rowid,run.accession,experiment.accession,sample.accession,study.accession,bioproject,study.title,study.alias,study.type,study.abstract,study.attributes,study.PMIDs,sample.description,sample.title,sample.alias,sample.centername,sample.attributes,GEOsample.title,GEOsample.dataprocessing,GEOsample.source,GEOsample.treatmentprotocol,GEOsample.extractprotocol,GEOsample.growthprotocol,GEOsample.characteristics,GEOsample.accession,experiment.title,experiment.alias,experiment.library_name,experiment.design_description,experiment.library_construction_protocol,experiment.attributes,experiment.library_strategy,experiment.library_source,experiment.library_selection,experiment.library_layout,experiment.platform,experiment.instrument_model,experiment.spot_descriptor,experiment.study_ref,run.title,run.attributes,run.filename,run.semantic_name,run.total_bases,run.total_spots,run.alias,run.read_lengths,run.base_counts,run.r1_length,run.r2_length,run.r3_length,run.r4_length,run.Acount,run.Ccount,run.Gcount,run.Tcount,run.Ncount,run.experiment,run.pool_member,submission.accession,submission.srasource,submission.bioprojectsource,seqdetective.n_mates,seqdetective.mapping_rate.mate1,seqdetective.mapping_rate.mate2,seqdetective.nofeature_rate.mate1,seqdetective.nofeature_rate.mate2,seqdetective.sparsity.mate1,seqdetective.sparsity.mate2,seqdetective.pos_strand_rate.mate1,seqdetective.pos_strand_rate.mate2,seqdetective.readlen.mate1,seqdetective.readlen.mate2,seqdetective.judgement.mate1,seqdetective.judgement.mate2,seqdetective.judgement.reason,platform_family,instrument_generation,read_bias,selection_class,prep_kit,sc_or_bulk,tech_class,technology,tech_variant,submission.bioprojectsource.country,earliest_date,devstage_curation,devstage_curation_coarse,tissue_curation,tissue_curation_coarse
11245,ERR10851251,ERX10296231,ERS14601258,ERP144652,PRJEB59599,Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41,E-MTAB-12577,Transcriptome Analysis,Comparison between wildtype and Gata2b heterozygous zebrafish HSPCs,ENA FIRST PUBLIC:2023 02 17|ENA LAST UPDATE:2023 02 17,,Protocols: Embryos were dissociated using Collagenase 1 2 and 4 and sorted using a FACS Aria III in trizol RNA was isolated from trizol RNA was smarter amplified,WT3 cd41pflt1p48hpf,SAMEA112483908,Department of Hematology cancer institute ErasmusMC,ENA FIRST PUBLIC:2023 02 17|ENA LAST UPDATE:2023 02 17|External Id:SAMEA112483908|INSDC center alias:Department of Hematology cancer institute ErasmusMC|INSDC center name:Department of Hematology cancer institute ErasmusMC|INSDC first public:2023 02 17T00:21:53Z|INSDC last update:2023 02 17T00:21:53Z|INSDC status:public|Submitter Id:E MTAB 12577:WT3 cd41pflt1p48hpf|age:48|broker name:ArrayExpress|cell type:hematopoietic stem cell|common name:zebrafish|developmental stage:embryo|genotype:wild type genotype|immunophenotype:CD41:GFP+ Flt1:RFP+|individual:pools of 3 embryos 1|organism part:liver|sample name:E MTAB 12577:WT3 cd41pflt1p48hpf|scientific name:Danio rerio|strain:TgCD41:GFP TgFlt1:RFP WT,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41,E MTAB 12577:WT3 cd41pflt1p48hpf p,WT3 cd41pflt1p48hpf p,Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41,Embryos were dissociated using Collagenase 1 2 and 4 and sorted using a FACS Aria III in trizol RNA was isolated from trizol RNA was smarter amplified,Experimental Factor: genotype:wild type genotype,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP144652,Illumina NovaSeq 6000 paired end sequencing; Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41,ENA FIRST PUBLIC:2023 02 17|ENA LAST UPDATE:2023 02 17,WT3_cd41pflt1p48hpf_R1.fastq.gz WT3_cd41pflt1p48hpf_R2.fastq.gz,fastq fastq,2865896816.0,14187608.0,E MTAB 12577:WT3 cd41pflt1p48hpf R,0:101 1:101,A:766433553;C:631932872;G:660672891;T:806849737;N:7763,101,101,,,766433553,631932872,660672891,806849737,7763,ERX10296231,ERS14601258,ERA20429817,Department of Hematology cancer institute ErasmusMC|European Nucleotide Archive,Department of Hematology cancer institute ErasmusMC|European Nucleotide Archive,2,0.90501,0.85042,0.09405,0.09335,0.87286,0.87943,0.48423,0.47904,101,101,B,B,biological fallback assumption,illumina,novaseq_era,full_length,cdna_unspecified,smarter,bulk,unknown,unknown,,Netherlands,2023-02-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
11246,ERR10851250,ERX10296230,ERS14601257,ERP144652,PRJEB59599,Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41,E-MTAB-12577,Transcriptome Analysis,Comparison between wildtype and Gata2b heterozygous zebrafish HSPCs,ENA FIRST PUBLIC:2023 02 17|ENA LAST UPDATE:2023 02 17,,Protocols: Embryos were dissociated using Collagenase 1 2 and 4 and sorted using a FACS Aria III in trizol RNA was isolated from trizol RNA was smarter amplified,WT2 cd41pflt1p48hpf,SAMEA112483907,Department of Hematology cancer institute ErasmusMC,ENA FIRST PUBLIC:2023 02 17|ENA LAST UPDATE:2023 02 17|External Id:SAMEA112483907|INSDC center alias:Department of Hematology cancer institute ErasmusMC|INSDC center name:Department of Hematology cancer institute ErasmusMC|INSDC first public:2023 02 17T00:21:53Z|INSDC last update:2023 02 17T00:21:53Z|INSDC status:public|Submitter Id:E MTAB 12577:WT2 cd41pflt1p48hpf|age:48|broker name:ArrayExpress|cell type:hematopoietic stem cell|common name:zebrafish|developmental stage:embryo|genotype:wild type genotype|immunophenotype:CD41:GFP+ Flt1:RFP+|individual:pools of 3 embryos 5|organism part:liver|sample name:E MTAB 12577:WT2 cd41pflt1p48hpf|scientific name:Danio rerio|strain:TgCD41:GFP TgFlt1:RFP WT,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41,E MTAB 12577:WT2 cd41pflt1p48hpf p,WT2 cd41pflt1p48hpf p,Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41,Embryos were dissociated using Collagenase 1 2 and 4 and sorted using a FACS Aria III in trizol RNA was isolated from trizol RNA was smarter amplified,Experimental Factor: genotype:wild type genotype,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP144652,Illumina NovaSeq 6000 paired end sequencing; Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41,ENA FIRST PUBLIC:2023 02 17|ENA LAST UPDATE:2023 02 17,WT2_cd41pflt1p48hpf_R1.fastq.gz WT2_cd41pflt1p48hpf_R2.fastq.gz,fastq fastq,2929743360.0,14503680.0,E MTAB 12577:WT2 cd41pflt1p48hpf R,0:101 1:101,A:803775344;C:639485652;G:661899077;T:824575679;N:7608,101,101,,,803775344,639485652,661899077,824575679,7608,ERX10296230,ERS14601257,ERA20429817,Department of Hematology cancer institute ErasmusMC|European Nucleotide Archive,Department of Hematology cancer institute ErasmusMC|European Nucleotide Archive,2,0.94558,0.90768,0.09379,0.09399,0.79058,0.79833,0.48216,0.47743,101,101,B,B,biological fallback assumption,illumina,novaseq_era,full_length,cdna_unspecified,smarter,bulk,unknown,unknown,,Netherlands,2023-02-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
11247,ERR10851249,ERX10296229,ERS14601256,ERP144652,PRJEB59599,Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41,E-MTAB-12577,Transcriptome Analysis,Comparison between wildtype and Gata2b heterozygous zebrafish HSPCs,ENA FIRST PUBLIC:2023 02 17|ENA LAST UPDATE:2023 02 17,,Protocols: Embryos were dissociated using Collagenase 1 2 and 4 and sorted using a FACS Aria III in trizol RNA was isolated from trizol RNA was smarter amplified,WT1 cd41pflt1p48hpf,SAMEA112483906,Department of Hematology cancer institute ErasmusMC,ENA FIRST PUBLIC:2023 02 17|ENA LAST UPDATE:2023 02 17|External Id:SAMEA112483906|INSDC center alias:Department of Hematology cancer institute ErasmusMC|INSDC center name:Department of Hematology cancer institute ErasmusMC|INSDC first public:2023 02 17T00:21:53Z|INSDC last update:2023 02 17T00:21:53Z|INSDC status:public|Submitter Id:E MTAB 12577:WT1 cd41pflt1p48hpf|age:48|broker name:ArrayExpress|cell type:hematopoietic stem cell|common name:zebrafish|developmental stage:embryo|genotype:wild type genotype|immunophenotype:CD41:GFP+ Flt1:RFP+|individual:pools of 3 embryos 4|organism part:liver|sample name:E MTAB 12577:WT1 cd41pflt1p48hpf|scientific name:Danio rerio|strain:TgCD41:GFP TgFlt1:RFP WT,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41,E MTAB 12577:WT1 cd41pflt1p48hpf p,WT1 cd41pflt1p48hpf p,Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41,Embryos were dissociated using Collagenase 1 2 and 4 and sorted using a FACS Aria III in trizol RNA was isolated from trizol RNA was smarter amplified,Experimental Factor: genotype:wild type genotype,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP144652,Illumina NovaSeq 6000 paired end sequencing; Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41,ENA FIRST PUBLIC:2023 02 17|ENA LAST UPDATE:2023 02 17,WT1_cd41pflt1p48hpf_R1.fastq.gz WT1_cd41pflt1p48hpf_R2.fastq.gz,fastq fastq,3248647426.0,16082413.0,E MTAB 12577:WT1 cd41pflt1p48hpf R,0:101 1:101,A:883030193;C:725566673;G:750551574;T:889489774;N:9212,101,101,,,883030193,725566673,750551574,889489774,9212,ERX10296229,ERS14601256,ERA20429817,Department of Hematology cancer institute ErasmusMC|European Nucleotide Archive,Department of Hematology cancer institute ErasmusMC|European Nucleotide Archive,2,0.91568,0.8915,0.09819,0.09602,0.86634,0.8706,0.48887,0.48731,101,101,B,B,biological fallback assumption,illumina,novaseq_era,full_length,cdna_unspecified,smarter,bulk,unknown,unknown,,Netherlands,2023-02-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
11248,ERR10851248,ERX10296228,ERS14601255,ERP144652,PRJEB59599,Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41,E-MTAB-12577,Transcriptome Analysis,Comparison between wildtype and Gata2b heterozygous zebrafish HSPCs,ENA FIRST PUBLIC:2023 02 17|ENA LAST UPDATE:2023 02 17,,Protocols: Embryos were dissociated using Collagenase 1 2 and 4 and sorted using a FACS Aria III in trizol RNA was isolated from trizol RNA was smarter amplified,Het3 cd41pflt1p48hpf,SAMEA112483905,Department of Hematology cancer institute ErasmusMC,ENA FIRST PUBLIC:2023 02 17|ENA LAST UPDATE:2023 02 17|External Id:SAMEA112483905|INSDC center alias:Department of Hematology cancer institute ErasmusMC|INSDC center name:Department of Hematology cancer institute ErasmusMC|INSDC first public:2023 02 17T00:21:53Z|INSDC last update:2023 02 17T00:21:53Z|INSDC status:public|Submitter Id:E MTAB 12577:Het3 cd41pflt1p48hpf|age:48|broker name:ArrayExpress|cell type:hematopoietic stem cell|common name:zebrafish|developmental stage:embryo|genotype:Gata2b +/ |immunophenotype:CD41:GFP+ Flt1:RFP+|individual:pools of 3 embryos 3|organism part:liver|sample name:E MTAB 12577:Het3 cd41pflt1p48hpf|scientific name:Danio rerio|strain:TgCD41:GFP TgFlt1:RFP Gata2b KO,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41,E MTAB 12577:Het3 cd41pflt1p48hpf p,Het3 cd41pflt1p48hpf p,Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41,Embryos were dissociated using Collagenase 1 2 and 4 and sorted using a FACS Aria III in trizol RNA was isolated from trizol RNA was smarter amplified,Experimental Factor: genotype:Gata2b +/ ,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP144652,Illumina NovaSeq 6000 paired end sequencing; Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41,ENA FIRST PUBLIC:2023 02 17|ENA LAST UPDATE:2023 02 17,Het3_cd41pflt1p48hpf_R1.fastq.gz Het3_cd41pflt1p48hpf_R2.fastq.gz,fastq fastq,2826011512.0,13990156.0,E MTAB 12577:Het3 cd41pflt1p48hpf R,0:101 1:101,A:777245323;C:622387331;G:640520737;T:785850577;N:7544,101,101,,,777245323,622387331,640520737,785850577,7544,ERX10296228,ERS14601255,ERA20429817,Department of Hematology cancer institute ErasmusMC|European Nucleotide Archive,Department of Hematology cancer institute ErasmusMC|European Nucleotide Archive,2,0.92716,0.90121,0.10896,0.10895,0.76739,0.77628,0.47007,0.46569,101,101,B,B,biological fallback assumption,illumina,novaseq_era,full_length,cdna_unspecified,smarter,bulk,unknown,unknown,,Netherlands,2023-02-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
11249,ERR10851247,ERX10296227,ERS14601254,ERP144652,PRJEB59599,Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41,E-MTAB-12577,Transcriptome Analysis,Comparison between wildtype and Gata2b heterozygous zebrafish HSPCs,ENA FIRST PUBLIC:2023 02 17|ENA LAST UPDATE:2023 02 17,,Protocols: Embryos were dissociated using Collagenase 1 2 and 4 and sorted using a FACS Aria III in trizol RNA was isolated from trizol RNA was smarter amplified,Het2 cd41pflt1p48hpf,SAMEA112483904,Department of Hematology cancer institute ErasmusMC,ENA FIRST PUBLIC:2023 02 17|ENA LAST UPDATE:2023 02 17|External Id:SAMEA112483904|INSDC center alias:Department of Hematology cancer institute ErasmusMC|INSDC center name:Department of Hematology cancer institute ErasmusMC|INSDC first public:2023 02 17T00:21:53Z|INSDC last update:2023 02 17T00:21:53Z|INSDC status:public|Submitter Id:E MTAB 12577:Het2 cd41pflt1p48hpf|age:48|broker name:ArrayExpress|cell type:hematopoietic stem cell|common name:zebrafish|developmental stage:embryo|genotype:Gata2b +/ |immunophenotype:CD41:GFP+ Flt1:RFP+|individual:pools of 3 embryos 2|organism part:liver|sample name:E MTAB 12577:Het2 cd41pflt1p48hpf|scientific name:Danio rerio|strain:TgCD41:GFP TgFlt1:RFP Gata2b KO,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41,E MTAB 12577:Het2 cd41pflt1p48hpf p,Het2 cd41pflt1p48hpf p,Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41,Embryos were dissociated using Collagenase 1 2 and 4 and sorted using a FACS Aria III in trizol RNA was isolated from trizol RNA was smarter amplified,Experimental Factor: genotype:Gata2b +/ ,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP144652,Illumina NovaSeq 6000 paired end sequencing; Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41,ENA FIRST PUBLIC:2023 02 17|ENA LAST UPDATE:2023 02 17,Het2_cd41pflt1p48hpf_R1.fastq.gz Het2_cd41pflt1p48hpf_R2.fastq.gz,fastq fastq,2999149954.0,14847277.0,E MTAB 12577:Het2 cd41pflt1p48hpf R,0:101 1:101,A:822247269;C:656610849;G:681974696;T:838308917;N:8223,101,101,,,822247269,656610849,681974696,838308917,8223,ERX10296227,ERS14601254,ERA20429817,Department of Hematology cancer institute ErasmusMC|European Nucleotide Archive,Department of Hematology cancer institute ErasmusMC|European Nucleotide Archive,2,0.94678,0.91473,0.10277,0.10053,0.76686,0.77684,0.46042,0.47202,101,101,B,B,biological fallback assumption,illumina,novaseq_era,full_length,cdna_unspecified,smarter,bulk,unknown,unknown,,Netherlands,2023-02-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
11250,ERR10851246,ERX10296226,ERS14601253,ERP144652,PRJEB59599,Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41,E-MTAB-12577,Transcriptome Analysis,Comparison between wildtype and Gata2b heterozygous zebrafish HSPCs,ENA FIRST PUBLIC:2023 02 17|ENA LAST UPDATE:2023 02 17,,Protocols: Embryos were dissociated using Collagenase 1 2 and 4 and sorted using a FACS Aria III in trizol RNA was isolated from trizol RNA was smarter amplified,Het1 cd41pflt1p48hpf,SAMEA112483903,Department of Hematology cancer institute ErasmusMC,ENA FIRST PUBLIC:2023 02 17|ENA LAST UPDATE:2023 02 17|External Id:SAMEA112483903|INSDC center alias:Department of Hematology cancer institute ErasmusMC|INSDC center name:Department of Hematology cancer institute ErasmusMC|INSDC first public:2023 02 17T00:21:53Z|INSDC last update:2023 02 17T00:21:53Z|INSDC status:public|Submitter Id:E MTAB 12577:Het1 cd41pflt1p48hpf|age:48|broker name:ArrayExpress|cell type:hematopoietic stem cell|common name:zebrafish|developmental stage:embryo|genotype:Gata2b +/ |immunophenotype:CD41:GFP+ Flt1:RFP+|individual:pools of 3 embryos 1|organism part:liver|sample name:E MTAB 12577:Het1 cd41pflt1p48hpf|scientific name:Danio rerio|strain:TgCD41:GFP TgFlt1:RFP Gata2b KO,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41,E MTAB 12577:Het1 cd41pflt1p48hpf p,Het1 cd41pflt1p48hpf p,Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41,Embryos were dissociated using Collagenase 1 2 and 4 and sorted using a FACS Aria III in trizol RNA was isolated from trizol RNA was smarter amplified,Experimental Factor: genotype:Gata2b +/ ,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP144652,Illumina NovaSeq 6000 paired end sequencing; Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41,ENA FIRST PUBLIC:2023 02 17|ENA LAST UPDATE:2023 02 17,Het1_cd41pflt1p48hpf_R1.fastq.gz Het1_cd41pflt1p48hpf_R2.fastq.gz,fastq fastq,36682350994.0,181595797.0,E MTAB 12577:Het1 cd41pflt1p48hpf R,0:101 1:101,A:10130106739;C:7969045717;G:8373740062;T:10209360741;N:97735,101,101,,,10130106739,7969045717,8373740062,10209360741,97735,ERX10296226,ERS14601253,ERA20429817,Department of Hematology cancer institute ErasmusMC|European Nucleotide Archive,Department of Hematology cancer institute ErasmusMC|European Nucleotide Archive,2,0.94302,0.91104,0.11873,0.11597,0.7554,0.76579,0.48813,0.47764,101,101,B,B,biological fallback assumption,illumina,novaseq_era,full_length,cdna_unspecified,smarter,bulk,unknown,unknown,,Netherlands,2023-02-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
30035,SRR27732031,SRX23397617,SRS20258458,SRP485064,PRJNA1067370,zebrafish embryo for scRNA seq and bulk RNA seq,PRJNA1067370,Other,Hepcidin hamp is a key regulator for the maintenance of iron metabolism. How hamp affects the mechanism of zebrafish hematopoiesis is still largely unknown. Here we have generated a stable hamp mutant zebrafish model by using the CRISPR/Cas9 system.We found that iron overload occurred in several tissues of zebrafish and the hemoglobin content decreased significantly during embryonic development.Single cell profiling demonstrated that hematopoietic actors were aberrantly expressed and hematopoietic progenitor cells appeared a group of cell clusters with relatively delayed development accompanied by ferroptosis.,,,,wild type 48 hpf embryo,zebrafish embryo 48hpf replicate 3,,strain:not applicable|isolate:not collected|breed:Danio|cultivar:not applicable|ecotype:not applicable|dev stage:48 hpf|collection date:2022 10|geo loc name:not applicable|sex:not applicable|tissue:embryo|genotype:wild type|sample type:whole organism|treatment:replicate 3|BioSampleModel:Model organism or animal,,,,,,,,,RNA Seq of Danio rerio: 48hpf embryo,W 18,W 18,bulk RNA seq,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP485064,,,WT48h-3_1.fq.gz WT48h-3_2.fq.gz,fastq fastq,6520477800.0,21734926.0,WT48h 3 1.fq.gz,0:150 1:150,A:1739928482;C:1516508736;G:1531638319;T:1732180903;N:221360,150,150,,,1739928482,1516508736,1531638319,1732180903,221360,SRX23397617,SRS20258458,SRA1791946,Shanghai Ocean University|College of Fisheries and Life,Shanghai Ocean University,2,0.93874,0.93954,0.09485,0.09438,0.67888,0.67913,0.46039,0.46026,150,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,sc_generic,bulk,bulk,,China,2024-01-26,Hatching,Embryo,Embryo Imprecise,All anatomical structures
30036,SRR27732032,SRX23397616,SRS20258457,SRP485064,PRJNA1067370,zebrafish embryo for scRNA seq and bulk RNA seq,PRJNA1067370,Other,Hepcidin hamp is a key regulator for the maintenance of iron metabolism. How hamp affects the mechanism of zebrafish hematopoiesis is still largely unknown. Here we have generated a stable hamp mutant zebrafish model by using the CRISPR/Cas9 system.We found that iron overload occurred in several tissues of zebrafish and the hemoglobin content decreased significantly during embryonic development.Single cell profiling demonstrated that hematopoietic actors were aberrantly expressed and hematopoietic progenitor cells appeared a group of cell clusters with relatively delayed development accompanied by ferroptosis.,,,,wild type 48 hpf embryo,zebrafish embryo 48hpf replicate 2,,strain:not applicable|isolate:not collected|breed:Danio|cultivar:not applicable|ecotype:not applicable|dev stage:48 hpf|collection date:2022 10|geo loc name:not applicable|sex:not applicable|tissue:embryo|genotype:wild type|sample type:whole organism|treatment:replicate 2|BioSampleModel:Model organism or animal,,,,,,,,,RNA Seq of Danio rerio: 48hpf embryo,W 17,W 17,bulk RNA seq,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP485064,,,WT48h-2_2.fq.gz WT48h-2_1.fq.gz,fastq fastq,7046397300.0,23487991.0,WT48h 2 1.fq.gz,0:150 1:150,A:1865031055;C:1655796645;G:1670091105;T:1855237793;N:240702,150,150,,,1865031055,1655796645,1670091105,1855237793,240702,SRX23397616,SRS20258457,SRA1791946,Shanghai Ocean University|College of Fisheries and Life,Shanghai Ocean University,2,0.94056,0.93987,0.08562,0.08535,0.68241,0.68288,0.46355,0.46204,150,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,sc_generic,bulk,bulk,,China,2024-01-26,Hatching,Embryo,Embryo Imprecise,All anatomical structures
