of zebrafish actin:prl3.1 transgenic embryos for transcriptional profiling.,ArrayExpress:E ERAD 507,,,zmp ph260 B10,SAMEA4055829,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Segmentation:26+somites Pharyngula:Prim 5 ZFS:0000028 ZFS:0000046|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 10 24|ENA last update:2016 06 28|External Id:SAMEA4055829|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 10 24T16:33:40Z|INSDC last update:2016 06 28T15:22:51Z|INSDC status:public|Submitter Id:d788e670 2e55 11e6 a63e 3c4a9275d6c8|common name:zebrafish|sample description:RNA from a single zebrafish actin:prl3.1 embryo plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:d788e670 2e55 11e6 a63e 3c4a9275d6c8|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 20417 1#18,17117071,Illumina sequencing of library 17117071 constructed from sample accession ERS1226939 for study accession ERP016002. This is part of an Illumina multiplexed sequencing run 20417 1. This submission includes reads tagged with the sequence GTGAAA.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP016002,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 10 24|ENA LAST UPDATE:2018 11 16,20417_1#18.cram,cram,1306412850.0,8709419.0,SC RUN 20417 1#18,0:75 1:75,A:348858023;C:304800763;G:306149463;T:346474389;N:130212,75,75,,,348858023,304800763,306149463,346474389,130212,ERX1776758,ERS1226939,ERA740537,European Nucleotide Archive,Wellcome Sanger Institute,2,0.95746,0.9601,0.16534,0.1628,0.72297,0.72247,0.52807,0.52513,75,75,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-06-28,Multi-stage,Embryo,Whole Organism,All anatomical structures 5032,ERR1706523,ERX1776757,ERS1226931,ERP016002,PRJEB14364,Transcriptome profiling of zebrafish actin prl3 1 transgenic embryos,Transcriptome_profiling_of_zebrafish_actin_prl3_1_transgenic_embryos-sc-4266,Transcriptome Analysis,RNA Seq data was generated from RNA of zebrafish actin:prl3.1 transgenic embryos for transcriptional profiling.,ArrayExpress:E ERAD 507,,,zmp ph260 B9,SAMEA4055821,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Segmentation:26+somites Pharyngula:Prim 5 ZFS:0000028 ZFS:0000045|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 10 24|ENA last update:2016 06 28|External Id:SAMEA4055821|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 10 24T16:33:40Z|INSDC last update:2016 06 28T15:22:43Z|INSDC status:public|Submitter Id:d780d020 2e55 11e6 a63e 3c4a9275d6c8|common name:zebrafish|sample description:RNA from a single zebrafish actin:prl3.1 embryo plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:d780d020 2e55 11e6 a63e 3c4a9275d6c8|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 20417 1#17,17117059,Illumina sequencing of library 17117059 constructed from sample accession ERS1226931 for study accession ERP016002. This is part of an Illumina multiplexed sequencing run 20417 1. This submission includes reads tagged with the sequence GTCCGC.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP016002,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 10 24|ENA LAST UPDATE:2018 11 16,20417_1#17.cram,cram,943334550.0,6288897.0,SC RUN 20417 1#17,0:75 1:75,A:250576062;C:221289820;G:222449063;T:248930088;N:89517,75,75,,,250576062,221289820,222449063,248930088,89517,ERX1776757,ERS1226931,ERA740537,European Nucleotide Archive,Wellcome Sanger Institute,2,0.95898,0.9615,0.16669,0.16433,0.72636,0.7262,0.53064,0.52544,75,75,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-06-28,Multi-stage,Embryo,Whole Organism,All anatomical structures 5043,ERR1706512,ERX1776746,ERS1226790,ERP016002,PRJEB14364,Transcriptome profiling of zebrafish actin prl3 1 transgenic embryos,Transcriptome_profiling_of_zebrafish_actin_prl3_1_transgenic_embryos-sc-4266,Transcriptome Analysis,RNA Seq data was generated from RNA of zebrafish actin:prl3.1 transgenic embryos for transcriptional profiling.,ArrayExpress:E ERAD 507,,,zmp ph260 A6,SAMEA4055680,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Segmentation:26+somites Pharyngula:Prim 5 ZFS:0000028 ZFS:0000034|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 10 24|ENA last update:2016 06 28|External Id:SAMEA4055680|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 10 24T16:33:40Z|INSDC last update:2016 06 28T15:20:34Z|INSDC status:public|Submitter Id:d72b5d20 2e55 11e6 a63e 3c4a9275d6c8|common name:zebrafish|sample description:RNA from a single zebrafish non transgenic actin:prl3.1 sibling embryo plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:d72b5d20 2e55 11e6 a63e 3c4a9275d6c8|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 20417 1#6,17117117,Illumina sequencing of library 17117117 constructed from sample accession ERS1226790 for study accession ERP016002. This is part of an Illumina multiplexed sequencing run 20417 1. This submission includes reads tagged with the sequence GCCAAT.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP016002,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 10 24|ENA LAST UPDATE:2018 11 16,20417_1#6.cram,cram,652493400.0,4349956.0,SC RUN 20417 1#6,,,,,,,,,,,,ERX1776746,ERS1226790,ERA740537,European Nucleotide Archive,Wellcome Sanger Institute,2,0.94432,0.94163,0.16831,0.16496,0.72912,0.72766,0.50382,0.5065,75,75,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-06-28,Multi-stage,Embryo,Whole Organism,All anatomical structures 5044,ERR1706511,ERX1776745,ERS1226779,ERP016002,PRJEB14364,Transcriptome profiling of zebrafish actin prl3 1 transgenic embryos,Transcriptome_profiling_of_zebrafish_actin_prl3_1_transgenic_embryos-sc-4266,Transcriptome Analysis,RNA Seq data was generated from RNA of zebrafish actin:prl3.1 transgenic embryos for transcriptional profiling.,ArrayExpress:E ERAD 507,,,zmp ph260 A5,SAMEA4055669,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Segmentation:26+somites Pharyngula:Prim 5 ZFS:0000028 ZFS:0000033|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 10 24|ENA last update:2016 06 28|External Id:SAMEA4055669|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 10 24T16:33:40Z|INSDC last update:2016 06 28T15:20:26Z|INSDC status:public|Submitter Id:d7219920 2e55 11e6 a63e 3c4a9275d6c8|common name:zebrafish|sample description:RNA from a single zebrafish non transgenic actin:prl3.1 sibling embryo plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:d7219920 2e55 11e6 a63e 3c4a9275d6c8|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 20417 1#5,17117105,Illumina sequencing of library 17117105 constructed from sample accession ERS1226779 for study accession ERP016002. This is part of an Illumina multiplexed sequencing run 20417 1. This submission includes reads tagged with the sequence ACAGTG.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP016002,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 10 24|ENA LAST UPDATE:2018 11 16,20417_1#5.cram,cram,825205650.0,5501371.0,SC RUN 20417 1#5,0:75 1:75,A:224928393;C:188238841;G:188933086;T:223024865;N:80465,75,75,,,224928393,188238841,188933086,223024865,80465,ERX1776745,ERS1226779,ERA740537,European Nucleotide Archive,Wellcome Sanger Institute,2,0.95709,0.96033,0.14048,0.13863,0.71887,0.71987,0.49099,0.49207,75,75,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-06-28,Multi-stage,Embryo,Whole Organism,All anatomical structures 5045,ERR1706510,ERX1776744,ERS1226767,ERP016002,PRJEB14364,Transcriptome profiling of zebrafish actin prl3 1 transgenic embryos,Transcriptome_profiling_of_zebrafish_actin_prl3_1_transgenic_embryos-sc-4266,Transcriptome Analysis,RNA Seq data was generated from RNA of zebrafish actin:prl3.1 transgenic embryos for transcriptional profiling.,ArrayExpress:E ERAD 507,,,zmp ph260 A4,SAMEA4055657,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Segmentation:26+somites Pharyngula:Prim 5 ZFS:0000028 ZFS:0000032|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 10 24|ENA last update:2016 06 28|External Id:SAMEA4055657|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 10 24T16:33:40Z|INSDC last update:2016 06 28T15:20:16Z|INSDC status:public|Submitter Id:d71934b0 2e55 11e6 a63e 3c4a9275d6c8|common name:zebrafish|sample description:RNA from a single zebrafish non transgenic actin:prl3.1 sibling embryo plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:d71934b0 2e55 11e6 a63e 3c4a9275d6c8|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 20417 1#4,17117093,Illumina sequencing of library 17117093 constructed from sample accession ERS1226767 for study accession ERP016002. This is part of an Illumina multiplexed sequencing run 20417 1. This submission includes reads tagged with the sequence TGACCA.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP016002,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 10 24|ENA LAST UPDATE:2018 11 16,20417_1#4.cram,cram,767189250.0,5114595.0,SC RUN 20417 1#4,0:75 1:75,A:210673766;C:173125942;G:174062852;T:209253897;N:72793,75,75,,,210673766,173125942,174062852,209253897,72793,ERX1776744,ERS1226767,ERA740537,European Nucleotide Archive,Wellcome Sanger Institute,2,0.95581,0.95773,0.11947,0.11773,0.72103,0.72178,0.4674,0.46869,75,75,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-06-28,Multi-stage,Embryo,Whole Organism,All anatomical structures 5046,ERR1706509,ERX1776743,ERS1226757,ERP016002,PRJEB14364,Transcriptome profiling of zebrafish actin prl3 1 transgenic embryos,Transcriptome_profiling_of_zebrafish_actin_prl3_1_transgenic_embryos-sc-4266,Transcriptome Analysis,RNA Seq data was generated from RNA of zebrafish actin:prl3.1 transgenic embryos for transcriptional profiling.,ArrayExpress:E ERAD 507,,,zmp ph260 A3,SAMEA4055647,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Segmentation:26+somites Pharyngula:Prim 5 ZFS:0000028 ZFS:0000031|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 10 24|ENA last update:2016 06 28|External Id:SAMEA4055647|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 10 24T16:33:40Z|INSDC last update:2016 06 28T15:20:08Z|INSDC status:public|Submitter Id:d7092f20 2e55 11e6 a63e 3c4a9275d6c8|common name:zebrafish|sample description:RNA from a single zebrafish non transgenic actin:prl3.1 sibling embryo plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:d7092f20 2e55 11e6 a63e 3c4a9275d6c8|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 20417 1#3,17117081,Illumina sequencing of library 17117081 constructed from sample accession ERS1226757 for study accession ERP016002. This is part of an Illumina multiplexed sequencing run 20417 1. This submission includes reads tagged with the sequence TTAGGC.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP016002,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 10 24|ENA LAST UPDATE:2018 11 16,20417_1#3.cram,cram,776002350.0,5173349.0,SC RUN 20417 1#3,0:75 1:75,A:207553748;C:180473885;G:180618978;T:207278008;N:77731,75,75,,,207553748,180473885,180618978,207278008,77731,ERX1776743,ERS1226757,ERA740537,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96457,0.96611,0.23757,0.23414,0.74507,0.74497,0.55158,0.55086,75,75,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-06-28,Multi-stage,Embryo,Whole Organism,All anatomical structures 5047,ERR1706508,ERX1776742,ERS1226745,ERP016002,PRJEB14364,Transcriptome profiling of zebrafish actin prl3 1 transgenic embryos,Transcriptome_profiling_of_zebrafish_actin_prl3_1_transgenic_embryos-sc-4266,Transcriptome Analysis,RNA Seq data was generated from RNA of zebrafish actin:prl3.1 transgenic embryos for transcriptional profiling.,ArrayExpress:E ERAD 507,,,zmp ph260 A2,SAMEA4055635,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Segmentation:26+somites Pharyngula:Prim 5 ZFS:0000028 ZFS:0000030|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 10 24|ENA last update:2016 06 28|External Id:SAMEA4055635|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 10 24T16:33:40Z|INSDC last update:2016 06 28T15:19:59Z|INSDC status:public|Submitter Id:d6f77be0 2e55 11e6 a63e 3c4a9275d6c8|common name:zebrafish|sample description:RNA from a single zebrafish non transgenic actin:prl3.1 sibling embryo plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:d6f77be0 2e55 11e6 a63e 3c4a9275d6c8|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 20417 1#2,17117069,Illumina sequencing of library 17117069 constructed from sample accession ERS1226745 for study accession ERP016002. This is part of an Illumina multiplexed sequencing run 20417 1. This submission includes reads tagged with the sequence CGATGT.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP016002,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 10 24|ENA LAST UPDATE:2018 11 16,20417_1#2.cram,cram,581391900.0,3875946.0,SC RUN 20417 1#2,0:75 1:75,A:156042125;C:134966129;G:135462829;T:154862718;N:58099,75,75,,,156042125,134966129,135462829,154862718,58099,ERX1776742,ERS1226745,ERA740537,European Nucleotide Archive,Wellcome Sanger Institute,2,0.9582,0.96234,0.1297,0.12747,0.72863,0.72949,0.48838,0.48132,75,75,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-06-28,Multi-stage,Embryo,Whole Organism,All anatomical structures 5048,ERR1706507,ERX1776741,ERS1226722,ERP016002,PRJEB14364,Transcriptome profiling of zebrafish actin prl3 1 transgenic embryos,Transcriptome_profiling_of_zebrafish_actin_prl3_1_transgenic_embryos-sc-4266,Transcriptome Analysis,RNA Seq data was generated from RNA of zebrafish actin:prl3.1 transgenic embryos for transcriptional profiling.,ArrayExpress:E ERAD 507,,,zmp ph260 A1,SAMEA4055612,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Segmentation:26+somites Pharyngula:Prim 5 ZFS:0000028 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 10 24|ENA last update:2016 06 28|External Id:SAMEA4055612|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 10 24T16:33:40Z|INSDC last update:2016 06 28T15:19:38Z|INSDC status:public|Submitter Id:d6e3f3e0 2e55 11e6 a63e 3c4a9275d6c8|common name:zebrafish|sample description:RNA from a single zebrafish non transgenic actin:prl3.1 sibling embryo plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:d6e3f3e0 2e55 11e6 a63e 3c4a9275d6c8|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 20417 1#1,17117057,Illumina sequencing of library 17117057 constructed from sample accession ERS1226722 for study accession ERP016002. This is part of an Illumina multiplexed sequencing run 20417 1. This submission includes reads tagged with the sequence ATCACG.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP016002,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 10 24|ENA LAST UPDATE:2018 11 16,20417_1#1.cram,cram,1233271650.0,8221811.0,SC RUN 20417 1#1,0:75 1:75,A:334336992;C:282740616;G:283953463;T:332113804;N:126775,75,75,,,334336992,282740616,283953463,332113804,126775,ERX1776741,ERS1226722,ERA740537,European Nucleotide Archive,Wellcome Sanger Institute,2,0.95579,0.95701,0.15941,0.15689,0.71758,0.71709,0.4967,0.5163,75,75,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-06-28,Multi-stage,Embryo,Whole Organism,All anatomical structures 9898,ERR4194114,ERX4155254,ERS4601292,ERP122151,PRJEB38705,Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,E-MTAB-9193,Transcriptome Analysis,TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.,ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01,,Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.,Sample 2,SAMEA6873729,"Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada",ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873729|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 2|age:8|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 2|scientific name:Danio rerio|sex:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,E MTAB 9193:Sample 2 s,Sample 2 s,Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.,Experimental Factor: age:8|Experimental Factor: RNA interference:n1,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP122151,Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01,cDNA8h_1_S2_L001.bam,bam,10087287534.0,99874134.0,E MTAB 9193:cDNA8h 1 S2 L001,0:101,A:2892833391;C:2022466595;G:2198646699;T:2962268446;N:11072403,101,,,,2892833391,2022466595,2198646699,2962268446,11072403,ERX4155254,ERS4601292,ERA2667966,"Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive","Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive",1,0.93609,,0.12902,,0.82158,,0.5062,,101,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,sc,single_cell_droplet,10x,,Canada,2020-06-04,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 9899,ERR4194115,ERX4155254,ERS4601292,ERP122151,PRJEB38705,Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,E-MTAB-9193,Transcriptome Analysis,TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.,ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01,,Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.,Sample 2,SAMEA6873729,"Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada",ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873729|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 2|age:8|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 2|scientific name:Danio rerio|sex:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,E MTAB 9193:Sample 2 s,Sample 2 s,Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.,Experimental Factor: age:8|Experimental Factor: RNA interference:n1,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP122151,Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01,cDNA8h_1_S2_L002.bam,bam,10191911414.0,100910014.0,E MTAB 9193:cDNA8h 1 S2 L002,0:101,A:2923216190;C:2043975715;G:2221734566;T:2992798366;N:10186577,101,,,,2923216190,2043975715,2221734566,2992798366,10186577,ERX4155254,ERS4601292,ERA2667966,"Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive","Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive",1,0.93445,,0.13038,,0.824,,0.49774,,101,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,sc,single_cell_droplet,10x,,Canada,2020-06-04,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 9900,ERR4194112,ERX4155253,ERS4601291,ERP122151,PRJEB38705,Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,E-MTAB-9193,Transcriptome Analysis,TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.,ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01,,Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.,Sample 1,SAMEA6873728,"Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada",ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873728|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 1|age:6|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 1|scientific name:Danio rerio|sex:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,E MTAB 9193:Sample 1 s,Sample 1 s,Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.,Experimental Factor: age:6|Experimental Factor: RNA interference:n1,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP122151,Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01,cDNA6h_1_S1_L001.bam,bam,7181772357.0,71106657.0,E MTAB 9193:cDNA6h 1 S1 L001,0:101,A:2074032710;C:1415439071;G:1544274166;T:2140112533;N:7913877,101,,,,2074032710,1415439071,1544274166,2140112533,7913877,ERX4155253,ERS4601291,ERA2667966,"Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive","Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive",1,0.9297,,0.12156,,0.8117,,0.51457,,101,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,sc,single_cell_droplet,10x,,Canada,2020-06-04,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 9901,ERR4194113,ERX4155253,ERS4601291,ERP122151,PRJEB38705,Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,E-MTAB-9193,Transcriptome Analysis,TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.,ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01,,Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.,Sample 1,SAMEA6873728,"Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada",ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873728|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 1|age:6|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 1|scientific name:Danio rerio|sex:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,E MTAB 9193:Sample 1 s,Sample 1 s,Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.,Experimental Factor: age:6|Experimental Factor: RNA interference:n1,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP122151,Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01,cDNA6h_1_S1_L002.bam,bam,7256542253.0,71846953.0,E MTAB 9193:cDNA6h 1 S1 L002,0:101,A:2096163385;C:1430325700;G:1560530043;T:2162265616;N:7257509,101,,,,2096163385,1430325700,1560530043,2162265616,7257509,ERX4155253,ERS4601291,ERA2667966,"Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive","Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive",1,0.92882,,0.12127,,0.81162,,0.51457,,101,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,sc,single_cell_droplet,10x,,Canada,2020-06-04,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 9902,ERR4194128,ERX4155256,ERS4601294,ERP122151,PRJEB38705,Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,E-MTAB-9193,Transcriptome Analysis,TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.,ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01,,Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.,Sample 4,SAMEA6873731,"Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada",ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873731|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 4|age:13|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 4|scientific name:Danio rerio|sex:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,E MTAB 9193:Sample 4 s,Sample 4 s,Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.,Experimental Factor: age:13|Experimental Factor: RNA interference:n1,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP122151,Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01,cDNA13h_1_control_S1_L001.bam,bam,10785974123.0,106791823.0,E MTAB 9193:cDNA13h 1 control S1 L001,0:101,A:3007305661;C:2241057062;G:2505494392;T:2986021199;N:46095809,101,,,,3007305661,2241057062,2505494392,2986021199,46095809,ERX4155256,ERS4601294,ERA2667966,"Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive","Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive",1,0.67094,,0.07571,,0.92951,,0.5272,,101,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,sc,single_cell_droplet,10x,,Canada,2020-06-04,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 9903,ERR4194129,ERX4155256,ERS4601294,ERP122151,PRJEB38705,Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,E-MTAB-9193,Transcriptome Analysis,TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.,ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01,,Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.,Sample 4,SAMEA6873731,"Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada",ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873731|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 4|age:13|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 4|scientific name:Danio rerio|sex:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,E MTAB 9193:Sample 4 s,Sample 4 s,Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.,Experimental Factor: age:13|Experimental Factor: RNA interference:n1,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP122151,Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01,cDNA13h_1_control_S1_L002.bam,bam,10595192294.0,104902894.0,E MTAB 9193:cDNA13h 1 control S1 L002,0:101,A:2971916419;C:2204229263;G:2390854035;T:2949877754;N:78314823,101,,,,2971916419,2204229263,2390854035,2949877754,78314823,ERX4155256,ERS4601294,ERA2667966,"Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive","Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive",1,0.67255,,0.08054,,0.91583,,0.52661,,101,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,sc,single_cell_droplet,10x,,Canada,2020-06-04,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 9904,ERR4194116,ERX4155255,ERS4601293,ERP122151,PRJEB38705,Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,E-MTAB-9193,Transcriptome Analysis,TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.,ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01,,Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.,Sample 3,SAMEA6873730,"Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada",ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873730|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 3|age:10|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 3|scientific name:Danio rerio|sex:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,E MTAB 9193:Sample 3 s,Sample 3 s,Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.,Experimental Factor: age:10|Experimental Factor: RNA interference:n1,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP122151,Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01,cDNA10h_1_S3_L001.bam,bam,1622536412.0,16556494.0,E MTAB 9193:cDNA10h 1 S3 L001,0:98,A:491141175;C:317161060;G:354179755;T:459976409;N:78013,98,,,,491141175,317161060,354179755,459976409,78013,ERX4155255,ERS4601293,ERA2667966,"Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive","Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive",1,0.93238,,0.13033,,0.89132,,0.47076,,98,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,sc,single_cell_droplet,10x,,Canada,2020-06-04,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 9905,ERR4194117,ERX4155255,ERS4601293,ERP122151,PRJEB38705,Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,E-MTAB-9193,Transcriptome Analysis,TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.,ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01,,Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.,Sample 3,SAMEA6873730,"Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada",ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873730|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 3|age:10|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 3|scientific name:Danio rerio|sex:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,E MTAB 9193:Sample 3 s,Sample 3 s,Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.,Experimental Factor: age:10|Experimental