rowid,run.accession,experiment.accession,sample.accession,study.accession,bioproject,study.title,study.alias,study.type,study.abstract,study.attributes,study.PMIDs,sample.description,sample.title,sample.alias,sample.centername,sample.attributes,GEOsample.title,GEOsample.dataprocessing,GEOsample.source,GEOsample.treatmentprotocol,GEOsample.extractprotocol,GEOsample.growthprotocol,GEOsample.characteristics,GEOsample.accession,experiment.title,experiment.alias,experiment.library_name,experiment.design_description,experiment.library_construction_protocol,experiment.attributes,experiment.library_strategy,experiment.library_source,experiment.library_selection,experiment.library_layout,experiment.platform,experiment.instrument_model,experiment.spot_descriptor,experiment.study_ref,run.title,run.attributes,run.filename,run.semantic_name,run.total_bases,run.total_spots,run.alias,run.read_lengths,run.base_counts,run.r1_length,run.r2_length,run.r3_length,run.r4_length,run.Acount,run.Ccount,run.Gcount,run.Tcount,run.Ncount,run.experiment,run.pool_member,submission.accession,submission.srasource,submission.bioprojectsource,seqdetective.n_mates,seqdetective.mapping_rate.mate1,seqdetective.mapping_rate.mate2,seqdetective.nofeature_rate.mate1,seqdetective.nofeature_rate.mate2,seqdetective.sparsity.mate1,seqdetective.sparsity.mate2,seqdetective.pos_strand_rate.mate1,seqdetective.pos_strand_rate.mate2,seqdetective.readlen.mate1,seqdetective.readlen.mate2,seqdetective.judgement.mate1,seqdetective.judgement.mate2,seqdetective.judgement.reason,platform_family,instrument_generation,read_bias,selection_class,prep_kit,sc_or_bulk,tech_class,technology,tech_variant,submission.bioprojectsource.country,earliest_date,devstage_curation,devstage_curation_coarse,tissue_curation,tissue_curation_coarse 60,DRR032764,DRX029570,DRS049969,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 100 individuals,Dr shield 2,SAMD00028161,,sample name:Dr shield 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:shield|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028161,DRX029570,Dr shield 2,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028161,,,,3644397900.0,36443979.0,DRR032764,0:100 1:0,A:986071173;C:842367218;G:837686080;T:978236607;N:36822,100,0,,,986071173,842367218,837686080,978236607,36822,DRX029570,DRS049969,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.92419,,0.08269,,0.75558,,0.47863,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Gastrula,Embryo,Whole Organism,All anatomical structures 61,DRR032763,DRX029569,DRS049968,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 100 individuals,Dr shield 1,SAMD00028160,,sample name:Dr shield 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:shield|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028160,DRX029569,Dr shield 1,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028160,,,,3834622000.0,38346220.0,DRR032763,0:100 1:0,A:1043352851;C:880011834;G:876775415;T:1034444253;N:37647,100,0,,,1043352851,880011834,876775415,1034444253,37647,DRX029569,DRS049968,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.92305,,0.09126,,0.75481,,0.47587,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Gastrula,Embryo,Whole Organism,All anatomical structures 69,DRR032755,DRX029561,DRS049960,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 100 individuals,Dr 90epiboly 2,SAMD00028152,,sample name:Dr 90epiboly 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:90epiboly|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028152,DRX029561,Dr 90epiboly 2,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028152,,,,3572358600.0,35723586.0,DRR032755,0:100 1:0,A:971653450;C:821326559;G:816855636;T:962477457;N:45498,100,0,,,971653450,821326559,816855636,962477457,45498,DRX029561,DRS049960,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.92485,,0.10642,,0.74213,,0.47012,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Gastrula,Embryo,Whole Organism,All anatomical structures 70,DRR032754,DRX029560,DRS049959,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 100 individuals,Dr 90epiboly 1,SAMD00028151,,sample name:Dr 90epiboly 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:90epiboly|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028151,DRX029560,Dr 90epiboly 1,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028151,,,,3423980500.0,34239805.0,DRR032754,0:100 1:0,A:933088185;C:785251613;G:780911148;T:924686406;N:43148,100,0,,,933088185,785251613,780911148,924686406,43148,DRX029560,DRS049959,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.92436,,0.10881,,0.74255,,0.47068,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Gastrula,Embryo,Whole Organism,All anatomical structures 73,DRR032751,DRX029557,DRS049956,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 