30037,SRR27732033,SRX23397615,SRS20258456,SRP485064,PRJNA1067370,zebrafish embryo for scRNA seq and bulk RNA seq,PRJNA1067370,Other,Hepcidin hamp is a key regulator for the maintenance of iron metabolism. How hamp affects the mechanism of zebrafish hematopoiesis is still largely unknown. Here we have generated a stable hamp mutant zebrafish model by using the CRISPR/Cas9 system.We found that iron overload occurred in several tissues of zebrafish and the hemoglobin content decreased significantly during embryonic development.Single cell profiling demonstrated that hematopoietic actors were aberrantly expressed and hematopoietic progenitor cells appeared a group of cell clusters with relatively delayed development accompanied by ferroptosis.,,,,wild type 48 hpf embryo,zebrafish embryo 48hpf replicate 1,,strain:not applicable|isolate:not collected|breed:Danio|cultivar:not applicable|ecotype:not applicable|dev stage:48 hpf|collection date:2022 10|geo loc name:not applicable|sex:not applicable|tissue:embryo|genotype:wild type|sample type:whole organism|treatment:replicate 1|BioSampleModel:Model organism or animal,,,,,,,,,RNA Seq of Danio rerio: 48hpf embryo,W 16,W 16,bulk RNA seq,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP485064,,,WT48h-1_1.fq.gz WT48h-1_2.fq.gz,fastq fastq,6851959800.0,22839866.0,WT48h 1 1.fq.gz,0:150 1:150,A:1813160204;C:1610483050;G:1626359291;T:1801871129;N:86126,150,150,,,1813160204,1610483050,1626359291,1801871129,86126,SRX23397615,SRS20258456,SRA1791946,Shanghai Ocean University|College of Fisheries and Life,Shanghai Ocean University,2,0.94028,0.93857,0.08526,0.08523,0.68331,0.68477,0.45695,0.45202,150,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,sc_generic,bulk,bulk,,China,2024-01-26,Hatching,Embryo,Embryo Imprecise,All anatomical structures
30053,SRR27730716,SRX23396342,SRS20257256,SRP485064,PRJNA1067370,zebrafish embryo for scRNA seq and bulk RNA seq,PRJNA1067370,Other,Hepcidin hamp is a key regulator for the maintenance of iron metabolism. How hamp affects the mechanism of zebrafish hematopoiesis is still largely unknown. Here we have generated a stable hamp mutant zebrafish model by using the CRISPR/Cas9 system.We found that iron overload occurred in several tissues of zebrafish and the hemoglobin content decreased significantly during embryonic development.Single cell profiling demonstrated that hematopoietic actors were aberrantly expressed and hematopoietic progenitor cells appeared a group of cell clusters with relatively delayed development accompanied by ferroptosis.,,,,hamp / 48 hpf embryo,zebrafish embryo hamp / 48hpf replicate 3,,strain:not applicable|isolate:not collected|breed:Danio|cultivar:not applicable|ecotype:not applicable|dev stage:48 hpf|collection date:2022 10|geo loc name:not applicable|sex:not applicable|tissue:embryo|genotype:hamp / |sample type:whole organism|treatment:replicate 3|BioSampleModel:Model organism or animal,,,,,,,,,RNA Seq of Danio rerio: 48hpf embryo,W 39,W 39,bulk RNA seq,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP485064,,,hamp48h-3_1.fq.gz hamp48h-3_2.fq.gz,fastq fastq,7580570700.0,25268569.0,hamp48h 3 1.fq.gz,0:150 1:150,A:2019162299;C:1768225001;G:1782049665;T:2011039613;N:94122,150,150,,,2019162299,1768225001,1782049665,2011039613,94122,SRX23396342,SRS20257256,SRA1791861,Shanghai Ocean University|College of Fisheries and Life,Shanghai Ocean University,2,0.93863,0.93681,0.08675,0.08582,0.68394,0.6857,0.46373,0.46321,150,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,sc_generic,bulk,bulk,,China,2024-01-25,Hatching,Embryo,Embryo Imprecise,All anatomical structures
30054,SRR27730717,SRX23396341,SRS20257255,SRP485064,PRJNA1067370,zebrafish embryo for scRNA seq and bulk RNA seq,PRJNA1067370,Other,Hepcidin hamp is a key regulator for the maintenance of iron metabolism. How hamp affects the mechanism of zebrafish hematopoiesis is still largely unknown. Here we have generated a stable hamp mutant zebrafish model by using the CRISPR/Cas9 system.We found that iron overload occurred in several tissues of zebrafish and the hemoglobin content decreased significantly during embryonic development.Single cell profiling demonstrated that hematopoietic actors were aberrantly expressed and hematopoietic progenitor cells appeared a group of cell clusters with relatively delayed development accompanied by ferroptosis.,,,,hamp / 48 hpf embryo,zebrafish embryo hamp / 48hpf replicate 2,,strain:not applicable|isolate:not collected|breed:Danio|cultivar:not applicable|ecotype:not applicable|dev stage:48 hpf|collection date:2022 10|geo loc name:not applicable|sex:not applicable|tissue:embryo|genotype:hamp / |sample type:whole organism|treatment:replicate 2|BioSampleModel:Model organism or animal,,,,,,,,,RNA Seq of Danio rerio: 48hpf embryo,W 38,W 38,bulk RNA seq,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP485064,,,hamp48h-2_1.fq.gz hamp48h-2_2.fq.gz,fastq fastq,7385330400.0,24617768.0,hamp48h 2 1.fq.gz,0:150 1:150,A:1971527478;C:1717463447;G:1738237873;T:1957858394;N:243208,150,150,,,1971527478,1717463447,1738237873,1957858394,243208,SRX23396341,SRS20257255,SRA1791861,Shanghai Ocean University|College of Fisheries and Life,Shanghai Ocean University,2,0.93851,0.9369,0.09049,0.08988,0.68274,0.6843,0.45945,0.46042,150,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,sc_generic,bulk,bulk,,China,2024-01-25,Hatching,Embryo,Embryo Imprecise,All anatomical structures
30055,SRR27730718,SRX23396340,SRS20257254,SRP485064,PRJNA1067370,zebrafish embryo for scRNA seq and bulk RNA seq,PRJNA1067370,Other,Hepcidin hamp is a key regulator for the maintenance of iron metabolism. How hamp affects the mechanism of zebrafish hematopoiesis is still largely unknown. Here we have generated a stable hamp mutant zebrafish model by using the CRISPR/Cas9 system.We found that iron overload occurred in several tissues of zebrafish and the hemoglobin content decreased significantly during embryonic development.Single cell profiling demonstrated that hematopoietic actors were aberrantly expressed and hematopoietic progenitor cells appeared a group of cell clusters with relatively delayed development accompanied by ferroptosis.,,,,hamp / 48 hpf embryo,zebrafish embryo hamp / 48hpf replicate 1,,strain:not applicable|isolate:not collected|breed:Danio|cultivar:not applicable|ecotype:not applicable|dev stage:48 hpf|collection date:2022 10|geo loc name:not applicable|sex:not applicable|tissue:embryo|genotype:hamp / |sample type:whole organism|treatment:replicate 1|BioSampleModel:Model organism or animal,,,,,,,,,RNA Seq of Danio rerio: 48hpf embryo,W 37,W 37,bulk RNA seq,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP485064,,,hamp48h-1_1.fq.gz hamp48h-1_2.fq.gz,fastq fastq,6188343000.0,20627810.0,hamp48h 1 1.fq.gz,0:150 1:150,A:1649030143;C:1444577102;G:1461592285;T:1633092294;N:51176,150,150,,,1649030143,1444577102,1461592285,1633092294,51176,SRX23396340,SRS20257254,SRA1791861,Shanghai Ocean University|College of Fisheries and Life,Shanghai Ocean University,2,0.94313,0.94006,0.08835,0.08702,0.6859,0.68702,0.45658,0.46001,150,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,sc_generic,bulk,bulk,,China,2024-01-25,Hatching,Embryo,Embryo Imprecise,All anatomical structures
30091,SRR29493624,SRX25004204,SRS21704907,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,48hpf 8,GSM8339650,,tissue:RNA from single embryo at mRNA|strain:RW|geo loc name:missing|collection date:missing,48hpf 8,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RNA from single embryo at mRNA,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:48hpf,GSM8339650,GSM8339650: 48hpf 8; Danio rerio; RNA Seq,GSM8339650 r1,GSM8339650,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,DrRyu-040_1.fastq.gz,fastq,1054993210.0,6986710.0,GSM8339650 r1,0:151,A:368591219;C:204073285;G:206449879;T:275872318;N:6509,151,,,,368591219,204073285,206449879,275872318,6509,SRX25004204,SRS21704907,SRA1904789,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.69055,,0.05653,,0.80781,,0.51858,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-06-20,Hatching,Embryo,Embryo Imprecise,All anatomical structures
30092,SRR29493625,SRX25004203,SRS21704908,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,48hpf 7,GSM8339649,,tissue:RNA from single embryo at mRNA|strain:RW|geo loc name:missing|collection date:missing,48hpf 7,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RNA from single embryo at mRNA,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:48hpf,GSM8339649,GSM8339649: 48hpf 7; Danio rerio; RNA Seq,GSM8339649 r1,GSM8339649,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,DrRyu-039_1.fastq.gz,fastq,733281972.0,4856172.0,GSM8339649 r1,0:151,A:252862813;C:144646461;G:145278671;T:190489500;N:4527,151,,,,252862813,144646461,145278671,190489500,4527,SRX25004203,SRS21704908,SRA1904789,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.71608,,0.06725,,0.80821,,0.51028,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-06-20,Hatching,Embryo,Embryo Imprecise,All anatomical structures
30093,SRR29493626,SRX25004202,SRS21704909,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,48hpf 6,GSM8339648,,tissue:RNA from single embryo at mRNA|strain:RW|geo loc name:missing|collection date:missing,48hpf 6,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RNA from single embryo at mRNA,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:48hpf,GSM8339648,GSM8339648: 48hpf 6; Danio rerio; RNA Seq,GSM8339648 r1,GSM8339648,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,DrRyu-038_1.fastq.gz,fastq,411007353.0,2721903.0,GSM8339648 r1,0:151,A:140856859;C:80213546;G:81159924;T:108774567;N:2457,151,,,,140856859,80213546,81159924,108774567,2457,SRX25004202,SRS21704909,SRA1904789,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.71964,,0.07576,,0.81105,,0.51566,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-06-20,Hatching,Embryo,Embryo Imprecise,All anatomical structures
30094,SRR29493627,SRX25004201,SRS21704902,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,48hpf 5,GSM8339647,,tissue:RNA from single embryo at mRNA|strain:RW|geo loc name:missing|collection date:missing,48hpf 5,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RNA from single embryo at mRNA,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:48hpf,GSM8339647,GSM8339647: 48hpf 5; Danio rerio; RNA Seq,GSM8339647 r1,GSM8339647,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,DrRyu-037_1.fastq.gz,fastq,376794226.0,2495326.0,GSM8339647 r1,0:151,A:127943820;C:74332462;G:75265601;T:99249992;N:2351,151,,,,127943820,74332462,75265601,99249992,2351,SRX25004201,SRS21704902,SRA1904789,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.72373,,0.0719,,0.8101,,0.51107,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-06-20,Hatching,Embryo,Embryo Imprecise,All anatomical structures
30095,SRR29493628,SRX25004200,SRS21704905,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,48hpf 4,GSM8339646,,tissue:RNA from single embryo at mRNA|strain:RW|geo loc name:missing|collection date:missing,48hpf 4,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RNA from single embryo at mRNA,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:48hpf,GSM8339646,GSM8339646: 48hpf 4; Danio rerio; RNA Seq,GSM8339646 r1,GSM8339646,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,DrRyu-036_1.fastq.gz,fastq,671390847.0,4446297.0,GSM8339646 r1,0:151,A:233430966;C:130934865;G:131672025;T:175348951;N:4040,151,,,,233430966,130934865,131672025,175348951,4040,SRX25004200,SRS21704905,SRA1904789,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.70308,,0.05985,,0.81144,,0.52262,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-06-20,Hatching,Embryo,Embryo Imprecise,All anatomical structures
30096,SRR29493629,SRX25004199,SRS21704900,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,48hpf 3,GSM8339645,,tissue:RNA from single embryo at mRNA|strain:RW|geo loc name:missing|collection date:missing,48hpf 3,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RNA from single embryo at mRNA,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:48hpf,GSM8339645,GSM8339645: 48hpf 3; Danio rerio; RNA Seq,GSM8339645 r1,GSM8339645,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,DrRyu-035_1.fastq,fastq,843792681.0,5588031.0,GSM8339645 r1,0:151,A:292807912;C:163694971;G:166440340;T:220844279;N:5179,151,,,,292807912,163694971,166440340,220844279,5179,SRX25004199,SRS21704900,SRA1904789,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.70281,,0.06102,,0.80726,,0.51105,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-06-20,Hatching,Embryo,Embryo Imprecise,All anatomical structures
30097,SRR29493630,SRX25004198,SRS21704906,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,48hpf 2,GSM8339644,,tissue:RNA from single embryo at mRNA|strain:RW|geo loc name:missing|collection date:missing,48hpf 2,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RNA from single embryo at mRNA,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:48hpf,GSM8339644,GSM8339644: 48hpf 2; Danio rerio; RNA Seq,GSM8339644 r1,GSM8339644,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,DrRyu-034_1.fastq.gz,fastq,644765017.0,4269967.0,GSM8339644 r1,0:151,A:221252168;C:125928858;G:127481054;T:170099038;N:3899,151,,,,221252168,125928858,127481054,170099038,3899,SRX25004198,SRS21704906,SRA1904789,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.72235,,0.07025,,0.80612,,0.52362,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-06-20,Hatching,Embryo,Embryo Imprecise,All anatomical structures
30098,SRR29493631,SRX25004197,SRS21704901,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,48hpf 1,GSM8339643,,tissue:RNA from single embryo at mRNA|strain:RW|geo loc name:missing|collection date:missing,48hpf 1,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RNA from single embryo at mRNA,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:48hpf,GSM8339643,GSM8339643: 48hpf 1; Danio rerio; RNA Seq,GSM8339643 r1,GSM8339643,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,DrRyu-033_1.fastq.gz,fastq,611672159.0,4050809.0,GSM8339643 r1,0:151,A:212078207;C:119459285;G:120486929;T:159644086;N:3652,151,,,,212078207,119459285,120486929,159644086,3652,SRX25004197,SRS21704901,SRA1904789,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.71248,,0.05797,,0.81712,,0.49614,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-06-20,Hatching,Embryo,Embryo Imprecise,All anatomical structures
30147,SRR27710077,SRX23376543,SRS20238466,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,49 48hpf 8,GSM8032982,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,49 48hpf 8,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:48hpf,GSM8032982,GSM8032982: 49 48hpf 8; Danio rerio; RNA Seq,GSM8032982 r1,GSM8032982,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-049_R1.fastq.gz,fastq,966508569.0,6400719.0,GSM8032982 r1,0:151,A:320935060;C:194440228;G:196632381;T:254498610;N:2290,151,,,,320935060,194440228,196632381,254498610,2290,SRX23376543,SRS20238466,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.72814,,0.05007,,0.80095,,0.48661,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Hatching,Embryo,Embryo Imprecise,All anatomical structures
30164,SRR27710094,SRX23376526,SRS20238448,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,48 48hpf 7,GSM8032981,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,48 48hpf 7,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:48hpf,GSM8032981,GSM8032981: 48 48hpf 7; Danio rerio; RNA Seq,GSM8032981 r1,GSM8032981,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-048_R1.fastq.gz,fastq,2757529686.0,18261786.0,GSM8032981 r1,0:151,A:910828140;C:558468820;G:564879365;T:723346484;N:6877,151,,,,910828140,558468820,564879365,723346484,6877,SRX23376526,SRS20238448,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.73443,,0.04825,,0.79683,,0.48998,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Hatching,Embryo,Embryo Imprecise,All anatomical structures
30165,SRR27710095,SRX23376525,SRS20238447,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,47 48hpf 6,GSM8032980,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,47 48hpf 6,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:48hpf,GSM8032980,GSM8032980: 47 48hpf 6; Danio rerio; RNA Seq,GSM8032980 r1,GSM8032980,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-047_R1.fastq.gz,fastq,3490930495.0,23118745.0,GSM8032980 r1,0:151,A:1149241773;C:703401164;G:711403608;T:926875030;N:8920,151,,,,1149241773,703401164,711403608,926875030,8920,SRX23376525,SRS20238447,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.73592,,0.05139,,0.79009,,0.48157,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Hatching,Embryo,Embryo Imprecise,All anatomical structures
30166,SRR27710096,SRX23376524,SRS20238446,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,46 48hpf 5,GSM8032979,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,46 48hpf 5,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:48hpf,GSM8032979,GSM8032979: 46 48hpf 5; Danio rerio; RNA Seq,GSM8032979 r1,GSM8032979,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-046_R1.fastq.gz,fastq,363154094.0,2404994.0,GSM8032979 r1,0:151,A:120491623;C:72842193;G:73943263;T:95876121;N:894,151,,,,120491623,72842193,73943263,95876121,894,SRX23376524,SRS20238446,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.7308,,0.04961,,0.80146,,0.49425,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Hatching,Embryo,Embryo Imprecise,All anatomical structures
30167,SRR27710097,SRX23376523,SRS20238445,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,45 48hpf 4,GSM8032978,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,45 48hpf 4,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:48hpf,GSM8032978,GSM8032978: 45 48hpf 4; Danio rerio; RNA Seq,GSM8032978 r1,GSM8032978,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-045_R1.fastq.gz,fastq,748115759.0,4954409.0,GSM8032978 r1,0:151,A:245914397;C:151299413;G:153694702;T:197205323;N:1924,151,,,,245914397,151299413,153694702,197205323,1924,SRX23376523,SRS20238445,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.73182,,0.05145,,0.80079,,0.484,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Hatching,Embryo,Embryo Imprecise,All anatomical structures
30168,SRR27710098,SRX23376522,SRS20238444,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,44 48hpf 3,GSM8032977,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,44 48hpf 3,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:48hpf,GSM8032977,GSM8032977: 44 48hpf 3; Danio rerio; RNA Seq,GSM8032977 r1,GSM8032977,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-044_R1.fastq.gz,fastq,251878721.0,1668071.0,GSM8032977 r1,0:151,A:85089090;C:50523433;G:51169464;T:65096047;N:687,151,,,,85089090,50523433,51169464,65096047,687,SRX23376522,SRS20238444,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.72161,,0.03724,,0.81326,,0.47813,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Hatching,Embryo,Embryo Imprecise,All anatomical structures