Factor: RNA interference:n1,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP122151,Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01,cDNA10h_1_S3_L002.bam,bam,1484328776.0,15146212.0,E MTAB 9193:cDNA10h 1 S3 L002,0:98,A:450782055;C:290088574;G:322801188;T:420570801;N:86158,98,,,,450782055,290088574,322801188,420570801,86158,ERX4155255,ERS4601293,ERA2667966,"Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive","Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive",1,0.92846,,0.13128,,0.89923,,0.46879,,98,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,sc,single_cell_droplet,10x,,Canada,2020-06-04,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 9906,ERR4194118,ERX4155255,ERS4601293,ERP122151,PRJEB38705,Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,E-MTAB-9193,Transcriptome Analysis,TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.,ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01,,Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.,Sample 3,SAMEA6873730,"Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada",ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873730|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 3|age:10|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 3|scientific name:Danio rerio|sex:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,E MTAB 9193:Sample 3 s,Sample 3 s,Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.,Experimental Factor: age:10|Experimental Factor: RNA interference:n1,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP122151,Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01,cDNA10h_1_S3_L003.bam,bam,1578833116.0,16110542.0,E MTAB 9193:cDNA10h 1 S3 L003,0:98,A:477600666;C:308260969;G:347303289;T:445467384;N:200808,98,,,,477600666,308260969,347303289,445467384,200808,ERX4155255,ERS4601293,ERA2667966,"Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive","Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive",1,0.93107,,0.12965,,0.91265,,0.47375,,98,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,sc,single_cell_droplet,10x,,Canada,2020-06-04,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 9907,ERR4194119,ERX4155255,ERS4601293,ERP122151,PRJEB38705,Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,E-MTAB-9193,Transcriptome Analysis,TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.,ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01,,Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.,Sample 3,SAMEA6873730,"Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada",ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873730|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 3|age:10|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 3|scientific name:Danio rerio|sex:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,E MTAB 9193:Sample 3 s,Sample 3 s,Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.,Experimental Factor: age:10|Experimental Factor: RNA interference:n1,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP122151,Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01,cDNA10h_1_S3_L004.bam,bam,1859564994.0,18975153.0,E MTAB 9193:cDNA10h 1 S3 L004,0:98,A:562936790;C:364057256;G:406607636;T:525811595;N:151717,98,,,,562936790,364057256,406607636,525811595,151717,ERX4155255,ERS4601293,ERA2667966,"Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive","Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive",1,0.93453,,0.1266,,0.87714,,0.46957,,98,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,sc,single_cell_droplet,10x,,Canada,2020-06-04,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 9908,ERR4194120,ERX4155255,ERS4601293,ERP122151,PRJEB38705,Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,E-MTAB-9193,Transcriptome Analysis,TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.,ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01,,Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.,Sample 3,SAMEA6873730,"Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada",ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873730|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 3|age:10|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 3|scientific name:Danio rerio|sex:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,E MTAB 9193:Sample 3 s,Sample 3 s,Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.,Experimental Factor: age:10|Experimental Factor: RNA interference:n1,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP122151,Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01,cDNA10h_2_S3_L001.bam,bam,1156341102.0,11799399.0,E MTAB 9193:cDNA10h 2 S3 L001,0:98,A:345857612;C:224453195;G:257551986;T:327969064;N:509245,98,,,,345857612,224453195,257551986,327969064,509245,ERX4155255,ERS4601293,ERA2667966,"Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive","Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive",1,0.93863,,0.10744,,0.81984,,0.501,,98,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,sc,single_cell_droplet,10x,,Canada,2020-06-04,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 9909,ERR4194121,ERX4155255,ERS4601293,ERP122151,PRJEB38705,Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,E-MTAB-9193,Transcriptome Analysis,TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.,ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01,,Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.,Sample 3,SAMEA6873730,"Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada",ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873730|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 3|age:10|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 3|scientific name:Danio rerio|sex:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,E MTAB 9193:Sample 3 s,Sample 3 s,Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.,Experimental Factor: age:10|Experimental Factor: RNA interference:n1,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP122151,Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01,cDNA10h_2_S3_L002.bam,bam,1105219696.0,11277752.0,E MTAB 9193:cDNA10h 2 S3 L002,0:98,A:331051973;C:214369903;G:246546338;T:312897773;N:353709,98,,,,331051973,214369903,246546338,312897773,353709,ERX4155255,ERS4601293,ERA2667966,"Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive","Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive",1,0.93941,,0.10818,,0.82211,,0.50079,,98,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,sc,single_cell_droplet,10x,,Canada,2020-06-04,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 9910,ERR4194122,ERX4155255,ERS4601293,ERP122151,PRJEB38705,Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,E-MTAB-9193,Transcriptome Analysis,TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.,ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01,,Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.,Sample 3,SAMEA6873730,"Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada",ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873730|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 3|age:10|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 3|scientific name:Danio rerio|sex:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,E MTAB 9193:Sample 3 s,Sample 3 s,Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.,Experimental Factor: age:10|Experimental Factor: RNA interference:n1,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP122151,Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01,cDNA10h_2_S3_L003.bam,bam,1105199606.0,11277547.0,E MTAB 9193:cDNA10h 2 S3 L003,0:98,A:331158619;C:214305131;G:246465559;T:312930408;N:339889,98,,,,331158619,214305131,246465559,312930408,339889,ERX4155255,ERS4601293,ERA2667966,"Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive","Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive",1,0.93767,,0.10645,,0.82329,,0.50057,,98,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,sc,single_cell_droplet,10x,,Canada,2020-06-04,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 9911,ERR4194123,ERX4155255,ERS4601293,ERP122151,PRJEB38705,Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,E-MTAB-9193,Transcriptome Analysis,TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.,ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01,,Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.,Sample 3,SAMEA6873730,"Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada",ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873730|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 3|age:10|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 3|scientific name:Danio rerio|sex:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,E MTAB 9193:Sample 3 s,Sample 3 s,Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.,Experimental Factor: age:10|Experimental Factor: RNA interference:n1,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP122151,Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01,cDNA10h_2_S3_L004.bam,bam,1108707712.0,11313344.0,E MTAB 9193:cDNA10h 2 S3 L004,0:98,A:331374433;C:215925150;G:247131942;T:313865174;N:411013,98,,,,331374433,215925150,247131942,313865174,411013,ERX4155255,ERS4601293,ERA2667966,"Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive","Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive",1,0.93827,,0.10842,,0.82031,,0.49241,,98,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,sc,single_cell_droplet,10x,,Canada,2020-06-04,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 9912,ERR4194124,ERX4155255,ERS4601293,ERP122151,PRJEB38705,Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,E-MTAB-9193,Transcriptome Analysis,TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.,ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01,,Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.,Sample 3,SAMEA6873730,"Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada",ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873730|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 3|age:10|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 3|scientific name:Danio rerio|sex:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,E MTAB 9193:Sample 3 s,Sample 3 s,Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.,Experimental Factor: age:10|Experimental Factor: RNA interference:n1,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP122151,Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01,cDNA10h_2_S3_L005.bam,bam,1110084612.0,11327394.0,E MTAB 9193:cDNA10h 2 S3 L005,0:98,A:332881960;C:215360330;G:247563319;T:313842331;N:436672,98,,,,332881960,215360330,247563319,313842331,436672,ERX4155255,ERS4601293,ERA2667966,"Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive","Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive",1,0.93827,,0.10719,,0.8238,,0.50406,,98,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,sc,single_cell_droplet,10x,,Canada,2020-06-04,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 9913,ERR4194125,ERX4155255,ERS4601293,ERP122151,PRJEB38705,Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,E-MTAB-9193,Transcriptome Analysis,TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.,ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01,,Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.,Sample 3,SAMEA6873730,"Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada",ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873730|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 3|age:10|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 3|scientific name:Danio rerio|sex:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,E MTAB 9193:Sample 3 s,Sample 3 s,Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.,Experimental Factor: age:10|Experimental Factor: RNA interference:n1,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP122151,Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01,cDNA10h_2_S3_L006.bam,bam,1113812728.0,11365436.0,E MTAB 9193:cDNA10h 2 S3 L006,0:98,A:333112288;C:216649152;G:248341020;T:315338848;N:371420,98,,,,333112288,216649152,248341020,315338848,371420,ERX4155255,ERS4601293,ERA2667966,"Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive","Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive",1,0.93843,,0.10675,,0.82079,,0.49284,,98,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,sc,single_cell_droplet,10x,,Canada,2020-06-04,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 9914,ERR4194126,ERX4155255,ERS4601293,ERP122151,PRJEB38705,Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,E-MTAB-9193,Transcriptome Analysis,TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.,ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01,,Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.,Sample 3,SAMEA6873730,"Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada",ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873730|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 3|age:10|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 3|scientific name:Danio rerio|sex:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,E MTAB 9193:Sample 3 s,Sample 3 s,Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.,Experimental Factor: age:10|Experimental Factor: RNA interference:n1,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP122151,Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01,cDNA10h_2_S3_L007.bam,bam,1119495748.0,11423426.0,E MTAB 9193:cDNA10h 2 S3 L007,0:98,A:335288339;C:217283719;G:249624836;T:316900388;N:398466,98,,,,335288339,217283719,249624836,316900388,398466,ERX4155255,ERS4601293,ERA2667966,"Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive","Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive",1,0.93711,,0.10749,,0.82266,,0.49382,,98,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,sc,single_cell_droplet,10x,,Canada,2020-06-04,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 9915,ERR4194127,ERX4155255,ERS4601293,ERP122151,PRJEB38705,Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,E-MTAB-9193,Transcriptome Analysis,TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.,ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01,,Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.,Sample 3,SAMEA6873730,"Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada",ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873730|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 3|age:10|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 3|scientific name:Danio rerio|sex:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,E MTAB 9193:Sample 3 s,Sample 3 s,Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.,Experimental Factor: age:10|Experimental Factor: RNA interference:n1,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP122151,Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01,cDNA10h_2_S3_L008.bam,bam,1175946688.0,11999456.0,E MTAB 9193:cDNA10h 2 S3 L008,0:98,A:351364169;C:228318193;G:261971072;T:333863943;N:429311,98,,,,351364169,228318193,261971072,333863943,429311,ERX4155255,ERS4601293,ERA2667966,"Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive","Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive",1,0.93851,,0.10755,,0.82158,,0.49895,,98,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,sc,single_cell_droplet,10x,,Canada,2020-06-04,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 9916,ERR4194130,ERX4155257,ERS4601295,ERP122151,PRJEB38705,Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,E-MTAB-9193,Transcriptome Analysis,TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.,ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01,,Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.,Sample 5,SAMEA6873732,"Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada",ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873732|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 5|age:13|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 5|scientific name:Danio rerio|sex:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,E MTAB 9193:Sample 5 s,Sample 5 s,Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.,Experimental Factor: age:13|Experimental Factor: RNA interference:morpholino mediated Gata5/6 knockdown,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP122151,Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01,cDNA13h_2_gata56KD_S2_L001.bam,bam,7791309377.0,77141677.0,E MTAB 9193:cDNA13h 2 gata56KD S2 L001,0:101,A:2198242220;C:1593746618;G:1784167452;T:2181979820;N:33173267,101,,,,2198242220,1593746618,1784167452,2181979820,33173267,ERX4155257,ERS4601295,ERA2667966,"Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive","Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive",1,0.66736,,0.08039,,0.93026,,0.50796,,101,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,sc,single_cell_droplet,10x,,Canada,2020-06-04,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 9917,ERR4194131,ERX4155257,ERS4601295,ERP122151,PRJEB38705,Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,E-MTAB-9193,Transcriptome Analysis,TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.,ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01,,Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.,Sample 5,SAMEA6873732,"Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada",ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873732|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 5|age:13|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 5|scientific name:Danio rerio|sex:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,E MTAB 9193:Sample 5 s,Sample 5 s,Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.,Experimental Factor: age:13|Experimental Factor: RNA interference:morpholino mediated Gata5/6 knockdown,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP122151,Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish,ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01,cDNA13h_2_gata56KD_S2_L002.bam,bam,7658149967.0,75823267.0,E MTAB 9193:cDNA13h 2 gata56KD S2 L002,0:101,A:2172230233;C:1568805100;G:1703587704;T:2157181071;N:56345859,101,,,,2172230233,1568805100,1703587704,2157181071,56345859,ERX4155257,ERS4601295,ERA2667966,"Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive","Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive",1,0.66565,,0.08597,,0.91804,,0.51772,,101,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,sc,single_cell_droplet,10x,,Canada,2020-06-04,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 10213,ERR6511329,ERX6138165,ERS7264188,ERP131213,PRJEB46978,Nano3P seq: transcriptome wide analysis of gene expression and tail dynamics using end capture nanopore sequencing,ena-STUDY-CENTER FOR GENOMIC REGULATION (CRG)-12-08-2021-14:48:52:906-1159,Other,Nano3P seq is a simple and robust method to accurately estimate transcript levels tail lengths and tail nucleotide composition information in full length individual reads with minimal library preparation biases both in the coding and non coding transcriptome.,ENA FIRST PUBLIC:2023 12 28|ENA LAST UPDATE:2023 12 28,,Zebrafish Nano3P seq of Ribodepleted sample biological replicate 1 including 2 hpf 4 hpf 6 hpf RNAs,Zebrafish Ribodep Rep1,SAMEA9541418,CENTER FOR GENOMIC REGULATION (CRG),ENA FIRST PUBLIC:2023 12 28T01:07:23Z|ENA LAST UPDATE:2023 12 28T01:07:23Z|External Id:SAMEA9541418|INSDC center name:CENTER FOR GENOMIC REGULATION CRG|INSDC first public:2023 12 28T01:07:23Z|INSDC last update:2023 12 28T01:07:23Z|INSDC status:public|Submitter Id:Zebrafish Ribodep Rep1|common name:zebrafish|sample name:Zebrafish Ribodep Rep1|scientific name:Danio rerio,,,,,,,,,MinION sequencing,ena EXPERIMENT CENTER FOR GENOMIC REGULATION CRG 17 08 2021 13:09:55:665 3,cDNA786327,Nano3P seq,Nano3P seq,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,OXFORD_NANOPORE,MinION,,ERP131213,MinION sequencing,ENA FIRST PUBLIC:2023 12 28|ENA LAST UPDATE:2023 12 28,zebrafish_ribodep_rep1.tar.gz,nanopore,1745399583.0,1644167.0,ena RUN CENTER FOR GENOMIC REGULATION CRG 17 08 2021 13:09:55:665 3,0:1061.57,A:449704009;C:421915878;G:378879857;T:494899839;N:0,1061,,,,449704009,421915878,378879857,494899839,0,ERX6138165,ERS7264188,ERA5757997,CENTER FOR GENOMIC REGULATION (CRG)|European Nucleotide Archive,CENTER FOR GENOMIC REGULATION (CRG),1,0.01112,,0.0,,0.99997,,1.0,,546,,T,,long read,ont,ont,full_length,rrna_depletion,unknown,bulk,unknown,unknown,,Spain,2023-12-28,Multi-stage,Embryo,Undetermined,Embryo Imprecise 10215,ERR6511330,ERX6138166,ERS7264189,ERP131213,PRJEB46978,Nano3P seq: transcriptome wide analysis of gene expression and tail dynamics using end capture nanopore sequencing,ena-STUDY-CENTER FOR GENOMIC REGULATION (CRG)-12-08-2021-14:48:52:906-1159,Other,Nano3P seq is a simple and robust method to accurately estimate transcript levels tail lengths and tail nucleotide composition information in full length individual reads with minimal library preparation biases both in the coding and non coding transcriptome.,ENA FIRST PUBLIC:2023 12 28|ENA LAST UPDATE:2023 12 28,,Zebrafish Nano3P seq of Ribodepleted sample biological replicate 1 including 2 hpf 4 hpf 6 hpf RNAs,Zebrafish Ribodep Rep2,SAMEA9541419,CENTER FOR GENOMIC REGULATION (CRG),ENA FIRST PUBLIC:2023 12 28T01:07:23Z|ENA LAST UPDATE:2023 12 28T01:07:23Z|External Id:SAMEA9541419|INSDC center name:CENTER FOR GENOMIC REGULATION CRG|INSDC first public:2023 12 28T01:07:23Z|INSDC last update:2023 12 28T01:07:23Z|INSDC status:public|Submitter Id:Zebrafish Ribodep Rep2|common name:zebrafish|sample name:Zebrafish Ribodep Rep2|scientific name:Danio rerio,,,,,,,,,MinION sequencing,ena EXPERIMENT CENTER FOR GENOMIC REGULATION CRG 17 08 2021 13:09:55:665 4,cDNA123791,Nano3P seq,Nano3P seq,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,OXFORD_NANOPORE,MinION,,ERP131213,MinION sequencing,ENA FIRST PUBLIC:2023 12 28|ENA LAST UPDATE:2023 12 28,zebrafish_ribodep_rep2.tar.gz,nanopore,2038398139.0,1955617.0,ena RUN CENTER FOR GENOMIC REGULATION CRG 17 08 2021 13:09:55:665 4,0:1042.33,A:518369802;C:477535545;G:441294056;T:601198736;N:0,1042,,,,518369802,477535545,441294056,601198736,0,ERX6138166,ERS7264189,ERA5757997,CENTER FOR GENOMIC REGULATION (CRG)|European Nucleotide Archive,CENTER FOR GENOMIC REGULATION (CRG),,,,,,,,,,,,,,,ont,ont,full_length,rrna_depletion,unknown,bulk,unknown,unknown,,Spain,2023-12-28,Multi-stage,Embryo,Undetermined,Embryo Imprecise 10649,ERR406885,ERX373262,ERS391761,ERP004564,PRJEB5188,YD embryos 8 hpf 24 hpf 32 hpf,E-MTAB-2194,Transcriptome Analysis,Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity a poorly understood mechanism that responds to environmental cues from early to late developmental stages. In this study we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability we partially remove the yolk during embryogenesis. Around 5 hpf we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8 24 hpf and 32 hpf we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.,,,Protocols: Zebrafish embryos in HANKS embryo buffer Around 5hpf sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2,5s24,SAMEA2299303,CAS-MPG PICB,ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:38Z|External Id:SAMEA2299303|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:38Z|INSDC status:public|Submitter Id:E MTAB 2194:5s24|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:5s24|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb,,,,,,,,,Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf,E MTAB 2194:Unique sample ID.4,batchA 24hpf SP,YD embryos 8 hpf 24 hpf 32 hpf,Zebrafish embryos in HANKS embryo buffer Around 5hpf sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2,Experimental Factor: treatment:sham punctured embryos|Experimental Factor: time:24 hour,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,ERP004564,Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf,ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16,5s24.fq.gz,fastq,584550600.0,11691012.0,E MTAB 2194:5s24.fq.gz,0:50 1:0,A:154602150;C:138134763;G:138628704;T:153175234;N:9749,50,0,,,154602150,138134763,138628704,153175234,9749,ERX373262,ERS391761,ERA280282,CAS-MPG PICB|ArrayExpress,CAS-MPG PICB|ArrayExpress,1,0.9356,,0.0996,,0.68615,,0.47069,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,random_priming,trueseq,bulk,unknown,unknown,,China,2014-04-01,Multi-stage,Embryo,Whole Organism,All anatomical structures 10650,ERR406893,ERX373261,ERS391760,ERP004564,PRJEB5188,YD embryos 8 hpf 24 hpf 32 hpf,E-MTAB-2194,Transcriptome Analysis,Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity a poorly understood mechanism that responds to environmental cues from early to late developmental stages. In this study we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability we partially remove the yolk during embryogenesis. Around 5 hpf we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8 24 hpf and 32 hpf we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.,,,Protocols: Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2,5y32,SAMEA2299302,CAS-MPG PICB,ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:38Z|External Id:SAMEA2299302|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:38Z|INSDC status:public|Submitter Id:E MTAB 2194:5y32|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:5y32|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb,,,,,,,,,Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf,E MTAB 2194:Unique sample ID.5,batchA 32hpf YD,YD embryos 8 hpf 24 hpf 32 hpf,Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2,Experimental Factor: treatment:yolk|Experimental Factor: time:32 hour,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,ERP004564,Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf,ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16,5y32.fq.gz,fastq,528892950.0,10577859.0,E MTAB 2194:5y32.fq.gz,0:50 1:0,A:140383478;C:125036983;G:124119152;T:139344643;N:8694,50,0,,,140383478,125036983,124119152,139344643,8694,ERX373261,ERS391760,ERA280282,CAS-MPG PICB|ArrayExpress,CAS-MPG