100 individuals,Dr 75epiboly 2,SAMD00028148,,sample name:Dr 75epiboly 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:75epiboly|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028148,DRX029557,Dr 75epiboly 2,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028148,,,,3252021500.0,32520215.0,DRR032751,0:100 1:0,A:885527595;C:746750899;G:742907892;T:876794123;N:40991,100,0,,,885527595,746750899,742907892,876794123,40991,DRX029557,DRS049956,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.92594,,0.10181,,0.74862,,0.47789,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Gastrula,Embryo,Whole Organism,All anatomical structures 74,DRR032750,DRX029556,DRS049955,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 100 individuals,Dr 75epiboly 1,SAMD00028147,,sample name:Dr 75epiboly 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:75epiboly|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028147,DRX029556,Dr 75epiboly 1,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028147,,,,3785053700.0,37850537.0,DRR032750,0:100 1:0,A:1029014798;C:870946157;G:867537069;T:1017508684;N:46992,100,0,,,1029014798,870946157,867537069,1017508684,46992,DRX029556,DRS049955,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.92346,,0.10046,,0.74921,,0.47295,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Gastrula,Embryo,Whole Organism,All anatomical structures 8088,ERR034127,ERX012653,ERS032268,ERP000635,PRJEB2512,The Zebrafish transcriptome during early development,KI-BN-JKE-DRERIO-RNASEQ-2011,Transcriptome Analysis,Background: Zebrafish Danio rerio is an important model for the study of early vertebrate development. The transition from fertilized egg to embryo is accompanied by a multitude of changes in gene expression and the transcriptional events that underlie these processes have not been fully characterized. In this study we use RNA Seq to characterize and compare the transcriptome of four early developmental stages in zebrafish on a global scale. Results: An average of 79M total reads were detected from the different stages. Out of the total number of reads 65% 73% reads were successfully mapped to the zebrafish genome and 36% 44% out of those were uniquely mapped. The total number of detected unique gene transcripts was 11187 of which 10096 of these were already present at 1 cell stage. The largest number of common transcripts was observed between 1 cell stage and 16 cell stage. An enrichment of gene transcripts with molecular functions of DNA binding protein folding and processing as well as metal ion binding was observed with progression of development. To confirm our RNA Seq results and to further investigate the developmental expression of specific genes the transcript levels of a subset of genes were analyzed using TaqMan® array micro fluidic card TLDA. Conclusion: Clustering analysis of the detected transcripts show a majority of gene transcripts being present at steady levels with a minority of the gene transcripts clustering as increasing or decreasing in expression during development. Developmental stages pre MBT were similar when comparing highly expressed genes whereas 50% epiboly stage differed from the earlier three stages in highly expressed genes number of uniquely expressed genes and enrichment of GO molecular functions.,,,RNA extracted from zebrafish embryo at 50% epiboly stage,zebrafish embryo 50 epiboly,SAMEA791629,"Department of Biosciences and Nutrition, Karolinska Institutet, Sweden",ENA first public:2011 06 09|ENA last update:2018 03 08|External Id:SAMEA791629|INSDC center alias:KI BN|INSDC center name:Department of Biosciences and Nutrition Karolinska Institutet Sweden|INSDC first public:2011 06 09T11:04:10Z|INSDC last update:2018 03 08T15:26:39Z|INSDC status:public|Submitter Id:KI BN JKE DRERIO RNASEQ 2011 50epiboly|common name:zebrafish|sample name:KI BN JKE DRERIO RNASEQ 2011 50epiboly|sex:mixed|strain:Tuebingen,,,,,,,,,Transcriptome profiling of early zebrafish development,KI BN JKE DRERIO RNASEQ 2011 50epiboly,JKE Drerio rna seq,Transcriptome profiling of 50% epiboly stages of zebrafish embryos.,Total RNA was extracted from approximately 150 embryos per developmental stage using Trireagent Sigma Aldrich. The total RNA was then processed further according to the Small RNA Expression Kit Applied Biosystems.,,RNA-Seq,TRANSCRIPTOMIC,RANDOM,SINGLE,ABI_SOLID,AB SOLiD System 3.0,500Application ReadForward1,ERP000635,AB SOLiD System 3.0 sequencing; Transcriptome profiling of early zebrafish development,ENA FIRST PUBLIC:2011 06 09|ENA LAST UPDATE:2018 11 16,KI-BN-JKE-DRERIO-RNASEQ-2011-50epiboly.csfasta.gz KI-BN-JKE-DRERIO-RNASEQ-2011-50epiboly_QV.qual.gz,SOLiD_native SOLiD_native,3929903550.0,78598071.0,KI BN JKE