30169,SRR27710099,SRX23376521,SRS20238443,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,43 48hpf 2,GSM8032976,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,43 48hpf 2,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:48hpf,GSM8032976,GSM8032976: 43 48hpf 2; Danio rerio; RNA Seq,GSM8032976 r1,GSM8032976,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-043_R1.fastq.gz,fastq,614177702.0,4067402.0,GSM8032976 r1,0:151,A:204044429;C:122774107;G:124400265;T:162957344;N:1557,151,,,,204044429,122774107,124400265,162957344,1557,SRX23376521,SRS20238443,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.73058,,0.0544,,0.79703,,0.48883,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Hatching,Embryo,Embryo Imprecise,All anatomical structures
30170,SRR27710100,SRX23376520,SRS20238442,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,42 48hpf 1,GSM8032975,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,42 48hpf 1,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:48hpf,GSM8032975,GSM8032975: 42 48hpf 1; Danio rerio; RNA Seq,GSM8032975 r1,GSM8032975,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-042_R1.fastq.gz,fastq,380919848.0,2522648.0,GSM8032975 r1,0:151,A:127191971;C:76851550;G:77831756;T:99043630;N:941,151,,,,127191971,76851550,77831756,99043630,941,SRX23376520,SRS20238442,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.72002,,0.04841,,0.80866,,0.48644,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Hatching,Embryo,Embryo Imprecise,All anatomical structures
31872,SRR28764740,SRX24330059,SRS21091017,SRP502657,PRJNA1101966,Pioneer neurons are molecularly distinct and their axon targeting is regulated by retinoic acid signaling,GSE264323,Transcriptome Analysis,During nervous system development pioneer neurons are the first to extend their axons into target tissues creating a scaffold for follower neurons. Despite years of study whether pioneer neurons are a molecularly distinct population is unknown. Analysis of zebrafish posterior lateral line pLL sensory neurons during axon growth using single cell RNA sequencing scRNA seq revealed that pioneer and follower neurons are transcriptionally distinct. Expression profiling of differentiating pLL progenitors defined follower as the ground state whereas “pioneer” is a later developmental state. The scRNA seq data revealed active retinoic acid RA signaling in followers but not in pioneers. Modulation of RA signaling within single pLL neurons showed that its downregulation in pioneers is necessary for expression of neurotrophic factor receptor ret which is required for correct targeting of pioneer axons. Our study provided insights into the molecular landscape of pioneer neurons and revealed the regulatory role of RA signaling in their development. Overall design: Fourteen hpf eighteen hpf twenty two hpf forty eight hpf TgBACneurod1:EGFPnl1 zebrafish embryos were collected and euthanized in 1.7 ml microcentrifuge tubes. Embryos were deyolked using a calcium free Ringer's solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 by gently pipetting up and down with a P200 pipet. Embryos were incubated for 5 minutes in Ringer's solution. Embryos were transferred to pre warmed protease solutions 0.25% trypsin 1 mM EDTA pH 8.0 PBS and collagenase P/HBSS 100 mg/mL was added. Embryos were incubated at 28° C for 15 minutes and were homogenized every 5 minutes using a P1000 pipet. The Stop solution 6X 30% calf serum 6 mM CaCl2 PBS was added and samples were centrifuged 350xg 4° C for 5 minutes. Supernatant was removed and 1 mL of chilled suspension solution was added 1% FBS 0.8 mM CaCl2 50 U/mL penicillin 0.05 mg/mL streptomycin DMEM. Samples were centrifuged again 350g 4° C for 5 minutes and supernatant was removed. 700 µl of chilled suspension solution was added and cells were resuspended by pipetting. Cells were passed through a 40 µm cell strainer into a FACs tube and kept on ice. GFP and RFP+ cells were FAC sorted on a BD Symphony cell sorter into sorting buffer 50 µl PBS/ 2% BSA in a siliconized 1.5mL tube.,,,,CEL210312AN WT 48h,GSM8222580,,source name:zebrafish embryo|cell type:neuron|tissue:zebrafish embryo|strain:mixed|age:48 hpf loc name:missing|collection date:missing,CEL210312AN WT 48h,using Cell Ranger version 3.1.0; 10X Genomics Pleasanton CA. USA Assembly: ZebraFishGRCz11 Supplementary files format and content: Tab separated values files and matrix files,zebrafish embryo,,Forty eight hpf TgBACneurod1:EGFPnl1 zebrafish embryos were collected and euthanized in 1.7 ml microcentrifuge tubes. Embryos were deyolked using a calcium free Ringer’s solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 by gently pipetting up and down with a P200 pipet. Embryos were incubated for 5 minutes in Ringer’s solution. Embryos were transferred to pre warmed protease solutions 0.25% trypsin 1 mM EDTA pH 8.0 PBS and collagenase P/HBSS 100 mg/mL was added. Embryos were incubated at 28° C for 15 minutes and were homogenized every 5 minutes using a P1000 pipet. The Stop solution 6X 30% calf serum 6 mM CaCl2 PBS was added and samples were centrifuged 350xg 4° C for 5 minutes. Supernatant was removed and 1 mL of chilled suspension solution was added 1% FBS 0.8 mM CaCl2 50 U/mL penicillin 0.05 mg/mL streptomycin DMEM. Samples were centrifuged again 350g 4° C for 5 minutes and supernatant was removed. 700 μl of chilled suspension solution was added and cells were resuspended by pipetting. Cells were passed through a 40 μm cell strainer into a FACs tube and kept on ice. GFP and RFP+ cells were FAC sorted on a BD Symphony cell sorter into sorting buffer 50 μl PBS/ 2% BSA in a siliconized 1.5mL tube. Library was performed according to the manufacter’s instructions single cell 3’ v3 protocol 10x Genomics.,,cell type:neuron|tissue:zebrafish embryo|strain:mixed|age:48 hpf,GSM8222580,GSM8222580: CEL210312AN WT 48h; Danio rerio; RNA Seq,GSM8222580 r1,GSM8222580,1,Forty eight hpf TgBACneurod1:EGFPnl1 zebrafish embryos were collected and euthanized in 1.7 ml microcentrifuge tubes. Embryos were deyolked using a calcium free Ringer's solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 by gently pipetting up and down with a P200 pipet. Embryos were incubated for 5 minutes in Ringer's solution. Embryos were transferred to pre warmed protease solutions 0.25% trypsin 1 mM EDTA pH 8.0 PBS and collagenase P/HBSS 100 mg/mL was added. Embryos were incubated at 28° C for 15 minutes and were homogenized every 5 minutes using a P1000 pipet. The Stop solution 6X 30% calf serum 6 mM CaCl2 PBS was added and samples were centrifuged 350xg 4° C for 5 minutes. Supernatant was removed and 1 mL of chilled suspension solution was added 1% FBS 0.8 mM CaCl2 50 U/mL penicillin 0.05 mg/mL streptomycin DMEM. Samples were centrifuged again 350g 4° C for 5 minutes and supernatant was removed. 700 μl of chilled suspension solution was added and cells were resuspended by pipetting. Cells were passed through a 40 μm cell strainer into a FACs tube and kept on ice. GFP and RFP+ cells were FAC sorted on a BD Symphony cell sorter into sorting buffer 50 μl PBS/ 2% BSA in a siliconized 1.5mL tube. Library was performed according to the manufacter's instructions single cell three prime v3 protocol 10x Genomics.,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP502657,,loader:fastq load.py,CEL210312AN_WT_48h_S100_L003_I1_001.fastq.gz CEL210312AN_WT_48h_S100_L003_R1_001.fastq.gz CEL210312AN_WT_48h_S100_L003_R2_001.fastq.gz,fastq fastq fastq,8597674702.0,67698226.0,GSM8222580 r1,0:8 1:28 2:91,A:1824246454;C:1278127991;G:1448333280;T:1609791598;N:39243,8,28,91,,1824246454,1278127991,1448333280,1609791598,39243,SRX24330059,SRS21091017,SRA1850361,Oregon Health and Science Univ,Oregon Health and Science Univ,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_droplet,10x,,United States,2024-04-22,Hatching,Embryo,Embryo Imprecise,All anatomical structures
31873,SRR28764741,SRX24330059,SRS21091017,SRP502657,PRJNA1101966,Pioneer neurons are molecularly distinct and their axon targeting is regulated by retinoic acid signaling,GSE264323,Transcriptome Analysis,During nervous system development pioneer neurons are the first to extend their axons into target tissues creating a scaffold for follower neurons. Despite years of study whether pioneer neurons are a molecularly distinct population is unknown. Analysis of zebrafish posterior lateral line pLL sensory neurons during axon growth using single cell RNA sequencing scRNA seq revealed that pioneer and follower neurons are transcriptionally distinct. Expression profiling of differentiating pLL progenitors defined follower as the ground state whereas “pioneer” is a later developmental state. The scRNA seq data revealed active retinoic acid RA signaling in followers but not in pioneers. Modulation of RA signaling within single pLL neurons showed that its downregulation in pioneers is necessary for expression of neurotrophic factor receptor ret which is required for correct targeting of pioneer axons. Our study provided insights into the molecular landscape of pioneer neurons and revealed the regulatory role of RA signaling in their development. Overall design: Fourteen hpf eighteen hpf twenty two hpf forty eight hpf TgBACneurod1:EGFPnl1 zebrafish embryos were collected and euthanized in 1.7 ml microcentrifuge tubes. Embryos were deyolked using a calcium free Ringer's solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 by gently pipetting up and down with a P200 pipet. Embryos were incubated for 5 minutes in Ringer's solution. Embryos were transferred to pre warmed protease solutions 0.25% trypsin 1 mM EDTA pH 8.0 PBS and collagenase P/HBSS 100 mg/mL was added. Embryos were incubated at 28° C for 15 minutes and were homogenized every 5 minutes using a P1000 pipet. The Stop solution 6X 30% calf serum 6 mM CaCl2 PBS was added and samples were centrifuged 350xg 4° C for 5 minutes. Supernatant was removed and 1 mL of chilled suspension solution was added 1% FBS 0.8 mM CaCl2 50 U/mL penicillin 0.05 mg/mL streptomycin DMEM. Samples were centrifuged again 350g 4° C for 5 minutes and supernatant was removed. 700 µl of chilled suspension solution was added and cells were resuspended by pipetting. Cells were passed through a 40 µm cell strainer into a FACs tube and kept on ice. GFP and RFP+ cells were FAC sorted on a BD Symphony cell sorter into sorting buffer 50 µl PBS/ 2% BSA in a siliconized 1.5mL tube.,,,,CEL210312AN WT 48h,GSM8222580,,source name:zebrafish embryo|cell type:neuron|tissue:zebrafish embryo|strain:mixed|age:48 hpf loc name:missing|collection date:missing,CEL210312AN WT 48h,using Cell Ranger version 3.1.0; 10X Genomics Pleasanton CA. USA Assembly: ZebraFishGRCz11 Supplementary files format and content: Tab separated values files and matrix files,zebrafish embryo,,Forty eight hpf TgBACneurod1:EGFPnl1 zebrafish embryos were collected and euthanized in 1.7 ml microcentrifuge tubes. Embryos were deyolked using a calcium free Ringer’s solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 by gently pipetting up and down with a P200 pipet. Embryos were incubated for 5 minutes in Ringer’s solution. Embryos were transferred to pre warmed protease solutions 0.25% trypsin 1 mM EDTA pH 8.0 PBS and collagenase P/HBSS 100 mg/mL was added. Embryos were incubated at 28° C for 15 minutes and were homogenized every 5 minutes using a P1000 pipet. The Stop solution 6X 30% calf serum 6 mM CaCl2 PBS was added and samples were centrifuged 350xg 4° C for 5 minutes. Supernatant was removed and 1 mL of chilled suspension solution was added 1% FBS 0.8 mM CaCl2 50 U/mL penicillin 0.05 mg/mL streptomycin DMEM. Samples were centrifuged again 350g 4° C for 5 minutes and supernatant was removed. 700 μl of chilled suspension solution was added and cells were resuspended by pipetting. Cells were passed through a 40 μm cell strainer into a FACs tube and kept on ice. GFP and RFP+ cells were FAC sorted on a BD Symphony cell sorter into sorting buffer 50 μl PBS/ 2% BSA in a siliconized 1.5mL tube. Library was performed according to the manufacter’s instructions single cell 3’ v3 protocol 10x Genomics.,,cell type:neuron|tissue:zebrafish embryo|strain:mixed|age:48 hpf,GSM8222580,GSM8222580: CEL210312AN WT 48h; Danio rerio; RNA Seq,GSM8222580 r1,GSM8222580,1,Forty eight hpf TgBACneurod1:EGFPnl1 zebrafish embryos were collected and euthanized in 1.7 ml microcentrifuge tubes. Embryos were deyolked using a calcium free Ringer's solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 by gently pipetting up and down with a P200 pipet. Embryos were incubated for 5 minutes in Ringer's solution. Embryos were transferred to pre warmed protease solutions 0.25% trypsin 1 mM EDTA pH 8.0 PBS and collagenase P/HBSS 100 mg/mL was added. Embryos were incubated at 28° C for 15 minutes and were homogenized every 5 minutes using a P1000 pipet. The Stop solution 6X 30% calf serum 6 mM CaCl2 PBS was added and samples were centrifuged 350xg 4° C for 5 minutes. Supernatant was removed and 1 mL of chilled suspension solution was added 1% FBS 0.8 mM CaCl2 50 U/mL penicillin 0.05 mg/mL streptomycin DMEM. Samples were centrifuged again 350g 4° C for 5 minutes and supernatant was removed. 700 μl of chilled suspension solution was added and cells were resuspended by pipetting. Cells were passed through a 40 μm cell strainer into a FACs tube and kept on ice. GFP and RFP+ cells were FAC sorted on a BD Symphony cell sorter into sorting buffer 50 μl PBS/ 2% BSA in a siliconized 1.5mL tube. Library was performed according to the manufacter's instructions single cell three prime v3 protocol 10x Genomics.,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP502657,,loader:fastq load.py,CEL210312AN_WT_48h_S101_L003_I1_001.fastq.gz CEL210312AN_WT_48h_S101_L003_R1_001.fastq.gz CEL210312AN_WT_48h_S101_L003_R2_001.fastq.gz,fastq fastq fastq,10521686856.0,82847928.0,GSM8222580 r2,0:8 1:28 2:91,A:2230570510;C:1564859730;G:1774018840;T:1969664072;N:48296,8,28,91,,2230570510,1564859730,1774018840,1969664072,48296,SRX24330059,SRS21091017,SRA1850361,Oregon Health and Science Univ,Oregon Health and Science Univ,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_droplet,10x,,United States,2024-04-22,Hatching,Embryo,Embryo Imprecise,All anatomical structures
31874,SRR28764742,SRX24330059,SRS21091017,SRP502657,PRJNA1101966,Pioneer neurons are molecularly distinct and their axon targeting is regulated by retinoic acid signaling,GSE264323,Transcriptome Analysis,During nervous system development pioneer neurons are the first to extend their axons into target tissues creating a scaffold for follower neurons. Despite years of study whether pioneer neurons are a molecularly distinct population is unknown. Analysis of zebrafish posterior lateral line pLL sensory neurons during axon growth using single cell RNA sequencing scRNA seq revealed that pioneer and follower neurons are transcriptionally distinct. Expression profiling of differentiating pLL progenitors defined follower as the ground state whereas “pioneer” is a later developmental state. The scRNA seq data revealed active retinoic acid RA signaling in followers but not in pioneers. Modulation of RA signaling within single pLL neurons showed that its downregulation in pioneers is necessary for expression of neurotrophic factor receptor ret which is required for correct targeting of pioneer axons. Our study provided insights into the molecular landscape of pioneer neurons and revealed the regulatory role of RA signaling in their development. Overall design: Fourteen hpf eighteen hpf twenty two hpf forty eight hpf TgBACneurod1:EGFPnl1 zebrafish embryos were collected and euthanized in 1.7 ml microcentrifuge tubes. Embryos were deyolked using a calcium free Ringer's solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 by gently pipetting up and down with a P200 pipet. Embryos were incubated for 5 minutes in Ringer's solution. Embryos were transferred to pre warmed protease solutions 0.25% trypsin 1 mM EDTA pH 8.0 PBS and collagenase P/HBSS 100 mg/mL was added. Embryos were incubated at 28° C for 15 minutes and were homogenized every 5 minutes using a P1000 pipet. The Stop solution 6X 30% calf serum 6 mM CaCl2 PBS was added and samples were centrifuged 350xg 4° C for 5 minutes. Supernatant was removed and 1 mL of chilled suspension solution was added 1% FBS 0.8 mM CaCl2 50 U/mL penicillin 0.05 mg/mL streptomycin DMEM. Samples were centrifuged again 350g 4° C for 5 minutes and supernatant was removed. 700 µl of chilled suspension solution was added and cells were resuspended by pipetting. Cells were passed through a 40 µm cell strainer into a FACs tube and kept on ice. GFP and RFP+ cells were FAC sorted on a BD Symphony cell sorter into sorting buffer 50 µl PBS/ 2% BSA in a siliconized 1.5mL tube.,,,,CEL210312AN WT 48h,GSM8222580,,source name:zebrafish embryo|cell type:neuron|tissue:zebrafish embryo|strain:mixed|age:48 hpf loc name:missing|collection date:missing,CEL210312AN WT 48h,using Cell Ranger version 3.1.0; 10X Genomics Pleasanton CA. USA Assembly: ZebraFishGRCz11 Supplementary files format and content: Tab separated values files and matrix files,zebrafish embryo,,Forty eight hpf TgBACneurod1:EGFPnl1 zebrafish embryos were collected and euthanized in 1.7 ml microcentrifuge tubes. Embryos were deyolked using a calcium free Ringer’s solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 by gently pipetting up and down with a P200 pipet. Embryos were incubated for 5 minutes in Ringer’s solution. Embryos were transferred to pre warmed protease solutions 0.25% trypsin 1 mM EDTA pH 8.0 PBS and collagenase P/HBSS 100 mg/mL was added. Embryos were incubated at 28° C for 15 minutes and were homogenized every 5 minutes using a P1000 pipet. The Stop solution 6X 30% calf serum 6 mM CaCl2 PBS was added and samples were centrifuged 350xg 4° C for 5 minutes. Supernatant was removed and 1 mL of chilled suspension solution was added 1% FBS 0.8 mM CaCl2 50 U/mL penicillin 0.05 mg/mL streptomycin DMEM. Samples were centrifuged again 350g 4° C for 5 minutes and supernatant was removed. 700 μl of chilled suspension solution was added and cells were resuspended by pipetting. Cells were passed through a 40 μm cell strainer into a FACs tube and kept on ice. GFP and RFP+ cells were FAC sorted on a BD Symphony cell sorter into sorting buffer 50 μl PBS/ 2% BSA in a siliconized 1.5mL tube. Library was performed according to the manufacter’s instructions single cell 3’ v3 protocol 10x Genomics.,,cell type:neuron|tissue:zebrafish embryo|strain:mixed|age:48 hpf,GSM8222580,GSM8222580: CEL210312AN WT 48h; Danio rerio; RNA Seq,GSM8222580 r1,GSM8222580,1,Forty eight hpf TgBACneurod1:EGFPnl1 zebrafish embryos were collected and euthanized in 1.7 ml microcentrifuge tubes. Embryos were deyolked using a calcium free Ringer's solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 by gently pipetting up and down with a P200 pipet. Embryos were incubated for 5 minutes in Ringer's solution. Embryos were transferred to pre warmed protease solutions 0.25% trypsin 1 mM EDTA pH 8.0 PBS and collagenase P/HBSS 100 mg/mL was added. Embryos were incubated at 28° C for 15 minutes and were homogenized every 5 minutes using a P1000 pipet. The Stop solution 6X 30% calf serum 6 mM CaCl2 PBS was added and samples were centrifuged 350xg 4° C for 5 minutes. Supernatant was removed and 1 mL of chilled suspension solution was added 1% FBS 0.8 mM CaCl2 50 U/mL penicillin 0.05 mg/mL streptomycin DMEM. Samples were centrifuged again 350g 4° C for 5 minutes and supernatant was removed. 700 μl of chilled suspension solution was added and cells were resuspended by pipetting. Cells were passed through a 40 μm cell strainer into a FACs tube and kept on ice. GFP and RFP+ cells were FAC sorted on a BD Symphony cell sorter into sorting buffer 50 μl PBS/ 2% BSA in a siliconized 1.5mL tube. Library was performed according to the manufacter's instructions single cell three prime v3 protocol 10x Genomics.,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP502657,,loader:fastq load.py,CEL210312AN_WT_48h_S102_L003_I1_001.fastq.gz CEL210312AN_WT_48h_S102_L003_R1_001.fastq.gz CEL210312AN_WT_48h_S102_L003_R2_001.fastq.gz,fastq fastq fastq,10393048429.0,81835027.0,GSM8222580 r3,0:8 1:28 2:91,A:2205422432;C:1544223539;G:1750760277;T:1946533138;N:48071,8,28,91,,2205422432,1544223539,1750760277,1946533138,48071,SRX24330059,SRS21091017,SRA1850361,Oregon Health and Science Univ,Oregon Health and Science Univ,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_droplet,10x,,United States,2024-04-22,Hatching,Embryo,Embryo Imprecise,All anatomical structures