PICB|ArrayExpress,1,0.93478,,0.10542,,0.68296,,0.4795,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,random_priming,trueseq,bulk,unknown,unknown,,China,2014-04-01,Multi-stage,Embryo,Whole Organism,All anatomical structures 10651,ERR406898,ERX373260,ERS391759,ERP004564,PRJEB5188,YD embryos 8 hpf 24 hpf 32 hpf,E-MTAB-2194,Transcriptome Analysis,Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity a poorly understood mechanism that responds to environmental cues from early to late developmental stages. In this study we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability we partially remove the yolk during embryogenesis. Around 5 hpf we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8 24 hpf and 32 hpf we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.,,,Protocols: Zebrafish embryos in HANKS embryo buffer Around 5hpf sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2,6s24,SAMEA2299301,CAS-MPG PICB,ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:38Z|External Id:SAMEA2299301|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:38Z|INSDC status:public|Submitter Id:E MTAB 2194:6s24|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:6s24|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb,,,,,,,,,Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf,E MTAB 2194:Unique sample ID.10,batchB 24hpf SP,YD embryos 8 hpf 24 hpf 32 hpf,Zebrafish embryos in HANKS embryo buffer Around 5hpf sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2,Experimental Factor: treatment:sham punctured embryos|Experimental Factor: time:24 hour,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,ERP004564,Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf,ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16,6s24.fq.gz,fastq,542771850.0,10855437.0,E MTAB 2194:6s24.fq.gz,0:50 1:0,A:142311943;C:129686202;G:129130172;T:141634727;N:8806,50,0,,,142311943,129686202,129130172,141634727,8806,ERX373260,ERS391759,ERA280282,CAS-MPG PICB|ArrayExpress,CAS-MPG PICB|ArrayExpress,1,0.93717,,0.09239,,0.68876,,0.46809,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,random_priming,trueseq,bulk,unknown,unknown,,China,2014-04-01,Multi-stage,Embryo,Whole Organism,All anatomical structures 10652,ERR406896,ERX373259,ERS391758,ERP004564,PRJEB5188,YD embryos 8 hpf 24 hpf 32 hpf,E-MTAB-2194,Transcriptome Analysis,Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity a poorly understood mechanism that responds to environmental cues from early to late developmental stages. In this study we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability we partially remove the yolk during embryogenesis. Around 5 hpf we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8 24 hpf and 32 hpf we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.,,,Protocols: Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2,13y32,SAMEA2299300,CAS-MPG PICB,ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:38Z|External Id:SAMEA2299300|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:38Z|INSDC status:public|Submitter Id:E MTAB 2194:13y32|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:13y32|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb,,,,,,,,,Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf,E MTAB 2194:Unique sample ID.18,batchC 32hpf YD,YD embryos 8 hpf 24 hpf 32 hpf,Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2,Experimental Factor: treatment:yolk|Experimental Factor: time:32 hour,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,ERP004564,Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf,ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16,13y32.fq.gz,fastq,649898350.0,12997967.0,E MTAB 2194:13y32.fq.gz,0:50 1:0,A:169738689;C:156130165;G:155102788;T:168916174;N:10534,50,0,,,169738689,156130165,155102788,168916174,10534,ERX373259,ERS391758,ERA280282,CAS-MPG PICB|ArrayExpress,CAS-MPG PICB|ArrayExpress,1,0.93898,,0.08535,,0.68217,,0.47133,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,random_priming,trueseq,bulk,unknown,unknown,,China,2014-04-01,Multi-stage,Embryo,Whole Organism,All anatomical structures 10653,ERR406899,ERX373258,ERS391757,ERP004564,PRJEB5188,YD embryos 8 hpf 24 hpf 32 hpf,E-MTAB-2194,Transcriptome Analysis,Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity a poorly understood mechanism that responds to environmental cues from early to late developmental stages. In this study we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability we partially remove the yolk during embryogenesis. Around 5 hpf we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8 24 hpf and 32 hpf we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.,,,Protocols: Zebrafish embryos in HANKS embryo buffer Around 5hpf sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2,5s32,SAMEA2299299,CAS-MPG PICB,ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:38Z|External Id:SAMEA2299299|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:38Z|INSDC status:public|Submitter Id:E MTAB 2194:5s32|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:5s32|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb,,,,,,,,,Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf,E MTAB 2194:Unique sample ID.6,batchA 32hpf SP,YD embryos 8 hpf 24 hpf 32 hpf,Zebrafish embryos in HANKS embryo buffer Around 5hpf sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2,Experimental Factor: treatment:sham punctured embryos|Experimental Factor: time:32 hour,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,ERP004564,Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf,ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16,5s32.fq.gz,fastq,566813600.0,11336272.0,E MTAB 2194:5s32.fq.gz,0:50 1:0,A:149907366;C:134421172;G:133399280;T:149076590;N:9192,50,0,,,149907366,134421172,133399280,149076590,9192,ERX373258,ERS391757,ERA280282,CAS-MPG PICB|ArrayExpress,CAS-MPG PICB|ArrayExpress,1,0.93497,,0.10019,,0.68379,,0.4671,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,random_priming,trueseq,bulk,unknown,unknown,,China,2014-04-01,Multi-stage,Embryo,Whole Organism,All anatomical structures 10654,ERR406888,ERX373257,ERS391756,ERP004564,PRJEB5188,YD embryos 8 hpf 24 hpf 32 hpf,E-MTAB-2194,Transcriptome Analysis,Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity a poorly understood mechanism that responds to environmental cues from early to late developmental stages. In this study we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability we partially remove the yolk during embryogenesis. Around 5 hpf we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8 24 hpf and 32 hpf we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.,,,Protocols: Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2,5y24,SAMEA2299298,CAS-MPG PICB,ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:38Z|External Id:SAMEA2299298|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:38Z|INSDC status:public|Submitter Id:E MTAB 2194:5y24|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:5y24|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb,,,,,,,,,Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf,E MTAB 2194:Unique sample ID.3,batchA 24hpf YD,YD embryos 8 hpf 24 hpf 32 hpf,Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2,Experimental Factor: treatment:yolk|Experimental Factor: time:24 hour,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,ERP004564,Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf,ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16,5y24.fq.gz,fastq,578936250.0,11578725.0,E MTAB 2194:5y24.fq.gz,0:50 1:0,A:154884020;C:135497257;G:135214353;T:153331273;N:9347,50,0,,,154884020,135497257,135214353,153331273,9347,ERX373257,ERS391756,ERA280282,CAS-MPG PICB|ArrayExpress,CAS-MPG PICB|ArrayExpress,1,0.9342,,0.1106,,0.67811,,0.47685,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,random_priming,trueseq,bulk,unknown,unknown,,China,2014-04-01,Multi-stage,Embryo,Whole Organism,All anatomical structures 10655,ERR406887,ERX373256,ERS391755,ERP004564,PRJEB5188,YD embryos 8 hpf 24 hpf 32 hpf,E-MTAB-2194,Transcriptome Analysis,Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity a poorly understood mechanism that responds to environmental cues from early to late developmental stages. In this study we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability we partially remove the yolk during embryogenesis. Around 5 hpf we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8 24 hpf and 32 hpf we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.,,,Protocols: Zebrafish embryos in HANKS embryo buffer Around 5hpf sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2,13s24,SAMEA2299297,CAS-MPG PICB,ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:38Z|External Id:SAMEA2299297|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:38Z|INSDC status:public|Submitter Id:E MTAB 2194:13s24|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:13s24|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb,,,,,,,,,Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf,E MTAB 2194:Unique sample ID.16,batchC 24hpf SP,YD embryos 8 hpf 24 hpf 32 hpf,Zebrafish embryos in HANKS embryo buffer Around 5hpf sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2,Experimental Factor: treatment:sham punctured embryos|Experimental Factor: time:24 hour,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,ERP004564,Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf,ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16,13s24.fq.gz,fastq,837415050.0,16748301.0,E MTAB 2194:13s24.fq.gz,0:50 1:0,A:217172462;C:202556518;G:201365353;T:216307386;N:13331,50,0,,,217172462,202556518,201365353,216307386,13331,ERX373256,ERS391755,ERA280282,CAS-MPG PICB|ArrayExpress,CAS-MPG PICB|ArrayExpress,1,0.93888,,0.07561,,0.6899,,0.46646,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,random_priming,trueseq,bulk,unknown,unknown,,China,2014-04-01,Multi-stage,Embryo,Whole Organism,All anatomical structures 10656,ERR406894,ERX373255,ERS391754,ERP004564,PRJEB5188,YD embryos 8 hpf 24 hpf 32 hpf,E-MTAB-2194,Transcriptome Analysis,Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity a poorly understood mechanism that responds to environmental cues from early to late developmental stages. In this study we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability we partially remove the yolk during embryogenesis. Around 5 hpf we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8 24 hpf and 32 hpf we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.,,,Protocols: Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2,6y24,SAMEA2299296,CAS-MPG PICB,ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:38Z|External Id:SAMEA2299296|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:38Z|INSDC status:public|Submitter Id:E MTAB 2194:6y24|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:6y24|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb,,,,,,,,,Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf,E MTAB 2194:Unique sample ID.9,batchB 24hpf YD,YD embryos 8 hpf 24 hpf 32 hpf,Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2,Experimental Factor: treatment:yolk|Experimental Factor: time:24 hour,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,ERP004564,Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf,ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16,6y24.fq.gz,fastq,569424550.0,11388491.0,E MTAB 2194:6y24.fq.gz,0:50 1:0,A:149287318;C:136121879;G:135445765;T:148560272;N:9316,50,0,,,149287318,136121879,135445765,148560272,9316,ERX373255,ERS391754,ERA280282,CAS-MPG PICB|ArrayExpress,CAS-MPG PICB|ArrayExpress,1,0.93486,,0.0893,,0.68751,,0.46133,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,random_priming,trueseq,bulk,unknown,unknown,,China,2014-04-01,Multi-stage,Embryo,Whole Organism,All anatomical structures 10657,ERR406895,ERX373254,ERS391753,ERP004564,PRJEB5188,YD embryos 8 hpf 24 hpf 32 hpf,E-MTAB-2194,Transcriptome Analysis,Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity a poorly understood mechanism that responds to environmental cues from early to late developmental stages. In this study we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability we partially remove the yolk during embryogenesis. Around 5 hpf we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8 24 hpf and 32 hpf we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.,,,Protocols: Zebrafish embryos in HANKS embryo buffer Around 5hpf sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2,13s8,SAMEA2299295,CAS-MPG PICB,ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:38Z|External Id:SAMEA2299295|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:38Z|INSDC status:public|Submitter Id:E MTAB 2194:13s8|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:13s8|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb,,,,,,,,,Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf,E MTAB 2194:Unique sample ID.14,batchC 8hpf SP,YD embryos 8 hpf 24 hpf 32 hpf,Zebrafish embryos in HANKS embryo buffer Around 5hpf sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2,Experimental Factor: treatment:sham punctured embryos|Experimental Factor: time:8 hour,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,ERP004564,Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf,ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16,13s8.fq.gz,fastq,532141500.0,10642830.0,E MTAB 2194:13s8.fq.gz,0:50 1:0,A:139773245;C:127051350;G:126773752;T:138534560;N:8593,50,0,,,139773245,127051350,126773752,138534560,8593,ERX373254,ERS391753,ERA280282,CAS-MPG PICB|ArrayExpress,CAS-MPG PICB|ArrayExpress,1,0.93506,,0.0742,,0.74748,,0.47765,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,random_priming,trueseq,bulk,unknown,unknown,,China,2014-04-01,Multi-stage,Embryo,Whole Organism,All anatomical structures 10658,ERR406891,ERX373253,ERS391752,ERP004564,PRJEB5188,YD embryos 8 hpf 24 hpf 32 hpf,E-MTAB-2194,Transcriptome Analysis,Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity a poorly understood mechanism that responds to environmental cues from early to late developmental stages. In this study we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability we partially remove the yolk during embryogenesis. Around 5 hpf we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8 24 hpf and 32 hpf we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.,,,Protocols: Zebrafish embryos in HANKS embryo buffer Around 5hpf sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2,6s8,SAMEA2299294,CAS-MPG PICB,ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:38Z|External Id:SAMEA2299294|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:38Z|INSDC status:public|Submitter Id:E MTAB 2194:6s8|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:6s8|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb,,,,,,,,,Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf,E MTAB 2194:Unique sample ID.8,batchB 8hpf SP,YD embryos 8 hpf 24 hpf 32 hpf,Zebrafish embryos in HANKS embryo buffer Around 5hpf sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2,Experimental Factor: treatment:sham punctured embryos|Experimental Factor: time:8 hour,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,ERP004564,Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf,ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16,6s8.fq.gz,fastq,477620550.0,9552411.0,E MTAB 2194:6s8.fq.gz,0:50 1:0,A:127095393;C:112660046;G:111717464;T:126139686;N:7961,50,0,,,127095393,112660046,111717464,126139686,7961,ERX373253,ERS391752,ERA280282,CAS-MPG PICB|ArrayExpress,CAS-MPG PICB|ArrayExpress,1,0.93605,,0.08112,,0.74552,,0.46821,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,random_priming,trueseq,bulk,unknown,unknown,,China,2014-04-01,Multi-stage,Embryo,Whole Organism,All anatomical structures 10659,ERR406886,ERX373252,ERS391751,ERP004564,PRJEB5188,YD embryos 8 hpf 24 hpf 32 hpf,E-MTAB-2194,Transcriptome Analysis,Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity a poorly understood mechanism that responds to environmental cues from early to late developmental stages. In this study we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability we partially remove the yolk during embryogenesis. Around 5 hpf we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8 24 hpf and 32 hpf we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.,,,Protocols: Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2,6y8,SAMEA2299293,CAS-MPG PICB,ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:38Z|External Id:SAMEA2299293|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:38Z|INSDC status:public|Submitter Id:E MTAB 2194:6y8|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:6y8|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb,,,,,,,,,Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf,E MTAB 2194:Unique sample ID.7,batchB 8hpf YD,YD embryos 8 hpf 24 hpf 32 hpf,Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2,Experimental Factor: treatment:yolk|Experimental Factor: time:8 hour,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,ERP004564,Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf,ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16,6y8.fq.gz,fastq,508637450.0,10172749.0,E MTAB 2194:6y8.fq.gz,0:50 1:0,A:135377293;C:119833844;G:119447157;T:133970958;N:8198,50,0,,,135377293,119833844,119447157,133970958,8198,ERX373252,ERS391751,ERA280282,CAS-MPG PICB|ArrayExpress,CAS-MPG PICB|ArrayExpress,1,0.93203,,0.07833,,0.73744,,0.47586,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,random_priming,trueseq,bulk,unknown,unknown,,China,2014-04-01,Multi-stage,Embryo,Whole Organism,All anatomical structures 10660,ERR406892,ERX373251,ERS391750,ERP004564,PRJEB5188,YD embryos 8 hpf 24 hpf 32 hpf,E-MTAB-2194,Transcriptome Analysis,Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity a poorly understood mechanism that responds to environmental cues from early to late developmental stages. In this study we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability we partially remove the yolk during embryogenesis. Around 5 hpf we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8 24 hpf and 32 hpf we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.,,,Protocols: Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2,6y32,SAMEA2299292,CAS-MPG PICB,ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:37Z|External Id:SAMEA2299292|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:37Z|INSDC status:public|Submitter Id:E MTAB 2194:6y32|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:6y32|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb,,,,,,,,,Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf,E MTAB 2194:Unique sample ID.11,batchB 32hpf YD,YD embryos 8 hpf 24 hpf 32 hpf,Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2,Experimental Factor: treatment:yolk|Experimental Factor: time:32 hour,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,ERP004564,Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf,ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16,6y32.fq.gz,fastq,568482400.0,11369648.0,E MTAB 2194:6y32.fq.gz,0:50 1:0,A:149679881;C:135411801;G:134312216;T:149069222;N:9280,50,0,,,149679881,135411801,134312216,149069222,9280,ERX373251,ERS391750,ERA280282,CAS-MPG PICB|ArrayExpress,CAS-MPG PICB|ArrayExpress,1,0.93184,,0.104,,0.68128,,0.47652,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,random_priming,trueseq,bulk,unknown,unknown,,China,2014-04-01,Multi-stage,Embryo,Whole Organism,All anatomical structures 10661,ERR406897,ERX373250,ERS391749,ERP004564,PRJEB5188,YD embryos 8 hpf 24 hpf 32 hpf,E-MTAB-2194,Transcriptome Analysis,Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity a poorly understood mechanism that responds to environmental cues from early to late developmental stages. In this study we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability we partially remove the yolk during embryogenesis. Around 5 hpf we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8 24 hpf and 32 hpf we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.,,,Protocols: Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2,5y8,SAMEA2299291,CAS-MPG PICB,ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:37Z|External Id:SAMEA2299291|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:37Z|INSDC status:public|Submitter Id:E MTAB 2194:5y8|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:5y8|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb,,,,,,,,,Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf,E MTAB 2194:Unique sample ID.1,batchA 8hpf YD,YD embryos 8 hpf 24 hpf 32 hpf,Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2,Experimental Factor: treatment:yolk|Experimental Factor: time:8 hour,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,ERP004564,Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf,ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16,5y8.fq.gz,fastq,497573200.0,9951464.0,E MTAB 2194:5y8.fq.gz,0:50 1:0,A:134128000;C:115688460;G:114668036;T:133080206;N:8498,50,0,,,134128000,115688460,114668036,133080206,8498,ERX373250,ERS391749,ERA280282,CAS-MPG PICB|ArrayExpress,CAS-MPG PICB|ArrayExpress,1,0.93519,,0.07057,,0.73511,,0.47977,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,random_priming,trueseq,bulk,unknown,unknown,,China,2014-04-01,Multi-stage,Embryo,Whole Organism,All anatomical structures 10662,ERR406889,ERX373249,ERS391748,ERP004564,PRJEB5188,YD embryos 8 hpf 24 hpf 32 hpf,E-MTAB-2194,Transcriptome Analysis,Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity a poorly understood mechanism that responds to environmental cues from early to late developmental stages. In this study we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability we partially remove the yolk during embryogenesis. Around 5 hpf we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8 24 hpf and 32 hpf we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.,,,Protocols: Zebrafish embryos in HANKS embryo buffer Around 5hpf sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2,13s32,SAMEA2299290,CAS-MPG PICB,ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:37Z|External Id:SAMEA2299290|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:37Z|INSDC status:public|Submitter Id:E MTAB 2194:13s32|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:13s32|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb,,,,,,,,,Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf,E MTAB 2194:Unique sample ID.19,batchC 32hpf SP,YD embryos 8 hpf 24 hpf 32 hpf,Zebrafish embryos in HANKS embryo buffer Around 5hpf sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2,Experimental Factor: treatment:sham punctured embryos|Experimental Factor: time:32 hour,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,ERP004564,Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf,ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16,13s32.fq.gz,fastq,637724150.0,12754483.0,E MTAB 2194:13s32.fq.gz,0:50 1:0,A:165500205;C:154383334;G:152953181;T:164877160;N:10270,50,0,,,165500205,154383334,152953181,164877160,10270,ERX373249,ERS391748,ERA280282,CAS-MPG PICB|ArrayExpress,CAS-MPG PICB|ArrayExpress,1,0.93998,,0.08954,,0.68146,,0.4729,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,random_priming,trueseq,bulk,unknown,unknown,,China,2014-04-01,Multi-stage,Embryo,Whole Organism,All anatomical structures 10663,ERR406890,ERX373248,ERS391747,ERP004564,PRJEB5188,YD embryos 8 hpf 24 hpf 32 hpf,E-MTAB-2194,Transcriptome Analysis,Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity a poorly understood mechanism that responds to environmental cues from early to late developmental stages. In this study we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability we partially remove the yolk during embryogenesis. Around 5 hpf we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8 24 hpf and 32 hpf we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.,,,Protocols: Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2,13y24,SAMEA2299289,CAS-MPG PICB,ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:26Z|External Id:SAMEA2299289|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:26Z|INSDC status:public|Submitter Id:E MTAB 2194:13y24|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:13y24|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb,,,,,,,,,Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf,E MTAB 2194:Unique sample ID.15,batchC 24hpf YD,YD embryos 8 hpf 24 hpf 32 hpf,Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2,Experimental Factor: treatment:yolk|Experimental Factor: time:24 hour,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,ERP004564,Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf,ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16,13y24.fq.gz,fastq,834725800.0,16694516.0,E MTAB 2194:13y24.fq.gz,0:50 1:0,A:216896952;C:201332171;G:200308143;T:216174965;N:13569,50,0,,,216896952,201332171,200308143,216174965,13569,ERX373248,ERS391747,ERA280282,CAS-MPG PICB|ArrayExpress,CAS-MPG PICB|ArrayExpress,1,0.9358,,0.07569,,0.68757,,0.46994,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,random_priming,trueseq,bulk,unknown,unknown,,China,2014-04-01,Multi-stage,Embryo,Whole Organism,All anatomical structures 10664,ERR406900,ERX373247,ERS391746,ERP004564,PRJEB5188,YD embryos 8 hpf 24 hpf 32 hpf,E-MTAB-2194,Transcriptome Analysis,Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity a poorly understood mechanism that responds to environmental cues from early to late developmental stages. In this study we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability we partially remove the yolk during embryogenesis. Around 5 hpf we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8 24 hpf and 32 hpf we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.,,,Protocols: Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2,13y8,SAMEA2299288,CAS-MPG PICB,ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:26Z|External Id:SAMEA2299288|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:26Z|INSDC status:public|Submitter Id:E MTAB 