rowid,run.accession,experiment.accession,sample.accession,study.accession,bioproject,study.title,study.alias,study.type,study.abstract,study.attributes,study.PMIDs,sample.description,sample.title,sample.alias,sample.centername,sample.attributes,GEOsample.title,GEOsample.dataprocessing,GEOsample.source,GEOsample.treatmentprotocol,GEOsample.extractprotocol,GEOsample.growthprotocol,GEOsample.characteristics,GEOsample.accession,experiment.title,experiment.alias,experiment.library_name,experiment.design_description,experiment.library_construction_protocol,experiment.attributes,experiment.library_strategy,experiment.library_source,experiment.library_selection,experiment.library_layout,experiment.platform,experiment.instrument_model,experiment.spot_descriptor,experiment.study_ref,run.title,run.attributes,run.filename,run.semantic_name,run.total_bases,run.total_spots,run.alias,run.read_lengths,run.base_counts,run.r1_length,run.r2_length,run.r3_length,run.r4_length,run.Acount,run.Ccount,run.Gcount,run.Tcount,run.Ncount,run.experiment,run.pool_member,submission.accession,submission.srasource,submission.bioprojectsource,seqdetective.n_mates,seqdetective.mapping_rate.mate1,seqdetective.mapping_rate.mate2,seqdetective.nofeature_rate.mate1,seqdetective.nofeature_rate.mate2,seqdetective.sparsity.mate1,seqdetective.sparsity.mate2,seqdetective.pos_strand_rate.mate1,seqdetective.pos_strand_rate.mate2,seqdetective.readlen.mate1,seqdetective.readlen.mate2,seqdetective.judgement.mate1,seqdetective.judgement.mate2,seqdetective.judgement.reason,platform_family,instrument_generation,read_bias,selection_class,prep_kit,sc_or_bulk,tech_class,technology,tech_variant,submission.bioprojectsource.country,earliest_date,devstage_curation,devstage_curation_coarse,tissue_curation,tissue_curation_coarse
38119,SRR1551796,SRX681416,SRS685079,SRP045504,PRJNA258223,Danio rerio strain:TL Transcriptome or Gene expression,PRJNA258223,Other,Transcriptome profiling of keratocytes derived from 2dpf and 4dpf embryos,,,,Transcriptome from 2dpf keratocytes,keratocytes from 2dpf embryos,,breed:TL|strain:TL|age:2dpf|biomaterial provider:Julie Theriot Stanford University|sex:not collected|tissue:keratocytes skin|cell type:keratocyte|dev stage:2dpf|BioSampleModel:Model organism or animal,,,,,,,,,Transcriptome from 2dpf keratocytes replicate 3,2dpf 3,2dpf 3,RNA was extracted from approximately 1 x 105 keratocytes per sample using Trizol Invitrogen. Three biological replicates were collected for each developmental stage. Ribosomal RNA was depleted using the Ribo Zero magnetic kit Epicentre. The remaining mRNA was then fragmented with 8 minutes incubation in 50mM sodium carbonate/bicarbonate 1mM EDTA pH 9.2 at 95 degrees. To prepare cDNA first strand synthesis was performed with Superscript III Invitrogen using random hexamer priming and second strand synthesis was performed with DNA Polymerase I NEB. Illumina libraries were prepared from the cDNA in an automated fashion using the Illumina TruSeq sample prep kit with TruSeq adapters on a SPRIworks System I Beckman Coulter. Sequencing reactions were performed on an Illumina Genome Analyzer IIX according to manufacturer’s instructions to generate 40nt single ended reads.,,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina Genome Analyzer IIx,400Application ReadForward1,SRP045504,,,lane3_2dpf629.fastq,fastq,551787520.0,13794688.0,2dpf 3,0:40,A:138660463;C:132605577;G:134640312;T:145852714;N:28454,40,,,,138660463,132605577,134640312,145852714,28454,SRX681416,SRS685079,SRA179323,Stanford University|Julie Theriot,Stanford University,1,0.91375,,0.21598,,0.75317,,0.47881,,40,,B,,usable mapping rate,illumina,early_illumina,unknown,poly_a,trueseq,bulk,unknown,unknown,,United States,2014-08-14,Hatching,Embryo,Skin,Surface Structure