31875,SRR28764743,SRX24330059,SRS21091017,SRP502657,PRJNA1101966,Pioneer neurons are molecularly distinct and their axon targeting is regulated by retinoic acid signaling,GSE264323,Transcriptome Analysis,During nervous system development pioneer neurons are the first to extend their axons into target tissues creating a scaffold for follower neurons. Despite years of study whether pioneer neurons are a molecularly distinct population is unknown. Analysis of zebrafish posterior lateral line pLL sensory neurons during axon growth using single cell RNA sequencing scRNA seq revealed that pioneer and follower neurons are transcriptionally distinct. Expression profiling of differentiating pLL progenitors defined follower as the ground state whereas “pioneer” is a later developmental state. The scRNA seq data revealed active retinoic acid RA signaling in followers but not in pioneers. Modulation of RA signaling within single pLL neurons showed that its downregulation in pioneers is necessary for expression of neurotrophic factor receptor ret which is required for correct targeting of pioneer axons. Our study provided insights into the molecular landscape of pioneer neurons and revealed the regulatory role of RA signaling in their development. Overall design: Fourteen hpf eighteen hpf twenty two hpf forty eight hpf TgBACneurod1:EGFPnl1 zebrafish embryos were collected and euthanized in 1.7 ml microcentrifuge tubes. Embryos were deyolked using a calcium free Ringer's solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 by gently pipetting up and down with a P200 pipet. Embryos were incubated for 5 minutes in Ringer's solution. Embryos were transferred to pre warmed protease solutions 0.25% trypsin 1 mM EDTA pH 8.0 PBS and collagenase P/HBSS 100 mg/mL was added. Embryos were incubated at 28° C for 15 minutes and were homogenized every 5 minutes using a P1000 pipet. The Stop solution 6X 30% calf serum 6 mM CaCl2 PBS was added and samples were centrifuged 350xg 4° C for 5 minutes. Supernatant was removed and 1 mL of chilled suspension solution was added 1% FBS 0.8 mM CaCl2 50 U/mL penicillin 0.05 mg/mL streptomycin DMEM. Samples were centrifuged again 350g 4° C for 5 minutes and supernatant was removed. 700 µl of chilled suspension solution was added and cells were resuspended by pipetting. Cells were passed through a 40 µm cell strainer into a FACs tube and kept on ice. GFP and RFP+ cells were FAC sorted on a BD Symphony cell sorter into sorting buffer 50 µl PBS/ 2% BSA in a siliconized 1.5mL tube.,,,,CEL210312AN WT 48h,GSM8222580,,source name:zebrafish embryo|cell type:neuron|tissue:zebrafish embryo|strain:mixed|age:48 hpf loc name:missing|collection date:missing,CEL210312AN WT 48h,using Cell Ranger version 3.1.0; 10X Genomics Pleasanton CA. USA Assembly: ZebraFishGRCz11 Supplementary files format and content: Tab separated values files and matrix files,zebrafish embryo,,Forty eight hpf TgBACneurod1:EGFPnl1 zebrafish embryos were collected and euthanized in 1.7 ml microcentrifuge tubes. Embryos were deyolked using a calcium free Ringer’s solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 by gently pipetting up and down with a P200 pipet. Embryos were incubated for 5 minutes in Ringer’s solution. Embryos were transferred to pre warmed protease solutions 0.25% trypsin 1 mM EDTA pH 8.0 PBS and collagenase P/HBSS 100 mg/mL was added. Embryos were incubated at 28° C for 15 minutes and were homogenized every 5 minutes using a P1000 pipet. The Stop solution 6X 30% calf serum 6 mM CaCl2 PBS was added and samples were centrifuged 350xg 4° C for 5 minutes. Supernatant was removed and 1 mL of chilled suspension solution was added 1% FBS 0.8 mM CaCl2 50 U/mL penicillin 0.05 mg/mL streptomycin DMEM. Samples were centrifuged again 350g 4° C for 5 minutes and supernatant was removed. 700 μl of chilled suspension solution was added and cells were resuspended by pipetting. Cells were passed through a 40 μm cell strainer into a FACs tube and kept on ice. GFP and RFP+ cells were FAC sorted on a BD Symphony cell sorter into sorting buffer 50 μl PBS/ 2% BSA in a siliconized 1.5mL tube. Library was performed according to the manufacter’s instructions single cell 3’ v3 protocol 10x Genomics.,,cell type:neuron|tissue:zebrafish embryo|strain:mixed|age:48 hpf,GSM8222580,GSM8222580: CEL210312AN WT 48h; Danio rerio; RNA Seq,GSM8222580 r1,GSM8222580,1,Forty eight hpf TgBACneurod1:EGFPnl1 zebrafish embryos were collected and euthanized in 1.7 ml microcentrifuge tubes. Embryos were deyolked using a calcium free Ringer's solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 by gently pipetting up and down with a P200 pipet. Embryos were incubated for 5 minutes in Ringer's solution. Embryos were transferred to pre warmed protease solutions 0.25% trypsin 1 mM EDTA pH 8.0 PBS and collagenase P/HBSS 100 mg/mL was added. Embryos were incubated at 28° C for 15 minutes and were homogenized every 5 minutes using a P1000 pipet. The Stop solution 6X 30% calf serum 6 mM CaCl2 PBS was added and samples were centrifuged 350xg 4° C for 5 minutes. Supernatant was removed and 1 mL of chilled suspension solution was added 1% FBS 0.8 mM CaCl2 50 U/mL penicillin 0.05 mg/mL streptomycin DMEM. Samples were centrifuged again 350g 4° C for 5 minutes and supernatant was removed. 700 μl of chilled suspension solution was added and cells were resuspended by pipetting. Cells were passed through a 40 μm cell strainer into a FACs tube and kept on ice. GFP and RFP+ cells were FAC sorted on a BD Symphony cell sorter into sorting buffer 50 μl PBS/ 2% BSA in a siliconized 1.5mL tube. Library was performed according to the manufacter's instructions single cell three prime v3 protocol 10x Genomics.,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP502657,,loader:fastq load.py,CEL210312AN_WT_48h_S103_L003_I1_001.fastq.gz CEL210312AN_WT_48h_S103_L003_R1_001.fastq.gz CEL210312AN_WT_48h_S103_L003_R2_001.fastq.gz,fastq fastq fastq,1539235301.0,12119963.0,GSM8222580 r4,0:8 1:28 2:91,A:326058980;C:228846142;G:262343444;T:285660694;N:7373,8,28,91,,326058980,228846142,262343444,285660694,7373,SRX24330059,SRS21091017,SRA1850361,Oregon Health and Science Univ,Oregon Health and Science Univ,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_droplet,10x,,United States,2024-04-22,Hatching,Embryo,Embryo Imprecise,All anatomical structures
32370,SRR29180530,SRX24700714,SRS21428245,SRP509851,PRJNA1116337,Ioxynil and diethylstilbestrol disrupt vascular and heart development in zebrafish,PRJNA1116337,Other,Endocrine disruption is one of the consequences of industrialization and chemicals released into theenvironment have a profound impact on organisms. Waterborne micromolar concentrations of ioxynil IOX and diethylstilbestrol DES in fish affect the development of the heart vasculature and thyroid gland.,,,,,DES,,isolate:exposure to DES|age:48 hpf|dev stage:embryos|collection date:2018 06|geo loc name:Portugal|sex:pooled male and female|tissue:embryos|treatment:exposure to DES|BioSampleModel:Model organism or animal,,,,,,,,,RNA seq of DES treated,DES,DES,Sequencing the transcriptomes of zebrafish embryos of DES treated,,,RNA-Seq,TRANSCRIPTOMIC,RANDOM,SINGLE,ILLUMINA,Illumina HiSeq 4000,,SRP509851,,,DES_TAAGGC_L001_R1_001.fastq.gz DES_TAAGGC_L001_R2_001.fastq.gz,fastq fastq,9169560000.0,30565200.0,DES TAAGGC L001 R1 001.fastq.gz,0:150 1:150,A:2545096687;C:2037322055;G:2024787099;T:2562124529;N:229630,150,150,,,2545096687,2037322055,2024787099,2562124529,229630,SRX24700714,SRS21428245,SRA1878028,Shanghai Ocean University|College of Fisheries and Life Science,Shanghai Ocean University,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,random_priming,unknown,bulk,unknown,unknown,,China,2024-05-25,Hatching,Embryo,Embryo Imprecise,All anatomical structures
32371,SRR29180531,SRX24700713,SRS21428246,SRP509851,PRJNA1116337,Ioxynil and diethylstilbestrol disrupt vascular and heart development in zebrafish,PRJNA1116337,Other,Endocrine disruption is one of the consequences of industrialization and chemicals released into theenvironment have a profound impact on organisms. Waterborne micromolar concentrations of ioxynil IOX and diethylstilbestrol DES in fish affect the development of the heart vasculature and thyroid gland.,,,,,IOX,,isolate:exposure to IOX|age:48 hpf|dev stage:embryos|collection date:2018 06|geo loc name:Portugal|sex:pooled male and female|tissue:embryos|treatment:exposure to IOX|BioSampleModel:Model organism or animal,,,,,,,,,RNA seq of IOX treated,IOX,IOX,Sequencing the transcriptomes of zebrafish embryos of IOX treated,,,RNA-Seq,TRANSCRIPTOMIC,RANDOM,PAIRED,ILLUMINA,Illumina HiSeq 4000,,SRP509851,,,IOX_CGTACT_L001_R1_001.fastq.gz IOX_CGTACT_L001_R2_001.fastq.gz,fastq fastq,9547157100.0,31823857.0,IOX CGTACT L001 R1 001.fastq.gz,0:150 1:150,A:2631030736;C:2146265744;G:2124421595;T:2645201596;N:237429,150,150,,,2631030736,2146265744,2124421595,2645201596,237429,SRX24700713,SRS21428246,SRA1878028,Shanghai Ocean University|College of Fisheries and Life Science,Shanghai Ocean University,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,random_priming,unknown,bulk,unknown,unknown,,China,2024-05-25,Hatching,Embryo,Embryo Imprecise,All anatomical structures
32372,SRR29180532,SRX24700712,SRS21428244,SRP509851,PRJNA1116337,Ioxynil and diethylstilbestrol disrupt vascular and heart development in zebrafish,PRJNA1116337,Other,Endocrine disruption is one of the consequences of industrialization and chemicals released into theenvironment have a profound impact on organisms. Waterborne micromolar concentrations of ioxynil IOX and diethylstilbestrol DES in fish affect the development of the heart vasculature and thyroid gland.,,,,,CTR,,isolate:control|age:48 hpf|dev stage:embryos|collection date:2018 06|geo loc name:Portugal|sex:pooled male and female|tissue:embryos|treatment:control|BioSampleModel:Model organism or animal,,,,,,,,,RNA seq of CTR treated,CTR,CTR,Sequencing the transcriptomes of zebrafish embryos of control,,,RNA-Seq,TRANSCRIPTOMIC,RANDOM,PAIRED,ILLUMINA,Illumina HiSeq 4000,,SRP509851,,,CTR_AGGCAG_L001_R1_001.fastq.gz CTR_AGGCAG_L001_R2_001.fastq.gz,fastq fastq,9602954100.0,32009847.0,CTR AGGCAG L001 R1 001.fastq.gz,0:150 1:150,A:2637866848;C:2169057233;G:2152906664;T:2642882530;N:240825,150,150,,,2637866848,2169057233,2152906664,2642882530,240825,SRX24700712,SRS21428244,SRA1878028,Shanghai Ocean University|College of Fisheries and Life Science,Shanghai Ocean University,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,random_priming,unknown,bulk,unknown,unknown,,China,2024-05-25,Hatching,Embryo,Embryo Imprecise,All anatomical structures
33990,SRR31030860,SRX26416598,SRS22936450,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF NES GAPDH Rep4 minus,GSM8578751,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF|geo loc name:missing|collection date:missing,ZF NES GAPDH Rep4 minus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF,GSM8578751,GSM8578751: ZF NES GAPDH Rep4 minus; Danio rerio; OTHER,GSM8578751 r1,GSM8578751,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_NES_GAPDH_Rep4_minus.R1.fq.gz ZF_NES_GAPDH_Rep4_minus.R2.fq.gz,fastq fastq,1100578200.0,3668594.0,GSM8578751 r1,0:150 1:150,A:287878221;C:249390946;G:265835736;T:297454600;N:18697,150,150,,,287878221,249390946,265835736,297454600,18697,SRX26416598,SRS22936450,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
33991,SRR31030861,SRX26416597,SRS22936451,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF NES GAPDH Rep3 plus,GSM8578750,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF|geo loc name:missing|collection date:missing,ZF NES GAPDH Rep3 plus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF,GSM8578750,GSM8578750: ZF NES GAPDH Rep3 plus; Danio rerio; OTHER,GSM8578750 r1,GSM8578750,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_NES_GAPDH_Rep3_plus.R1.fq.gz ZF_NES_GAPDH_Rep3_plus.R2.fq.gz,fastq fastq,1231779300.0,4105931.0,GSM8578750 r1,0:150 1:150,A:322256597;C:278991471;G:297394980;T:333116282;N:19970,150,150,,,322256597,278991471,297394980,333116282,19970,SRX26416597,SRS22936451,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
33992,SRR31030862,SRX26416596,SRS22936449,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF NES GAPDH Rep3 minus,GSM8578749,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF|geo loc name:missing|collection date:missing,ZF NES GAPDH Rep3 minus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF,GSM8578749,GSM8578749: ZF NES GAPDH Rep3 minus; Danio rerio; OTHER,GSM8578749 r1,GSM8578749,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_NES_GAPDH_Rep3_minus.R1.fq.gz ZF_NES_GAPDH_Rep3_minus.R2.fq.gz,fastq fastq,1002124500.0,3340415.0,GSM8578749 r1,0:150 1:150,A:262024969;C:227163761;G:242157218;T:270761424;N:17128,150,150,,,262024969,227163761,242157218,270761424,17128,SRX26416596,SRS22936449,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
33993,SRR31030863,SRX26416595,SRS22936448,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF NES GAPDH Rep2 plus,GSM8578748,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF|geo loc name:missing|collection date:missing,ZF NES GAPDH Rep2 plus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF,GSM8578748,GSM8578748: ZF NES GAPDH Rep2 plus; Danio rerio; OTHER,GSM8578748 r1,GSM8578748,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_NES_GAPDH_Rep2_plus.R1.fq.gz ZF_NES_GAPDH_Rep2_plus.R2.fq.gz,fastq fastq,1051565100.0,3505217.0,GSM8578748 r1,0:150 1:150,A:275784945;C:237523425;G:253300749;T:284937948;N:18033,150,150,,,275784945,237523425,253300749,284937948,18033,SRX26416595,SRS22936448,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
33994,SRR31030864,SRX26416594,SRS22936447,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF NES GAPDH Rep2 minus,GSM8578747,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF|geo loc name:missing|collection date:missing,ZF NES GAPDH Rep2 minus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF,GSM8578747,GSM8578747: ZF NES GAPDH Rep2 minus; Danio rerio; OTHER,GSM8578747 r1,GSM8578747,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_NES_GAPDH_Rep2_minus.R1.fq.gz ZF_NES_GAPDH_Rep2_minus.R2.fq.gz,fastq fastq,1021837200.0,3406124.0,GSM8578747 r1,0:150 1:150,A:268290250;C:230525208;G:245949056;T:277056045;N:16641,150,150,,,268290250,230525208,245949056,277056045,16641,SRX26416594,SRS22936447,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
33995,SRR31030865,SRX26416593,SRS22936446,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF NES GAPDH Rep1 plus,GSM8578746,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF|geo loc name:missing|collection date:missing,ZF NES GAPDH Rep1 plus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF,GSM8578746,GSM8578746: ZF NES GAPDH Rep1 plus; Danio rerio; OTHER,GSM8578746 r1,GSM8578746,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_NES_GAPDH_Rep1_plus.R1.fq.gz ZF_NES_GAPDH_Rep1_plus.R2.fq.gz,fastq fastq,1093620300.0,3645401.0,GSM8578746 r1,0:150 1:150,A:285989719;C:247805250;G:264181043;T:295625946;N:18342,150,150,,,285989719,247805250,264181043,295625946,18342,SRX26416593,SRS22936446,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
33996,SRR31030866,SRX26416592,SRS22936445,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF NES GAPDH Rep1 minus,GSM8578745,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF|geo loc name:missing|collection date:missing,ZF NES GAPDH Rep1 minus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF,GSM8578745,GSM8578745: ZF NES GAPDH Rep1 minus; Danio rerio; OTHER,GSM8578745 r1,GSM8578745,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_NES_GAPDH_Rep1_minus.R1.fq.gz ZF_NES_GAPDH_Rep1_minus.R2.fq.gz,fastq fastq,911747100.0,3039157.0,GSM8578745 r1,0:150 1:150,A:239833349;C:205185786;G:218897710;T:247814511;N:15744,150,150,,,239833349,205185786,218897710,247814511,15744,SRX26416592,SRS22936445,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
33997,SRR31030867,SRX26416591,SRS22936444,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF H2B MALAT1 Rep4 plus,GSM8578744,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF|geo loc name:missing|collection date:missing,ZF H2B MALAT1 Rep4 plus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF,GSM8578744,GSM8578744: ZF H2B MALAT1 Rep4 plus; Danio rerio; OTHER,GSM8578744 r1,GSM8578744,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_H2B_MALAT1_Rep4_plus.R1.fq.gz ZF_H2B_MALAT1_Rep4_plus.R2.fq.gz,fastq fastq,842103300.0,2807011.0,GSM8578744 r1,0:150 1:150,A:204870477;C:222752099;G:215404135;T:199062275;N:14314,150,150,,,204870477,222752099,215404135,199062275,14314,SRX26416591,SRS22936444,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
33998,SRR31030868,SRX26416590,SRS22936442,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF H2B MALAT1 Rep4 minus,GSM8578743,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF|geo loc name:missing|collection date:missing,ZF H2B MALAT1 Rep4 minus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF,GSM8578743,GSM8578743: ZF H2B MALAT1 Rep4 minus; Danio rerio; OTHER,GSM8578743 r1,GSM8578743,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_H2B_MALAT1_Rep4_minus.R1.fq.gz ZF_H2B_MALAT1_Rep4_minus.R2.fq.gz,fastq fastq,1166375100.0,3887917.0,GSM8578743 r1,0:150 1:150,A:283781955;C:308660466;G:298298204;T:275614377;N:20098,150,150,,,283781955,308660466,298298204,275614377,20098,SRX26416590,SRS22936442,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