2194:13y8|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:13y8|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb,,,,,,,,,Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf,E MTAB 2194:Unique sample ID.13,batchC 8hpf YD,YD embryos 8 hpf 24 hpf 32 hpf,Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2,Experimental Factor: treatment:yolk|Experimental Factor: time:8 hour,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,ERP004564,Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf,ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16,13y8.fq.gz,fastq,457245150.0,9144903.0,E MTAB 2194:13y8.fq.gz,0:50 1:0,A:119648940;C:109589521;G:109491446;T:118507707;N:7536,50,0,,,119648940,109589521,109491446,118507707,7536,ERX373247,ERS391746,ERA280282,CAS-MPG PICB|ArrayExpress,CAS-MPG PICB|ArrayExpress,1,0.93146,,0.0681,,0.73718,,0.47464,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,random_priming,trueseq,bulk,unknown,unknown,,China,2014-04-01,Multi-stage,Embryo,Whole Organism,All anatomical structures 10665,ERR406884,ERX373246,ERS391745,ERP004564,PRJEB5188,YD embryos 8 hpf 24 hpf 32 hpf,E-MTAB-2194,Transcriptome Analysis,Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity a poorly understood mechanism that responds to environmental cues from early to late developmental stages. In this study we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability we partially remove the yolk during embryogenesis. Around 5 hpf we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8 24 hpf and 32 hpf we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.,,,Protocols: Zebrafish embryos in HANKS embryo buffer Around 5hpf sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2,6s32,SAMEA2299287,CAS-MPG PICB,ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:26Z|External Id:SAMEA2299287|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:26Z|INSDC status:public|Submitter Id:E MTAB 2194:6s32|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:6s32|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb,,,,,,,,,Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf,E MTAB 2194:Unique sample ID.12,batchB 32hpf SP,YD embryos 8 hpf 24 hpf 32 hpf,Zebrafish embryos in HANKS embryo buffer Around 5hpf sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2,Experimental Factor: treatment:sham punctured embryos|Experimental Factor: time:32 hour,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,ERP004564,Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf,ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16,6s32.fq.gz,fastq,652353200.0,13047064.0,E MTAB 2194:6s32.fq.gz,0:50 1:0,A:170844587;C:156203331;G:155264927;T:170029850;N:10505,50,0,,,170844587,156203331,155264927,170029850,10505,ERX373246,ERS391745,ERA280282,CAS-MPG PICB|ArrayExpress,CAS-MPG PICB|ArrayExpress,1,0.93785,,0.09102,,0.68554,,0.46397,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,random_priming,trueseq,bulk,unknown,unknown,,China,2014-04-01,Multi-stage,Embryo,Whole Organism,All anatomical structures 10666,ERR406901,ERX373245,ERS391744,ERP004564,PRJEB5188,YD embryos 8 hpf 24 hpf 32 hpf,E-MTAB-2194,Transcriptome Analysis,Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity a poorly understood mechanism that responds to environmental cues from early to late developmental stages. In this study we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability we partially remove the yolk during embryogenesis. Around 5 hpf we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8 24 hpf and 32 hpf we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.,,,Protocols: Zebrafish embryos in HANKS embryo buffer Around 5hpf sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2,5s8,SAMEA2299286,CAS-MPG PICB,ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:26Z|External Id:SAMEA2299286|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:26Z|INSDC status:public|Submitter Id:E MTAB 2194:5s8|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:5s8|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb,,,,,,,,,Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf,E MTAB 2194:Unique sample ID.2,batchA 8hpf SP,YD embryos 8 hpf 24 hpf 32 hpf,Zebrafish embryos in HANKS embryo buffer Around 5hpf sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2,Experimental Factor: treatment:sham punctured embryos|Experimental Factor: time:8 hour,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,ERP004564,Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf,ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16,5s8.fq.gz,fastq,359298500.0,7185970.0,E MTAB 2194:5s8.fq.gz,0:50 1:0,A:96450828;C:83805020;G:83440885;T:95595844;N:5923,50,0,,,96450828,83805020,83440885,95595844,5923,ERX373245,ERS391744,ERA280282,CAS-MPG PICB|ArrayExpress,CAS-MPG PICB|ArrayExpress,1,0.93524,,0.07491,,0.73312,,0.47914,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,random_priming,trueseq,bulk,unknown,unknown,,China,2014-04-01,Multi-stage,Embryo,Whole Organism,All anatomical structures 11042,ERR9839781,ERX9385638,ERS12199238,ERP138294,PRJEB53494,Nano3P seq: transcriptome wide analysis of gene expression and tail dynamics using end capture nanopore cDNA sequencing,94bf5509-4622-4d5f-b7c5-6a14bdfac340,Other,RNA polyadenylation plays a central role in RNA maturation fate and stability. In response to developmental cues polyA tail lengths can vary affecting the translation efficiency and stability of mRNAs. Here we develop Nanopore three prime end capture sequencing Nano3P seq a novel method that relies on nanopore cDNA sequencing to simultaneously quantify RNA abundance tail composition and tail length dynamics at per read resolution. By employing a template switching based sequencing protocol Nano3P seq can sequence any given RNA molecule from its three prime end regardless of its polyadenylation status without xxx need for PCR amplification or ligation of RNA adapters. We demonstrate that Nano3P seq captures a wide diversity of RNA biotypes providing quantitative estimates of RNA abundance and tail lengths in mRNA lncRNA sn/snoRNA scaRNA and rRNA molecules. We find that in addition to mRNA and lncRNA polyA tails can be identified in 16S mitochondrial rRNA in both mouse and zebrafish models. Moreover we show that mRNA tail lengths are dynamically regulated during vertebrate embryogenesis at an isoform specific level correlating with mRNA decay. Finally we identify non A bases within polyA tails of various lengths and reveal their distribution during vertebrate embryogenesis. Overall Nano3P seq is a simple and robust method for accurately estimating transcript levels tail lengths and tail composition heterogeneity in individual reads with minimal library preparation biases both in the coding and non coding transcriptome.,ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10,,Zebrafish Ribodepleted RNA 2hpf 4hpf 6hpf,Zebrafish Ribodepleted Rep3,SAMEA110100413,CENTER FOR GENOMIC REGULATION (CRG),ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10|External Id:SAMEA110100413|INSDC center alias:CENTER FOR GENOMIC REGULATION CRG|INSDC center name:CENTER FOR GENOMIC REGULATION CRG|INSDC first public:2022 10 10T00:20:53Z|INSDC last update:2022 10 10T00:20:53Z|INSDC status:public|Submitter Id:Zebrafish Ribodepleted Rep3|common name:zebrafish|sample name:Zebrafish Ribodepleted Rep3,,,,,,,,,MinION sequencing,ena EXPERIMENT TAB 13 06 2022 16:07:52:807 817,cDNA897892 ZFRDR3,1,,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,OXFORD_NANOPORE,MinION,,ERP138294,MinION sequencing,ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10,cDNA897892_ZFRDR3.tar.gz,nanopore,848659575.0,587586.0,ena RUN TAB 13 06 2022 16:07:52:808 818,0:1444.32,A:210205014;C:186527780;G:188214279;T:263712502;N:0,1444,,,,210205014,186527780,188214279,263712502,0,ERX9385638,ERS12199238,ERA15547404,CENTER FOR GENOMIC REGULATION (CRG)|European Nucleotide Archive,CENTER FOR GENOMIC REGULATION (CRG),,,,,,,,,,,,,,,ont,ont,3prime,poly_a,unknown,bulk,unknown,unknown,,Spain,2022-10-10,Multi-stage,Embryo,Undetermined,Embryo Imprecise 11043,ERR9839780,ERX9385637,ERS12199237,ERP138294,PRJEB53494,Nano3P seq: transcriptome wide analysis of gene expression and tail dynamics using end capture nanopore cDNA sequencing,94bf5509-4622-4d5f-b7c5-6a14bdfac340,Other,RNA polyadenylation plays a central role in RNA maturation fate and stability. In response to developmental cues polyA tail lengths can vary affecting the translation efficiency and stability of mRNAs. Here we develop Nanopore three prime end capture sequencing Nano3P seq a novel method that relies on nanopore cDNA sequencing to simultaneously quantify RNA abundance tail composition and tail length dynamics at per read resolution. By employing a template switching based sequencing protocol Nano3P seq can sequence any given RNA molecule from its three prime end regardless of its polyadenylation status without xxx need for PCR amplification or ligation of RNA adapters. We demonstrate that Nano3P seq captures a wide diversity of RNA biotypes providing quantitative estimates of RNA abundance and tail lengths in mRNA lncRNA sn/snoRNA scaRNA and rRNA molecules. We find that in addition to mRNA and lncRNA polyA tails can be identified in 16S mitochondrial rRNA in both mouse and zebrafish models. Moreover we show that mRNA tail lengths are dynamically regulated during vertebrate embryogenesis at an isoform specific level correlating with mRNA decay. Finally we identify non A bases within polyA tails of various lengths and reveal their distribution during vertebrate embryogenesis. Overall Nano3P seq is a simple and robust method for accurately estimating transcript levels tail lengths and tail composition heterogeneity in individual reads with minimal library preparation biases both in the coding and non coding transcriptome.,ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10,,Zebrafish Ribodepleted RNA 2hpf 4hpf 6hpf,Zebrafish Ribodepleted Rep2,SAMEA110100412,CENTER FOR GENOMIC REGULATION (CRG),ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10|External Id:SAMEA110100412|INSDC center alias:CENTER FOR GENOMIC REGULATION CRG|INSDC center name:CENTER FOR GENOMIC REGULATION CRG|INSDC first public:2022 10 10T00:20:53Z|INSDC last update:2022 10 10T00:20:53Z|INSDC status:public|Submitter Id:Zebrafish Ribodepleted Rep2|common name:zebrafish|sample name:Zebrafish Ribodepleted Rep2,,,,,,,,,MinION sequencing,ena EXPERIMENT TAB 13 06 2022 16:07:52:807 815,cDNA123791 ZFRDR2,1,,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,OXFORD_NANOPORE,MinION,,ERP138294,MinION sequencing,ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10,cDNA123791_ZFRDR2.tar.gz,nanopore,2229275175.0,1955617.0,ena RUN TAB 13 06 2022 16:07:52:807 816,0:1139.93,A:533543922;C:498938137;G:515833119;T:680959997;N:0,1139,,,,533543922,498938137,515833119,680959997,0,ERX9385637,ERS12199237,ERA15547404,CENTER FOR GENOMIC REGULATION (CRG)|European Nucleotide Archive,CENTER FOR GENOMIC REGULATION (CRG),,,,,,,,,,,,,,,ont,ont,3prime,poly_a,unknown,bulk,unknown,unknown,,Spain,2022-10-10,Multi-stage,Embryo,Undetermined,Embryo Imprecise 11044,ERR9839779,ERX9385636,ERS12199236,ERP138294,PRJEB53494,Nano3P seq: transcriptome wide analysis of gene expression and tail dynamics using end capture nanopore cDNA sequencing,94bf5509-4622-4d5f-b7c5-6a14bdfac340,Other,RNA polyadenylation plays a central role in RNA maturation fate and stability. In response to developmental cues polyA tail lengths can vary affecting the translation efficiency and stability of mRNAs. Here we develop Nanopore three prime end capture sequencing Nano3P seq a novel method that relies on nanopore cDNA sequencing to simultaneously quantify RNA abundance tail composition and tail length dynamics at per read resolution. By employing a template switching based sequencing protocol Nano3P seq can sequence any given RNA molecule from its three prime end regardless of its polyadenylation status without xxx need for PCR amplification or ligation of RNA adapters. We demonstrate that Nano3P seq captures a wide diversity of RNA biotypes providing quantitative estimates of RNA abundance and tail lengths in mRNA lncRNA sn/snoRNA scaRNA and rRNA molecules. We find that in addition to mRNA and lncRNA polyA tails can be identified in 16S mitochondrial rRNA in both mouse and zebrafish models. Moreover we show that mRNA tail lengths are dynamically regulated during vertebrate embryogenesis at an isoform specific level correlating with mRNA decay. Finally we identify non A bases within polyA tails of various lengths and reveal their distribution during vertebrate embryogenesis. Overall Nano3P seq is a simple and robust method for accurately estimating transcript levels tail lengths and tail composition heterogeneity in individual reads with minimal library preparation biases both in the coding and non coding transcriptome.,ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10,,Zebrafish Ribodepleted RNA 2hpf 4hpf 6hpf,Zebrafish Ribodepleted Rep1,SAMEA110100411,CENTER FOR GENOMIC REGULATION (CRG),ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10|External Id:SAMEA110100411|INSDC center alias:CENTER FOR GENOMIC REGULATION CRG|INSDC center name:CENTER FOR GENOMIC REGULATION CRG|INSDC first public:2022 10 10T00:20:53Z|INSDC last update:2022 10 10T00:20:53Z|INSDC status:public|Submitter Id:Zebrafish Ribodepleted Rep1|common name:zebrafish|sample name:Zebrafish Ribodepleted Rep1,,,,,,,,,MinION sequencing,ena EXPERIMENT TAB 13 06 2022 16:07:52:807 813,cDNA786327 ZFRDR1,1,,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,OXFORD_NANOPORE,MinION,,ERP138294,MinION sequencing,ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10,cDNA786327_ZFRDR1.tar.gz,nanopore,1900613556.0,1660167.0,ena RUN TAB 13 06 2022 16:07:52:807 814,0:1144.83,A:473050820;C:438054520;G:425169743;T:564338473;N:0,1144,,,,473050820,438054520,425169743,564338473,0,ERX9385636,ERS12199236,ERA15547404,CENTER FOR GENOMIC REGULATION (CRG)|European Nucleotide Archive,CENTER FOR GENOMIC REGULATION (CRG),,,,,,,,,,,,,,,ont,ont,3prime,poly_a,unknown,bulk,unknown,unknown,,Spain,2022-10-10,Multi-stage,Embryo,Undetermined,Embryo Imprecise 11130,ERR9979395,ERX9520370,ERS12499848,ERP139765,PRJEB54901,Single cell RNA sequencing of germ free zebrafish embryos,E-MTAB-11984,Transcriptome Analysis,The present study was conducted in the frame of the EU funded Graphene Flagship project. We previously evaluated the impact of graphene oxide GO on the gut microbiome in adult zebrafish by performing 16S rRNA gene sequencing in wild type versus AhR deficient zebrafish. Here we performed single cell RNA sequencing 10x Genomics on whole dissociated germ free GF zebrafish embryos exposed at 5 dpf to GO plus the microbial metabolite butyrate to gain insight into the impact on specific cell populations in GF zebrafish.,ENA FIRST PUBLIC:2022 07 22|ENA LAST UPDATE:2022 07 22,,Protocols: The generation of germ free zebrafish wild type AB followed previously established protocols [1]. In brief 2 hpf embryos were transferred to petri dishes with sterile E3 medium supplemented with ampicillin 100 μg/mL kanamycin 5 μg/mL and amphotericin B 250 ng/mL and incubated at 28°C. At 50% epiboly up to shield stage 6 hpf the embryos were surface disinfected with 0.1% of polyvinylpyrroidone iodine PVP I for exactly 2 min followed by 0.003% sterile bleach immersion for 18 min. The embryos were then rinsed with sterile E3 medium transferred to flasks and incubated at 28°C. The viability was monitored and sterile medium was refreshed daily. At day 4 the hatched embryos were used for the sterility validation. A day 5 germ free zebrafish were exposed to the combination of GO 30 µg/mL and butyrate 2.5 mM for 24 h. GO and BA were pre incubated for 1 h prior to the exposure. Twenty larvae were used as one replicate four replicates i.e. eighty larvae in total were used for each condition. post the exposure zebrafish larvae were dissociated for single cell suspension following the published protocol [2]. Briefly zebrafish larvae were euthanized with 0.01% of tricaine for 5 min collected in 1.5 mL tube and washed with PBS for three times. The dissociation was initiated by adding 500 μL of pre warmed enzyme mix containing 460 μL of 0.25% trypsin EDTA Gibco and 40 μL of collagenase Sigma Aldrich at the concentration of 100 mg/mL followed by mechanical dissociation using P1000 and then P200 pipette tips in heat block at 30 °C until the tissue was no longer visible about 10 min. The dissociation was then stopped by adding 800 μL DMEM Corning Cat# 10 013 CV with 10% FBS Fisher Scientific. The cell pellets were collected by centrifuging at 1000 rpm for 5 min at RT followed by washing with PBS. The cells were next resuspended in 0.5 mL DMEM with 10% FBS. Four replicates from each condition were pooled together at this step and filtered through 40 μm nylon mesh with an additional washing using DMEM with 10% FBS. The cell suspension was then stained with a fluorescent DNA dye DRAQ7 to exclude non viable cells Invitrogen Cat# D15106 at the dose of 3 μM for 10 min at room temperature before the fluorescence activated cell sorting BD FACSAria III BD Biosciences NJ USA. The sorting was performed using a 100 microns nozzle with the flow rate of 2 and temperature control at 4 °C and gated based on forward scatter and DRAQ7. The DRAQ7 negative cells of each sample were FACS sorted into the tubes containing DMEM with 10% FBS and placed on ice immediately post the sorting. The cells were then proceeded with the single cell RNA sequencing analysis. 1. Pham LN Kanther M Semova I & Rawls JF. Methods for generating and colonizing gnotobiotic zebrafish. Nat. Protoc. 3 1862 1875 2008. 2. Bresciani E Broadbridge E Liu PP An efficient dissociation protocol for generation of single cell suspension from zebrafish embryos and larvae MethodsX. 5 1287 1290 2018. Single cell RNA sequencing scRNA seq was performed by Eukaryotic Single Cell Genomics Facility at SciLifeLab Stockholm. The single cells collected from FACS sorting were loaded on a 10x GemCode Single Cell Instrument 10x Genomics Pleasanton USA to generate single cell gel beads in emulsion GEMs using the Chromium Next GEM Single Cell three prime GEM Library & Gel Bead Kit v3.1 10x Genomics following the manufacture's protocol. Briefly GEMs were generated by combining barcoded Single Cell three prime v3.1 Gel Beads a Master Mix containing cells and Partitioning Oil onto Chromium Next GEM Chip G. Following GEMs generation the Gel Bead was dissolved primers containing an Illumina TruSeq Read 1read 1 sequencing primer 16 nt 10x Barcode 12 nt unique molecular identifier UMI and 30 nt polydT sequence were released and the co partitioned cells were lysed. The nucleic acid library construction was performed using the Chromium Next GEM Single Cell three prime GEM Library & Gel Bead Kit v3.1 10x Genomics 16 rxns PN 1000268 following the manufacture's protocol. post GEMs generation primers were mixed with the cell lysate and a Master Mix containing reverse transcription RT reagents to produce barcoded full length cDNA from polyadenylated mRNA. Silane magnetic beads were used to purify the first strand cDNA from the post GEM RT reaction mixture which included leftover biochemical reagents and primers. Barcoded full length cDNA was amplified via PCR to generate sufficient mass for library construction. Enzymatic fragmentation and size selection were used to optimize the cDNA amplicon size. P5 P7 i7 and i5 sample indexes and TruSeq Read 2 read 2 primer sequence were added via End Repair A tailing Adaptor Ligation and PCR. The final libraries containing the P5 and P7 primers used in Illumina amplification were prepared for an estimated 5000 nuclei per sample.,Sample 2 WT GO+BA,SAMEA110401656,"Institute of Environmental Medicine, Karolinska Institutet",ENA FIRST PUBLIC:2022 07 22|ENA LAST UPDATE:2022 07 22|External Id:SAMEA110401656|INSDC center alias:Institute of Environmental Medicine Karolinska Institutet|INSDC center name:Institute of Environmental Medicine Karolinska Institutet|INSDC first public:2022 07 22T16:26:50Z|INSDC last update:2022 07 22T16:26:50Z|INSDC status:public|Submitter Id:E MTAB 11984:Sample 2 WT GO+BA|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:wild type genotype|individual:pool of 80 individuals|isolate:not applicable|organism part:whole organism|sample name:E MTAB 11984:Sample 2 WT GO+BA|sex:not available|stimulus:graphene oxide 30 ug/mL and butyrate 2.5 mM|strain:AB,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; Single cell RNA sequencing of germ free zebrafish embryos,E MTAB 11984:Sample 2 WT GO+BA p,Sample 2 WT GO+BA p,Single cell RNA sequencing of germ free zebrafish embryos,The generation of germ free zebrafish wild type AB followed previously established protocols [1]. In brief 2 hpf embryos were transferred to petri dishes with sterile E3 medium supplemented with ampicillin 100 μg/mL kanamycin 5 μg/mL and amphotericin B 250 ng/mL and incubated at 28°C. At 50% epiboly up to shield stage 6 hpf the embryos were surface disinfected with 0.1% of polyvinylpyrroidone iodine PVP I for exactly 2 min followed by 0.003% sterile bleach immersion for 18 min. The embryos were then rinsed with sterile E3 medium transferred to flasks and incubated at 28°C. The viability was monitored and sterile medium was refreshed daily. At day 4 the hatched embryos were used for the sterility validation. A day 5 germ free zebrafish were exposed to the combination of GO 30 µg/mL and butyrate 2.5 mM for 24 h. GO and BA were pre incubated for 1 h prior to the exposure. Twenty larvae were used as one replicate four replicates i.e. eighty larvae in total were used for each condition. post the exposure zebrafish larvae were dissociated for single cell suspension following the published protocol [2]. Briefly zebrafish larvae were euthanized with 0.01% of tricaine for 5 min collected in 1.5 mL tube and washed with PBS for three times. The dissociation was initiated by adding 500 μL of pre warmed enzyme mix containing 460 μL of 0.25% trypsin EDTA Gibco and 40 μL of collagenase Sigma Aldrich at the concentration of 100 mg/mL followed by mechanical dissociation using P1000 and then P200 pipette tips in heat block at 30 °C until the tissue was no longer visible about 10 min. The dissociation was then stopped by adding 800 μL DMEM Corning Cat# 10 013 CV with 10% FBS Fisher Scientific. The cell pellets were collected by centrifuging at 1000 rpm for 5 min at RT followed by washing with PBS. The cells were next resuspended in 0.5 mL DMEM with 10% FBS. Four replicates from each condition were pooled together at this step and filtered through 40 μm nylon mesh with an additional washing using DMEM with 10% FBS. The cell suspension was then stained with a fluorescent DNA dye DRAQ7 to exclude non viable cells Invitrogen Cat# D15106 at the dose of 3 μM for 10 min at room temperature before the fluorescence activated cell sorting BD FACSAria III BD Biosciences NJ USA. The sorting was performed using a 100 microns nozzle with the flow rate of 2 and temperature control at 4 °C and gated based on forward scatter and DRAQ7. The DRAQ7 negative cells of each sample were FACS sorted into the tubes containing DMEM with 10% FBS and placed on ice immediately post the sorting. The cells were then proceeded with the single cell RNA sequencing analysis. 1. Pham LN Kanther M Semova I & Rawls JF. Methods for generating and colonizing gnotobiotic zebrafish. Nat. Protoc. 3 1862 1875 2008. 2. Bresciani E Broadbridge E Liu PP An efficient dissociation protocol for generation of single cell suspension from zebrafish embryos and larvae MethodsX. 