38120,SRR1551795,SRX681415,SRS685079,SRP045504,PRJNA258223,Danio rerio strain:TL Transcriptome or Gene expression,PRJNA258223,Other,Transcriptome profiling of keratocytes derived from 2dpf and 4dpf embryos,,,,Transcriptome from 2dpf keratocytes,keratocytes from 2dpf embryos,,breed:TL|strain:TL|age:2dpf|biomaterial provider:Julie Theriot Stanford University|sex:not collected|tissue:keratocytes skin|cell type:keratocyte|dev stage:2dpf|BioSampleModel:Model organism or animal,,,,,,,,,Transcriptome from 2dpf keratocytes,2dpf 2,2dpf 2,RNA was extracted from approximately 1 x 105 keratocytes per sample using Trizol Invitrogen. Three biological replicates were collected for each developmental stage. Ribosomal RNA was depleted using the Ribo Zero magnetic kit Epicentre. The remaining mRNA was then fragmented with 8 minutes incubation in 50mM sodium carbonate/bicarbonate 1mM EDTA pH 9.2 at 95 degrees. To prepare cDNA first strand synthesis was performed with Superscript III Invitrogen using random hexamer priming and second strand synthesis was performed with DNA Polymerase I NEB. Illumina libraries were prepared from the cDNA in an automated fashion using the Illumina TruSeq sample prep kit with TruSeq adapters on a SPRIworks System I Beckman Coulter. Sequencing reactions were performed on an Illumina Genome Analyzer IIX according to manufacturer’s instructions to generate 40nt single ended reads.,,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina Genome Analyzer IIx,400Application ReadForward1,SRP045504,,,lane1_2dpf.fastq,fastq,796874112.0,22135392.0,2dpf 2,0:36,A:209956517;C:184659684;G:185142987;T:216055902;N:1059022,36,,,,209956517,184659684,185142987,216055902,1059022,SRX681415,SRS685079,SRA179323,Stanford University|Julie Theriot,Stanford University,1,0.89178,,0.17837,,0.7609,,0.49774,,36,,B,,usable mapping rate,illumina,early_illumina,unknown,poly_a,trueseq,bulk,unknown,unknown,,United States,2015-04-07,Hatching,Embryo,Skin,Surface Structure
38121,SRR1551782,SRX681402,SRS685079,SRP045504,PRJNA258223,Danio rerio strain:TL Transcriptome or Gene expression,PRJNA258223,Other,Transcriptome profiling of keratocytes derived from 2dpf and 4dpf embryos,,,,Transcriptome from 2dpf keratocytes,keratocytes from 2dpf embryos,,breed:TL|strain:TL|age:2dpf|biomaterial provider:Julie Theriot Stanford University|sex:not collected|tissue:keratocytes skin|cell type:keratocyte|dev stage:2dpf|BioSampleModel:Model organism or animal,,,,,,,,,2dpf keratocytes replicate 1,2dpf 1,2dpf 1,RNA was extracted from approximately 1 x 105 keratocytes per sample using Trizol Invitrogen. Three biological replicates were collected for each developmental stage. Ribosomal RNA was depleted using the Ribo Zero magnetic kit Epicentre. The remaining mRNA was then fragmented with 8 minutes incubation in 50mM sodium carbonate/bicarbonate 1mM EDTA pH 9.2 at 95 degrees. To prepare cDNA first strand synthesis was performed with Superscript III Invitrogen using random hexamer priming and second strand synthesis was performed with DNA Polymerase I NEB. Illumina libraries were prepared from the cDNA in an automated fashion using the Illumina TruSeq sample prep kit with TruSeq adapters on a SPRIworks System I Beckman Coulter. Sequencing reactions were performed on an Illumina Genome Analyzer IIX according to manufacturer’s instructions to generate 40nt single ended reads.,,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina Genome Analyzer IIx,400Application ReadForward1,SRP045504,,,lane6_2dpf.fastq,fastq,647944118.0,17051161.0,2dpf 1,0:38,A:145735255;C:167786338;G:186677806;T:141598169;N:6146550,38,,,,145735255,167786338,186677806,141598169,6146550,SRX681402,SRS685079,SRA179323,Stanford University|Julie Theriot,Stanford University,1,0.7695,,0.15816,,0.81491,,0.44972,,38,,B,,usable mapping rate,illumina,early_illumina,unknown,poly_a,trueseq,bulk,unknown,unknown,,United States,2014-08-14,Hatching,Embryo,Skin,Surface Structure
52812,SRR9211490,SRX5982381,SRS4887886,SRP200656,PRJNA547573,Tissue specific transcriptomes reveal gene expression trajectories in two maturing skin epithelial layers in zebrafish embryos,GSE132304,Transcriptome Analysis,We purified FACS and profiled RNA Seq zebrafish embryo skin cells vs. nonskin cells at three early developmental stages. At two of the stages we further purified and profiled two distinct epithelial layers of the skin: the periderm and basal cells. Our comprehensive expression analysis provides the first reported transcriptomes of these two cell types reveals gene expression dynamics in space and time and identifies common and distinct features of epithelial maturation in the two layers. Given the conserved nature of skin development we