DRERIO RNASEQ 2011 50epiboly,0:50,,50,,,,,,,,,ERX012653,ERS032268,ERA029959,KI-BN|Department of Biosciences and Nutrition,"Department of Biosciences and Nutrition, Karolinska Institutet, Sweden",1,0.60757,,0.09893,,0.94899,,0.77821,,50,,B,,usable mapping rate,legacy,early,unknown,random_priming,unknown,bulk,unknown,unknown,,Sweden,2011-06-09,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 9717,ERR3842002,ERX3854564,ERS4268611,ERP116106,PRJEB33323,Deconstructing the individual steps of vertebrate translation initiation,ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422,Other,In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate.,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03,,,Shield 4Ei,SAMEA6504165,Computational Biology Unit,ENA FIRST PUBLIC:2020 03 27T17:05:06Z|ENA LAST UPDATE:2020 01 27T16:04:35Z|External Id:SAMEA6504165|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:05:06Z|INSDC last update:2020 01 27T16:04:35Z|INSDC status:public|Submitter Id:Shield 4Ei|common name:zebrafish|sample name:Shield 4Ei|scientific name:Danio rerio,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT Computational Biology Unit 27 01 2020 17:26:02:557 2,Shield 4Ei LSU,OTHER,RCP seq,,OTHER,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 500,,ERP116106,NextSeq 500 sequencing,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2020 02 14,,,10915827408.0,143629308.0,ena RUN Computational Biology Unit 27 01 2020 17:26:02:557 2,0:76,A:3900515347;C:2409375725;G:3041696977;T:1564127293;N:112066,76,,,,3900515347,2409375725,3041696977,1564127293,112066,ERX3854564,ERS4268611,ERA2359340,Computational Biology Unit|European Nucleotide Archive,Computational Biology Unit,1,0.64398,,0.40944,,0.98817,,0.59337,,76,,B,,usable mapping rate,illumina,nextseq,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2019-07-03,Gastrula,Embryo,Undetermined,Embryo Imprecise 9718,ERR3842001,ERX3854563,ERS4268611,ERP116106,PRJEB33323,Deconstructing the individual steps of vertebrate translation initiation,ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422,Other,In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate.,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03,,,Shield 4Ei,SAMEA6504165,Computational Biology Unit,ENA FIRST PUBLIC:2020 03 27T17:05:06Z|ENA LAST UPDATE:2020 01 27T16:04:35Z|External Id:SAMEA6504165|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:05:06Z|INSDC last update:2020 01 27T16:04:35Z|INSDC status:public|Submitter Id:Shield 4Ei|common name:zebrafish|sample name:Shield 4Ei|scientific name:Danio rerio,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT Computational Biology Unit 27 01 2020 17:26:02:557 1,Shield 4Ei SSU,OTHER,RCP seq,,OTHER,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 500,,ERP116106,NextSeq 500 sequencing,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2020 02 14,,,7154041880.0,94132130.0,ena RUN Computational Biology Unit 27 01 2020 17:26:02:557 1,0:76,A:2939474250;C:1489083073;G:1922522149;T:802890185;N:72223,76,,,,2939474250,1489083073,1922522149,802890185,72223,ERX3854563,ERS4268611,ERA2359340,Computational Biology Unit|European Nucleotide Archive,Computational Biology Unit,1,0.4369,,0.25417,,0.9867,,0.60047,,76,,B,,usable mapping rate,illumina,nextseq,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2019-07-03,Gastrula,Embryo,Undetermined,Embryo Imprecise 9719,ERR3842000,ERX3854562,ERS4268611,ERP116106,PRJEB33323,Deconstructing the individual steps of vertebrate translation initiation,ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422,Other,In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate.,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03,,,Shield 4Ei,SAMEA6504165,Computational Biology Unit,ENA FIRST PUBLIC:2020 03 27T17:05:06Z|ENA LAST UPDATE:2020 01 27T16:04:35Z|External Id:SAMEA6504165|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:05:06Z|INSDC last update:2020 01 27T16:04:35Z|INSDC status:public|Submitter Id:Shield 4Ei|common name:zebrafish|sample name:Shield 4Ei|scientific name:Danio rerio,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT Computational Biology Unit 27 01 2020 16:24:36:406 10,Shield 4Ei,OTHER,RNA Seq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 500,,ERP116106,NextSeq 500 sequencing,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2020 02 14,,,1435748376.0,18891426.0,ena RUN Computational Biology Unit 27 01 2020 16:24:36:406 10,0:76,A:489056518;C:372290023;G:393663734;T:180723629;N:14472,76,,,,489056518,372290023,393663734,180723629,14472,ERX3854562,ERS4268611,ERA2359305,Computational Biology Unit|European Nucleotide Archive,Computational Biology Unit,1,0.11942,,0.03394,,0.98971,,0.62271,,76,,B,,usable mapping