33999,SRR31030869,SRX26416589,SRS22936443,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF H2B MALAT1 Rep3 plus,GSM8578742,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF|geo loc name:missing|collection date:missing,ZF H2B MALAT1 Rep3 plus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF,GSM8578742,GSM8578742: ZF H2B MALAT1 Rep3 plus; Danio rerio; OTHER,GSM8578742 r1,GSM8578742,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_H2B_MALAT1_Rep3_plus.R1.fq.gz ZF_H2B_MALAT1_Rep3_plus.R2.fq.gz,fastq fastq,1159439400.0,3864798.0,GSM8578742 r1,0:150 1:150,A:282055391;C:306842216;G:296569227;T:273952570;N:19996,150,150,,,282055391,306842216,296569227,273952570,19996,SRX26416589,SRS22936443,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34000,SRR31030870,SRX26416588,SRS22936440,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF H2B MALAT1 Rep3 minus,GSM8578741,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF|geo loc name:missing|collection date:missing,ZF H2B MALAT1 Rep3 minus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF,GSM8578741,GSM8578741: ZF H2B MALAT1 Rep3 minus; Danio rerio; OTHER,GSM8578741 r1,GSM8578741,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_H2B_MALAT1_Rep3_minus.R1.fq.gz ZF_H2B_MALAT1_Rep3_minus.R2.fq.gz,fastq fastq,1008297600.0,3360992.0,GSM8578741 r1,0:150 1:150,A:245277585;C:266840408;G:257911846;T:238251305;N:16456,150,150,,,245277585,266840408,257911846,238251305,16456,SRX26416588,SRS22936440,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34001,SRR31030871,SRX26416587,SRS22936441,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF H2B MALAT1 Rep2 plus,GSM8578740,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF|geo loc name:missing|collection date:missing,ZF H2B MALAT1 Rep2 plus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF,GSM8578740,GSM8578740: ZF H2B MALAT1 Rep2 plus; Danio rerio; OTHER,GSM8578740 r1,GSM8578740,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_H2B_MALAT1_Rep2_plus.R1.fq.gz ZF_H2B_MALAT1_Rep2_plus.R2.fq.gz,fastq fastq,1419263400.0,4730878.0,GSM8578740 r1,0:150 1:150,A:345302268;C:375591885;G:362956395;T:335387828;N:25024,150,150,,,345302268,375591885,362956395,335387828,25024,SRX26416587,SRS22936441,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34002,SRR31030872,SRX26416586,SRS22936439,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF H2B MALAT1 Rep2 minus,GSM8578739,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF|geo loc name:missing|collection date:missing,ZF H2B MALAT1 Rep2 minus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF,GSM8578739,GSM8578739: ZF H2B MALAT1 Rep2 minus; Danio rerio; OTHER,GSM8578739 r1,GSM8578739,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_H2B_MALAT1_Rep2_minus.R1.fq.gz ZF_H2B_MALAT1_Rep2_minus.R2.fq.gz,fastq fastq,1249910700.0,4166369.0,GSM8578739 r1,0:150 1:150,A:304074828;C:330741431;G:319677748;T:295395235;N:21458,150,150,,,304074828,330741431,319677748,295395235,21458,SRX26416586,SRS22936439,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34003,SRR31030873,SRX26416585,SRS22936438,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF H2B MALAT1 Rep1 plus,GSM8578738,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF|geo loc name:missing|collection date:missing,ZF H2B MALAT1 Rep1 plus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF,GSM8578738,GSM8578738: ZF H2B MALAT1 Rep1 plus; Danio rerio; OTHER,GSM8578738 r1,GSM8578738,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_H2B_MALAT1_Rep1_plus.R1.fq.gz ZF_H2B_MALAT1_Rep1_plus.R2.fq.gz,fastq fastq,1257872700.0,4192909.0,GSM8578738 r1,0:150 1:150,A:306022947;C:332851039;G:321699513;T:297277788;N:21413,150,150,,,306022947,332851039,321699513,297277788,21413,SRX26416585,SRS22936438,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34004,SRR31030874,SRX26416584,SRS22936437,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF H2B MALAT1 Rep1 minus,GSM8578737,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF|geo loc name:missing|collection date:missing,ZF H2B MALAT1 Rep1 minus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF,GSM8578737,GSM8578737: ZF H2B MALAT1 Rep1 minus; Danio rerio; OTHER,GSM8578737 r1,GSM8578737,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_H2B_MALAT1_Rep1_minus.R1.fq.gz ZF_H2B_MALAT1_Rep1_minus.R2.fq.gz,fastq fastq,1377040200.0,4590134.0,GSM8578737 r1,0:150 1:150,A:335021330;C:364359707;G:352178356;T:325457746;N:23061,150,150,,,335021330,364359707,352178356,325457746,23061,SRX26416584,SRS22936437,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34005,SRR31030875,SRX26416583,SRS22936435,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF H2B GAPDH Rep4 plus,GSM8578736,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF|geo loc name:missing|collection date:missing,ZF H2B GAPDH Rep4 plus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF,GSM8578736,GSM8578736: ZF H2B GAPDH Rep4 plus; Danio rerio; OTHER,GSM8578736 r1,GSM8578736,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_H2B_GAPDH_Rep4_plus.R1.fq.gz ZF_H2B_GAPDH_Rep4_plus.R2.fq.gz,fastq fastq,1051103100.0,3503677.0,GSM8578736 r1,0:150 1:150,A:274220771;C:238733668;G:254670769;T:283460283;N:17609,150,150,,,274220771,238733668,254670769,283460283,17609,SRX26416583,SRS22936435,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,mate1-mate2 similar by mapping diff,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34006,SRR31030876,SRX26416582,SRS22936436,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF H2B GAPDH Rep4 minus,GSM8578735,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF|geo loc name:missing|collection date:missing,ZF H2B GAPDH Rep4 minus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF,GSM8578735,GSM8578735: ZF H2B GAPDH Rep4 minus; Danio rerio; OTHER,GSM8578735 r1,GSM8578735,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_H2B_GAPDH_Rep4_minus.R1.fq.gz ZF_H2B_GAPDH_Rep4_minus.R2.fq.gz,fastq fastq,1206485700.0,4021619.0,GSM8578735 r1,0:150 1:150,A:314740194;C:274101014;G:292357972;T:325267132;N:19388,150,150,,,314740194,274101014,292357972,325267132,19388,SRX26416582,SRS22936436,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,mate1-mate2 similar by mapping diff,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34007,SRR31030877,SRX26416581,SRS22936434,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF H2B GAPDH Rep3 plus,GSM8578734,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF|geo loc name:missing|collection date:missing,ZF H2B GAPDH Rep3 plus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF,GSM8578734,GSM8578734: ZF H2B GAPDH Rep3 plus; Danio rerio; OTHER,GSM8578734 r1,GSM8578734,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_H2B_GAPDH_Rep3_plus.R1.fq.gz ZF_H2B_GAPDH_Rep3_plus.R2.fq.gz,fastq fastq,1140550200.0,3801834.0,GSM8578734 r1,0:150 1:150,A:297636297;C:258828826;G:276373993;T:307692213;N:18871,150,150,,,297636297,258828826,276373993,307692213,18871,SRX26416581,SRS22936434,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,mate1-mate2 similar by mapping diff,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34008,SRR31030878,SRX26416580,SRS22936433,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF H2B GAPDH Rep3 minus,GSM8578733,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF|geo loc name:missing|collection date:missing,ZF H2B GAPDH Rep3 minus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF,GSM8578733,GSM8578733: ZF H2B GAPDH Rep3 minus; Danio rerio; OTHER,GSM8578733 r1,GSM8578733,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_H2B_GAPDH_Rep3_minus.R1.fq.gz ZF_H2B_GAPDH_Rep3_minus.R2.fq.gz,fastq fastq,782406600.0,2608022.0,GSM8578733 r1,0:150 1:150,A:204132316;C:177696721;G:189675433;T:210888939;N:13191,150,150,,,204132316,177696721,189675433,210888939,13191,SRX26416580,SRS22936433,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,mate1-mate2 similar by mapping diff,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34009,SRR31030879,SRX26416579,SRS22936431,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF H2B GAPDH Rep2 plus,GSM8578732,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF|geo loc name:missing|collection date:missing,ZF H2B GAPDH Rep2 plus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF,GSM8578732,GSM8578732: ZF H2B GAPDH Rep2 plus; Danio rerio; OTHER,GSM8578732 r1,GSM8578732,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_H2B_GAPDH_Rep2_plus.R1.fq.gz ZF_H2B_GAPDH_Rep2_plus.R2.fq.gz,fastq fastq,958297200.0,3194324.0,GSM8578732 r1,0:150 1:150,A:250011335;C:217600823;G:232206339;T:258462392;N:16311,150,150,,,250011335,217600823,232206339,258462392,16311,SRX26416579,SRS22936431,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,mate1-mate2 similar by mapping diff,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34010,SRR31030880,SRX26416578,SRS22936432,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF H2B GAPDH Rep2 minus,GSM8578731,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF|geo loc name:missing|collection date:missing,ZF H2B GAPDH Rep2 minus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF,GSM8578731,GSM8578731: ZF H2B GAPDH Rep2 minus; Danio rerio; OTHER,GSM8578731 r1,GSM8578731,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_H2B_GAPDH_Rep2_minus.R1.fq.gz ZF_H2B_GAPDH_Rep2_minus.R2.fq.gz,fastq fastq,1020926700.0,3403089.0,GSM8578731 r1,0:150 1:150,A:266429488;C:231749424;G:247353147;T:275377720;N:16921,150,150,,,266429488,231749424,247353147,275377720,16921,SRX26416578,SRS22936432,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,mate1-mate2 similar by mapping diff,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34011,SRR31030881,SRX26416577,SRS22936430,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF H2B GAPDH Rep1 plus,GSM8578730,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF|geo loc name:missing|collection date:missing,ZF H2B GAPDH Rep1 plus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF,GSM8578730,GSM8578730: ZF H2B GAPDH Rep1 plus; Danio rerio; OTHER,GSM8578730 r1,GSM8578730,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_H2B_GAPDH_Rep1_plus.R1.fq.gz ZF_H2B_GAPDH_Rep1_plus.R2.fq.gz,fastq fastq,1134318600.0,3781062.0,GSM8578730 r1,0:150 1:150,A:295931335;C:257596481;G:274848790;T:305922827;N:19167,150,150,,,295931335,257596481,274848790,305922827,19167,SRX26416577,SRS22936430,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,mate1-mate2 similar by mapping diff,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34012,SRR31030882,SRX26416576,SRS22936429,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF H2B GAPDH Rep1 minus,GSM8578729,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF|geo loc name:missing|collection date:missing,ZF H2B GAPDH Rep1 minus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF,GSM8578729,GSM8578729: ZF H2B GAPDH Rep1 minus; Danio rerio; OTHER,GSM8578729 r1,GSM8578729,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_H2B_GAPDH_Rep1_minus.R1.fq.gz ZF_H2B_GAPDH_Rep1_minus.R2.fq.gz,fastq fastq,752638800.0,2508796.0,GSM8578729 r1,0:150 1:150,A:196331185;C:170899863;G:182460258;T:202935049;N:12445,150,150,,,196331185,170899863,182460258,202935049,12445,SRX26416576,SRS22936429,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,mate1-mate2 similar by mapping diff,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34013,SRR31031004,SRX26416454,SRS22936307,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,Zeb WT pDBF Rep3,GSM8578770,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:wildtype|treatment:plus DBF|geo loc name:missing|collection date:missing,Zeb WT pDBF Rep3,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:wildtype|treatment:plus DBF,GSM8578770,GSM8578770: Zeb WT pDBF Rep3; Danio rerio; OTHER,GSM8578770 r1,GSM8578770,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,Zeb_WT_pDBF_Rep3.R1.fq.gz Zeb_WT_pDBF_Rep3.R2.fq.gz,fastq fastq,23216831100.0,77389437.0,GSM8578770 r1,0:150 1:150,A:7577896837;C:3508911439;G:4823311862;T:7306393244;N:317718,150,150,,,7577896837,3508911439,4823311862,7306393244,317718,SRX26416454,SRS22936307,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,mate2-mate1 similar by mapping diff,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34014,SRR31031005,SRX26416453,SRS22936305,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,Zeb WT pDBF Rep2,GSM8578769,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:wildtype|treatment:plus DBF|geo loc name:missing|collection date:missing,Zeb WT pDBF Rep2,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:wildtype|treatment:plus DBF,GSM8578769,GSM8578769: Zeb WT pDBF Rep2; Danio rerio; OTHER,GSM8578769 r1,GSM8578769,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,Zeb_WT_pDBF_Rep2.R1.fq.gz Zeb_WT_pDBF_Rep2.R2.fq.gz,fastq fastq,27237049500.0,90790165.0,GSM8578769 r1,0:150 1:150,A:8800724632;C:4062692793;G:5651432074;T:8721823175;N:376826,150,150,,,8800724632,4062692793,5651432074,8721823175,376826,SRX26416453,SRS22936305,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,mate2-mate1 similar by mapping diff,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34015,SRR31031006,SRX26416452,SRS22936306,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,Zeb WT pDBF Rep1,GSM8578768,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:wildtype|treatment:plus DBF|geo loc name:missing|collection date:missing,Zeb WT pDBF Rep1,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:wildtype|treatment:plus DBF,GSM8578768,GSM8578768: Zeb WT pDBF Rep1; Danio rerio; OTHER,GSM8578768 r1,GSM8578768,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,Zeb_WT_pDBF_Rep1.R1.fq.gz Zeb_WT_pDBF_Rep1.R2.fq.gz,fastq fastq,22364115300.0,74547051.0,GSM8578768 r1,0:150 1:150,A:7336106577;C:3346831944;G:4451536371;T:7229335436;N:304972,150,150,,,7336106577,3346831944,4451536371,7229335436,304972,SRX26416452,SRS22936306,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,mate2-mate1 similar by mapping diff,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34016,SRR31031007,SRX26416451,SRS22936304,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,Zeb WT mDBF Rep3,GSM8578767,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:wildtype|treatment:minus DBF|geo loc name:missing|collection date:missing,Zeb WT mDBF Rep3,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:wildtype|treatment:minus DBF,GSM8578767,GSM8578767: Zeb WT mDBF Rep3; Danio rerio; OTHER,GSM8578767 r1,GSM8578767,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,Zeb_WT_mDBF_Rep3.R1.fq.gz Zeb_WT_mDBF_Rep3.R2.fq.gz,fastq fastq,20112719100.0,67042397.0,GSM8578767 r1,0:150 1:150,A:6537370232;C:2924919118;G:3973928235;T:6676228153;N:273362,150,150,,,6537370232,2924919118,3973928235,6676228153,273362,SRX26416451,SRS22936304,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,mate2-mate1 similar by mapping diff,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34017,SRR31031008,SRX26416450,SRS22936303,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,Zeb WT mDBF Rep2,GSM8578766,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:wildtype|treatment:minus DBF|geo loc name:missing|collection date:missing,Zeb WT mDBF Rep2,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:wildtype|treatment:minus DBF,GSM8578766,GSM8578766: Zeb WT mDBF Rep2; Danio rerio; OTHER,GSM8578766 r1,GSM8578766,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,Zeb_WT_mDBF_Rep2.R1.fq.gz Zeb_WT_mDBF_Rep2.R2.fq.gz,fastq fastq,24839552100.0,82798507.0,GSM8578766 r1,0:150 1:150,A:8176074473;C:3715794630;G:4984816273;T:7962528150;N:338574,150,150,,,8176074473,3715794630,4984816273,7962528150,338574,SRX26416450,SRS22936303,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,mate2-mate1 similar by mapping diff,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34018,SRR31031009,SRX26416449,SRS22936302,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,Zeb WT mDBF Rep1,GSM8578765,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:wildtype|treatment:minus DBF|geo loc name:missing|collection date:missing,Zeb WT mDBF Rep1,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:wildtype|treatment:minus DBF,GSM8578765,GSM8578765: Zeb WT mDBF Rep1; Danio rerio; OTHER,GSM8578765 r1,GSM8578765,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,Zeb_WT_mDBF_Rep1.R1.fq.gz Zeb_WT_mDBF_Rep1.R2.fq.gz,fastq fastq,23029785600.0,76765952.0,GSM8578765 r1,0:150 1:150,A:7509388471;C:3438475939;G:4820328116;T:7261277960;N:315114,150,150,,,7509388471,3438475939,4820328116,7261277960,315114,SRX26416449,SRS22936302,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,mate2-mate1 similar by mapping diff,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34019,SRR31031010,SRX26416448,SRS22936301,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,Zeb NES pDBF Rep2,GSM8578764,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF|geo loc name:missing|collection date:missing,Zeb NES pDBF Rep2,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF,GSM8578764,GSM8578764: Zeb NES pDBF Rep2; Danio rerio; OTHER,GSM8578764 r1,GSM8578764,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,Zeb_NES_pDBF_Rep2.R1.fq.gz Zeb_NES_pDBF_Rep2.R2.fq.gz,fastq fastq,25465584900.0,84885283.0,GSM8578764 r1,0:150 1:150,A:7944190976;C:4330095891;G:5473069331;T:7718120992;N:107710,150,150,,,7944190976,4330095891,5473069331,7718120992,107710,SRX26416448,SRS22936301,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,mate2-mate1 similar by mapping diff,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34020,SRR31031011,SRX26416447,SRS22936300,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,Zeb NES pDBF Rep1,GSM8578763,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF|geo loc name:missing|collection date:missing,Zeb NES pDBF Rep1,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF,GSM8578763,GSM8578763: Zeb NES pDBF Rep1; Danio rerio; OTHER,GSM8578763 r1,GSM8578763,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,Zeb_NES_pDBF_Rep1.R1.fq.gz Zeb_NES_pDBF_Rep1.R2.fq.gz,fastq fastq,21107351400.0,70357838.0,GSM8578763 r1,0:150 1:150,A:6528579219;C:3620666961;G:4496642830;T:6461373643;N:88747,150,150,,,6528579219,3620666961,4496642830,6461373643,88747,SRX26416447,SRS22936300,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,mate2-mate1 similar by mapping diff,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34021,SRR31031012,SRX26416446,SRS22936299,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,Zeb NES mDBF Rep2,GSM8578762,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF|geo loc name:missing|collection date:missing,Zeb NES mDBF Rep2,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF,GSM8578762,GSM8578762: Zeb NES mDBF Rep2; Danio rerio; OTHER,GSM8578762 r1,GSM8578762,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,Zeb_NES_mDBF_Rep2.R1.fq.gz Zeb_NES_mDBF_Rep2.R2.fq.gz,fastq fastq,21542967300.0,71809891.0,GSM8578762 r1,0:150 1:150,A:6722613760;C:3654507931;G:4628076548;T:6537678084;N:90977,150,150,,,6722613760,3654507931,4628076548,6537678084,90977,SRX26416446,SRS22936299,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,mate2-mate1 similar by mapping diff,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34022,SRR31031013,SRX26416445,SRS22936297,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,Zeb NES mDBF Rep1,GSM8578761,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF|geo loc name:missing|collection date:missing,Zeb NES mDBF Rep1,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF,GSM8578761,GSM8578761: Zeb NES mDBF Rep1; Danio rerio; OTHER,GSM8578761 r1,GSM8578761,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,Zeb_NES_mDBF_Rep1.R1.fq.gz Zeb_NES_mDBF_Rep1.R2.fq.gz,fastq fastq,23038870800.0,76796236.0,GSM8578761 r1,0:150 1:150,A:7216059153;C:3815899397;G:4909028200;T:7097787584;N:96466,150,150,,,7216059153,3815899397,4909028200,7097787584,96466,SRX26416445,SRS22936297,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,mate2-mate1 similar by mapping diff,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34023,SRR31031014,SRX26416444,SRS22936298,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF NES MALAT1 Rep4 plus,GSM8578760,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF|geo loc name:missing|collection date:missing,ZF NES MALAT1 Rep4 plus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF,GSM8578760,GSM8578760: ZF NES MALAT1 Rep4 plus; Danio rerio; OTHER,GSM8578760 r1,GSM8578760,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_NES_MALAT1_Rep4_plus.R1.fq.gz ZF_NES_MALAT1_Rep4_plus.R2.fq.gz,fastq fastq,1091293200.0,3637644.0,GSM8578760 r1,0:150 1:150,A:265519561;C:288647650;G:279105515;T:258001510;N:18964,150,150,,,265519561,288647650,279105515,258001510,18964,SRX26416444,SRS22936298,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34024,SRR31031015,SRX26416443,SRS22936296,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF NES MALAT1 Rep4 minus,GSM8578759,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF|geo loc name:missing|collection date:missing,ZF NES MALAT1 Rep4 minus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF,GSM8578759,GSM8578759: ZF NES MALAT1 Rep4 minus; Danio rerio; OTHER,GSM8578759 