believe our study to be of interest to those studying skin in other vertebrates. Overall design: At each of 20 SS 52 hpf and 72 hpf we used krt4:dsRed transgenic zebrafish embryos and FACS to prepare and run two RNA Seq conditions: all skin vs. nonskin1 with two replicates for each condition. At each of 52 hpf and 72 hpf we used krt4:dsRed;krt5:GFP transenic zebrafish embryos and FACS to prepare and run three RNA Seq conditions: periderm vs. basal cells vs. nonskin2 with two replicates for each condition except 52 hpf nonskin2 has only one replicate.,,pubmed:31431477,,52 hpf nonskin2 only replicate,GSM3855898,,source name:FACS isolated nonskin cells from whole embryos|strain:AB+TU|developmental stage:52 hpf|tissue:FACS nonskin2|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed;krt5:GFP,52 hpf nonskin2 only replicate,Demultiplexing: single mismatch to expected 7 mers only keeping PF=1 spots Adapter low quality base trimming: CutAdapt 1.8.1 m 21 trim n max n=2 q 10 10 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC then only keeping reads >=47 nt long and only keeping the first 47 nt of those reads Alignment: STAR 2.5.3a to genome and transcriptome single pass mode with known junctions retaining multiple locations for non uniquely aligning reads see paper or BAMs for parameters Quantification: Salmon patched 0.10.2 numGibbsSamples=1000 thinningFactor=25 useVBOpt libType=U fldMean=200 fldSD=200 rangeFactorizationBins=4 minAssignedFrags=1 seqBias noBiasLengthThreshold with 1 000 Gibbs samples per experiment Statistics: see paper; similar to R Bioconductor Sleuth with Wasabi as importer but elaborated and with some DESeq2 features incorporated Genome build: Ensembl release 92 top level reference Zebrafish genome GRCz11 chr1..25 + MT + 847/120 KN/KZ scaffolds + PhiX and associated Ensembl genebuild annotations/models Supplementary files format and content: GZIP TAR Salmon files: GZIP compressed TAR archives of Salmon transcript quantification output filesystem trees. Supplementary file: Microsoft Excel workbook in XLSX format with multiple worksheets containing a comprehensive collection of analysis input data intermediate steps and statistical outputs see column headers as well as Methods and Supplemental methods of the associated journal publication.,FACS isolated nonskin cells from whole embryos,Transgenic embryos without xxx treatment,Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer’s solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit.,Zebrafish were maintained in 28.5 C and pH 7.5 fish water. Adults were kept in a 14 hour light / 10 hour dark cycle.,strain:AB+TU|developmental stage:52 hpf|tissue:FACS nonskin2|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed;krt5:GFP,GSM3855898,GSM3855898: 52 hpf nonskin2 only replicate; Danio rerio; RNA Seq,GSM3855898,,1,Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer's solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit.,GEO Accession:GSM3855898,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP200656,,,ZFishSkin_Reads_c09_52hpf-nonskin2_once_i12.CTTGTAA.pf1_VA061L6.fastq.gz,fastq,1497326340.0,29359340.0,GSM3855898 r1,0:51,A:395115715;C:356520233;G:354572362;T:391098396;N:19634,51,,,,395115715,356520233,354572362,391098396,19634,SRX5982381,SRS4887886,SRA894819,GEO,UCLA,1,0.93658,,0.08376,,0.70201,,0.47789,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United States,2019-06-06,Hatching,Embryo,Skin,Surface Structure
52813,SRR9211489,SRX5982380,SRS4887885,SRP200656,PRJNA547573,Tissue specific transcriptomes reveal gene expression trajectories in two maturing skin epithelial layers in zebrafish embryos,GSE132304,Transcriptome Analysis,We purified FACS and profiled RNA Seq zebrafish embryo skin cells vs. nonskin cells at three early developmental stages. At two of the stages we further purified and profiled two distinct epithelial layers of the skin: the periderm and basal cells. Our comprehensive expression analysis provides the first reported transcriptomes of these two cell types reveals gene expression dynamics in space and time and identifies common and distinct features of epithelial maturation in the two layers. Given the conserved nature of skin development we believe our study to be of