5 1287 1290 2018. Single cell RNA sequencing scRNA seq was performed by Eukaryotic Single Cell Genomics Facility at SciLifeLab Stockholm. The single cells collected from FACS sorting were loaded on a 10x GemCode Single Cell Instrument 10x Genomics Pleasanton USA to generate single cell gel beads in emulsion GEMs using the Chromium Next GEM Single Cell three prime GEM Library & Gel Bead Kit v3.1 10x Genomics following the manufacture's protocol. Briefly GEMs were generated by combining barcoded Single Cell three prime v3.1 Gel Beads a Master Mix containing cells and Partitioning Oil onto Chromium Next GEM Chip G. Following GEMs generation the Gel Bead was dissolved primers containing an Illumina TruSeq Read 1read 1 sequencing primer 16 nt 10x Barcode 12 nt unique molecular identifier UMI and 30 nt polydT sequence were released and the co partitioned cells were lysed. The nucleic acid library construction was performed using the Chromium Next GEM Single Cell three prime GEM Library & Gel Bead Kit v3.1 10x Genomics 16 rxns PN 1000268 following the manufacture's protocol. post GEMs generation primers were mixed with the cell lysate and a Master Mix containing reverse transcription RT reagents to produce barcoded full length cDNA from polyadenylated mRNA. Silane magnetic beads were used to purify the first strand cDNA from the post GEM RT reaction mixture which included leftover biochemical reagents and primers. Barcoded full length cDNA was amplified via PCR to generate sufficient mass for library construction. Enzymatic fragmentation and size selection were used to optimize the cDNA amplicon size. P5 P7 i7 and i5 sample indexes and TruSeq Read 2 read 2 primer sequence were added via End Repair A tailing Adaptor Ligation and PCR. The final libraries containing the P5 and P7 primers used in Illumina amplification were prepared for an estimated 5000 nuclei per sample.,Experimental Factor: stimulus:graphene oxide 30 ug/mL and butyrate 2.5 mM,AMPLICON,TRANSCRIPTOMIC SINGLE CELL,size fractionation,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP139765,Illumina NovaSeq 6000 paired end sequencing; Single cell RNA sequencing of germ free zebrafish embryos,ENA FIRST PUBLIC:2022 07 22|ENA LAST UPDATE:2022 07 22,P22202_7002_S2_L002_R1_001.fastq.gz P22202_7002_S2_L002_R2_001.fastq.gz,fastq fastq,18144406998.0,153766161.0,E MTAB 11984:P22202 7002 S2 L002,0:28 1:90,A:5277424121;C:3880928155;G:4118706097;T:4866649878;N:698747,28,90,,,5277424121,3880928155,4118706097,4866649878,698747,ERX9520370,ERS12499848,ERA16483151,"Institute of Environmental Medicine, Karolinska Institutet|European Nucleotide Archive","Institute of Environmental Medicine, Karolinska Institutet|European Nucleotide Archive",2,0.0109,0.90145,0.0053,0.21373,0.98746,0.79423,0.41198,0.54447,28,90,T,B,sc-like readlen,illumina,novaseq_era,full_length,size_fractionation,trueseq,sc,single_cell_droplet,10x,,Sweden,2022-07-22,Multi-stage,Embryo,Whole Organism,All anatomical structures 11131,ERR9979394,ERX9520370,ERS12499848,ERP139765,PRJEB54901,Single cell RNA sequencing of germ free zebrafish embryos,E-MTAB-11984,Transcriptome Analysis,The present study was conducted in the frame of the EU funded Graphene Flagship project. We previously evaluated the impact of graphene oxide GO on the gut microbiome in adult zebrafish by performing 16S rRNA gene sequencing in wild type versus AhR deficient zebrafish. Here we performed single cell RNA sequencing 10x Genomics on whole dissociated germ free GF zebrafish embryos exposed at 5 dpf to GO plus the microbial metabolite butyrate to gain insight into the impact on specific cell populations in GF zebrafish.,ENA FIRST PUBLIC:2022 07 22|ENA LAST UPDATE:2022 07 22,,Protocols: The generation of germ free zebrafish wild type AB followed previously established protocols [1]. In brief 2 hpf embryos were transferred to petri dishes with sterile E3 medium supplemented with ampicillin 100 μg/mL kanamycin 5 μg/mL and amphotericin B 250 ng/mL and incubated at 28°C. At 50% epiboly up to shield stage 6 hpf the embryos were surface disinfected with 0.1% of polyvinylpyrroidone iodine PVP I for exactly 2 min followed by 0.003% sterile bleach immersion for 18 min. The embryos were then rinsed with sterile E3 medium transferred to flasks and incubated at 28°C. The viability was monitored and sterile medium was refreshed daily. At day 4 the hatched embryos were used for the sterility validation. A day 5 germ free zebrafish were exposed to the combination of GO 30 µg/mL and butyrate 2.5 mM for 24 h. GO and BA were pre incubated for 1 h prior to the exposure. Twenty larvae were used as one replicate four replicates i.e. eighty larvae in total were used for each condition. post the exposure zebrafish larvae were dissociated for single cell suspension following the published protocol [2]. Briefly zebrafish larvae were euthanized with 0.01% of tricaine for 5 min collected in 1.5 mL tube and washed with PBS for three times. The dissociation was initiated by adding 500 μL of pre warmed enzyme mix containing 460 μL of 0.25% trypsin EDTA Gibco and 40 μL of collagenase Sigma Aldrich at the concentration of 100 mg/mL followed by mechanical dissociation using P1000 and then P200 pipette tips in heat block at 30 °C until the tissue was no longer visible about 10 min. The dissociation was then stopped by adding 800 μL DMEM Corning Cat# 10 013 CV with 10% FBS Fisher Scientific. The cell pellets were collected by centrifuging at 1000 rpm for 5 min at RT followed by washing with PBS. The cells were next resuspended in 0.5 mL DMEM with 10% FBS. Four replicates from each condition were pooled together at this step and filtered through 40 μm nylon mesh with an additional washing using DMEM with 10% FBS. The cell suspension was then stained with a fluorescent DNA dye DRAQ7 to exclude non viable cells Invitrogen Cat# D15106 at the dose of 3 μM for 10 min at room temperature before the fluorescence activated cell sorting BD FACSAria III BD Biosciences NJ USA. The sorting was performed using a 100 microns nozzle with the flow rate of 2 and temperature control at 4 °C and gated based on forward scatter and DRAQ7. The DRAQ7 negative cells of each sample were FACS sorted into the tubes containing DMEM with 10% FBS and placed on ice immediately post the sorting. The cells were then proceeded with the single cell RNA sequencing analysis. 1. Pham LN Kanther M Semova I & Rawls JF. Methods for generating and colonizing gnotobiotic zebrafish. Nat. Protoc. 3 1862 1875 2008. 2. Bresciani E Broadbridge E Liu PP An efficient dissociation protocol for generation of single cell suspension from zebrafish embryos and larvae MethodsX. 5 1287 1290 2018. Single cell RNA sequencing scRNA seq was performed by Eukaryotic Single Cell Genomics Facility at SciLifeLab Stockholm. The single cells collected from FACS sorting were loaded on a 10x GemCode Single Cell Instrument 10x Genomics Pleasanton USA to generate single cell gel beads in emulsion GEMs using the Chromium Next GEM Single Cell three prime GEM Library & Gel Bead Kit v3.1 10x Genomics following the manufacture's protocol. Briefly GEMs were generated by combining barcoded Single Cell three prime v3.1 Gel Beads a Master Mix containing cells and Partitioning Oil onto Chromium Next GEM Chip G. Following GEMs generation the Gel Bead was dissolved primers containing an Illumina TruSeq Read 1read 1 sequencing primer 16 nt 10x Barcode 12 nt unique molecular identifier UMI and 30 nt polydT sequence were released and the co partitioned cells were lysed. The nucleic acid library construction was performed using the Chromium Next GEM Single Cell three prime GEM Library & Gel Bead Kit v3.1 10x Genomics 16 rxns PN 1000268 following the manufacture's protocol. post GEMs generation primers were mixed with the cell lysate and a Master Mix containing reverse transcription RT reagents to produce barcoded full length cDNA from polyadenylated mRNA. Silane magnetic beads were used to purify the first strand cDNA from the post GEM RT reaction mixture which included leftover biochemical reagents and primers. Barcoded full length cDNA was amplified via PCR to generate sufficient mass for library construction. Enzymatic fragmentation and size selection were used to optimize the cDNA amplicon size. P5 P7 i7 and i5 sample indexes and TruSeq Read 2 read 2 primer sequence were added via End Repair A tailing Adaptor Ligation and PCR. The final libraries containing the P5 and P7 primers used in Illumina amplification were prepared for an estimated 5000 nuclei per sample.,Sample 2 WT GO+BA,SAMEA110401656,"Institute of Environmental Medicine, Karolinska Institutet",ENA FIRST PUBLIC:2022 07 22|ENA LAST UPDATE:2022 07 22|External Id:SAMEA110401656|INSDC center alias:Institute of Environmental Medicine Karolinska Institutet|INSDC center name:Institute of Environmental Medicine Karolinska Institutet|INSDC first public:2022 07 22T16:26:50Z|INSDC last update:2022 07 22T16:26:50Z|INSDC status:public|Submitter Id:E MTAB 11984:Sample 2 WT GO+BA|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:wild type genotype|individual:pool of 80 individuals|isolate:not applicable|organism part:whole organism|sample name:E MTAB 11984:Sample 2 WT GO+BA|sex:not available|stimulus:graphene oxide 30 ug/mL and butyrate 2.5 mM|strain:AB,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; Single cell RNA sequencing of germ free zebrafish embryos,E MTAB 11984:Sample 2 WT GO+BA p,Sample 2 WT GO+BA p,Single cell RNA sequencing of germ free zebrafish embryos,The generation of germ free zebrafish wild type AB followed previously established protocols [1]. In brief 2 hpf embryos were transferred to petri dishes with sterile E3 medium supplemented with ampicillin 100 μg/mL kanamycin 5 μg/mL and amphotericin B 250 ng/mL and incubated at 28°C. At 50% epiboly up to shield stage 6 hpf the embryos were surface disinfected with 0.1% of polyvinylpyrroidone iodine PVP I for exactly 2 min followed by 0.003% sterile bleach immersion for 18 min. The embryos were then rinsed with sterile E3 medium transferred to flasks and incubated at 28°C. The viability was monitored and sterile medium was refreshed daily. At day 4 the hatched embryos were used for the sterility validation. A day 5 germ free zebrafish were exposed to the combination of GO 30 µg/mL and butyrate 2.5 mM for 24 h. GO and BA were pre incubated for 1 h prior to the exposure. Twenty larvae were used as one replicate four replicates i.e. eighty larvae in total were used for each condition. post the exposure zebrafish larvae were dissociated for single cell suspension following the published protocol [2]. Briefly zebrafish larvae were euthanized with 0.01% of tricaine for 5 min collected in 1.5 mL tube and washed with PBS for three times. The dissociation was initiated by adding 500 μL of pre warmed enzyme mix containing 460 μL of 0.25% trypsin EDTA Gibco and 40 μL of collagenase Sigma Aldrich at the concentration of 100 mg/mL followed by mechanical dissociation using P1000 and then P200 pipette tips in heat block at 30 °C until the tissue was no longer visible about 10 min. The dissociation was then stopped by adding 800 μL DMEM Corning Cat# 10 013 CV with 10% FBS Fisher Scientific. The cell pellets were collected by centrifuging at 1000 rpm for 5 min at RT followed by washing with PBS. The cells were next resuspended in 0.5 mL DMEM with 10% FBS. Four replicates from each condition were pooled together at this step and filtered through 40 μm nylon mesh with an additional washing using DMEM with 10% FBS. The cell suspension was then stained with a fluorescent DNA dye DRAQ7 to exclude non viable cells Invitrogen Cat# D15106 at the dose of 3 μM for 10 min at room temperature before the fluorescence activated cell sorting BD FACSAria III BD Biosciences NJ USA. The sorting was performed using a 100 microns nozzle with the flow rate of 2 and temperature control at 4 °C and gated based on forward scatter and DRAQ7. The DRAQ7 negative cells of each sample were FACS sorted into the tubes containing DMEM with 10% FBS and placed on ice immediately post the sorting. The cells were then proceeded with the single cell RNA sequencing analysis. 1. Pham LN Kanther M Semova I & Rawls JF. Methods for generating and colonizing gnotobiotic zebrafish. Nat. Protoc. 3 1862 1875 2008. 2. Bresciani E Broadbridge E Liu PP An efficient dissociation protocol for generation of single cell suspension from zebrafish embryos and larvae MethodsX. 5 1287 1290 2018. Single cell RNA sequencing scRNA seq was performed by Eukaryotic Single Cell Genomics Facility at SciLifeLab Stockholm. The single cells collected from FACS sorting were loaded on a 10x GemCode Single Cell Instrument 10x Genomics Pleasanton USA to generate single cell gel beads in emulsion GEMs using the Chromium Next GEM Single Cell three prime GEM Library & Gel Bead Kit v3.1 10x Genomics following the manufacture's protocol. Briefly GEMs were generated by combining barcoded Single Cell three prime v3.1 Gel Beads a Master Mix containing cells and Partitioning Oil onto Chromium Next GEM Chip G. Following GEMs generation the Gel Bead was dissolved primers containing an Illumina TruSeq Read 1read 1 sequencing primer 16 nt 10x Barcode 12 nt unique molecular identifier UMI and 30 nt polydT sequence were released and the co partitioned cells were lysed. The nucleic acid library construction was performed using the Chromium Next GEM Single Cell three prime GEM Library & Gel Bead Kit v3.1 10x Genomics 16 rxns PN 1000268 following the manufacture's protocol. post GEMs generation primers were mixed with the cell lysate and a Master Mix containing reverse transcription RT reagents to produce barcoded full length cDNA from polyadenylated mRNA. Silane magnetic beads were used to purify the first strand cDNA from the post GEM RT reaction mixture which included leftover biochemical reagents and primers. Barcoded full length cDNA was amplified via PCR to generate sufficient mass for library construction. Enzymatic fragmentation and size selection were used to optimize the cDNA amplicon size. P5 P7 i7 and i5 sample indexes and TruSeq Read 2 read 2 primer sequence were added via End Repair A tailing Adaptor Ligation and PCR. The final libraries containing the P5 and P7 primers used in Illumina amplification were prepared for an estimated 5000 nuclei per sample.,Experimental Factor: stimulus:graphene oxide 30 ug/mL and butyrate 2.5 mM,AMPLICON,TRANSCRIPTOMIC SINGLE CELL,size fractionation,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP139765,Illumina NovaSeq 6000 paired end sequencing; Single cell RNA sequencing of germ free zebrafish embryos,ENA FIRST PUBLIC:2022 07 22|ENA LAST UPDATE:2022 07 22,P22202_7002_S2_L001_R1_001.fastq.gz P22202_7002_S2_L001_R2_001.fastq.gz,fastq fastq,18458951574.0,156431793.0,E MTAB 11984:P22202 7002 S2 L001,0:28 1:90,A:5372920926;C:3946687814;G:4185647697;T:4953205454;N:489683,28,90,,,5372920926,3946687814,4185647697,4953205454,489683,ERX9520370,ERS12499848,ERA16483151,"Institute of Environmental Medicine, Karolinska Institutet|European Nucleotide Archive","Institute of Environmental Medicine, Karolinska Institutet|European Nucleotide Archive",2,0.01037,0.90168,0.0048,0.21246,0.98752,0.79297,0.42601,0.54996,28,90,T,B,sc-like readlen,illumina,novaseq_era,full_length,size_fractionation,trueseq,sc,single_cell_droplet,10x,,Sweden,2022-07-22,Multi-stage,Embryo,Whole Organism,All anatomical structures 11132,ERR9979392,ERX9520369,ERS12499847,ERP139765,PRJEB54901,Single cell RNA sequencing of germ free zebrafish embryos,E-MTAB-11984,Transcriptome Analysis,The present study was conducted in the frame of the EU funded Graphene Flagship project. We previously evaluated the impact of graphene oxide GO on the gut microbiome in adult zebrafish by performing 16S rRNA gene sequencing in wild type versus AhR deficient zebrafish. Here we performed single cell RNA sequencing 10x Genomics on whole dissociated germ free GF zebrafish embryos exposed at 5 dpf to GO plus the microbial metabolite butyrate to gain insight into the impact on specific cell populations in GF zebrafish.,ENA FIRST PUBLIC:2022 07 22|ENA LAST UPDATE:2022 07 22,,Protocols: The generation of germ free zebrafish wild type AB followed previously established protocols [1]. In brief 2 hpf embryos were transferred to petri dishes with sterile E3 medium supplemented with ampicillin 100 μg/mL kanamycin 5 μg/mL and amphotericin B 250 ng/mL and incubated at 28°C. At 50% epiboly up to shield stage 6 hpf the embryos were surface disinfected with 0.1% of polyvinylpyrroidone iodine PVP I for exactly 2 min followed by 0.003% sterile bleach immersion for 18 min. The embryos were then rinsed with sterile E3 medium transferred to flasks and incubated at 28°C. The viability was monitored and sterile medium was refreshed daily. At day 4 the hatched embryos were used for the sterility validation. A day 5 germ free zebrafish were exposed to the combination of GO 30 µg/mL and butyrate 2.5 mM for 24 h. GO and BA were pre incubated for 1 h prior to the exposure. Twenty larvae were used as one replicate four replicates i.e. eighty larvae in total were used for each condition. post the exposure zebrafish larvae were dissociated for single cell suspension following the published protocol [2]. Briefly zebrafish larvae were euthanized with 0.01% of tricaine for 5 min collected in 1.5 mL tube and washed with PBS for three times. The dissociation was initiated by adding 500 μL of pre warmed enzyme mix containing 460 μL of 0.25% trypsin EDTA Gibco and 40 μL of collagenase Sigma Aldrich at the concentration of 100 mg/mL followed by mechanical dissociation using P1000 and then P200 pipette tips in heat block at 30 °C until the tissue was no longer visible about 10 min. The dissociation was then stopped by adding 800 μL DMEM Corning Cat# 10 013 CV with 10% FBS Fisher Scientific. The cell pellets were collected by centrifuging at 1000 rpm for 5 min at RT followed by washing with PBS. The cells were next resuspended in 0.5 mL DMEM with 10% FBS. Four replicates from each condition were pooled together at this step and filtered through 40 μm nylon mesh with an additional washing using DMEM with 10% FBS. The cell suspension was then stained with a fluorescent DNA dye DRAQ7 to exclude non viable cells Invitrogen Cat# D15106 at the dose of 3 μM for 10 min at room temperature before the fluorescence activated cell sorting BD FACSAria III BD Biosciences NJ USA. The sorting was performed using a 100 microns nozzle with the flow rate of 2 and temperature control at 4 °C and gated based on forward scatter and DRAQ7. The DRAQ7 negative cells of each sample were FACS sorted into the tubes containing DMEM with 10% FBS and placed on ice immediately post the sorting. The cells were then proceeded with the single cell RNA sequencing analysis. 1. Pham LN Kanther M Semova I & Rawls JF. Methods for generating and colonizing gnotobiotic zebrafish. Nat. Protoc. 3 1862 1875 2008. 2. Bresciani E Broadbridge E Liu PP An efficient dissociation protocol for generation of single cell suspension from zebrafish embryos and larvae MethodsX. 5 1287 1290 2018. Single cell RNA sequencing scRNA seq was performed by Eukaryotic Single Cell Genomics Facility at SciLifeLab Stockholm. The single cells collected from FACS sorting were loaded on a 10x GemCode Single Cell Instrument 10x Genomics Pleasanton USA to generate single cell gel beads in emulsion GEMs using the Chromium Next GEM Single Cell three prime GEM Library & Gel Bead Kit v3.1 10x Genomics following the manufacture's protocol. Briefly GEMs were generated by combining barcoded Single Cell three prime v3.1 Gel Beads a Master Mix containing cells and Partitioning Oil onto Chromium Next GEM Chip G. Following GEMs generation the Gel Bead was dissolved primers containing an Illumina TruSeq Read 1read 1 sequencing primer 16 nt 10x Barcode 12 nt unique molecular identifier UMI and 30 nt polydT sequence were released and the co partitioned cells were lysed. The nucleic acid library construction was performed using the Chromium Next GEM Single Cell three prime GEM Library & Gel Bead Kit v3.1 10x Genomics 16 rxns PN 1000268 following the manufacture's protocol. post GEMs generation primers were mixed with the cell lysate and a Master Mix containing reverse transcription RT reagents to produce barcoded full length cDNA from polyadenylated mRNA. Silane magnetic beads were used to purify the first strand cDNA from the post GEM RT reaction mixture which included leftover biochemical reagents and primers. Barcoded full length cDNA was amplified via PCR to generate sufficient mass for library construction. Enzymatic fragmentation and size selection were used to optimize the cDNA amplicon size. P5 P7 i7 and i5 sample indexes and TruSeq Read 2 read 2 primer sequence were added via End Repair A tailing Adaptor Ligation and PCR. The final libraries containing the P5 and P7 primers used in Illumina amplification were prepared for an estimated 5000 nuclei per sample.,Sample 1 WT control,SAMEA110401655,"Institute of Environmental Medicine, Karolinska Institutet",ENA FIRST PUBLIC:2022 07 22|ENA LAST UPDATE:2022 07 22|External Id:SAMEA110401655|INSDC center alias:Institute of Environmental Medicine Karolinska Institutet|INSDC center name:Institute of Environmental Medicine Karolinska Institutet|INSDC first public:2022 07 22T16:26:50Z|INSDC last update:2022 07 22T16:26:50Z|INSDC status:public|Submitter Id:E MTAB 11984:Sample 1 WT control|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:wild type genotype|individual:pool of 80 individuals|isolate:not applicable|organism part:whole organism|sample name:E MTAB 11984:Sample 1 WT control|sex:not available|stimulus:n1|strain:AB,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; Single cell RNA sequencing of germ free zebrafish embryos,E MTAB 11984:Sample 1 WT control p,Sample 1 WT control p,Single cell RNA sequencing of germ free zebrafish embryos,The generation of germ free zebrafish wild type AB followed previously established protocols [1]. In brief 2 hpf embryos were transferred to petri dishes with sterile E3 medium supplemented with ampicillin 100 μg/mL kanamycin 5 μg/mL and amphotericin B 250 ng/mL and incubated at 28°C. At 50% epiboly up to shield stage 6 hpf the embryos were surface disinfected with 0.1% of polyvinylpyrroidone iodine PVP I for exactly 2 min followed by 0.003% sterile bleach immersion for 18 min. The embryos were then rinsed with sterile E3 medium transferred to flasks and incubated at 28°C. The viability was monitored and sterile medium was refreshed daily. At day 4 the hatched embryos were used for the sterility validation. A day 5 germ free zebrafish were exposed to the combination of GO 30 µg/mL and butyrate 2.5 mM for 24 h. GO and BA were pre incubated for 1 h prior to the exposure. Twenty larvae were used as one replicate four replicates i.e. eighty larvae in total were used for each condition. post the exposure zebrafish larvae were dissociated for single cell suspension following the published protocol [2]. Briefly zebrafish larvae were euthanized with 0.01% of tricaine for 5 min collected in 1.5 mL tube and washed with PBS for three times. The dissociation was initiated by adding 500 μL of pre warmed enzyme mix containing 460 μL of 0.25% trypsin EDTA Gibco and 40 μL of collagenase Sigma Aldrich at the concentration of 100 mg/mL followed by mechanical dissociation using P1000 and then P200 pipette tips in heat block at 30 °C until the tissue was no longer visible about 10 min. The dissociation was then stopped by adding 800 μL DMEM Corning Cat# 10 013 CV with 10% FBS Fisher Scientific. The cell pellets were collected by centrifuging at 1000 rpm for 5 min at RT followed by washing with PBS. The cells were next resuspended in 0.5 mL DMEM with 10% FBS. Four replicates from each condition were pooled together at this step and filtered through 40 μm nylon mesh with an additional washing using DMEM with 10% FBS. The cell suspension was then stained with a fluorescent DNA dye DRAQ7 to exclude non viable cells Invitrogen Cat# D15106 at the dose of 3 μM for 10 min at room temperature before the fluorescence activated cell sorting BD FACSAria III BD Biosciences NJ USA. The sorting was performed using a 100 microns nozzle with the flow rate of 2 and temperature control at 4 °C and gated based on forward scatter and DRAQ7. The DRAQ7 negative cells of each sample were FACS sorted into the tubes containing DMEM with 10% FBS and placed on ice immediately post the sorting. The cells were then proceeded with the single cell RNA sequencing analysis. 1. Pham LN Kanther M Semova I & Rawls JF. Methods for generating and colonizing gnotobiotic zebrafish. Nat. Protoc. 3 1862 1875 2008. 2. Bresciani E Broadbridge E Liu PP An efficient dissociation protocol for generation of single cell suspension from zebrafish embryos and larvae MethodsX. 5 1287 1290 2018. Single cell RNA sequencing scRNA seq was performed by Eukaryotic Single Cell Genomics Facility at SciLifeLab Stockholm. The single cells collected from FACS sorting were loaded on a 10x GemCode Single Cell Instrument 10x Genomics Pleasanton USA to generate single cell gel beads in emulsion GEMs using the Chromium Next GEM Single Cell three prime GEM Library & Gel Bead Kit v3.1 10x Genomics following the manufacture's protocol. Briefly GEMs were generated by combining barcoded Single Cell three prime v3.1 Gel Beads a Master Mix containing cells and Partitioning Oil onto Chromium Next GEM Chip G. Following GEMs generation the Gel Bead was dissolved primers containing an Illumina TruSeq Read 1read 1 sequencing primer 16 nt 10x Barcode 12 nt unique molecular identifier UMI and 30 nt polydT sequence were released and the co partitioned cells were lysed. The nucleic acid library construction was performed using the Chromium Next GEM Single Cell three prime GEM Library & Gel Bead Kit v3.1 10x Genomics 16 rxns PN 1000268 following the manufacture's protocol. post GEMs generation primers were mixed with the cell lysate and a Master Mix containing reverse transcription RT reagents to produce barcoded full length cDNA from polyadenylated mRNA. Silane magnetic beads were used to purify the first strand cDNA from the post GEM RT reaction mixture which included leftover biochemical reagents and primers. Barcoded full length cDNA was amplified via PCR to generate sufficient mass for library construction. Enzymatic fragmentation and size selection were used to optimize the cDNA amplicon size. P5 P7 i7 and i5 sample indexes and TruSeq Read 2 read 2 primer sequence were added via End Repair A tailing Adaptor Ligation and PCR. The final libraries containing the P5 and P7 primers used in Illumina amplification were prepared for an estimated 5000 nuclei per sample.,Experimental Factor: stimulus:n1,AMPLICON,TRANSCRIPTOMIC SINGLE CELL,size fractionation,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP139765,Illumina NovaSeq 6000 paired end sequencing; Single cell RNA sequencing of germ free zebrafish embryos,ENA FIRST PUBLIC:2022 07 22|ENA LAST UPDATE:2022 07 22,P22202_7001_S1_L001_R1_001.fastq.gz P22202_7001_S1_L001_R2_001.fastq.gz,fastq fastq,19396994226.0,164381307.0,E MTAB 11984:P22202 7001 S1 L001,0:28 1:90,A:5665199484;C:4091196594;G:4415211076;T:5224866754;N:520318,28,90,,,5665199484,4091196594,4415211076,5224866754,520318,ERX9520369,ERS12499847,ERA16483151,"Institute of Environmental Medicine, Karolinska Institutet|European Nucleotide Archive","Institute of Environmental Medicine, Karolinska Institutet|European Nucleotide Archive",2,0.01093,0.89238,0.00557,0.232,0.98764,0.79444,0.40806,0.54781,28,90,T,B,sc-like readlen,illumina,novaseq_era,full_length,size_fractionation,trueseq,sc,single_cell_droplet,10x,,Sweden,2022-07-22,Multi-stage,Embryo,Whole Organism,All anatomical structures 11133,ERR9979393,ERX9520369,ERS12499847,ERP139765,PRJEB54901,Single cell RNA sequencing of germ free zebrafish embryos,E-MTAB-11984,Transcriptome Analysis,The present study was conducted in the frame of the EU funded Graphene Flagship project. We previously evaluated the impact of graphene oxide GO on the gut microbiome in adult zebrafish by performing 16S rRNA gene sequencing in wild type versus AhR deficient zebrafish. Here we performed single cell RNA sequencing 10x Genomics on whole dissociated germ free GF zebrafish embryos exposed at 5 dpf to GO plus the microbial metabolite butyrate to gain insight into the impact on specific cell populations in GF zebrafish.,ENA FIRST PUBLIC:2022 07 22|ENA LAST UPDATE:2022 07 22,,Protocols: The generation of germ free zebrafish wild type AB followed previously established protocols [1]. In brief 2 hpf embryos were transferred to petri dishes with sterile E3 medium supplemented with ampicillin 100 μg/mL kanamycin 5 μg/mL and amphotericin B 250 ng/mL and incubated at 28°C. At 50% epiboly up to shield stage 6 hpf the embryos were surface disinfected with 0.1% of polyvinylpyrroidone iodine PVP I for exactly 2 min followed by 0.003% sterile bleach immersion for 18 min. The embryos were then rinsed with sterile E3 medium transferred to flasks and incubated at 28°C. The viability was monitored and sterile medium was refreshed daily. At day 4 the hatched embryos were used for the sterility validation. A day 5 germ free zebrafish were exposed to the combination of GO 30 µg/mL and butyrate 2.5 mM for 24 h. GO and BA were pre incubated for 1 h prior to the exposure. Twenty larvae were used as one replicate four replicates i.e. eighty larvae in total were used for each condition. post the exposure zebrafish larvae were dissociated for single cell suspension following the published protocol [2]. Briefly zebrafish larvae were euthanized with 0.01% of tricaine for 5 min collected in 1.5 mL tube and washed with PBS for three times. The dissociation was initiated by adding 500 μL of pre warmed enzyme mix containing 460 μL of 0.25% trypsin EDTA Gibco and 40 μL of collagenase Sigma Aldrich at the concentration of 100 mg/mL followed by mechanical dissociation using P1000 and then P200 pipette tips in heat block at 30 °C until the tissue was no longer visible about 10 min. The dissociation was then stopped by adding 800 μL DMEM Corning Cat# 10 013 CV with 10% FBS Fisher Scientific. The cell pellets were collected by centrifuging at 1000 rpm for 5 min at RT followed by washing with PBS. The cells were next resuspended in 0.5 mL DMEM with 10% FBS. Four replicates from each condition were pooled together at this step and filtered through 40 μm nylon mesh with an additional washing using DMEM with 10% FBS. The cell suspension was then stained with a fluorescent DNA dye DRAQ7 to exclude non viable cells Invitrogen Cat# D15106 at the dose of 3 μM for 10 min at room temperature before the fluorescence activated cell sorting BD FACSAria III BD Biosciences NJ USA. The sorting was performed using a 100 microns nozzle with the flow rate of 2 and temperature control at 4 °C and gated based on forward scatter and DRAQ7. The DRAQ7 negative cells of each sample were FACS sorted into the tubes containing DMEM with 10% FBS and placed on ice immediately post the sorting. The cells were then proceeded with the single cell RNA sequencing analysis. 