r1,GSM8578759,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_NES_MALAT1_Rep4_minus.R1.fq.gz ZF_NES_MALAT1_Rep4_minus.R2.fq.gz,fastq fastq,1395963600.0,4653212.0,GSM8578759 r1,0:150 1:150,A:339654289;C:369433701;G:356957685;T:329893853;N:24072,150,150,,,339654289,369433701,356957685,329893853,24072,SRX26416443,SRS22936296,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34025,SRR31031016,SRX26416442,SRS22936295,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF NES MALAT1 Rep3 plus,GSM8578758,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF|geo loc name:missing|collection date:missing,ZF NES MALAT1 Rep3 plus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF,GSM8578758,GSM8578758: ZF NES MALAT1 Rep3 plus; Danio rerio; OTHER,GSM8578758 r1,GSM8578758,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_NES_MALAT1_Rep3_plus.R1.fq.gz ZF_NES_MALAT1_Rep3_plus.R2.fq.gz,fastq fastq,1556195100.0,5187317.0,GSM8578758 r1,0:150 1:150,A:378553535;C:411730281;G:398086882;T:367797563;N:26839,150,150,,,378553535,411730281,398086882,367797563,26839,SRX26416442,SRS22936295,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34026,SRR31031017,SRX26416441,SRS22936294,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF NES MALAT1 Rep3 minus,GSM8578757,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF|geo loc name:missing|collection date:missing,ZF NES MALAT1 Rep3 minus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF,GSM8578757,GSM8578757: ZF NES MALAT1 Rep3 minus; Danio rerio; OTHER,GSM8578757 r1,GSM8578757,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_NES_MALAT1_Rep3_minus.R1.fq.gz ZF_NES_MALAT1_Rep3_minus.R2.fq.gz,fastq fastq,1511328900.0,5037763.0,GSM8578757 r1,0:150 1:150,A:367639521;C:400036694;G:386523395;T:357103340;N:25950,150,150,,,367639521,400036694,386523395,357103340,25950,SRX26416441,SRS22936294,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34027,SRR31031018,SRX26416440,SRS22936293,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF NES MALAT1 Rep2 plus,GSM8578756,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF|geo loc name:missing|collection date:missing,ZF NES MALAT1 Rep2 plus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF,GSM8578756,GSM8578756: ZF NES MALAT1 Rep2 plus; Danio rerio; OTHER,GSM8578756 r1,GSM8578756,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_NES_MALAT1_Rep2_plus.R1.fq.gz ZF_NES_MALAT1_Rep2_plus.R2.fq.gz,fastq fastq,1451137800.0,4837126.0,GSM8578756 r1,0:150 1:150,A:353052445;C:383981771;G:371154128;T:342925275;N:24181,150,150,,,353052445,383981771,371154128,342925275,24181,SRX26416440,SRS22936293,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34028,SRR31031019,SRX26416439,SRS22936292,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF NES MALAT1 Rep2 minus,GSM8578755,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF|geo loc name:missing|collection date:missing,ZF NES MALAT1 Rep2 minus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF,GSM8578755,GSM8578755: ZF NES MALAT1 Rep2 minus; Danio rerio; OTHER,GSM8578755 r1,GSM8578755,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_NES_MALAT1_Rep2_minus.R1.fq.gz ZF_NES_MALAT1_Rep2_minus.R2.fq.gz,fastq fastq,1286489400.0,4288298.0,GSM8578755 r1,0:150 1:150,A:312986127;C:340482608;G:329001591;T:303997982;N:21092,150,150,,,312986127,340482608,329001591,303997982,21092,SRX26416439,SRS22936292,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34029,SRR31031020,SRX26416438,SRS22936291,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF NES MALAT1 Rep1 plus,GSM8578754,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF|geo loc name:missing|collection date:missing,ZF NES MALAT1 Rep1 plus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF,GSM8578754,GSM8578754: ZF NES MALAT1 Rep1 plus; Danio rerio; OTHER,GSM8578754 r1,GSM8578754,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_NES_MALAT1_Rep1_plus.R1.fq.gz ZF_NES_MALAT1_Rep1_plus.R2.fq.gz,fastq fastq,1146380100.0,3821267.0,GSM8578754 r1,0:150 1:150,A:278826422;C:303464534;G:293239572;T:270830265;N:19307,150,150,,,278826422,303464534,293239572,270830265,19307,SRX26416438,SRS22936291,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34030,SRR31031021,SRX26416437,SRS22936289,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF NES MALAT1 Rep1 minus,GSM8578753,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF|geo loc name:missing|collection date:missing,ZF NES MALAT1 Rep1 minus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF,GSM8578753,GSM8578753: ZF NES MALAT1 Rep1 minus; Danio rerio; OTHER,GSM8578753 r1,GSM8578753,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_NES_MALAT1_Rep1_minus.R1.fq.gz ZF_NES_MALAT1_Rep1_minus.R2.fq.gz,fastq fastq,1149087000.0,3830290.0,GSM8578753 r1,0:150 1:150,A:279487473;C:304130198;G:293947979;T:271501018;N:20332,150,150,,,279487473,304130198,293947979,271501018,20332,SRX26416437,SRS22936289,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34031,SRR31031022,SRX26416436,SRS22936290,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF NES GAPDH Rep4 plus,GSM8578752,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF|geo loc name:missing|collection date:missing,ZF NES GAPDH Rep4 plus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF,GSM8578752,GSM8578752: ZF NES GAPDH Rep4 plus; Danio rerio; OTHER,GSM8578752 r1,GSM8578752,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_NES_GAPDH_Rep4_plus.R1.fq.gz ZF_NES_GAPDH_Rep4_plus.R2.fq.gz,fastq fastq,1010253300.0,3367511.0,GSM8578752 r1,0:150 1:150,A:264284161;C:228880831;G:244038984;T:273032130;N:17194,150,150,,,264284161,228880831,244038984,273032130,17194,SRX26416436,SRS22936290,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
35460,SRR32818804,SRX28102240,SRS24458287,SRP572436,PRJNA1240804,Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 48 hpf zebrafish embryos WT vs. aBTX injected paralyzed bulk RNAseq dataset,GSE292683,Transcriptome Analysis,Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from uninjected control 48 hpf and aBTX alpha bungarotoxin injected paralyzed 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes.,,pubmed:40145570,,sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 8,GSM8863198,,source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf embryos uninjected control|geo loc name:missing|collection date:missing,sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 8,Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: DESeq2 normalized counts,FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos,,For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O’Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit,,tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf embryos uninjected control,GSM8863198,GSM8863198: sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 8; Danio rerio; RNA Seq,GSM8863198 r1,GSM8863198,1,For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O'Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 550,,SRP572436,,,nR284-L2-G5-P57-GTTCCAAT-GCAGAATT-READ1-Sequences.txt nR284-L2-G5-P57-GTTCCAAT-GCAGAATT-READ2-Sequences.txt,fastq fastq,10743485140.0,53185570.0,GSM8863198 r1,0:101 1:101,A:2043166141;C:3372557345;G:3302778932;T:2024928209;N:54513,101,101,,,2043166141,3372557345,3302778932,2024928209,54513,SRX28102240,SRS24458287,SRA2098459,UC Irvine,UC Irvine,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,full_length,cdna_unspecified,smarter,bulk,bulk,bulk,,United States,2025-03-23,Hatching,Embryo,Embryo Imprecise,All anatomical structures
35461,SRR32818805,SRX28102239,SRS24458286,SRP572436,PRJNA1240804,Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 48 hpf zebrafish embryos WT vs. aBTX injected paralyzed bulk RNAseq dataset,GSE292683,Transcriptome Analysis,Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from uninjected control 48 hpf and aBTX alpha bungarotoxin injected paralyzed 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes.,,pubmed:40145570,,sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 7,GSM8863197,,source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf embryos uninjected control|geo loc name:missing|collection date:missing,sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 7,Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: DESeq2 normalized counts,FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos,,For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O’Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit,,tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf embryos uninjected control,GSM8863197,GSM8863197: sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 7; Danio rerio; RNA Seq,GSM8863197 r1,GSM8863197,1,For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O'Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 550,,SRP572436,,,nR284-L2-G5-P56-GCAATGCA-AACGTTCC-READ1-Sequences.txt nR284-L2-G5-P56-GCAATGCA-AACGTTCC-READ2-Sequences.txt,fastq fastq,8690926174.0,43024387.0,GSM8863197 r1,0:101 1:101,A:1676436454;C:2706306943;G:2647919752;T:1660219021;N:44004,101,101,,,1676436454,2706306943,2647919752,1660219021,44004,SRX28102239,SRS24458286,SRA2098459,UC Irvine,UC Irvine,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,full_length,cdna_unspecified,smarter,bulk,bulk,bulk,,United States,2025-03-23,Hatching,Embryo,Embryo Imprecise,All anatomical structures
35462,SRR32818806,SRX28102238,SRS24458285,SRP572436,PRJNA1240804,Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 48 hpf zebrafish embryos WT vs. aBTX injected paralyzed bulk RNAseq dataset,GSE292683,Transcriptome Analysis,Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from uninjected control 48 hpf and aBTX alpha bungarotoxin injected paralyzed 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes.,,pubmed:40145570,,sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 6,GSM8863196,,source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf embryos uninjected control|geo loc name:missing|collection date:missing,sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 6,Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: DESeq2 normalized counts,FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos,,For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O’Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit,,tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf embryos uninjected control,GSM8863196,GSM8863196: sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 6; Danio rerio; RNA Seq,GSM8863196 r1,GSM8863196,1,For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O'Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 550,,SRP572436,,,nR284-L2-G5-P55-ATGGCATG-GGTACCTT-READ1-Sequences.txt nR284-L2-G5-P55-ATGGCATG-GGTACCTT-READ2-Sequences.txt,fastq fastq,10679789894.0,52870247.0,GSM8863196 r1,0:101 1:101,A:2075736321;C:3306230069;G:3245751043;T:2052019154;N:53307,101,101,,,2075736321,3306230069,3245751043,2052019154,53307,SRX28102238,SRS24458285,SRA2098459,UC Irvine,UC Irvine,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,full_length,cdna_unspecified,smarter,bulk,bulk,bulk,,United States,2025-03-23,Hatching,Embryo,Embryo Imprecise,All anatomical structures
35463,SRR32818807,SRX28102237,SRS24458284,SRP572436,PRJNA1240804,Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 48 hpf zebrafish embryos WT vs. aBTX injected paralyzed bulk RNAseq dataset,GSE292683,Transcriptome Analysis,Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from uninjected control 48 hpf and aBTX alpha bungarotoxin injected paralyzed 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes.,,pubmed:40145570,,sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 5,GSM8863195,,source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf embryos uninjected control|geo loc name:missing|collection date:missing,sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 5,Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: DESeq2 normalized counts,FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos,,For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O’Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit,,tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf embryos uninjected control,GSM8863195,GSM8863195: sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 5; Danio rerio; RNA Seq,GSM8863195 r1,GSM8863195,1,For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O'Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 550,,SRP572436,,,nR284-L2-G5-P54-GGAGCGTC-GCACGGAC-READ1-Sequences.txt nR284-L2-G5-P54-GGAGCGTC-GCACGGAC-READ2-Sequences.txt,fastq fastq,10631975484.0,52633542.0,GSM8863195 r1,0:101 1:101,A:1978520961;C:3379107355;G:3313372052;T:1960921814;N:53302,101,101,,,1978520961,3379107355,3313372052,1960921814,53302,SRX28102237,SRS24458284,SRA2098459,UC Irvine,UC Irvine,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,full_length,cdna_unspecified,smarter,bulk,bulk,bulk,,United States,2025-03-23,Hatching,Embryo,Embryo Imprecise,All anatomical structures
35464,SRR32818808,SRX28102236,SRS24458283,SRP572436,PRJNA1240804,Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 48 hpf zebrafish embryos WT vs. aBTX injected paralyzed bulk RNAseq dataset,GSE292683,Transcriptome Analysis,Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from uninjected control 48 hpf and aBTX alpha bungarotoxin injected paralyzed 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes.,,pubmed:40145570,,sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 4,GSM8863194,,source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf embryos uninjected control|geo loc name:missing|collection date:missing,sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 4,Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: DESeq2 normalized counts,FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos,,For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O’Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit,,tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf embryos uninjected control,GSM8863194,GSM8863194: sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 4; Danio rerio; RNA Seq,GSM8863194 r1,GSM8863194,1,For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O'Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 550,,SRP572436,,,nR284-L2-G5-P53-AAGATACT-ATGTAAGT-READ1-Sequences.txt nR284-L2-G5-P53-AAGATACT-ATGTAAGT-READ2-Sequences.txt,fastq fastq,11273189336.0,55807868.0,GSM8863194 r1,0:101 1:101,A:2204760360;C:3477277778;G:3404605220;T:2186489012;N:56966,101,101,,,2204760360,3477277778,3404605220,2186489012,56966,SRX28102236,SRS24458283,SRA2098459,UC Irvine,UC Irvine,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,full_length,cdna_unspecified,smarter,bulk,bulk,bulk,,United States,2025-03-23,Hatching,Embryo,Embryo Imprecise,All anatomical structures
35465,SRR32818809,SRX28102235,SRS24458282,SRP572436,PRJNA1240804,Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 48 hpf zebrafish embryos WT vs. aBTX injected paralyzed bulk RNAseq dataset,GSE292683,Transcriptome Analysis,Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from uninjected control 48 hpf and aBTX alpha bungarotoxin injected paralyzed 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes.,,pubmed:40145570,,sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 3,GSM8863193,,source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf embryos uninjected control|geo loc name:missing|collection date:missing,sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 3,Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: DESeq2 normalized counts,FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos,,For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O’Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit,,tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf embryos uninjected control,GSM8863193,GSM8863193: sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 3; Danio rerio; RNA Seq,GSM8863193 r1,GSM8863193,1,For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O'Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 550,,SRP572436,,,nR284-L2-G5-P52-GCGCAAGC-CGGCGTGA-READ1-Sequences.txt nR284-L2-G5-P52-GCGCAAGC-CGGCGTGA-READ2-Sequences.txt,fastq fastq,10239163658.0,50688929.0,GSM8863193 r1,0:101 1:101,A:2004831470;C:3154126629;G:3091862970;T:1988292042;N:50547,101,101,,,2004831470,3154126629,3091862970,1988292042,50547,SRX28102235,SRS24458282,SRA2098459,UC Irvine,UC Irvine,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,full_length,cdna_unspecified,smarter,bulk,bulk,bulk,,United States,2025-03-23,Hatching,Embryo,Embryo Imprecise,All anatomical structures
35466,SRR32818810,SRX28102234,SRS24458281,SRP572436,PRJNA1240804,Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 48 hpf zebrafish embryos WT vs. aBTX injected paralyzed bulk RNAseq dataset,GSE292683,Transcriptome Analysis,Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from uninjected control 48 hpf and aBTX alpha bungarotoxin injected paralyzed 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes.,,pubmed:40145570,,sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 2,GSM8863192,,source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf embryos uninjected control|geo loc name:missing|collection date:missing,sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 2,Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: DESeq2 normalized counts,FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos,,For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O’Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit,,tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf embryos uninjected control,GSM8863192,GSM8863192: sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 2; Danio rerio; RNA Seq,GSM8863192 r1,GSM8863192,1,For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O'Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 550,,SRP572436,,,nR284-L2-G5-P51-ATATGGAT-TAATACAG-READ1-Sequences.txt nR284-L2-G5-P51-ATATGGAT-TAATACAG-READ2-Sequences.txt,fastq fastq,11426211002.0,56565401.0,GSM8863192 r1,0:101 1:101,A:2181426814;C:3575345894;G:3505040965;T:2164340511;N:56818,101,101,,,2181426814,3575345894,3505040965,2164340511,56818,SRX28102234,SRS24458281,SRA2098459,UC Irvine,UC Irvine,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,full_length,cdna_unspecified,smarter,bulk,bulk,bulk,,United States,2025-03-23,Hatching,Embryo,Embryo Imprecise,All anatomical structures
35467,SRR32818811,SRX28102233,SRS24458280,SRP572436,PRJNA1240804,Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 48 hpf zebrafish embryos WT vs. aBTX injected paralyzed bulk RNAseq dataset,GSE292683,Transcriptome Analysis,Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from uninjected control 48 hpf and aBTX alpha bungarotoxin injected paralyzed 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes.,,pubmed:40145570,,sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 1,GSM8863191,,source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf embryos uninjected control|geo loc name:missing|collection date:missing,sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 1,Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: DESeq2 normalized counts,FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos,,For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O’Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit,,tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf embryos uninjected control,GSM8863191,GSM8863191: sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 1; Danio rerio; RNA Seq,GSM8863191 r1,GSM8863191,1,For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O'Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 550,,SRP572436,,,nR284-L2-G5-P50-CGGACAAC-AATCCGGA-READ1-Sequences.txt nR284-L2-G5-P50-CGGACAAC-AATCCGGA-READ2-Sequences.txt,fastq fastq,8241627270.0,40800135.0,GSM8863191 r1,0:101 1:101,A:1585704825;C:2569399779;G:2515169694;T:1571311579;N:41393,101,101,,,1585704825,2569399779,2515169694,1571311579,41393,SRX28102233,SRS24458280,SRA2098459,UC Irvine,UC Irvine,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,full_length,cdna_unspecified,smarter,bulk,bulk,bulk,,United States,2025-03-23,Hatching,Embryo,Embryo Imprecise,All anatomical structures