interest to those studying skin in other vertebrates. Overall design: At each of 20 SS 52 hpf and 72 hpf we used krt4:dsRed transgenic zebrafish embryos and FACS to prepare and run two RNA Seq conditions: all skin vs. nonskin1 with two replicates for each condition. At each of 52 hpf and 72 hpf we used krt4:dsRed;krt5:GFP transenic zebrafish embryos and FACS to prepare and run three RNA Seq conditions: periderm vs. basal cells vs. nonskin2 with two replicates for each condition except 52 hpf nonskin2 has only one replicate.,,pubmed:31431477,,52 hpf all skin replicate B,GSM3855897,,source name:FACS isolated all skin cells from whole embryos|strain:AB+TU|developmental stage:52 hpf|tissue:FACS all skin|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed,52 hpf all skin replicate B,Demultiplexing: single mismatch to expected 7 mers only keeping PF=1 spots Adapter low quality base trimming: CutAdapt 1.8.1 m 21 trim n max n=2 q 10 10 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC then only keeping reads >=47 nt long and only keeping the first 47 nt of those reads Alignment: STAR 2.5.3a to genome and transcriptome single pass mode with known junctions retaining multiple locations for non uniquely aligning reads see paper or BAMs for parameters Quantification: Salmon patched 0.10.2 numGibbsSamples=1000 thinningFactor=25 useVBOpt libType=U fldMean=200 fldSD=200 rangeFactorizationBins=4 minAssignedFrags=1 seqBias noBiasLengthThreshold with 1 000 Gibbs samples per experiment Statistics: see paper; similar to R Bioconductor Sleuth with Wasabi as importer but elaborated and with some DESeq2 features incorporated Genome build: Ensembl release 92 top level reference Zebrafish genome GRCz11 chr1..25 + MT + 847/120 KN/KZ scaffolds + PhiX and associated Ensembl genebuild annotations/models Supplementary files format and content: GZIP TAR Salmon files: GZIP compressed TAR archives of Salmon transcript quantification output filesystem trees. Supplementary file: Microsoft Excel workbook in XLSX format with multiple worksheets containing a comprehensive collection of analysis input data intermediate steps and statistical outputs see column headers as well as Methods and Supplemental methods of the associated journal publication.,FACS isolated all skin cells from whole embryos,Transgenic embryos without xxx treatment,Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer’s solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit.,Zebrafish were maintained in 28.5 C and pH 7.5 fish water. Adults were kept in a 14 hour light / 10 hour dark cycle.,strain:AB+TU|developmental stage:52 hpf|tissue:FACS all skin|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed,GSM3855897,GSM3855897: 52 hpf all skin replicate B; Danio rerio; RNA Seq,GSM3855897,,1,Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer's solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit.,GEO Accession:GSM3855897,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP200656,,,ZFishSkin_Reads_c08_52hpf-allSkin-_repB_i03.TTAGGCA.pf1_XB039L2.fastq.gz,fastq,1519404450.0,30388089.0,GSM3855897 r1,0:50,A:387412457;C:374238433;G:369512809;T:388217220;N:23531,50,,,,387412457,374238433,369512809,388217220,23531,SRX5982380,SRS4887885,SRA894819,GEO,UCLA,1,0.93866,,0.05037,,0.76437,,0.37263,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United States,2019-06-06,Hatching,Embryo,Skin,Surface Structure
52814,SRR9211488,SRX5982379,SRS4887884,SRP200656,PRJNA547573,Tissue specific transcriptomes reveal gene expression trajectories in two maturing skin epithelial layers in zebrafish embryos,GSE132304,Transcriptome Analysis,We purified FACS and profiled RNA Seq zebrafish embryo skin cells vs. nonskin cells at three early developmental stages. At two of the stages we further purified and profiled two distinct epithelial layers of the skin: the periderm and basal cells. Our comprehensive expression analysis provides the first reported transcriptomes of these two cell types reveals gene expression dynamics in space and time and identifies common and distinct features of epithelial maturation in the two layers. Given the conserved nature of skin development we believe our study to be of interest to those studying skin in other