1. Pham LN Kanther M Semova I & Rawls JF. Methods for generating and colonizing gnotobiotic zebrafish. Nat. Protoc. 3 1862 1875 2008. 2. Bresciani E Broadbridge E Liu PP An efficient dissociation protocol for generation of single cell suspension from zebrafish embryos and larvae MethodsX. 5 1287 1290 2018. Single cell RNA sequencing scRNA seq was performed by Eukaryotic Single Cell Genomics Facility at SciLifeLab Stockholm. The single cells collected from FACS sorting were loaded on a 10x GemCode Single Cell Instrument 10x Genomics Pleasanton USA to generate single cell gel beads in emulsion GEMs using the Chromium Next GEM Single Cell three prime GEM Library & Gel Bead Kit v3.1 10x Genomics following the manufacture's protocol. Briefly GEMs were generated by combining barcoded Single Cell three prime v3.1 Gel Beads a Master Mix containing cells and Partitioning Oil onto Chromium Next GEM Chip G. Following GEMs generation the Gel Bead was dissolved primers containing an Illumina TruSeq Read 1read 1 sequencing primer 16 nt 10x Barcode 12 nt unique molecular identifier UMI and 30 nt polydT sequence were released and the co partitioned cells were lysed. The nucleic acid library construction was performed using the Chromium Next GEM Single Cell three prime GEM Library & Gel Bead Kit v3.1 10x Genomics 16 rxns PN 1000268 following the manufacture's protocol. post GEMs generation primers were mixed with the cell lysate and a Master Mix containing reverse transcription RT reagents to produce barcoded full length cDNA from polyadenylated mRNA. Silane magnetic beads were used to purify the first strand cDNA from the post GEM RT reaction mixture which included leftover biochemical reagents and primers. Barcoded full length cDNA was amplified via PCR to generate sufficient mass for library construction. Enzymatic fragmentation and size selection were used to optimize the cDNA amplicon size. P5 P7 i7 and i5 sample indexes and TruSeq Read 2 read 2 primer sequence were added via End Repair A tailing Adaptor Ligation and PCR. The final libraries containing the P5 and P7 primers used in Illumina amplification were prepared for an estimated 5000 nuclei per sample.,Sample 1 WT control,SAMEA110401655,"Institute of Environmental Medicine, Karolinska Institutet",ENA FIRST PUBLIC:2022 07 22|ENA LAST UPDATE:2022 07 22|External Id:SAMEA110401655|INSDC center alias:Institute of Environmental Medicine Karolinska Institutet|INSDC center name:Institute of Environmental Medicine Karolinska Institutet|INSDC first public:2022 07 22T16:26:50Z|INSDC last update:2022 07 22T16:26:50Z|INSDC status:public|Submitter Id:E MTAB 11984:Sample 1 WT control|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:wild type genotype|individual:pool of 80 individuals|isolate:not applicable|organism part:whole organism|sample name:E MTAB 11984:Sample 1 WT control|sex:not available|stimulus:n1|strain:AB,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; Single cell RNA sequencing of germ free zebrafish embryos,E MTAB 11984:Sample 1 WT control p,Sample 1 WT control p,Single cell RNA sequencing of germ free zebrafish embryos,The generation of germ free zebrafish wild type AB followed previously established protocols [1]. In brief 2 hpf embryos were transferred to petri dishes with sterile E3 medium supplemented with ampicillin 100 μg/mL kanamycin 5 μg/mL and amphotericin B 250 ng/mL and incubated at 28°C. At 50% epiboly up to shield stage 6 hpf the embryos were surface disinfected with 0.1% of polyvinylpyrroidone iodine PVP I for exactly 2 min followed by 0.003% sterile bleach immersion for 18 min. The embryos were then rinsed with sterile E3 medium transferred to flasks and incubated at 28°C. The viability was monitored and sterile medium was refreshed daily. At day 4 the hatched embryos were used for the sterility validation. A day 5 germ free zebrafish were exposed to the combination of GO 30 µg/mL and butyrate 2.5 mM for 24 h. GO and BA were pre incubated for 1 h prior to the exposure. Twenty larvae were used as one replicate four replicates i.e. eighty larvae in total were used for each condition. post the exposure zebrafish larvae were dissociated for single cell suspension following the published protocol [2]. Briefly zebrafish larvae were euthanized with 0.01% of tricaine for 5 min collected in 1.5 mL tube and washed with PBS for three times. The dissociation was initiated by adding 500 μL of pre warmed enzyme mix containing 460 μL of 0.25% trypsin EDTA Gibco and 40 μL of collagenase Sigma Aldrich at the concentration of 100 mg/mL followed by mechanical dissociation using P1000 and then P200 pipette tips in heat block at 30 °C until the tissue was no longer visible about 10 min. The dissociation was then stopped by adding 800 μL DMEM Corning Cat# 10 013 CV with 10% FBS Fisher Scientific. The cell pellets were collected by centrifuging at 1000 rpm for 5 min at RT followed by washing with PBS. The cells were next resuspended in 0.5 mL DMEM with 10% FBS. Four replicates from each condition were pooled together at this step and filtered through 40 μm nylon mesh with an additional washing using DMEM with 10% FBS. The cell suspension was then stained with a fluorescent DNA dye DRAQ7 to exclude non viable cells Invitrogen Cat# D15106 at the dose of 3 μM for 10 min at room temperature before the fluorescence activated cell sorting BD FACSAria III BD Biosciences NJ USA. The sorting was performed using a 100 microns nozzle with the flow rate of 2 and temperature control at 4 °C and gated based on forward scatter and DRAQ7. The DRAQ7 negative cells of each sample were FACS sorted into the tubes containing DMEM with 10% FBS and placed on ice immediately post the sorting. The cells were then proceeded with the single cell RNA sequencing analysis. 1. Pham LN Kanther M Semova I & Rawls JF. Methods for generating and colonizing gnotobiotic zebrafish. Nat. Protoc. 3 1862 1875 2008. 2. Bresciani E Broadbridge E Liu PP An efficient dissociation protocol for generation of single cell suspension from zebrafish embryos and larvae MethodsX. 5 1287 1290 2018. Single cell RNA sequencing scRNA seq was performed by Eukaryotic Single Cell Genomics Facility at SciLifeLab Stockholm. The single cells collected from FACS sorting were loaded on a 10x GemCode Single Cell Instrument 10x Genomics Pleasanton USA to generate single cell gel beads in emulsion GEMs using the Chromium Next GEM Single Cell three prime GEM Library & Gel Bead Kit v3.1 10x Genomics following the manufacture's protocol. Briefly GEMs were generated by combining barcoded Single Cell three prime v3.1 Gel Beads a Master Mix containing cells and Partitioning Oil onto Chromium Next GEM Chip G. Following GEMs generation the Gel Bead was dissolved primers containing an Illumina TruSeq Read 1read 1 sequencing primer 16 nt 10x Barcode 12 nt unique molecular identifier UMI and 30 nt polydT sequence were released and the co partitioned cells were lysed. The nucleic acid library construction was performed using the Chromium Next GEM Single Cell three prime GEM Library & Gel Bead Kit v3.1 10x Genomics 16 rxns PN 1000268 following the manufacture's protocol. post GEMs generation primers were mixed with the cell lysate and a Master Mix containing reverse transcription RT reagents to produce barcoded full length cDNA from polyadenylated mRNA. Silane magnetic beads were used to purify the first strand cDNA from the post GEM RT reaction mixture which included leftover biochemical reagents and primers. Barcoded full length cDNA was amplified via PCR to generate sufficient mass for library construction. Enzymatic fragmentation and size selection were used to optimize the cDNA amplicon size. P5 P7 i7 and i5 sample indexes and TruSeq Read 2 read 2 primer sequence were added via End Repair A tailing Adaptor Ligation and PCR. The final libraries containing the P5 and P7 primers used in Illumina amplification were prepared for an estimated 5000 nuclei per sample.,Experimental Factor: stimulus:n1,AMPLICON,TRANSCRIPTOMIC SINGLE CELL,size fractionation,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP139765,Illumina NovaSeq 6000 paired end sequencing; Single cell RNA sequencing of germ free zebrafish embryos,ENA FIRST PUBLIC:2022 07 22|ENA LAST UPDATE:2022 07 22,P22202_7001_S1_L002_R1_001.fastq.gz P22202_7001_S1_L002_R2_001.fastq.gz,fastq fastq,19063958224.0,161558968.0,E MTAB 11984:P22202 7001 S1 L002,0:28 1:90,A:5563588848;C:4022930643;G:4344549562;T:5132136743;N:752428,28,90,,,5563588848,4022930643,4344549562,5132136743,752428,ERX9520369,ERS12499847,ERA16483151,"Institute of Environmental Medicine, Karolinska Institutet|European Nucleotide Archive","Institute of Environmental Medicine, Karolinska Institutet|European Nucleotide Archive",2,0.01118,0.89308,0.00573,0.23128,0.98737,0.79354,0.39264,0.54552,28,90,T,B,sc-like readlen,illumina,novaseq_era,full_length,size_fractionation,trueseq,sc,single_cell_droplet,10x,,Sweden,2022-07-22,Multi-stage,Embryo,Whole Organism,All anatomical structures 11238,ERR10782555,ERX10233132,ERS14439197,ERP144048,PRJEB58983,RNA seq of zebrafish embryos to investigate how Rbm8a deficiency akin to TAR Syndrome causes hematopoietic defects by modulating Wnt/PCP signaling,E-MTAB-12503,Transcriptome Analysis,Defects in blood development are a major contributor to complex congenital anomalies. Thrombocytopenia Absent Radius TAR Syndrome is a rare congenital disease presenting with reduced blood platelets megakaryocytic thrombocytopenia and forelimb anomalies concurrent with variable heart and kidney defects caused by hypomorphic RBM8A/Y14 gene function. RBM8A encodes a component of the ubiquitous exon junction complex involved in mRNA splicing transport and nonsense mediated decay. How perturbing a general mRNA processing factor causes the distinct phenotypes of TAR Syndrome remains unknown. Here we connect zebrafish rbm8a perturbation to early hematopoiesis defects via attenuated planar cell polarity PCP signaling involved in controlling developmental cell arrangements. Combining different genetic means to reduce rbm8a function we find a significant reduction of cd41 positive thrombocytes in hypomorphic rbm8a larvae. Transcriptomics analysis documents rbm8a mutant zebrafish embryos already post gastrulation accumulate mRNAs with erroneously included introns a hallmark of defective nonsense mediated decay. Affected mRNAs include transcripts encoding components of the non canonical Wnt pathway involved in PCP signaling and rbm8a mutant embryos show hallmarks of Wnt/PCP dependent early convergent extension defects. We establish that reduced rbm8a function synergizes with perturbations in Wnt/PCP pathway genes including wnt5b wnt11f2 fzd7a and vangl2. Following axis formation rbm8a perturbation impairs the migration and architecture of the lateral plate mesoderm LPM that forms the hematopoietic cardiovascular kidney and forelimb skeleton progenitors. Subsequently rbm8a perturbation impairs expression of early hematopoietic/endothelial genes including runx1a kdrl sox7 and the megakaryocyte regulator gfi1aa. Lastly we document similar hematopoietic defects upon loss of vangl2. Together our data link reduced rbm8a function to LPM migration and hematopoietic defects via attenuated Wnt/PCP signaling. Our findings establish a developmental framework that connects the complex TAR Syndrome phenotypes to a potential LPM origin.,ENA FIRST PUBLIC:2023 03 31|ENA LAST UPDATE:2023 03 31,,Protocols: Zebrafish embryos were collected at indicated developmental stages tailbud stage and 24 hpf. Total RNA was isolated from genotype defined pooled embryos by Trizol LS extraction as per manufacturer’s guidelines Invitrogen with final precipitation using 70% Ethanol. Libraries for sequencing were generated with the TruSeq RNA Sample Preparation kit Illumina.,Sample 6,E MTAB 12503:Sample 6,,strain:mixed AB and Tubingen|ENA FIRST PUBLIC:2023 03 31|individual:20170530.A 6|organism:Danio rerio|organism:Danio rerio|ENA LAST UPDATE:2023 03 31|scientific name:Danio rerio|common name:zebrafish|organism part:embryo|age:10|developmental stage:bud|genotype:wild type genotype|ENA FIRST PUBLIC:2023 03 31|ENA LAST UPDATE:2023 03 31,,,,,,,,,Illumina HiSeq 4000 paired end sequencing; RNA seq of zebrafish embryos to investigate how Rbm8a deficiency akin to TAR Syndrome causes hematopoietic defects by modulating Wnt/PCP signaling,E MTAB 12503:Sample 6 p,Sample 6 p,RNA seq of zebrafish embryos to investigate how Rbm8a deficiency akin to TAR Syndrome causes hematopoietic defects by modulating Wnt/PCP signaling,Zebrafish embryos were collected at indicated developmental stages tailbud stage and 24 hpf. Total RNA was isolated from genotype defined pooled embryos by Trizol LS extraction as per manufacturer’s guidelines Invitrogen with final precipitation using 70% Ethanol. Libraries for sequencing were generated with the TruSeq RNA Sample Preparation kit Illumina.,Experimental Factor: developmental stage:bud|Experimental Factor: genotype:wild type genotype,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,RANDOM,PAIRED,ILLUMINA,Illumina HiSeq 4000,,ERP144048,Illumina HiSeq 4000 paired end sequencing; RNA seq of zebrafish embryos to investigate how Rbm8a deficiency akin to TAR Syndrome causes hematopoietic defects by modulating Wnt/PCP signaling,ENA FIRST PUBLIC:2023 03 31|ENA LAST UPDATE:2023 03 31,20170530.A-6_R1.fastq.gz 20170530.A-6_R2.fastq.gz,fastq fastq,14809693138.0,49038719.0,E MTAB 12503:20170530.A 6 R,0:151 1:151,A:4069749497;C:3367864217;G:3430269434;T:3928390721;N:13419269,151,151,,,4069749497,3367864217,3430269434,3928390721,13419269,ERX10233132,ERS14439197,ERA20162442,University of Zurich|European Nucleotide Archive,University of Zurich|European Nucleotide Archive,2,0.83945,0.69977,0.27269,0.22488,0.74523,0.77654,0.4899,0.4358,151,151,B,B,biological fallback assumption,illumina,hiseq_era,unknown,random_priming,trueseq,sc,unknown,unknown,,Switzerland,2023-03-31,Multi-stage,Embryo,Whole Organism,All anatomical structures 11239,ERR10782554,ERX10233131,ERS14439196,ERP144048,PRJEB58983,RNA seq of zebrafish embryos to investigate how Rbm8a deficiency akin to TAR Syndrome causes hematopoietic defects by modulating Wnt/PCP signaling,E-MTAB-12503,Transcriptome Analysis,Defects in blood development are a major contributor to complex congenital anomalies. Thrombocytopenia Absent Radius TAR Syndrome is a rare congenital disease presenting with reduced blood platelets megakaryocytic thrombocytopenia and forelimb anomalies concurrent with variable heart and kidney defects caused by hypomorphic RBM8A/Y14 gene function. RBM8A encodes a component of the ubiquitous exon junction complex involved in mRNA splicing transport and nonsense mediated decay. How perturbing a general mRNA processing factor causes the distinct phenotypes of TAR Syndrome remains unknown. Here we connect zebrafish rbm8a perturbation to early hematopoiesis defects via attenuated planar cell polarity PCP signaling involved in controlling developmental cell arrangements. Combining different genetic means to reduce rbm8a function we find a significant reduction of cd41 positive thrombocytes in hypomorphic rbm8a larvae. Transcriptomics analysis documents rbm8a mutant zebrafish embryos already post gastrulation accumulate mRNAs with erroneously included introns a hallmark of defective nonsense mediated decay. Affected mRNAs include transcripts encoding components of the non canonical Wnt pathway involved in PCP signaling and rbm8a mutant embryos show hallmarks of Wnt/PCP dependent early convergent extension defects. We establish that reduced rbm8a function synergizes with perturbations in Wnt/PCP pathway genes including wnt5b wnt11f2 fzd7a and vangl2. Following axis formation rbm8a perturbation impairs the migration and architecture of the lateral plate mesoderm LPM that forms the hematopoietic cardiovascular kidney and forelimb skeleton progenitors. Subsequently rbm8a perturbation impairs expression of early hematopoietic/endothelial genes including runx1a kdrl sox7 and the megakaryocyte regulator gfi1aa. Lastly we document similar hematopoietic defects upon loss of vangl2. Together our data link reduced rbm8a function to LPM migration and hematopoietic defects via attenuated Wnt/PCP signaling. Our findings establish a developmental framework that connects the complex TAR Syndrome phenotypes to a potential LPM origin.,ENA FIRST PUBLIC:2023 03 31|ENA LAST UPDATE:2023 03 31,,Protocols: Zebrafish embryos were collected at indicated developmental stages tailbud stage and 24 hpf. Total RNA was isolated from genotype defined pooled embryos by Trizol LS extraction as per manufacturer’s guidelines Invitrogen with final precipitation using 70% Ethanol. Libraries for sequencing were generated with the TruSeq RNA Sample Preparation kit Illumina.,Sample 5,E MTAB 12503:Sample 5,,strain:mixed AB and Tubingen|ENA FIRST PUBLIC:2023 03 31|individual:20170530.A 5|organism:Danio rerio|organism:Danio rerio|ENA LAST UPDATE:2023 03 31|scientific name:Danio rerio|common name:zebrafish|organism part:embryo|age:10|developmental stage:bud|genotype:wild type genotype|ENA FIRST PUBLIC:2023 03 31|ENA LAST UPDATE:2023 03 31,,,,,,,,,Illumina HiSeq 4000 paired end sequencing; RNA seq of zebrafish embryos to investigate how Rbm8a deficiency akin to TAR Syndrome causes hematopoietic defects by modulating Wnt/PCP signaling,E MTAB 12503:Sample 5 p,Sample 5 p,RNA seq of zebrafish embryos to investigate how Rbm8a deficiency akin to TAR Syndrome causes hematopoietic defects by modulating Wnt/PCP signaling,Zebrafish embryos were collected at indicated developmental stages tailbud stage and 24 hpf. Total RNA was isolated from genotype defined pooled embryos by Trizol LS extraction as per manufacturer’s guidelines Invitrogen with final precipitation using 70% Ethanol. Libraries for sequencing were generated with the TruSeq RNA Sample Preparation kit Illumina.,Experimental Factor: developmental stage:bud|Experimental Factor: genotype:wild type genotype,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,RANDOM,PAIRED,ILLUMINA,Illumina HiSeq 4000,,ERP144048,Illumina HiSeq 4000 paired end sequencing; RNA seq of zebrafish embryos to investigate how Rbm8a deficiency akin to TAR Syndrome causes hematopoietic defects by modulating Wnt/PCP signaling,ENA FIRST PUBLIC:2023 03 31|ENA LAST UPDATE:2023 03 31,20170530.A-5_R1.fastq.gz 20170530.A-5_R2.fastq.gz,fastq fastq,14954968728.0,49519764.0,E MTAB 12503:20170530.A 5 R,0:151 1:151,A:4063340262;C:3440933120;G:3455723079;T:3981396987;N:13575280,151,151,,,4063340262,3440933120,3455723079,3981396987,13575280,ERX10233131,ERS14439196,ERA20162442,University of Zurich|European Nucleotide Archive,University of Zurich|European Nucleotide Archive,2,0.85891,0.86859,0.28842,0.28866,0.7349,0.75051,0.45532,0.49145,151,151,B,B,biological fallback assumption,illumina,hiseq_era,unknown,random_priming,trueseq,sc,unknown,unknown,,Switzerland,2023-03-31,Multi-stage,Embryo,Whole Organism,All anatomical structures 11242,ERR10782551,ERX10233128,ERS14439193,ERP144048,PRJEB58983,RNA seq of zebrafish embryos to investigate how Rbm8a deficiency akin to TAR Syndrome causes hematopoietic defects by modulating Wnt/PCP signaling,E-MTAB-12503,Transcriptome Analysis,Defects in blood development are a major contributor to complex congenital anomalies. Thrombocytopenia Absent Radius TAR Syndrome is a rare congenital disease presenting with reduced blood platelets megakaryocytic thrombocytopenia and forelimb anomalies concurrent with variable heart and kidney defects caused by hypomorphic RBM8A/Y14 gene function. RBM8A encodes a component of the ubiquitous exon junction complex involved in mRNA splicing transport and nonsense mediated decay. How perturbing a general mRNA processing factor causes the distinct phenotypes of TAR Syndrome remains unknown. Here we connect zebrafish rbm8a perturbation to early hematopoiesis defects via attenuated planar cell polarity PCP signaling involved in controlling developmental cell arrangements. Combining different genetic means to reduce rbm8a function we find a significant reduction of cd41 positive thrombocytes in hypomorphic rbm8a larvae. Transcriptomics analysis documents rbm8a mutant zebrafish embryos already post gastrulation accumulate mRNAs with erroneously included introns a hallmark of defective nonsense mediated decay. Affected mRNAs include transcripts encoding components of the non canonical Wnt pathway involved in PCP signaling and rbm8a mutant embryos show hallmarks of Wnt/PCP dependent early convergent extension defects. We establish that reduced rbm8a function synergizes with perturbations in Wnt/PCP pathway genes including wnt5b wnt11f2 fzd7a and vangl2. Following axis formation rbm8a perturbation impairs the migration and architecture of the lateral plate mesoderm LPM that forms the hematopoietic cardiovascular kidney and forelimb skeleton progenitors. Subsequently rbm8a perturbation impairs expression of early hematopoietic/endothelial genes including runx1a kdrl sox7 and the megakaryocyte regulator gfi1aa. Lastly we document similar hematopoietic defects upon loss of vangl2. Together our data link reduced rbm8a function to LPM migration and hematopoietic defects via attenuated Wnt/PCP signaling. Our findings establish a developmental framework that connects the complex TAR Syndrome phenotypes to a potential LPM origin.,ENA FIRST PUBLIC:2023 03 31|ENA LAST UPDATE:2023 03 31,,Protocols: Zebrafish embryos were collected at indicated developmental stages tailbud stage and 24 hpf. Total RNA was isolated from genotype defined pooled embryos by Trizol LS extraction as per manufacturer’s guidelines Invitrogen with final precipitation using 70% Ethanol. Libraries for sequencing were generated with the TruSeq RNA Sample Preparation kit Illumina.,Sample 7,E MTAB 12503:Sample 7,,strain:mixed AB and Tubingen|ENA FIRST PUBLIC:2023 03 31|individual:20170530.A 7|organism:Danio rerio|organism:Danio rerio|ENA LAST UPDATE:2023 03 31|scientific name:Danio rerio|common name:zebrafish|organism part:embryo|age:10|developmental stage:bud|genotype:rbm8a d5/d5|ENA FIRST PUBLIC:2023 03 31|ENA LAST UPDATE:2023 03 31,,,,,,,,,Illumina HiSeq 4000 paired end sequencing; RNA seq of zebrafish embryos to investigate how Rbm8a deficiency akin to TAR Syndrome causes hematopoietic defects by modulating Wnt/PCP signaling,E MTAB 12503:Sample 7 p,Sample 7 p,RNA seq of zebrafish embryos to investigate how Rbm8a deficiency akin to TAR Syndrome causes hematopoietic defects by modulating Wnt/PCP signaling,Zebrafish embryos were collected at indicated developmental stages tailbud stage and 24 hpf. Total RNA was isolated from genotype defined pooled embryos by Trizol LS extraction as per manufacturer’s guidelines Invitrogen with final precipitation using 70% Ethanol. Libraries for sequencing were generated with the TruSeq RNA Sample Preparation kit Illumina.,Experimental Factor: developmental stage:bud|Experimental Factor: genotype:rbm8a d5/d5,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,RANDOM,PAIRED,ILLUMINA,Illumina HiSeq 4000,,ERP144048,Illumina HiSeq 4000 paired end sequencing; RNA seq of zebrafish embryos to investigate how Rbm8a deficiency akin to TAR Syndrome causes hematopoietic defects by modulating Wnt/PCP signaling,ENA FIRST PUBLIC:2023 03 31|ENA LAST UPDATE:2023 03 31,20170530.A-7_R1.fastq.gz 20170530.A-7_R2.fastq.gz,fastq fastq,12726557236.0,42140918.0,E MTAB 12503:20170530.A 7 R,0:151 1:151,A:3510176970;C:2879679978;G:2932244172;T:3392911734;N:11544382,151,151,,,3510176970,2879679978,2932244172,3392911734,11544382,ERX10233128,ERS14439193,ERA20162442,University of Zurich|European Nucleotide Archive,University of Zurich|European Nucleotide Archive,2,0.88531,0.88678,0.33279,0.3329,0.73545,0.74992,0.52548,0.52864,151,151,B,B,biological fallback assumption,illumina,hiseq_era,unknown,random_priming,trueseq,sc,unknown,unknown,,Switzerland,2023-03-31,Multi-stage,Embryo,Whole Organism,All anatomical structures 13299,ERR984502,ERX1065723,ERS715232,ERP006132,PRJEB6584,Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project,Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.,,,,,SAMEA3367580,SC,ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028 Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:55Z|ENA LAST UPDATE:2018 03 09T00:40:24Z|External Id:SAMEA3367580|INSDC center name:SC|INSDC first public:2015 08 18T09:04:55Z|INSDC last update:2018 03 09T00:40:24Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 24 sc 2286404|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo wild type for pcna allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TTCAGCTC is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 24 sc 2286404|scientific name:Danio rerio,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 16164 8#24,13741631,Illumina sequencing of library 13741631 constructed from sample accession ERS715232 for study accession ERP006132. This is part of an Illumina multiplexed sequencing run 16164 8. This submission includes reads tagged with the sequence TTCAGCTC.