35468,SRR32818812,SRX28102232,SRS24458279,SRP572436,PRJNA1240804,Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 48 hpf zebrafish embryos WT vs. aBTX injected paralyzed bulk RNAseq dataset,GSE292683,Transcriptome Analysis,Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from uninjected control 48 hpf and aBTX alpha bungarotoxin injected paralyzed 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes.,,pubmed:40145570,,sorted mCherry+ tenocytes from aBTX injected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 6,GSM8863190,,source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf embryos aBTX injected at single cell stage|geo loc name:missing|collection date:missing,sorted mCherry+ tenocytes from aBTX injected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 6,Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: DESeq2 normalized counts,FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos,,For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O’Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit,,tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf embryos aBTX injected at single cell stage,GSM8863190,GSM8863190: sorted mCherry+ tenocytes from aBTX injected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 6; Danio rerio; RNA Seq,GSM8863190 r1,GSM8863190,1,For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O'Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 550,,SRP572436,,,nR284-L2-G5-P49-TAAGTGGT-GGCTTAAG-READ1-Sequences.txt nR284-L2-G5-P49-TAAGTGGT-GGCTTAAG-READ2-Sequences.txt,fastq fastq,11020907900.0,54558950.0,GSM8863190 r1,0:101 1:101,A:2122315499;C:3428329681;G:3363708951;T:2106499941;N:53828,101,101,,,2122315499,3428329681,3363708951,2106499941,53828,SRX28102232,SRS24458279,SRA2098459,UC Irvine,UC Irvine,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,full_length,cdna_unspecified,smarter,bulk,bulk,bulk,,United States,2025-03-23,Hatching,Embryo,Embryo Imprecise,All anatomical structures
35469,SRR32818813,SRX28102231,SRS24458278,SRP572436,PRJNA1240804,Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 48 hpf zebrafish embryos WT vs. aBTX injected paralyzed bulk RNAseq dataset,GSE292683,Transcriptome Analysis,Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from uninjected control 48 hpf and aBTX alpha bungarotoxin injected paralyzed 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes.,,pubmed:40145570,,sorted mCherry+ tenocytes from aBTX injected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 5,GSM8863189,,source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf embryos aBTX injected at single cell stage|geo loc name:missing|collection date:missing,sorted mCherry+ tenocytes from aBTX injected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 5,Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: DESeq2 normalized counts,FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos,,For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O’Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit,,tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf embryos aBTX injected at single cell stage,GSM8863189,GSM8863189: sorted mCherry+ tenocytes from aBTX injected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 5; Danio rerio; RNA Seq,GSM8863189 r1,GSM8863189,1,For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O'Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 550,,SRP572436,,,nR284-L2-G5-P48-TACCGAGG-AGTTCAGG-READ1-Sequences.txt nR284-L2-G5-P48-TACCGAGG-AGTTCAGG-READ2-Sequences.txt,fastq fastq,9778516798.0,48408499.0,GSM8863189 r1,0:101 1:101,A:1871707305;C:3053861632;G:3000334130;T:1852564463;N:49268,101,101,,,1871707305,3053861632,3000334130,1852564463,49268,SRX28102231,SRS24458278,SRA2098459,UC Irvine,UC Irvine,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,full_length,cdna_unspecified,smarter,bulk,bulk,bulk,,United States,2025-03-23,Hatching,Embryo,Embryo Imprecise,All anatomical structures
35470,SRR32818814,SRX28102230,SRS24458277,SRP572436,PRJNA1240804,Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 48 hpf zebrafish embryos WT vs. aBTX injected paralyzed bulk RNAseq dataset,GSE292683,Transcriptome Analysis,Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from uninjected control 48 hpf and aBTX alpha bungarotoxin injected paralyzed 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes.,,pubmed:40145570,,sorted mCherry+ tenocytes from aBTX injected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 4,GSM8863188,,source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf embryos aBTX injected at single cell stage|geo loc name:missing|collection date:missing,sorted mCherry+ tenocytes from aBTX injected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 4,Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: DESeq2 normalized counts,FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos,,For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O’Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit,,tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf embryos aBTX injected at single cell stage,GSM8863188,GSM8863188: sorted mCherry+ tenocytes from aBTX injected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 4; Danio rerio; RNA Seq,GSM8863188 r1,GSM8863188,1,For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O'Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 550,,SRP572436,,,nR284-L2-G5-P47-AATGCCTC-TGGATCGA-READ1-Sequences.txt nR284-L2-G5-P47-AATGCCTC-TGGATCGA-READ2-Sequences.txt,fastq fastq,9225871462.0,45672631.0,GSM8863188 r1,0:101 1:101,A:1812334628;C:2836256230;G:2784608990;T:1792625480;N:46134,101,101,,,1812334628,2836256230,2784608990,1792625480,46134,SRX28102230,SRS24458277,SRA2098459,UC Irvine,UC Irvine,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,full_length,cdna_unspecified,smarter,bulk,bulk,bulk,,United States,2025-03-23,Hatching,Embryo,Embryo Imprecise,All anatomical structures
35471,SRR32818815,SRX28102229,SRS24458276,SRP572436,PRJNA1240804,Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 48 hpf zebrafish embryos WT vs. aBTX injected paralyzed bulk RNAseq dataset,GSE292683,Transcriptome Analysis,Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from uninjected control 48 hpf and aBTX alpha bungarotoxin injected paralyzed 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes.,,pubmed:40145570,,sorted mCherry+ tenocytes from aBTX injected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 3,GSM8863187,,source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf embryos aBTX injected at single cell stage|geo loc name:missing|collection date:missing,sorted mCherry+ tenocytes from aBTX injected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 3,Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: DESeq2 normalized counts,FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos,,For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O’Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit,,tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf embryos aBTX injected at single cell stage,GSM8863187,GSM8863187: sorted mCherry+ tenocytes from aBTX injected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 3; Danio rerio; RNA Seq,GSM8863187 r1,GSM8863187,1,For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O'Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 550,,SRP572436,,,nR284-L2-G5-P46-GGCATTCT-CAAGCTAG-READ1-Sequences.txt nR284-L2-G5-P46-GGCATTCT-CAAGCTAG-READ2-Sequences.txt,fastq fastq,8722157192.0,43178996.0,GSM8863187 r1,0:101 1:101,A:1656516190;C:2739809093;G:2694619623;T:1631169000;N:43286,101,101,,,1656516190,2739809093,2694619623,1631169000,43286,SRX28102229,SRS24458276,SRA2098459,UC Irvine,UC Irvine,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,full_length,cdna_unspecified,smarter,bulk,bulk,bulk,,United States,2025-03-23,Hatching,Embryo,Embryo Imprecise,All anatomical structures
35472,SRR32818816,SRX28102228,SRS24458275,SRP572436,PRJNA1240804,Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 48 hpf zebrafish embryos WT vs. aBTX injected paralyzed bulk RNAseq dataset,GSE292683,Transcriptome Analysis,Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from uninjected control 48 hpf and aBTX alpha bungarotoxin injected paralyzed 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes.,,pubmed:40145570,,sorted mCherry+ tenocytes from aBTX injected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 2,GSM8863186,,source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf embryos aBTX injected at single cell stage|geo loc name:missing|collection date:missing,sorted mCherry+ tenocytes from aBTX injected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 2,Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: DESeq2 normalized counts,FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos,,For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O’Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit,,tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf embryos aBTX injected at single cell stage,GSM8863186,GSM8863186: sorted mCherry+ tenocytes from aBTX injected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 2; Danio rerio; RNA Seq,GSM8863186 r1,GSM8863186,1,For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O'Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 550,,SRP572436,,,nR284-L2-G5-P45-TTACAGGA-GCTTGTCA-READ1-Sequences.txt nR284-L2-G5-P45-TTACAGGA-GCTTGTCA-READ2-Sequences.txt,fastq fastq,9539410206.0,47224803.0,GSM8863186 r1,0:101 1:101,A:1827192429;C:2980924877;G:2922457892;T:1808788630;N:46378,101,101,,,1827192429,2980924877,2922457892,1808788630,46378,SRX28102228,SRS24458275,SRA2098459,UC Irvine,UC Irvine,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,full_length,cdna_unspecified,smarter,bulk,bulk,bulk,,United States,2025-03-23,Hatching,Embryo,Embryo Imprecise,All anatomical structures
35473,SRR32818817,SRX28102227,SRS24458274,SRP572436,PRJNA1240804,Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 48 hpf zebrafish embryos WT vs. aBTX injected paralyzed bulk RNAseq dataset,GSE292683,Transcriptome Analysis,Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from uninjected control 48 hpf and aBTX alpha bungarotoxin injected paralyzed 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes.,,pubmed:40145570,,sorted mCherry+ tenocytes from aBTX injected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 1,GSM8863185,,source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf embryos aBTX injected at single cell stage|geo loc name:missing|collection date:missing,sorted mCherry+ tenocytes from aBTX injected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 1,Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: DESeq2 normalized counts,FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos,,For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O’Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit,,tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf embryos aBTX injected at single cell stage,GSM8863185,GSM8863185: sorted mCherry+ tenocytes from aBTX injected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 1; Danio rerio; RNA Seq,GSM8863185 r1,GSM8863185,1,For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O'Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 550,,SRP572436,,,nR284-L2-G5-P44-CCGTGAAG-ATCCACTG-READ1-Sequences.txt nR284-L2-G5-P44-CCGTGAAG-ATCCACTG-READ2-Sequences.txt,fastq fastq,8772356010.0,43427505.0,GSM8863185 r1,0:101 1:101,A:1656754122;C:2760877460;G:2711917989;T:1642763644;N:42795,101,101,,,1656754122,2760877460,2711917989,1642763644,42795,SRX28102227,SRS24458274,SRA2098459,UC Irvine,UC Irvine,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,full_length,cdna_unspecified,smarter,bulk,bulk,bulk,,United States,2025-03-23,Hatching,Embryo,Embryo Imprecise,All anatomical structures
35911,SRR33227833,SRX28474909,SRS24794875,SRP580008,PRJNA1253320,Prpf4 Sequentially Regulates the Expansion and Maturation of Erythrocyte through Distinct Mechanisms,PRJNA1253320,Other,The proliferation of early erythrocyte and the subsequent erythrocyte maturation are critical events during erythropoiesis how these two independent but interconnected processes are efficiently orchestrated during erythropoiesis was largely unknown. Prpf4 expression is enriched from Pre Colony Forming Unit Erythroid PreCFU E to Nucleated Erythrocytes especially in the CFU E cells implying Prpf4 plays a critical role in erythropoiesis. Here we demonstrate that prpf4 sequentially regulates erythrocyte proliferation and maturation during zebrafish definitive hematopoiesis. The data show that prpf4 mutation results in severe defects in erythropoiesis characterized by a substantial reduction in erythroid cell numbers and impaired erythrocyte maturation. Further analysis indicates that prpf4 mutation leads to cell cycle arrest of erythrocytes at the S and G2/M phases as well as a significant increase in erythrocyte apoptosis. Mechanistically prpf4 mutation leads to DNA damage and the subsequent activation of DNA damage response triggering the ATM/CHK2 p53 signaling pathway. This process inhibits the proliferation of early erythrocyte and induces erythrocyte apoptosis. On the other hand the data reveal that prpf4 mutation causes significant defect in skipped exon during pre mRNA splicing accompanying severe splicing defect in slc25a39 pre mRNA. This results in a significant downregulation of slc25a39 mRNA ultimately impairing erythrocyte maturation in late erythropoiesis. In conclusion we identify that prpf4 sequentially regulates early erythrocyte proliferation and the sequential erythrocyte maturation the dual function of prpf4 partially explaining how early erythrocyte proliferation and late erythrocyte maturation are efficiently coordinated during erythropoiesis.,,,,RNA seq of WT zebrafish at 48 hpf,Prpf4 WT rep3,,strain:AB|isolate:embryo pool 6|breed:wild type|ecotype:laboratory strain|age:48 hpf|dev stage:embryo|collection date:2023 11|geo loc name:China: Sichuan Chengdu|sex:not applicable|tissue:erythrocytes|BioSampleModel:Model organism or animal,,,,,,,,,RNA seq of wild type zebrafish at 48 hpf,lib Prpf4 WT rep3,lib Prpf4 WT rep3,Same as above,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq X Plus,,SRP580008,,,Prpf4_WT_rep3_R1_001.fastq.gz Prpf4_WT_rep3_R2_001.fastq.gz,fastq fastq,4980597900.0,16601993.0,Prpf4 WT rep3 R1 001.fastq.gz,0:150 1:150,A:1226282648;C:1235583412;G:1239317687;T:1279049146;N:365007,150,150,,,1226282648,1235583412,1239317687,1279049146,365007,SRX28474909,SRS24794875,SRA2115340,Chengdu medical college|School of Basic Medical Sciences,Chengdu medical college,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,China,2025-04-20,Hatching,Embryo,Embryo Imprecise,All anatomical structures
35912,SRR33227834,SRX28474908,SRS24794874,SRP580008,PRJNA1253320,Prpf4 Sequentially Regulates the Expansion and Maturation of Erythrocyte through Distinct Mechanisms,PRJNA1253320,Other,The proliferation of early erythrocyte and the subsequent erythrocyte maturation are critical events during erythropoiesis how these two independent but interconnected processes are efficiently orchestrated during erythropoiesis was largely unknown. Prpf4 expression is enriched from Pre Colony Forming Unit Erythroid PreCFU E to Nucleated Erythrocytes especially in the CFU E cells implying Prpf4 plays a critical role in erythropoiesis. Here we demonstrate that prpf4 sequentially regulates erythrocyte proliferation and maturation during zebrafish definitive hematopoiesis. The data show that prpf4 mutation results in severe defects in erythropoiesis characterized by a substantial reduction in erythroid cell numbers and impaired erythrocyte maturation. Further analysis indicates that prpf4 mutation leads to cell cycle arrest of erythrocytes at the S and G2/M phases as well as a significant increase in erythrocyte apoptosis. Mechanistically prpf4 mutation leads to DNA damage and the subsequent activation of DNA damage response triggering the ATM/CHK2 p53 signaling pathway. This process inhibits the proliferation of early erythrocyte and induces erythrocyte apoptosis. On the other hand the data reveal that prpf4 mutation causes significant defect in skipped exon during pre mRNA splicing accompanying severe splicing defect in slc25a39 pre mRNA. This results in a significant downregulation of slc25a39 mRNA ultimately impairing erythrocyte maturation in late erythropoiesis. In conclusion we identify that prpf4 sequentially regulates early erythrocyte proliferation and the sequential erythrocyte maturation the dual function of prpf4 partially explaining how early erythrocyte proliferation and late erythrocyte maturation are efficiently coordinated during erythropoiesis.,,,,RNA seq of WT zebrafish at 48 hpf,Prpf4 WT rep2,,strain:AB|isolate:embryo pool 5|breed:wild type|ecotype:laboratory strain|age:48 hpf|dev stage:embryo|collection date:2023 11|geo loc name:China: Sichuan Chengdu|sex:not applicable|tissue:erythrocytes|BioSampleModel:Model organism or animal,,,,,,,,,RNA seq of wild type zebrafish at 48 hpf,lib Prpf4 WT rep2,lib Prpf4 WT rep2,Same as above,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq X Plus,,SRP580008,,,Prpf4_WT_rep2_R1_001.fastq.gz Prpf4_WT_rep2_R2_001.fastq.gz,fastq fastq,6071219400.0,20237398.0,Prpf4 WT rep2 R1 001.fastq.gz,0:150 1:150,A:1485039562;C:1529219051;G:1507447307;T:1549077264;N:436216,150,150,,,1485039562,1529219051,1507447307,1549077264,436216,SRX28474908,SRS24794874,SRA2115340,Chengdu medical college|School of Basic Medical Sciences,Chengdu medical college,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,China,2025-04-20,Hatching,Embryo,Embryo Imprecise,All anatomical structures
35913,SRR33227835,SRX28474907,SRS24794873,SRP580008,PRJNA1253320,Prpf4 Sequentially Regulates the Expansion and Maturation of Erythrocyte through Distinct Mechanisms,PRJNA1253320,Other,The proliferation of early erythrocyte and the subsequent erythrocyte maturation are critical events during erythropoiesis how these two independent but interconnected processes are efficiently orchestrated during erythropoiesis was largely unknown. Prpf4 expression is enriched from Pre Colony Forming Unit Erythroid PreCFU E to Nucleated Erythrocytes especially in the CFU E cells implying Prpf4 plays a critical role in erythropoiesis. Here we demonstrate that prpf4 sequentially regulates erythrocyte proliferation and maturation during zebrafish definitive hematopoiesis. The data show that prpf4 mutation results in severe defects in erythropoiesis characterized by a substantial reduction in erythroid cell numbers and impaired erythrocyte maturation. Further analysis indicates that prpf4 mutation leads to cell cycle arrest of erythrocytes at the S and G2/M phases as well as a significant increase in erythrocyte apoptosis. Mechanistically prpf4 mutation leads to DNA damage and the subsequent activation of DNA damage response triggering the ATM/CHK2 p53 signaling pathway. This process inhibits the proliferation of early erythrocyte and induces erythrocyte apoptosis. On the other hand the data reveal that prpf4 mutation causes significant defect in skipped exon during pre mRNA splicing accompanying severe splicing defect in slc25a39 pre mRNA. This results in a significant downregulation of slc25a39 mRNA ultimately impairing erythrocyte maturation in late erythropoiesis. In conclusion we identify that prpf4 sequentially regulates early erythrocyte proliferation and the sequential erythrocyte maturation the dual function of prpf4 partially explaining how early erythrocyte proliferation and late erythrocyte maturation are efficiently coordinated during erythropoiesis.,,,,RNA seq of WT zebrafish at 48 hpf,Prpf4 WT rep1,,strain:AB|isolate:embryo pool 4|breed:wild type|ecotype:laboratory strain|age:48 hpf|dev stage:embryo|collection date:2023 11|geo loc name:China: Sichuan Chengdu|sex:not applicable|tissue:erythrocytes|BioSampleModel:Model organism or animal,,,,,,,,,RNA seq of wild type zebrafish at 48 hpf,lib Prpf4 WT rep1,lib Prpf4 WT rep1,Sorted erythrocytes from Tggata1:DsRed zebrafish embryo at 48 hpf wild type,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq X Plus,,SRP580008,,,Prpf4_WT_rep1_R1_001.fastq.gz Prpf4_WT_rep1_R2_001.fastq.gz,fastq fastq,5321886300.0,17739621.0,Prpf4 WT rep1 R1 001.fastq.gz,0:150 1:150,A:1289113266;C:1320009641;G:1352169266;T:1360194839;N:399288,150,150,,,1289113266,1320009641,1352169266,1360194839,399288,SRX28474907,SRS24794873,SRA2115340,Chengdu medical college|School of Basic Medical Sciences,Chengdu medical college,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,China,2025-04-20,Hatching,Embryo,Embryo Imprecise,All anatomical structures