vertebrates. Overall design: At each of 20 SS 52 hpf and 72 hpf we used krt4:dsRed transgenic zebrafish embryos and FACS to prepare and run two RNA Seq conditions: all skin vs. nonskin1 with two replicates for each condition. At each of 52 hpf and 72 hpf we used krt4:dsRed;krt5:GFP transenic zebrafish embryos and FACS to prepare and run three RNA Seq conditions: periderm vs. basal cells vs. nonskin2 with two replicates for each condition except 52 hpf nonskin2 has only one replicate.,,pubmed:31431477,,52 hpf all skin replicate A,GSM3855896,,source name:FACS isolated all skin cells from whole embryos|strain:AB+TU|developmental stage:52 hpf|tissue:FACS all skin|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed,52 hpf all skin replicate A,Demultiplexing: single mismatch to expected 7 mers only keeping PF=1 spots Adapter low quality base trimming: CutAdapt 1.8.1 m 21 trim n max n=2 q 10 10 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC then only keeping reads >=47 nt long and only keeping the first 47 nt of those reads Alignment: STAR 2.5.3a to genome and transcriptome single pass mode with known junctions retaining multiple locations for non uniquely aligning reads see paper or BAMs for parameters Quantification: Salmon patched 0.10.2 numGibbsSamples=1000 thinningFactor=25 useVBOpt libType=U fldMean=200 fldSD=200 rangeFactorizationBins=4 minAssignedFrags=1 seqBias noBiasLengthThreshold with 1 000 Gibbs samples per experiment Statistics: see paper; similar to R Bioconductor Sleuth with Wasabi as importer but elaborated and with some DESeq2 features incorporated Genome build: Ensembl release 92 top level reference Zebrafish genome GRCz11 chr1..25 + MT + 847/120 KN/KZ scaffolds + PhiX and associated Ensembl genebuild annotations/models Supplementary files format and content: GZIP TAR Salmon files: GZIP compressed TAR archives of Salmon transcript quantification output filesystem trees. Supplementary file: Microsoft Excel workbook in XLSX format with multiple worksheets containing a comprehensive collection of analysis input data intermediate steps and statistical outputs see column headers as well as Methods and Supplemental methods of the associated journal publication.,FACS isolated all skin cells from whole embryos,Transgenic embryos without xxx treatment,Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer’s solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit.,Zebrafish were maintained in 28.5 C and pH 7.5 fish water. Adults were kept in a 14 hour light / 10 hour dark cycle.,strain:AB+TU|developmental stage:52 hpf|tissue:FACS all skin|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed,GSM3855896,GSM3855896: 52 hpf all skin replicate A; Danio rerio; RNA Seq,GSM3855896,,1,Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer's solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit.,GEO Accession:GSM3855896,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP200656,,,ZFishSkin_Reads_c07_52hpf-allSkin-_repA_i05.ACAGTGA.pf1_XA025L6plusXB039L2.fastq.gz,fastq,1419182550.0,28383651.0,GSM3855896 r1,0:50,A:352916142;C:345678567;G:351315754;T:364989027;N:4283060,50,,,,352916142,345678567,351315754,364989027,4283060,SRX5982379,SRS4887884,SRA894819,GEO,UCLA,1,0.92139,,0.06056,,0.76763,,0.39214,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United States,2019-06-06,Hatching,Embryo,Skin,Surface Structure
52815,SRR9211487,SRX5982378,SRS4887883,SRP200656,PRJNA547573,Tissue specific transcriptomes reveal gene expression trajectories in two maturing skin epithelial layers in zebrafish embryos,GSE132304,Transcriptome Analysis,We purified FACS and profiled RNA Seq zebrafish embryo skin cells vs. nonskin cells at three early developmental stages. At two of the stages we further purified and profiled two distinct epithelial layers of the skin: the periderm and basal cells. Our comprehensive expression analysis provides the first reported transcriptomes of these two cell types reveals gene expression dynamics in space and time and identifies common and distinct features of epithelial maturation in the two layers. Given the conserved nature of skin development we believe our study to be of interest to those studying skin in other vertebrates. Overall design: At each of 