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP006132,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16,16164_8#24.cram,cram,570705070.0,4390039.0,SC RUN 16164 8#24,0:55 1:75,A:167603013;C:88769000;G:138595187;T:175336986;N:400884,55,75,,,167603013,88769000,138595187,175336986,400884,ERX1065723,ERS715232,ERA466416,The Wellcome Trust Sanger Institute|European Nucleotide Archive,Wellcome Sanger Institute,2,0.18131,0.44012,0.12372,0.1122,0.96759,0.93835,0.63426,0.57651,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-08-18,Multi-stage,Embryo,Whole Organism,All anatomical structures 13300,ERR984501,ERX1065722,ERS715231,ERP006132,PRJEB6584,Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project,Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.,,,,,SAMEA3367579,SC,ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028 Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:55Z|ENA LAST UPDATE:2018 03 09T00:01:26Z|External Id:SAMEA3367579|INSDC center name:SC|INSDC first public:2015 08 18T09:04:55Z|INSDC last update:2018 03 09T00:01:26Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 23 sc 2286403|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo wild type for pcna allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TACTAGTC is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 23 sc 2286403|scientific name:Danio rerio,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 16164 8#23,13741630,Illumina sequencing of library 13741630 constructed from sample accession ERS715231 for study accession ERP006132. This is part of an Illumina multiplexed sequencing run 16164 8. This submission includes reads tagged with the sequence TACTAGTC.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP006132,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16,16164_8#23.cram,cram,682831890.0,5252553.0,SC RUN 16164 8#23,0:55 1:75,A:201267036;C:106752351;G:152982998;T:221347859;N:481646,55,75,,,201267036,106752351,152982998,221347859,481646,ERX1065722,ERS715231,ERA466416,The Wellcome Trust Sanger Institute|European Nucleotide Archive,Wellcome Sanger Institute,2,0.19992,0.5315,0.13001,0.13817,0.96025,0.92261,0.60527,0.55787,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-08-18,Multi-stage,Embryo,Whole Organism,All anatomical structures 13301,ERR984500,ERX1065721,ERS715230,ERP006132,PRJEB6584,Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project,Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.,,,,,SAMEA3367578,SC,ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028 Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:56Z|ENA LAST UPDATE:2018 03 09T00:01:26Z|External Id:SAMEA3367578|INSDC center name:SC|INSDC first public:2015 08 18T09:04:56Z|INSDC last update:2018 03 09T00:01:26Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 22 sc 2286402|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo wild type for pcna allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TCAGATTC is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 22 sc 2286402|scientific name:Danio rerio,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 16164 8#22,13741629,Illumina sequencing of library 13741629 constructed from sample accession ERS715230 for study accession ERP006132. This is part of an Illumina multiplexed sequencing run 16164 8. This submission includes reads tagged with the sequence TCAGATTC.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP006132,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16,16164_8#22.cram,cram,822730220.0,6328694.0,SC RUN 16164 8#22,0:55 1:75,A:241693794;C:130571512;G:177853465;T:272028770;N:582679,55,75,,,241693794,130571512,177853465,272028770,582679,ERX1065721,ERS715230,ERA466416,The Wellcome Trust Sanger Institute|European Nucleotide Archive,Wellcome Sanger Institute,2,0.2212,0.54203,0.15635,0.13659,0.96159,0.9221,0.59031,0.55109,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-08-18,Multi-stage,Embryo,Whole Organism,All anatomical structures 13302,ERR984499,ERX1065720,ERS715229,ERP006132,PRJEB6584,Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project,Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.,,,,,SAMEA3367577,SC,ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028 Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:56Z|ENA LAST UPDATE:2018 03 09T00:40:24Z|External Id:SAMEA3367577|INSDC center name:SC|INSDC first public:2015 08 18T09:04:56Z|INSDC last update:2018 03 09T00:40:24Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 21 sc 2286401|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo wild type for pcna allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TATGCCAG is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 21 sc 2286401|scientific name:Danio rerio,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 16164 8#21,13741628,Illumina sequencing of library 13741628 constructed from sample accession ERS715229 for study accession ERP006132. This is part of an Illumina multiplexed sequencing run 16164 8. This submission includes reads tagged with the sequence TATGCCAG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP006132,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16,16164_8#21.cram,cram,616663190.0,4743563.0,SC RUN 16164 8#21,0:55 1:75,A:176848806;C:99629161;G:137029831;T:202730142;N:425250,55,75,,,176848806,99629161,137029831,202730142,425250,ERX1065720,ERS715229,ERA466416,The Wellcome Trust Sanger Institute|European Nucleotide Archive,Wellcome Sanger Institute,2,0.21864,0.57174,0.1516,0.14103,0.95905,0.9192,0.55513,0.51633,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-08-18,Multi-stage,Embryo,Whole Organism,All anatomical structures 13303,ERR984498,ERX1065719,ERS715228,ERP006132,PRJEB6584,Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project,Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.,,,,,SAMEA3367576,SC,ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028 Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:56Z|ENA LAST UPDATE:2018 03 09T00:01:26Z|External Id:SAMEA3367576|INSDC center name:SC|INSDC first public:2015 08 18T09:04:56Z|INSDC last update:2018 03 09T00:01:26Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 20 sc 2286400|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo wild type for pcna allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TGGCTCAG is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 20 sc 2286400|scientific name:Danio rerio,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 16164 8#20,13741627,Illumina sequencing of library 13741627 constructed from sample accession ERS715228 for study accession ERP006132. This is part of an Illumina multiplexed sequencing run 16164 8. This submission includes reads tagged with the sequence TGGCTCAG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP006132,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16,16164_8#20.cram,cram,708059950.0,5446615.0,SC RUN 16164 8#20,0:55 1:75,A:195264246;C:129715499;G:160155422;T:222438911;N:485872,55,75,,,195264246,129715499,160155422,222438911,485872,ERX1065719,ERS715228,ERA466416,The Wellcome Trust Sanger Institute|European Nucleotide Archive,Wellcome Sanger Institute,2,0.19642,0.48584,0.11921,0.11811,0.95422,0.91843,0.62494,0.56646,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-08-18,Multi-stage,Embryo,Whole Organism,All anatomical structures 13304,ERR984497,ERX1065718,ERS715227,ERP006132,PRJEB6584,Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project,Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.,,,,,SAMEA3367575,SC,ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028 Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:56Z|ENA LAST UPDATE:2018 03 09T00:01:26Z|External Id:SAMEA3367575|INSDC center name:SC|INSDC first public:2015 08 18T09:04:56Z|INSDC last update:2018 03 09T00:01:26Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 19 sc 2286399|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo wild type for pcna allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TCATTGAG is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 19 sc 2286399|scientific name:Danio rerio,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 16164 8#19,13741626,Illumina sequencing of library 13741626 constructed from sample accession ERS715227 for study accession ERP006132. This is part of an Illumina multiplexed sequencing run 16164 8. This submission includes reads tagged with the sequence TCATTGAG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP006132,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16,16164_8#19.cram,cram,651943890.0,5014953.0,SC RUN 16164 8#19,0:55 1:75,A:191809575;C:111573276;G:144109125;T:204007845;N:444069,55,75,,,191809575,111573276,144109125,204007845,444069,ERX1065718,ERS715227,ERA466416,The Wellcome Trust Sanger Institute|European Nucleotide Archive,Wellcome Sanger Institute,2,0.17909,0.44616,0.12326,0.12424,0.96256,0.93432,0.56606,0.52819,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-08-18,Multi-stage,Embryo,Whole Organism,All anatomical structures 13305,ERR984496,ERX1065717,ERS715226,ERP006132,PRJEB6584,Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project,Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.,,,,,SAMEA3367574,SC,ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028 Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:56Z|ENA LAST UPDATE:2018 03 09T00:40:24Z|External Id:SAMEA3367574|INSDC center name:SC|INSDC first public:2015 08 18T09:04:56Z|INSDC last update:2018 03 09T00:40:24Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 18 sc 2286398|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo heterozygous for pcna allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TGTATGCG is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 18 sc 2286398|scientific name:Danio rerio,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 16164 8#18,13741625,Illumina sequencing of library 13741625 constructed from sample accession ERS715226 for study accession ERP006132. This is part of an Illumina multiplexed sequencing run 16164 8. This submission includes reads tagged with the sequence TGTATGCG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP006132,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16,16164_8#18.cram,cram,610476620.0,4695974.0,SC RUN 16164 8#18,0:55 1:75,A:181332724;C:99472616;G:132687929;T:196571397;N:411954,55,75,,,181332724,99472616,132687929,196571397,411954,ERX1065717,ERS715226,ERA466416,The Wellcome Trust Sanger Institute|European Nucleotide Archive,Wellcome Sanger Institute,2,0.22636,0.55559,0.16123,0.16819,0.96025,0.92967,0.59576,0.54685,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-08-18,Multi-stage,Embryo,Whole Organism,All anatomical structures 13306,ERR984495,ERX1065716,ERS715225,ERP006132,PRJEB6584,Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project,Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.,,,,,SAMEA3367573,SC,ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028 Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:56Z|ENA LAST UPDATE:2018 03 09T00:01:26Z|External Id:SAMEA3367573|INSDC center name:SC|INSDC first public:2015 08 18T09:04:56Z|INSDC last update:2018 03 09T00:01:26Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 17 sc 2286397|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo heterozygous for pcna allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TCCAGTCG is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 17 sc 2286397|scientific name:Danio rerio,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 16164 8#17,13741624,Illumina sequencing of library 13741624 constructed from sample accession ERS715225 for study accession ERP006132. This is part of an Illumina multiplexed sequencing run 16164 8. This submission includes reads tagged with the sequence TCCAGTCG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP006132,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16,16164_8#17.cram,cram,712320830.0,5479391.0,SC RUN 16164 8#17,0:55 1:75,A:204316194;C:115198795;G:158608369;T:233717227;N:480245,55,75,,,204316194,115198795,158608369,233717227,480245,ERX1065716,ERS715225,ERA466416,The Wellcome Trust Sanger Institute|European Nucleotide Archive,Wellcome Sanger Institute,2,0.2492,0.59739,0.17155,0.14862,0.95657,0.92056,0.58039,0.53475,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-08-18,Multi-stage,Embryo,Whole Organism,All anatomical structures 13307,ERR984494,ERX1065715,ERS715224,ERP006132,PRJEB6584,Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project,Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.,,,,,SAMEA3367572,SC,ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028 Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:56Z|ENA LAST UPDATE:2018 03 09T00:01:26Z|External Id:SAMEA3367572|INSDC center name:SC|INSDC first public:2015 08 18T09:04:56Z|INSDC last update:2018 03 09T00:01:26Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 16 sc 2286396|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo heterozygous for pcna allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TAAGTTCG is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 16 sc 2286396|scientific name:Danio rerio,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 16164 8#16,13741623,Illumina sequencing of library 13741623 constructed from sample accession ERS715224 for study accession ERP006132. This is part of an Illumina multiplexed sequencing run 16164 8. This submission includes reads tagged with the sequence TAAGTTCG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP006132,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16,16164_8#16.cram,cram,793769340.0,6105918.0,SC RUN 16164 8#16,0:55 1:75,A:232264866;C:130235228;G:171709756;T:259013732;N:545758,55,75,,,232264866,130235228,171709756,259013732,545758,ERX1065715,ERS715224,ERA466416,The Wellcome Trust Sanger Institute|European Nucleotide Archive,Wellcome Sanger Institute,2,0.22065,0.5061,0.15274,0.13242,0.95779,0.92575,0.57619,0.53869,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-08-18,Multi-stage,Embryo,Whole Organism,All anatomical structures 13308,ERR984493,ERX1065714,ERS715223,ERP006132,PRJEB6584,Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project,Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.,,,,,SAMEA3367571,SC,ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028 Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:56Z|ENA LAST UPDATE:2018 03 09T00:40:24Z|External Id:SAMEA3367571|INSDC center name:SC|INSDC first public:2015 08 18T09:04:56Z|INSDC last update:2018 03 09T00:40:24Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 15 sc 2286395|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo heterozygous for pcna allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TCAGGAGG is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 15 sc 2286395|scientific name:Danio rerio,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 16164 8#15,13741622,Illumina sequencing of library 13741622 constructed from sample accession ERS715223 for study accession ERP006132. This is part of an Illumina multiplexed sequencing run 16164 8. This submission includes reads tagged with the sequence TCAGGAGG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP006132,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16,16164_8#15.cram,cram,785479760.0,6042152.0,SC RUN 16164 8#15,0:55 1:75,A:221631721;C:150326010;G:172964474;T:240036379;N:521176,55,75,,,221631721,150326010,172964474,240036379,521176,ERX1065714,ERS715223,ERA466416,The Wellcome Trust Sanger Institute|European Nucleotide Archive,Wellcome Sanger Institute,2,0.26761,0.37751,0.19858,0.09301,0.95162,0.93129,0.56282,0.54289,55,75,B,B,mate1-mate2 similar by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-08-18,Multi-stage,Embryo,Whole Organism,All anatomical structures 13309,ERR984492,ERX1065713,ERS715222,ERP006132,PRJEB6584,Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project,Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.,,,,,SAMEA3367570,SC,ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028 Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:56Z|ENA LAST UPDATE:2018 03 09T00:01:26Z|External Id:SAMEA3367570|INSDC center name:SC|INSDC first public:2015 08 18T09:04:56Z|INSDC last update:2018 03 09T00:01:26Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 14 sc 2286394|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo heterozygous for pcna allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TCTCACGG is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 14 sc 2286394|scientific name:Danio rerio,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 16164 8#14,13741621,Illumina sequencing of library 13741621 constructed from sample accession ERS715222 for study accession ERP006132. This is part of an Illumina multiplexed sequencing run 16164 8. This submission includes reads tagged with the sequence TCTCACGG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP006132,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16,16164_8#14.cram,cram,673293530.0,5179181.0,SC RUN 16164 8#14,0:55 1:75,A:188203068;C:115934699;G:155324541;T:213374769;N:456453,55,75,,,188203068,115934699,155324541,213374769,456453,ERX1065713,ERS715222,ERA466416,The Wellcome Trust Sanger Institute|European Nucleotide Archive,Wellcome Sanger Institute,2,0.21855,0.57586,0.15197,0.14501,0.95946,0.93077,0.56453,0.52351,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-08-18,Multi-stage,Embryo,Whole Organism,All anatomical structures 13310,ERR984491,ERX1065712,ERS715221,ERP006132,PRJEB6584,Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project,Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.,,,,,SAMEA3367569,SC,ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028 Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:56Z|ENA LAST UPDATE:2018 03 09T00:01:26Z|External Id:SAMEA3367569|INSDC center name:SC|INSDC first public:2015 08 18T09:04:56Z|INSDC last update:2018 03 09T00:01:26Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 13 sc 2286393|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo heterozygous for pcna allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TACTTCGG is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 13 sc 2286393|scientific name:Danio rerio,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 16164 8#13,13741620,Illumina sequencing of library 13741620 constructed from sample accession ERS715221 for study accession ERP006132. This is part of an Illumina multiplexed sequencing run 16164 8. This submission includes reads tagged with the sequence TACTTCGG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP006132,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16,16164_8#13.cram,cram,783634020.0,6027954.0,SC RUN 16164 8#13,0:55 1:75,A:231435775;C:129417634;G:178939153;T:243302897;N:538561,55,75,,,231435775,129417634,178939153,243302897,538561,ERX1065712,ERS715221,ERA466416,The Wellcome Trust Sanger Institute|European Nucleotide Archive,Wellcome Sanger Institute,2,0.20287,0.52947,0.14655,0.13479,0.96299,0.93703,0.56376,0.52626,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-08-18,Multi-stage,Embryo,Whole Organism,All anatomical structures 13311,ERR984490,ERX1065711,ERS715220,ERP006132,PRJEB6584,Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project,Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.,,,,,SAMEA3367568,SC,ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028 Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:56Z|ENA LAST UPDATE:2018 03 09T00:40:24Z|External Id:SAMEA3367568|INSDC center name:SC|INSDC first public:2015 08 18T09:04:56Z|INSDC last update:2018 03 09T00:40:24Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 12 sc 2286392|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo homozygous for pcna allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TGAACTGG is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 12 sc 2286392|scientific name:Danio rerio,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 16164 8#12,13741619,Illumina sequencing of library 13741619 constructed from sample accession ERS715220 for study accession ERP006132. This is part of an Illumina multiplexed sequencing run 16164 8. This submission includes reads tagged with the sequence TGAACTGG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP006132,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16,16164_8#12.cram,cram,746397730.0,5741521.0,SC RUN 16164 8#12,0:55 1:75,A:217959769;C:123138989;G:158254272;T:246531930;N:512770,55,75,,,217959769,123138989,158254272,246531930,512770,ERX1065711,ERS715220,ERA466416,The Wellcome Trust Sanger Institute|European Nucleotide Archive,Wellcome Sanger Institute,2,0.20695,0.57674,0.14123,0.14978,0.95899,0.9138,0.56705,0.57522,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-08-18,Multi-stage,Embryo,Whole Organism,All anatomical structures 13312,ERR984489,ERX1065710,ERS715219,ERP006132,PRJEB6584,Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project,Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.,,,,,SAMEA3367567,SC,ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028 Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:55Z|ENA LAST UPDATE:2018 03 09T00:01:26Z|External Id:SAMEA3367567|INSDC center name:SC|INSDC first public:2015 08 18T09:04:55Z|INSDC last update:2018 03 09T00:01:26Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 11 sc 2286391|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo homozygous for pcna allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TTGGTATG is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 11 sc 2286391|scientific name:Danio rerio,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 16164 8#11,13741618,Illumina sequencing of library 13741618 constructed from sample accession ERS715219 for study accession ERP006132. This is part of an Illumina multiplexed sequencing run 16164 8. This submission includes reads tagged with the sequence TTGGTATG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP006132,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16,16164_8#11.cram,cram,630077890.0,4846753.0,SC RUN 16164 8#11,0:55 1:75,A:181555459;C:107913967;G:131155798;T:209016157;N:436509,55,75,,,181555459,107913967,131155798,209016157,436509,ERX1065710,ERS715219,ERA466416,The Wellcome Trust Sanger Institute|European Nucleotide Archive,Wellcome Sanger Institute,2,0.23034,0.58664,0.14994,0.16031,0.9517,0.9134,0.43491,0.55537,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-08-18,Multi-stage,Embryo,Whole Organism,All anatomical structures 13313,ERR984488,ERX1065709,ERS715218,ERP006132,PRJEB6584,Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project,Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.,,,,,SAMEA3367566,SC,ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028 Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:57Z|ENA LAST UPDATE:2018 03 09T00:00:47Z|External Id:SAMEA3367566|INSDC center name:SC|INSDC first public:2015 08 18T09:04:57Z|INSDC last update:2018 03 09T00:00:47Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 10 sc 2286390|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo homozygous for pcna allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TAACGCTG is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 10 sc 2286390|scientific name:Danio rerio,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 16164 8#10,13741617,Illumina sequencing of library 13741617 constructed from sample accession ERS715218 for study accession ERP006132. This is part of an Illumina multiplexed sequencing run 16164 8. This submission includes reads tagged with the sequence TAACGCTG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP006132,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16,16164_8#10.cram,cram,522425410.0,4018657.0,SC RUN 16164 8#10,0:55 1:75,A:136789388;C:88820863;G:131305976;T:165156817;N:352366,55,75,,,136789388,88820863,131305976,165156817,352366,ERX1065709,ERS715218,ERA466416,The Wellcome Trust Sanger Institute|European Nucleotide Archive,Wellcome Sanger Institute,2,0.16976,0.61187,0.10677,0.16777,0.96096,0.93093,0.59603,0.58893,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-08-18,Multi-stage,Embryo,Whole Organism,All anatomical structures 13314,ERR984487,ERX1065708,ERS715217,ERP006132,PRJEB6584,Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project,Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.,,,,,SAMEA3367565,SC,ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028 Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:56Z|ENA