35914,SRR33227836,SRX28474906,SRS24794872,SRP580008,PRJNA1253320,Prpf4 Sequentially Regulates the Expansion and Maturation of Erythrocyte through Distinct Mechanisms,PRJNA1253320,Other,The proliferation of early erythrocyte and the subsequent erythrocyte maturation are critical events during erythropoiesis how these two independent but interconnected processes are efficiently orchestrated during erythropoiesis was largely unknown. Prpf4 expression is enriched from Pre Colony Forming Unit Erythroid PreCFU E to Nucleated Erythrocytes especially in the CFU E cells implying Prpf4 plays a critical role in erythropoiesis. Here we demonstrate that prpf4 sequentially regulates erythrocyte proliferation and maturation during zebrafish definitive hematopoiesis. The data show that prpf4 mutation results in severe defects in erythropoiesis characterized by a substantial reduction in erythroid cell numbers and impaired erythrocyte maturation. Further analysis indicates that prpf4 mutation leads to cell cycle arrest of erythrocytes at the S and G2/M phases as well as a significant increase in erythrocyte apoptosis. Mechanistically prpf4 mutation leads to DNA damage and the subsequent activation of DNA damage response triggering the ATM/CHK2 p53 signaling pathway. This process inhibits the proliferation of early erythrocyte and induces erythrocyte apoptosis. On the other hand the data reveal that prpf4 mutation causes significant defect in skipped exon during pre mRNA splicing accompanying severe splicing defect in slc25a39 pre mRNA. This results in a significant downregulation of slc25a39 mRNA ultimately impairing erythrocyte maturation in late erythropoiesis. In conclusion we identify that prpf4 sequentially regulates early erythrocyte proliferation and the sequential erythrocyte maturation the dual function of prpf4 partially explaining how early erythrocyte proliferation and late erythrocyte maturation are efficiently coordinated during erythropoiesis.,,,,RNA seq of prpf4 mutant zebrafish at 48 hpf,Prpf4 mut rep3,,strain:AB|isolate:embryo pool 3|breed:prpf4 mutant|ecotype:laboratory strain|age:48 hpf|dev stage:embryo|collection date:2023 11|geo loc name:China: Sichuan Chengdu|sex:not applicable|tissue:erythrocytes|BioSampleModel:Model organism or animal,,,,,,,,,RNA seq of prpf4 mutant zebrafish at 48 hpf,lib Prpf4 mut rep3,lib Prpf4 mut rep3,Same as above,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq X Plus,,SRP580008,,,Prpf4_mut_rep3_R1_001.fastq.gz Prpf4_mut_rep3_R2_001.fastq.gz,fastq fastq,7895645400.0,26318818.0,Prpf4 mut rep3 R1 001.fastq.gz,0:150 1:150,A:2018379504;C:1890119858;G:1874818429;T:2111750717;N:576892,150,150,,,2018379504,1890119858,1874818429,2111750717,576892,SRX28474906,SRS24794872,SRA2115340,Chengdu medical college|School of Basic Medical Sciences,Chengdu medical college,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,China,2025-04-20,Hatching,Embryo,Embryo Imprecise,All anatomical structures
35915,SRR33227837,SRX28474905,SRS24794871,SRP580008,PRJNA1253320,Prpf4 Sequentially Regulates the Expansion and Maturation of Erythrocyte through Distinct Mechanisms,PRJNA1253320,Other,The proliferation of early erythrocyte and the subsequent erythrocyte maturation are critical events during erythropoiesis how these two independent but interconnected processes are efficiently orchestrated during erythropoiesis was largely unknown. Prpf4 expression is enriched from Pre Colony Forming Unit Erythroid PreCFU E to Nucleated Erythrocytes especially in the CFU E cells implying Prpf4 plays a critical role in erythropoiesis. Here we demonstrate that prpf4 sequentially regulates erythrocyte proliferation and maturation during zebrafish definitive hematopoiesis. The data show that prpf4 mutation results in severe defects in erythropoiesis characterized by a substantial reduction in erythroid cell numbers and impaired erythrocyte maturation. Further analysis indicates that prpf4 mutation leads to cell cycle arrest of erythrocytes at the S and G2/M phases as well as a significant increase in erythrocyte apoptosis. Mechanistically prpf4 mutation leads to DNA damage and the subsequent activation of DNA damage response triggering the ATM/CHK2 p53 signaling pathway. This process inhibits the proliferation of early erythrocyte and induces erythrocyte apoptosis. On the other hand the data reveal that prpf4 mutation causes significant defect in skipped exon during pre mRNA splicing accompanying severe splicing defect in slc25a39 pre mRNA. This results in a significant downregulation of slc25a39 mRNA ultimately impairing erythrocyte maturation in late erythropoiesis. In conclusion we identify that prpf4 sequentially regulates early erythrocyte proliferation and the sequential erythrocyte maturation the dual function of prpf4 partially explaining how early erythrocyte proliferation and late erythrocyte maturation are efficiently coordinated during erythropoiesis.,,,,RNA seq of prpf4 mutant zebrafish at 48 hpf,Prpf4 mut rep2,,strain:AB|isolate:embryo pool 2|breed:prpf4 mutant|ecotype:laboratory strain|age:48 hpf|dev stage:embryo|collection date:2023 11|geo loc name:China: Sichuan Chengdu|sex:not applicable|tissue:erythrocytes|BioSampleModel:Model organism or animal,,,,,,,,,RNA seq of prpf4 mutant zebrafish at 48 hpf,lib Prpf4 mut rep2,lib Prpf4 mut rep2,Same as above,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq X Plus,,SRP580008,,,Prpf4_mut_rep2_R1_001.fastq.gz Prpf4_mut_rep2_R2_001.fastq.gz,fastq fastq,8530757700.0,28435859.0,Prpf4 mut rep2 R1 001.fastq.gz,0:150 1:150,A:2173003940;C:2024702047;G:2071325671;T:2261092825;N:633217,150,150,,,2173003940,2024702047,2071325671,2261092825,633217,SRX28474905,SRS24794871,SRA2115340,Chengdu medical college|School of Basic Medical Sciences,Chengdu medical college,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,China,2025-04-20,Hatching,Embryo,Embryo Imprecise,All anatomical structures
35916,SRR33227838,SRX28474904,SRS24794870,SRP580008,PRJNA1253320,Prpf4 Sequentially Regulates the Expansion and Maturation of Erythrocyte through Distinct Mechanisms,PRJNA1253320,Other,The proliferation of early erythrocyte and the subsequent erythrocyte maturation are critical events during erythropoiesis how these two independent but interconnected processes are efficiently orchestrated during erythropoiesis was largely unknown. Prpf4 expression is enriched from Pre Colony Forming Unit Erythroid PreCFU E to Nucleated Erythrocytes especially in the CFU E cells implying Prpf4 plays a critical role in erythropoiesis. Here we demonstrate that prpf4 sequentially regulates erythrocyte proliferation and maturation during zebrafish definitive hematopoiesis. The data show that prpf4 mutation results in severe defects in erythropoiesis characterized by a substantial reduction in erythroid cell numbers and impaired erythrocyte maturation. Further analysis indicates that prpf4 mutation leads to cell cycle arrest of erythrocytes at the S and G2/M phases as well as a significant increase in erythrocyte apoptosis. Mechanistically prpf4 mutation leads to DNA damage and the subsequent activation of DNA damage response triggering the ATM/CHK2 p53 signaling pathway. This process inhibits the proliferation of early erythrocyte and induces erythrocyte apoptosis. On the other hand the data reveal that prpf4 mutation causes significant defect in skipped exon during pre mRNA splicing accompanying severe splicing defect in slc25a39 pre mRNA. This results in a significant downregulation of slc25a39 mRNA ultimately impairing erythrocyte maturation in late erythropoiesis. In conclusion we identify that prpf4 sequentially regulates early erythrocyte proliferation and the sequential erythrocyte maturation the dual function of prpf4 partially explaining how early erythrocyte proliferation and late erythrocyte maturation are efficiently coordinated during erythropoiesis.,,,,RNA seq of prpf4 mutant zebrafish at 48 hpf,Prpf4 mut rep1,,strain:AB|isolate:embryo pool 1|breed:prpf4 mutant|ecotype:laboratory strain|age:48 hpf|dev stage:embryo|collection date:2023 11|geo loc name:China: Sichuan Chengdu|sex:not applicable|tissue:erythrocytes|BioSampleModel:Model organism or animal,,,,,,,,,RNA seq of prpf4 mutant zebrafish at 48 hpf,lib Prpf4 mut rep1,lib Prpf4 mut rep1,Sorted erythrocytes from Tggata1:DsRed zebrafish embryo at 48 hpf prpf4 mutant,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq X Plus,,SRP580008,,,Prpf4_mut_rep1_R1_001.fastq.gz Prpf4_mut_rep1_R2_001.fastq.gz,fastq fastq,4274603100.0,14248677.0,Prpf4 mut rep1 R1 001.fastq.gz,0:150 1:150,A:1071061320;C:1016341664;G:1078610744;T:1108274547;N:314825,150,150,,,1071061320,1016341664,1078610744,1108274547,314825,SRX28474904,SRS24794870,SRA2115340,Chengdu medical college|School of Basic Medical Sciences,Chengdu medical college,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,China,2025-04-20,Hatching,Embryo,Embryo Imprecise,All anatomical structures
36195,SRR042434,SRX020028,SRS066219,SRP002411,PRJNA126003,A novel miRNA processing pathway independent of Dicer requires Argonaute2 catalytic activity,GSE21503,Transcriptome Analysis,Here we identify a Dicer independent miRNA biogenesis pathway that employs the slicer catalytic activity of Argonaute2 Ago2. To uncover Dicer independent miRNAs we sequenced small RNAs in wild type maternal zygotic dicer MZdicer and MZago2 mutants using zebrafish as a model system. We find that in contrast to other miRNAs miR 451 levels were increased in MZdicer but drastically reduced in the MZago2 mutants. We show that pre miR 451 processing requires Ago2 catalytic activity in vivo. MZago2 mutant embryos display delayed erythrocyte maturation that can be rescued by wild type Ago2 or miR 451 duplex but not catalytically dead Ago2. We propose that Ago2 mediated cleavage of a subset of pre miRNAs followed by uridylation and trimming generates functional miRNAs in a Dicer independent manner. Overall design: Examination of small RNAs 18 to 35 nucleotides in 3 different zebrafish genotypes wild type MZago2 MZdicer at 48 hpf,,pubmed:20448148,,MZago2 mutant YΔ90,GSM540646,,tissue:48hpf embryo MZago2 mutant|strain:mixed AB TU TL TLF background|developmental stage:48hpf embryo|genotype:MZago2 Δ90/Δ90,MZago2 mutant YΔ90,Alignment: Sequence reads were mapped to Zebrafish Zv8/danRer6 precursor miRNA sequences using Bowtie software version 0.12.1 with maximal two mismatches within first 20 nucleotides. Alignments are available in the supplementary *out.txt file.,48hpf embryo MZago2 mutant,,Total RNA from frozen embryos was extracted with Trizol reagent and phenol/chloroform. Libraries were prepared according to Illumina's instructions Part # 1004239 Rev. A accompanying the small RNA Sample Kit. Briefly total RNA samples were run in a denaturing PAGE and the band corresponding to the RNAs of 18 35 nucletides was excised. RNA 5’ and 3’ adapters were ligated sequentially. Reverse transcription followed by PCR amplified cDNA constructs with both adapters. The purified DNA was captured on an Illumina flow cell for cluster generation. Libraries were sequenced on the Genome Analyzer following the manufacturer's protocols.,Embryos were collected from breeding tanks and kept at 28C in p60 plates with water and 0.2 mg/L methylene blue. At 48 hpf embryos were hand dechorionated and 40 embryos per sample were flash frozen in liquid nitrogen.,strain:mixed AB TU TL TLF background|developmental stage:48hpf embryo|genotype:MZago2 Δ90/Δ90,GSM540646,GSM540646: MZago2 mutant YΔ90,GSM540646: MZago2 mutant YΔ90,GSM540646: MZago2 mutant YΔ90,1,,GEO Accession:GSM540646,RNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina Genome Analyzer,0Application ReadForward1,SRP002411,,,Ago2_ydelta90.fastq,fastq,437752008.0,12159778.0,GSM540646 1,0:36,A:96750665;C:83495585;G:119239752;T:138073795;N:192211,36,,,,96750665,83495585,119239752,138073795,192211,SRX020028,SRS066219,SRA012683,GEO,"Giraldez Lab, Genetics, Yale University",1,0.03964,,0.0,,0.99985,,0.00052,,36,,B,,usable mapping rate,illumina,early_illumina,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2010-05-04,Hatching,Embryo,Embryo Imprecise,All anatomical structures
36196,SRR042433,SRX020027,SRS066218,SRP002411,PRJNA126003,A novel miRNA processing pathway independent of Dicer requires Argonaute2 catalytic activity,GSE21503,Transcriptome Analysis,Here we identify a Dicer independent miRNA biogenesis pathway that employs the slicer catalytic activity of Argonaute2 Ago2. To uncover Dicer independent miRNAs we sequenced small RNAs in wild type maternal zygotic dicer MZdicer and MZago2 mutants using zebrafish as a model system. We find that in contrast to other miRNAs miR 451 levels were increased in MZdicer but drastically reduced in the MZago2 mutants. We show that pre miR 451 processing requires Ago2 catalytic activity in vivo. MZago2 mutant embryos display delayed erythrocyte maturation that can be rescued by wild type Ago2 or miR 451 duplex but not catalytically dead Ago2. We propose that Ago2 mediated cleavage of a subset of pre miRNAs followed by uridylation and trimming generates functional miRNAs in a Dicer independent manner. Overall design: Examination of small RNAs 18 to 35 nucleotides in 3 different zebrafish genotypes wild type MZago2 MZdicer at 48 hpf,,pubmed:20448148,,WT2,GSM540645,,tissue:48hpf embryo WT|strain:mixed AB TU TL TLF background|developmental stage:48hpf embryo|genotype:wild type,WT2,Alignment: Sequence reads were mapped to Zebrafish Zv8/danRer6 precursor miRNA sequences using Bowtie software version 0.12.1 with maximal two mismatches within first 20 nucleotides. Alignments are available in the supplementary *out.txt file.,48hpf embryo WT,,Total RNA from frozen embryos was extracted with Trizol reagent and phenol/chloroform. Libraries were prepared according to Illumina's instructions Part # 1004239 Rev. A accompanying the small RNA Sample Kit. Briefly total RNA samples were run in a denaturing PAGE and the band corresponding to the RNAs of 18 35 nucletides was excised. RNA 5’ and 3’ adapters were ligated sequentially. Reverse transcription followed by PCR amplified cDNA constructs with both adapters. The purified DNA was captured on an Illumina flow cell for cluster generation. Libraries were sequenced on the Genome Analyzer following the manufacturer's protocols.,Embryos were collected from breeding tanks and kept at 28C in p60 plates with water and 0.2 mg/L methylene blue. At 48 hpf embryos were hand dechorionated and 40 embryos per sample were flash frozen in liquid nitrogen.,strain:mixed AB TU TL TLF background|developmental stage:48hpf embryo|genotype:wild type,GSM540645,GSM540645: WT2,GSM540645: WT2,GSM540645: WT2,1,,GEO Accession:GSM540645,RNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina Genome Analyzer,0Application ReadForward1,SRP002411,,,WT2.fastq,fastq,59530030.0,1700858.0,GSM540645 1,0:35,A:12981942;C:11521313;G:16378279;T:18609524;N:38972,35,,,,12981942,11521313,16378279,18609524,38972,SRX020027,SRS066218,SRA012683,GEO,"Giraldez Lab, Genetics, Yale University",1,0.06435,,0.0,,0.99995,,0.0,,35,,B,,usable mapping rate,illumina,early_illumina,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2010-05-04,Hatching,Embryo,Embryo Imprecise,All anatomical structures
36197,SRR042432,SRX020026,SRS066217,SRP002411,PRJNA126003,A novel miRNA processing pathway independent of Dicer requires Argonaute2 catalytic activity,GSE21503,Transcriptome Analysis,Here we identify a Dicer independent miRNA biogenesis pathway that employs the slicer catalytic activity of Argonaute2 Ago2. To uncover Dicer independent miRNAs we sequenced small RNAs in wild type maternal zygotic dicer MZdicer and MZago2 mutants using zebrafish as a model system. We find that in contrast to other miRNAs miR 451 levels were increased in MZdicer but drastically reduced in the MZago2 mutants. We show that pre miR 451 processing requires Ago2 catalytic activity in vivo. MZago2 mutant embryos display delayed erythrocyte maturation that can be rescued by wild type Ago2 or miR 451 duplex but not catalytically dead Ago2. We propose that Ago2 mediated cleavage of a subset of pre miRNAs followed by uridylation and trimming generates functional miRNAs in a Dicer independent manner. Overall design: Examination of small RNAs 18 to 35 nucleotides in 3 different zebrafish genotypes wild type MZago2 MZdicer at 48 hpf,,pubmed:20448148,,MZdicer mutant2 hu896,GSM540644,,tissue:48hpf embryo Mzdicer mutant|strain:mixed AB TU TL TLF background|developmental stage:48hpf embryo|genotype:MZdicer hu896/hu896,MZdicer mutant2 hu896,Alignment: Sequence reads were mapped to Zebrafish Zv8/danRer6 precursor miRNA sequences using Bowtie software version 0.12.1 with maximal two mismatches within first 20 nucleotides. Alignments are available in the supplementary *out.txt file.,48hpf embryo Mzdicer mutant,,Total RNA from frozen embryos was extracted with Trizol reagent and phenol/chloroform. Libraries were prepared according to Illumina's instructions Part # 1004239 Rev. A accompanying the small RNA Sample Kit. Briefly total RNA samples were run in a denaturing PAGE and the band corresponding to the RNAs of 18 35 nucletides was excised. RNA 5’ and 3’ adapters were ligated sequentially. Reverse transcription followed by PCR amplified cDNA constructs with both adapters. The purified DNA was captured on an Illumina flow cell for cluster generation. Libraries were sequenced on the Genome Analyzer following the manufacturer's protocols.,Embryos were collected from breeding tanks and kept at 28C in p60 plates with water and 0.2 mg/L methylene blue. At 48 hpf embryos were hand dechorionated and 40 embryos per sample were flash frozen in liquid nitrogen.,strain:mixed AB TU TL TLF background|developmental stage:48hpf embryo|genotype:MZdicer hu896/hu896,GSM540644,GSM540644: MZdicer mutant2 hu896,GSM540644: MZdicer mutant2 hu896,GSM540644: MZdicer mutant2 hu896,1,,GEO Accession:GSM540644,RNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina Genome Analyzer,0Application ReadForward1,SRP002411,,,MZdicer2_hu896.fastq,fastq,4268740.0,121964.0,GSM540644 1,0:35,A:813936;C:1034356;G:1131604;T:1280756;N:8088,35,,,,813936,1034356,1131604,1280756,8088,SRX020026,SRS066217,SRA012683,GEO,"Giraldez Lab, Genetics, Yale University",1,0.03836,,0.0009,,0.99849,,0.3021,,35,,B,,usable mapping rate,illumina,early_illumina,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2010-05-04,Hatching,Embryo,Embryo Imprecise,All anatomical structures