20 SS 52 hpf and 72 hpf we used krt4:dsRed transgenic zebrafish embryos and FACS to prepare and run two RNA Seq conditions: all skin vs. nonskin1 with two replicates for each condition. At each of 52 hpf and 72 hpf we used krt4:dsRed;krt5:GFP transenic zebrafish embryos and FACS to prepare and run three RNA Seq conditions: periderm vs. basal cells vs. nonskin2 with two replicates for each condition except 52 hpf nonskin2 has only one replicate.,,pubmed:31431477,,52 hpf nonskin1 replicate B,GSM3855895,,source name:FACS isolated nonskin cells from whole embryos|strain:AB+TU|developmental stage:52 hpf|tissue:FACS nonskin1|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed,52 hpf nonskin1 replicate B,Demultiplexing: single mismatch to expected 7 mers only keeping PF=1 spots Adapter low quality base trimming: CutAdapt 1.8.1 m 21 trim n max n=2 q 10 10 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC then only keeping reads >=47 nt long and only keeping the first 47 nt of those reads Alignment: STAR 2.5.3a to genome and transcriptome single pass mode with known junctions retaining multiple locations for non uniquely aligning reads see paper or BAMs for parameters Quantification: Salmon patched 0.10.2 numGibbsSamples=1000 thinningFactor=25 useVBOpt libType=U fldMean=200 fldSD=200 rangeFactorizationBins=4 minAssignedFrags=1 seqBias noBiasLengthThreshold with 1 000 Gibbs samples per experiment Statistics: see paper; similar to R Bioconductor Sleuth with Wasabi as importer but elaborated and with some DESeq2 features incorporated Genome build: Ensembl release 92 top level reference Zebrafish genome GRCz11 chr1..25 + MT + 847/120 KN/KZ scaffolds + PhiX and associated Ensembl genebuild annotations/models Supplementary files format and content: GZIP TAR Salmon files: GZIP compressed TAR archives of Salmon transcript quantification output filesystem trees. Supplementary file: Microsoft Excel workbook in XLSX format with multiple worksheets containing a comprehensive collection of analysis input data intermediate steps and statistical outputs see column headers as well as Methods and Supplemental methods of the associated journal publication.,FACS isolated nonskin cells from whole embryos,Transgenic embryos without xxx treatment,Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer’s solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit.,Zebrafish were maintained in 28.5 C and pH 7.5 fish water. Adults were kept in a 14 hour light / 10 hour dark cycle.,strain:AB+TU|developmental stage:52 hpf|tissue:FACS nonskin1|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed,GSM3855895,GSM3855895: 52 hpf nonskin1 replicate B; Danio rerio; RNA Seq,GSM3855895,,1,Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer's solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit.,GEO Accession:GSM3855895,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP200656,,,ZFishSkin_Reads_c06_52hpf-nonskin1_repB_i01.ATCACGA.pf1_XB039L2.fastq.gz,fastq,2006001000.0,40120020.0,GSM3855895 r1,0:50,A:519738512;C:486660134;G:481964980;T:517604839;N:32535,50,,,,519738512,486660134,481964980,517604839,32535,SRX5982378,SRS4887883,SRA894819,GEO,UCLA,1,0.9459,,0.07046,,0.68389,,0.48047,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United States,2019-06-06,Hatching,Embryo,Skin,Surface Structure
52816,SRR9211486,SRX5982377,SRS4887882,SRP200656,PRJNA547573,Tissue specific transcriptomes reveal gene expression trajectories in two maturing skin epithelial layers in zebrafish embryos,GSE132304,Transcriptome Analysis,We purified FACS and profiled RNA Seq zebrafish embryo skin cells vs. nonskin cells at three early developmental stages. At two of the stages we further purified and profiled two distinct epithelial layers of the skin: the periderm and basal cells. Our comprehensive expression analysis provides the first reported transcriptomes of these two cell types reveals gene expression dynamics in space and time and identifies common and distinct features of epithelial maturation in the two layers. Given the conserved nature of skin development we believe our study to be of interest to those studying skin in other vertebrates. Overall design: At each of 20 SS 52 hpf and 72 hpf we used krt4:dsRed transgenic