LAST UPDATE:2018 03 09T00:40:24Z|External Id:SAMEA3367565|INSDC center name:SC|INSDC first public:2015 08 18T09:04:56Z|INSDC last update:2018 03 09T00:40:24Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 9 sc 2286389|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo homozygous for pcna allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TCGAAGTG is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 9 sc 2286389|scientific name:Danio rerio,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 16164 8#9,13741616,Illumina sequencing of library 13741616 constructed from sample accession ERS715217 for study accession ERP006132. This is part of an Illumina multiplexed sequencing run 16164 8. This submission includes reads tagged with the sequence TCGAAGTG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP006132,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16,16164_8#9.cram,cram,662372100.0,5095170.0,SC RUN 16164 8#9,0:55 1:75,A:186346528;C:114321445;G:137139385;T:224106023;N:458719,55,75,,,186346528,114321445,137139385,224106023,458719,ERX1065708,ERS715217,ERA466416,The Wellcome Trust Sanger Institute|European Nucleotide Archive,Wellcome Sanger Institute,2,0.22854,0.63729,0.14734,0.16003,0.95089,0.90751,0.51773,0.50977,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-08-18,Multi-stage,Embryo,Whole Organism,All anatomical structures 13315,ERR984486,ERX1065707,ERS715216,ERP006132,PRJEB6584,Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project,Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.,,,,,SAMEA3367564,SC,ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028 Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:55Z|ENA LAST UPDATE:2018 03 09T00:00:47Z|External Id:SAMEA3367564|INSDC center name:SC|INSDC first public:2015 08 18T09:04:55Z|INSDC last update:2018 03 09T00:00:47Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 8 sc 2286388|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo homozygous for pcna allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TTCCATTG is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 8 sc 2286388|scientific name:Danio rerio,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 16164 8#8,13741615,Illumina sequencing of library 13741615 constructed from sample accession ERS715216 for study accession ERP006132. This is part of an Illumina multiplexed sequencing run 16164 8. This submission includes reads tagged with the sequence TTCCATTG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP006132,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16,16164_8#8.cram,cram,857007060.0,6592362.0,SC RUN 16164 8#8,0:55 1:75,A:257958701;C:131661477;G:190276240;T:276500331;N:610311,55,75,,,257958701,131661477,190276240,276500331,610311,ERX1065707,ERS715216,ERA466416,The Wellcome Trust Sanger Institute|European Nucleotide Archive,Wellcome Sanger Institute,2,0.21266,0.595,0.14225,0.14037,0.95964,0.92232,0.54595,0.53111,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-08-18,Multi-stage,Embryo,Whole Organism,All anatomical structures 13316,ERR984485,ERX1065706,ERS715215,ERP006132,PRJEB6584,Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project,Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.,,,,,SAMEA3367563,SC,ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028 Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:56Z|ENA LAST UPDATE:2018 03 09T00:00:47Z|External Id:SAMEA3367563|INSDC center name:SC|INSDC first public:2015 08 18T09:04:56Z|INSDC last update:2018 03 09T00:00:47Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 7 sc 2286387|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo homozygous for pcna allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TAGTCTTG is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 7 sc 2286387|scientific name:Danio rerio,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 16164 8#7,13741614,Illumina sequencing of library 13741614 constructed from sample accession ERS715215 for study accession ERP006132. This is part of an Illumina multiplexed sequencing run 16164 8. This submission includes reads tagged with the sequence TAGTCTTG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP006132,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16,16164_8#7.cram,cram,742942590.0,5714943.0,SC RUN 16164 8#7,0:55 1:75,A:228799118;C:117009382;G:166056205;T:230565934;N:511951,55,75,,,228799118,117009382,166056205,230565934,511951,ERX1065706,ERS715215,ERA466416,The Wellcome Trust Sanger Institute|European Nucleotide Archive,Wellcome Sanger Institute,2,0.19264,0.50767,0.1428,0.15173,0.9666,0.94606,0.57413,0.53902,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-08-18,Multi-stage,Embryo,Whole Organism,All anatomical structures 13317,ERR984484,ERX1065705,ERS715214,ERP006132,PRJEB6584,Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project,Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.,,,,,SAMEA3367562,SC,ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028 Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:56Z|ENA LAST UPDATE:2018 03 09T00:40:24Z|External Id:SAMEA3367562|INSDC center name:SC|INSDC first public:2015 08 18T09:04:56Z|INSDC last update:2018 03 09T00:40:24Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 6 sc 2286386|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo homozygous for pcna allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TGTGGTTG is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 6 sc 2286386|scientific name:Danio rerio,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 16164 8#6,13741613,Illumina sequencing of library 13741613 constructed from sample accession ERS715214 for study accession ERP006132. This is part of an Illumina multiplexed sequencing run 16164 8. This submission includes reads tagged with the sequence TGTGGTTG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP006132,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16,16164_8#6.cram,cram,908951420.0,6991934.0,SC RUN 16164 8#6,0:55 1:75,A:266807632;C:158160652;G:194742499;T:288619707;N:620930,55,75,,,266807632,158160652,194742499,288619707,620930,ERX1065705,ERS715214,ERA466416,The Wellcome Trust Sanger Institute|European Nucleotide Archive,Wellcome Sanger Institute,2,0.20021,0.52069,0.13208,0.1197,0.95775,0.93324,0.52946,0.52456,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-08-18,Multi-stage,Embryo,Whole Organism,All anatomical structures 13318,ERR984483,ERX1065704,ERS715213,ERP006132,PRJEB6584,Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project,Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.,,,,,SAMEA3367561,SC,ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028 Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:56Z|ENA LAST UPDATE:2018 03 09T00:00:47Z|External Id:SAMEA3367561|INSDC center name:SC|INSDC first public:2015 08 18T09:04:56Z|INSDC last update:2018 03 09T00:00:47Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 5 sc 2286385|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo homozygous for pcna allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TCCTCAAT is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 5 sc 2286385|scientific name:Danio rerio,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 16164 8#5,13741612,Illumina sequencing of library 13741612 constructed from sample accession ERS715213 for study accession ERP006132. This is part of an Illumina multiplexed sequencing run 16164 8. This submission includes reads tagged with the sequence TCCTCAAT.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP006132,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16,16164_8#5.cram,cram,771659330.0,5935841.0,SC RUN 16164 8#5,0:55 1:75,A:225161011;C:121434126;G:174639826;T:249876341;N:548026,55,75,,,225161011,121434126,174639826,249876341,548026,ERX1065704,ERS715213,ERA466416,The Wellcome Trust Sanger Institute|European Nucleotide Archive,Wellcome Sanger Institute,2,0.21069,0.57513,0.14228,0.12501,0.95672,0.92488,0.54397,0.52111,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-08-18,Multi-stage,Embryo,Whole Organism,All anatomical structures 13319,ERR984482,ERX1065703,ERS715212,ERP006132,PRJEB6584,Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project,Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.,,,,,SAMEA3367560,SC,ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028 Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:56Z|ENA LAST UPDATE:2018 03 09T00:00:47Z|External Id:SAMEA3367560|INSDC center name:SC|INSDC first public:2015 08 18T09:04:56Z|INSDC last update:2018 03 09T00:00:47Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 4 sc 2286384|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo homozygous for pcna allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TACAGGAT is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 4 sc 2286384|scientific name:Danio rerio,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 16164 8#4,13741611,Illumina sequencing of library 13741611 constructed from sample accession ERS715212 for study accession ERP006132. This is part of an Illumina multiplexed sequencing run 16164 8. This submission includes reads tagged with the sequence TACAGGAT.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP006132,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16,16164_8#4.cram,cram,784183790.0,6032183.0,SC RUN 16164 8#4,0:55 1:75,A:219327080;C:128313123;G:169475262;T:266538585;N:529740,55,75,,,219327080,128313123,169475262,266538585,529740,ERX1065703,ERS715212,ERA466416,The Wellcome Trust Sanger Institute|European Nucleotide Archive,Wellcome Sanger Institute,2,0.20392,0.58702,0.12804,0.12156,0.96047,0.9133,0.61438,0.53735,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-08-18,Multi-stage,Embryo,Whole Organism,All anatomical structures 13320,ERR984481,ERX1065702,ERS715211,ERP006132,PRJEB6584,Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project,Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.,,,,,SAMEA3367559,SC,ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028 Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:55Z|ENA LAST UPDATE:2018 03 09T00:40:24Z|External Id:SAMEA3367559|INSDC center name:SC|INSDC first public:2015 08 18T09:04:55Z|INSDC last update:2018 03 09T00:40:24Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 3 sc 2286383|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo homozygous for pcna allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TAGTGACT is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 3 sc 2286383|scientific name:Danio rerio,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 16164 8#3,13741610,Illumina sequencing of library 13741610 constructed from sample accession ERS715211 for study accession ERP006132. This is part of an Illumina multiplexed sequencing run 16164 8. This submission includes reads tagged with the sequence TAGTGACT.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP006132,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16,16164_8#3.cram,cram,810265170.0,6232809.0,SC RUN 16164 8#3,0:55 1:75,A:237117705;C:130774361;G:170817877;T:270997878;N:557349,55,75,,,237117705,130774361,170817877,270997878,557349,ERX1065702,ERS715211,ERA466416,The Wellcome Trust Sanger Institute|European Nucleotide Archive,Wellcome Sanger Institute,2,0.22414,0.5931,0.14561,0.13304,0.95651,0.91423,0.59465,0.54152,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-08-18,Multi-stage,Embryo,Whole Organism,All anatomical structures 13321,ERR984480,ERX1065701,ERS715210,ERP006132,PRJEB6584,Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project,Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.,,,,,SAMEA3367558,SC,ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028 Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:55Z|ENA LAST UPDATE:2018 03 09T00:00:47Z|External Id:SAMEA3367558|INSDC center name:SC|INSDC first public:2015 08 18T09:04:55Z|INSDC last update:2018 03 09T00:00:47Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 2 sc 2286382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo homozygous for pcna allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TTCCTGCT is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 2 sc 2286382|scientific name:Danio rerio,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 16164 8#2,13741609,Illumina sequencing of library 13741609 constructed from sample accession ERS715210 for study accession ERP006132. This is part of an Illumina multiplexed sequencing run 16164 8. This submission includes reads tagged with the sequence TTCCTGCT.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP006132,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16,16164_8#2.cram,cram,698194770.0,5370729.0,SC RUN 16164 8#2,0:55 1:75,A:190784194;C:110138446;G:188418516;T:208362798;N:490816,55,75,,,190784194,110138446,188418516,208362798,490816,ERX1065701,ERS715210,ERA466416,The Wellcome Trust Sanger Institute|European Nucleotide Archive,Wellcome Sanger Institute,2,0.17398,0.58306,0.10399,0.12476,0.96372,0.94468,0.64309,0.54721,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-08-18,Multi-stage,Embryo,Whole Organism,All anatomical structures 13322,ERR984479,ERX1065700,ERS715209,ERP006132,PRJEB6584,Transcriptome profiling of embryos collected for one or more alleles identified by the zebrafish mutation project,Transcriptome_profiling_of_embryos_collected_for_one_or_more_alleles_identified_by_the_zebrafish_mutation_project-sc-3191,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared for zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project for transcriptome profiling.,,,,,SAMEA3367557,SC,ArrayExpress DevelopmentalStage:Segmentation:26+ somites ZFS:0000028 Pharyngula:Prim 5 ZFS:0000029|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 08 18T09:04:56Z|ENA LAST UPDATE:2018 03 09T00:00:47Z|External Id:SAMEA3367557|INSDC center name:SC|INSDC first public:2015 08 18T09:04:56Z|INSDC last update:2018 03 09T00:00:47Z|INSDC status:public|Submitter Id:ZMP phenotype 175 1 1 sc 2286381|common name:zebrafish|sample description:3 prime end enriched mRNA from a single embryo homozygous for pcna allele sa8962 plus ERCC spike mix 1 Ambion. A 8 base indexing sequence TGCGATCT is bases 13 to 20 of read 1 followed by CG and polyT. More information describing the mutant phenotype can be found at the Wellcome Trust Sanger Institute Zebrafish Mutation Project website http://www.sanger.ac.uk/sanger/Zebrafish Zmpsearch/zmp ph175.|sample name:ZMP phenotype 175 1 1 sc 2286381|scientific name:Danio rerio,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 16164 8#1,13741608,Illumina sequencing of library 13741608 constructed from sample accession ERS715209 for study accession ERP006132. This is part of an Illumina multiplexed sequencing run 16164 8. This submission includes reads tagged with the sequence TGCGATCT.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP006132,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2015 08 18|ENA LAST UPDATE:2018 11 16,16164_8#1.cram,cram,882032060.0,6784862.0,SC RUN 16164 8#1,0:55 1:75,A:258098215;C:144707482;G:194402683;T:284218124;N:605556,55,75,,,258098215,144707482,194402683,284218124,605556,ERX1065700,ERS715209,ERA466416,The Wellcome Trust Sanger Institute|European Nucleotide Archive,Wellcome Sanger Institute,2,0.21585,0.55375,0.14409,0.13461,0.96015,0.9246,0.61791,0.5495,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-08-18,Multi-stage,Embryo,Whole Organism,All anatomical structures 24927,SRR25557778,SRX21286665,SRS18536778,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant XI,GSM7688794,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant XI,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688794,GSM7688794: Morphant XI; Danio rerio; RNA Seq,GSM7688794 r1,GSM7688794,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-XI_S7_L001_R1_001.fastq.gz,fastq,420092501.0,5668059.0,GSM7688794 r1,0:74.12,A:113006440;C:96725832;G:99320773;T:110915967;N:123489,74,,,,113006440,96725832,99320773,110915967,123489,SRX21286665,SRS18536778,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94757,,0.06229,,0.72364,,0.46676,,74,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24928,SRR25557779,SRX21286665,SRS18536778,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant XI,GSM7688794,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant XI,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688794,GSM7688794: Morphant XI; Danio rerio; RNA Seq,GSM7688794 r1,GSM7688794,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-XI_S7_L002_R1_001.fastq.gz,fastq,421869780.0,5690053.0,GSM7688794 r2,0:74.14,A:113530489;C:97144227;G:99697959;T:111388539;N:108566,74,,,,113530489,97144227,99697959,111388539,108566,SRX21286665,SRS18536778,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94921,,0.06226,,0.72462,,0.4738,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24929,SRR25557780,SRX21286665,SRS18536778,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant XI,GSM7688794,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant XI,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688794,GSM7688794: Morphant XI; Danio rerio; RNA Seq,GSM7688794 r1,GSM7688794,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-XI_S7_L003_R1_001.fastq.gz,fastq,425064659.0,5734041.0,GSM7688794 r3,0:74.13,A:114342253;C:97873100;G:100532599;T:112196433;N:120274,74,,,,114342253,97873100,100532599,112196433,120274,SRX21286665,SRS18536778,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94886,,0.06112,,0.72425,,0.47055,,74,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24930,SRR25557781,SRX21286665,SRS18536778,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant XI,GSM7688794,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant XI,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688794,GSM7688794: Morphant XI; Danio rerio; RNA Seq,GSM7688794 r1,GSM7688794,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-XI_S7_L004_R1_001.fastq.gz,fastq,416990548.0,5624902.0,GSM7688794 r4,0:74.13,A:112153356;C:96009158;G:98613145;T:110097476;N:117413,74,,,,112153356,96009158,98613145,110097476,117413,SRX21286665,SRS18536778,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94869,,0.06229,,0.72506,,0.47222,,74,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24931,SRR25557782,SRX21286664,SRS18536777,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant X,GSM7688793,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant X,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688793,GSM7688793: Morphant X; Danio rerio; RNA Seq,GSM7688793 r1,GSM7688793,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-X_S6_L001_R1_001.fastq.gz,fastq,434485284.0,5881416.0,GSM7688793 r1,0:73.87,A:116640351;C:100176557;G:102659919;T:114799536;N:208921,73,,,,116640351,100176557,102659919,114799536,208921,SRX21286664,SRS18536777,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94533,,0.07176,,0.72464,,0.47632,,74,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24932,SRR25557783,SRX21286664,SRS18536777,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant X,GSM7688793,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant X,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688793,GSM7688793: Morphant X; Danio rerio; RNA Seq,GSM7688793 r1,GSM7688793,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-X_S6_L002_R1_001.fastq.gz,fastq,435203869.0,5886556.0,GSM7688793 r2,0:73.93,A:116869356;C:100363580;G:102830644;T:114973504;N:166785,73,,,,116869356,100363580,102830644,114973504,166785,SRX21286664,SRS18536777,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94542,,0.07203,,0.72421,,0.47733,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24933,SRR25557784,SRX21286664,SRS18536777,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant X,GSM7688793,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant X,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688793,GSM7688793: Morphant X; Danio rerio; RNA Seq,GSM7688793 r1,GSM7688793,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-X_S6_L003_R1_001.fastq.gz,fastq,439897269.0,5951878.0,GSM7688793 r3,0:73.91,A:118101648;C:101426657;G:103990006;T:116184480;N:194478,73,,,,118101648,101426657,103990006,116184480,194478,SRX21286664,SRS18536777,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94486,,0.07224,,0.72448,,0.47915,,74,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24934,SRR25557785,SRX21286664,SRS18536777,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant X,GSM7688793,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant X,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688793,GSM7688793: Morphant X; Danio rerio; RNA Seq,GSM7688793 r1,GSM7688793,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-X_S6_L004_R1_001.fastq.gz,fastq,431385256.0,5836029.0,GSM7688793 r4,0:73.92,A:115804970;C:99459059;G:101962932;T:113975935;N:182360,73,,,,115804970,99459059,101962932,113975935,182360,SRX21286664,SRS18536777,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94432,,0.07229,,0.7261,,0.47463,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24935,SRR25557786,SRX21286663,SRS18536776,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant IX,GSM7688792,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant IX,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688792,GSM7688792: Morphant IX; Danio rerio; RNA Seq,GSM7688792 r1,GSM7688792,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-IX_S16_L001_R1_001.fastq.gz,fastq,513309395.0,6929648.0,GSM7688792 r1,0:74.07,A:137428462;C:118688804;G:122019962;T:134991729;N:180438,74,,,,137428462,118688804,122019962,134991729,180438,SRX21286663,SRS18536776,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94188,,0.07029,,0.73772,,0.47692,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24936,SRR25557787,SRX21286663,SRS18536776,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant IX,GSM7688792,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant IX,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688792,GSM7688792: Morphant IX; Danio rerio; RNA Seq,GSM7688792 r1,GSM7688792,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-IX_S16_L002_R1_001.fastq.gz,fastq,517356735.0,6982196.0,GSM7688792 r2,0:74.10,A:138524037;C:119650852;G:122965491;T:136056171;N:160184,74,,,,138524037,119650852,122965491,136056171,160184,SRX21286663,SRS18536776,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94281,,0.06967,,0.73963,,0.48142,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24937,SRR25557788,SRX21286663,SRS18536776,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant IX,GSM7688792,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant IX,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688792,GSM7688792: Morphant IX; Danio rerio; RNA Seq,GSM7688792 r1,GSM7688792,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-IX_S16_L003_R1_001.fastq.gz,fastq,519422328.0,7010631.0,GSM7688792 r3,0:74.09,A:139040684;C:120128748;G:123529198;T:136551898;N:171800,74,,,,139040684,120128748,123529198,136551898,171800,SRX21286663,SRS18536776,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94297,,0.06942,,0.73726,,0.47499,,74,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24938,SRR25557789,SRX21286663,SRS18536776,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant IX,GSM7688792,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant IX,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688792,GSM7688792: Morphant IX; Danio rerio; RNA Seq,GSM7688792 r1,GSM7688792,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-IX_S16_L004_R1_001.fastq.gz,fastq,511640294.0,6905748.0,GSM7688792 r4,0:74.09,A:136914638;C:118302866;G:121704665;T:134543505;N:174620,74,,,,136914638,118302866,121704665,134543505,174620,SRX21286663,SRS18536776,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94176,,0.07029,,0.73868,,0.47987,,74,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24939,SRR25557790,SRX21286662,SRS18536775,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant VIII,GSM7688791,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant VIII,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688791,GSM7688791: Morphant VIII; Danio rerio; RNA Seq,GSM7688791 r1,GSM7688791,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-VIII_S14_L001_R1_001.fastq.gz,fastq,429446821.0,5803178.0,GSM7688791 r1,0:74.00,A:114793535;C:99506379;G:102226914;T:112748761;N:171232,74,,,,114793535,99506379,102226914,112748761,171232,SRX21286662,SRS18536775,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94175,,0.06669,,0.73673,,0.48179,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24940,SRR25557791,SRX21286662,SRS18536775,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant VIII,GSM7688791,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant VIII,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688791,GSM7688791: Morphant VIII; Danio rerio; RNA Seq,GSM7688791 r1,GSM7688791,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-VIII_S14_L002_R1_001.fastq.gz,fastq,434629893.0,5870828.0,GSM7688791 r2,0:74.03,A:116216940;C:100703527;G:103463365;T:114092681;N:153380,74,,,,116216940,100703527,103463365,114092681,153380,SRX21286662,SRS18536775,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94143,,0.0676,,0.73791,,0.48091,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24941,SRR25557792,SRX21286662,SRS18536775,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant VIII,GSM7688791,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant VIII,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688791,GSM7688791: Morphant VIII; Danio rerio; RNA Seq,GSM7688791 r1,GSM7688791,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-VIII_S14_L003_R1_001.fastq.gz,fastq,435879881.0,5888685.0,GSM7688791 r3,0:74.02,A:116548094;C:100971153;G:103794902;T:114400770;N:164962,74,,,,116548094,100971153,103794902,114400770,164962,SRX21286662,SRS18536775,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94195,,0.06686,,0.73785,,0.48044,,73,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System