zebrafish embryos and FACS to prepare and run two RNA Seq conditions: all skin vs. nonskin1 with two replicates for each condition. At each of 52 hpf and 72 hpf we used krt4:dsRed;krt5:GFP transenic zebrafish embryos and FACS to prepare and run three RNA Seq conditions: periderm vs. basal cells vs. nonskin2 with two replicates for each condition except 52 hpf nonskin2 has only one replicate.,,pubmed:31431477,,52 hpf nonskin1 replicate A,GSM3855894,,source name:FACS isolated nonskin cells from whole embryos|strain:AB+TU|developmental stage:52 hpf|tissue:FACS nonskin1|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed,52 hpf nonskin1 replicate A,Demultiplexing: single mismatch to expected 7 mers only keeping PF=1 spots Adapter low quality base trimming: CutAdapt 1.8.1 m 21 trim n max n=2 q 10 10 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC then only keeping reads >=47 nt long and only keeping the first 47 nt of those reads Alignment: STAR 2.5.3a to genome and transcriptome single pass mode with known junctions retaining multiple locations for non uniquely aligning reads see paper or BAMs for parameters Quantification: Salmon patched 0.10.2 numGibbsSamples=1000 thinningFactor=25 useVBOpt libType=U fldMean=200 fldSD=200 rangeFactorizationBins=4 minAssignedFrags=1 seqBias noBiasLengthThreshold with 1 000 Gibbs samples per experiment Statistics: see paper; similar to R Bioconductor Sleuth with Wasabi as importer but elaborated and with some DESeq2 features incorporated Genome build: Ensembl release 92 top level reference Zebrafish genome GRCz11 chr1..25 + MT + 847/120 KN/KZ scaffolds + PhiX and associated Ensembl genebuild annotations/models Supplementary files format and content: GZIP TAR Salmon files: GZIP compressed TAR archives of Salmon transcript quantification output filesystem trees. Supplementary file: Microsoft Excel workbook in XLSX format with multiple worksheets containing a comprehensive collection of analysis input data intermediate steps and statistical outputs see column headers as well as Methods and Supplemental methods of the associated journal publication.,FACS isolated nonskin cells from whole embryos,Transgenic embryos without xxx treatment,Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer’s solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit.,Zebrafish were maintained in 28.5 C and pH 7.5 fish water. Adults were kept in a 14 hour light / 10 hour dark cycle.,strain:AB+TU|developmental stage:52 hpf|tissue:FACS nonskin1|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed,GSM3855894,GSM3855894: 52 hpf nonskin1 replicate A; Danio rerio; RNA Seq,GSM3855894,,1,Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer's solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit.,GEO Accession:GSM3855894,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP200656,,,ZFishSkin_Reads_c05_52hpf-nonskin1_repA_i06.GCCAATA.pf1_XA025L6plusXB039L2.fastq.gz,fastq,1349409700.0,26988194.0,GSM3855894 r1,0:50,A:342685736;C:323811588;G:328073629;T:350810627;N:4028120,50,,,,342685736,323811588,328073629,350810627,4028120,SRX5982377,SRS4887882,SRA894819,GEO,UCLA,1,0.92593,,0.09166,,0.70532,,0.47167,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United States,2019-06-06,Hatching,Embryo,Skin,Surface Structure
71777,SRR22094621,SRX18074628,SRS15579663,SRP405171,PRJNA893397,RNA sequencing of the zebrafish superficial epithelial cells,PRJNA893397,Other,"We discovered that the superficial epithelial cells SECs of zebrafish larvae could adapt a unique kind of cell division during rapid growth conditions. We termed it ""asynthetic fission"". We determined that asynthetic fission occurs in the absence of DNA replication generating progeny cells with reduced genome size. Here we aim to define the transcriptional landscape of the SECs during asynthetic fission by applying RNA sequencing.",,,replicate,SEC 2dpf r,SEC 2dpf r,,strain:EK|age:2dpf|dev stage:2dpf|sex:NA|tissue:skin superficial epithelial cell|BioSampleModel:Model organism or animal,,,,,,,,,RNA sequencing of zebrafish:superficial epithelial cells 2dpf replicate,LTS21 YW01,LTS21 YW01,100 150 larvae at 2 dpf 6 dpf 14 dpf and 21 dpf were first rinsed with 1x DPBS Gibco 14190 144 then digested with collagenase Sigma C9891 and 0.25% trypsin EDTA Sigma T4049. Digestion was stopped with DMEM Gibco 11995 065 with 10% NCS and rinsed with 1 x DPBS. Then cells were suspended in DMEM 10% NCS and filtered with a 35 m cell strainer tube. Dissociated cells were stained with PI 1 g/ml for 106 cells per mL for 5 min in the dark. All EGFP+ and PI cells were sorted by FACSAria IIIu BD Biosciences. Cells were directly sorted in buffer RLT supplemented with 1% mercapto ethanol provided in RNeasy Micro kit Qiagen and stored in 80 C until RNA extraction was performed. Total 2 replicates for each timepoint were collected. RNA extraction was carried out using RNeasy Micro kit according to manufacturers instructions. Sequencing was performed by the NGS High Throughput Genomics Core in Biodiversity Research Center Academia Sinica Taiwan using Illumina NextSeq2000 with paired end 2 x 150 bp chemistry and a library selection of low input stranded RNA library preparation Poly A.,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,NextSeq 2000,,SRP405171,,,LTS21_YW01_S3_L001_R1_001.fastq.gz LTS21_YW01_S3_L001_R2_001.fastq.gz,fastq fastq,19999530824.0,66223612.0,LTS21 YW01 S3 L001 R1 001.fastq.gz,0:151 1:151,A:5239226851;C:4832853944;G:4579224440;T:5331222900;N:17002689,151,151,,,5239226851,4832853944,4579224440,5331222900,17002689,SRX18074628,SRS15579663,SRA1530145,Academia Sinica|Institute of Cellular and Organismic Biology,Academia Sinica,2,0.77399,0.76874,0.04763,0.04655,0.75035,0.75087,0.423,0.42383,151,151,B,B,biological fallback assumption,illumina,nextseq_v2,unknown,poly_a,unknown,bulk,unknown,unknown,,Taiwan,2022-10-29,Hatching,Embryo,Skin,Surface Structure
71778,SRR22094622,SRX18074627,SRS15579662,SRP405171,PRJNA893397,RNA sequencing of the zebrafish superficial epithelial cells,PRJNA893397,Other,"We discovered that the superficial epithelial cells SECs of zebrafish larvae could adapt a unique kind of cell division during rapid growth conditions. We termed it ""asynthetic fission"". We determined that asynthetic fission occurs in the absence of DNA replication generating progeny cells with reduced genome size. Here we aim to define the transcriptional landscape of the SECs during asynthetic fission by applying RNA sequencing.",,,,SEC 2dpf,Zebrafish SEC 2dpf,,strain:EK|age:2dpf|dev stage:2dpf|sex:NA|tissue:Skin|BioSampleModel:Model organism or animal,,,,,,,,,RNA sequencing of zebrafish:superficial epithelial cells 2dpf,LTS21 YG01,LTS21 YG01,100 150 larvae at 2 dpf 6 dpf 14 dpf and 21 dpf were first rinsed with 1x DPBS Gibco 14190 144 then digested with collagenase Sigma C9891 and 0.25% trypsin EDTA Sigma T4049. Digestion was stopped with DMEM Gibco 11995 065 with 10% NCS and rinsed with 1 x DPBS. Then cells were suspended in DMEM 10% NCS and filtered with a 35 m cell strainer tube. Dissociated cells were stained with PI 1 g/ml for 106 cells per mL for 5 min in the dark. All EGFP+ and PI cells were sorted by FACSAria IIIu BD Biosciences. Cells were directly sorted in buffer RLT supplemented with 1% mercapto ethanol provided in RNeasy Micro kit Qiagen and stored in 80 C until RNA extraction was performed. Total 2 replicates for each timepoint were collected. RNA extraction was carried out using RNeasy Micro kit according to manufacturers instructions. Sequencing was performed by the NGS High Throughput Genomics Core in Biodiversity Research Center Academia Sinica Taiwan using Illumina NextSeq2000 with paired end 2 x 150 bp chemistry and a library selection of low input stranded RNA library preparation Poly A.,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,NextSeq 2000,,SRP405171,,,LTS21_YG01_S1_L001_R1_001.fastq.gz LTS21_YG01_S1_L001_R2_001.fastq.gz,fastq fastq,18171646530.0,60171015.0,LTS21 YG01 S1 L001 R1 001.fastq.gz,0:151 1:151,A:4727063040;C:4426085600;G:4200458773;T:4802148545;N:15890572,151,151,,,4727063040,4426085600,4200458773,4802148545,15890572,SRX18074627,SRS15579662,SRA1530145,Academia Sinica|Institute of Cellular and Organismic Biology,Academia Sinica,2,0.76303,0.75602,0.03268,0.03163,0.78427,0.78484,0.3601,0.35972,151,151,B,B,biological fallback assumption,illumina,nextseq_v2,unknown,poly_a,unknown,bulk,unknown,unknown,,Taiwan,2022-10-29,Hatching,Embryo,Skin,Surface Structure