rate,illumina,nextseq,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2019-07-03,Gastrula,Embryo,Undetermined,Embryo Imprecise 9720,ERR3841999,ERX3854561,ERS3556006,ERP116106,PRJEB33323,Deconstructing the individual steps of vertebrate translation initiation,ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422,Other,In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate.,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03,,,Shield 3,SAMEA5752547,Computational Biology Unit,ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752547|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:10|common name:zebrafish|dev stage:Shield|sample name:10|scientific name:Danio rerio,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT Computational Biology Unit 27 01 2020 16:24:36:406 9,Shield 3,OTHER,RNA Seq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 500,,ERP116106,NextSeq 500 sequencing,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2020 02 14,,,1168482976.0,15374776.0,ena RUN Computational Biology Unit 27 01 2020 16:24:36:406 9,0:76,A:516070340;C:238363428;G:268806793;T:145231087;N:11328,76,,,,516070340,238363428,268806793,145231087,11328,ERX3854561,ERS3556006,ERA2359305,Computational Biology Unit|European Nucleotide Archive,Computational Biology Unit,1,0.22586,,0.10275,,0.97281,,0.47683,,76,,B,,usable mapping rate,illumina,nextseq,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2019-07-03,Gastrula,Embryo,Undetermined,Embryo Imprecise 9721,ERR3841998,ERX3854560,ERS3556007,ERP116106,PRJEB33323,Deconstructing the individual steps of vertebrate translation initiation,ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422,Other,In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate.,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03,,,Shield 4150NT,SAMEA5752548,Computational Biology Unit,ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752548|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:11|common name:zebrafish|dev stage:Shield|sample name:11|scientific name:Danio rerio,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT Computational Biology Unit 27 01 2020 16:24:36:406 8,Shield 150NT,OTHER,RNA Seq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 500,,ERP116106,NextSeq 500 sequencing,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2020 02 14,,,1188343980.0,15636105.0,ena RUN Computational Biology Unit 27 01 2020 16:24:36:406 8,0:76,A:580658556;C:223116826;G:260847322;T:123709681;N:11595,76,,,,580658556,223116826,260847322,123709681,11595,ERX3854560,ERS3556007,ERA2359305,Computational Biology Unit|European Nucleotide Archive,Computational Biology Unit,1,0.27037,,0.13972,,0.97392,,0.39459,,76,,B,,usable mapping rate,illumina,nextseq,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2019-07-03,Gastrula,Embryo,Undetermined,Embryo Imprecise 9722,ERR3841997,ERX3854559,ERS3556004,ERP116106,PRJEB33323,Deconstructing the individual steps of vertebrate translation initiation,ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422,Other,In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate.,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03,,,Shield 1,SAMEA5752545,Computational Biology Unit,ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752545|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:8|common name:zebrafish|dev stage:Shield|sample name:8|scientific name:Danio rerio,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT Computational Biology Unit 27 01 2020 16:24:36:406 7,Shield 1,OTHER,RNA Seq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 500,,ERP116106,NextSeq 500 sequencing,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2020 02 14,,,1278891444.0,16827519.0,ena RUN Computational Biology Unit 27 01 2020 16:24:36:406 7,0:76,A:571738369;C:256385478;G:295145281;T:155610082;N:12234,76,,,,571738369,256385478,295145281,155610082,12234,ERX3854559,ERS3556004,ERA2359305,Computational Biology Unit|European Nucleotide Archive,Computational Biology Unit,1,0.23116,,0.11137,,0.97932,,0.45978,,76,,B,,usable mapping rate,illumina,nextseq,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2019-07-03,Gastrula,Embryo,Undetermined,Embryo Imprecise 9729,ERR3489881,ERX3511296,ERS3556004,ERP116106,PRJEB33323,Deconstructing the individual steps of vertebrate translation initiation,ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422,Other,In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate.,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03,,,Shield 1,SAMEA5752545,Computational Biology Unit,ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752545|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:8|common name:zebrafish|dev stage:Shield|sample name:8|scientific name:Danio rerio,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT Computational Biology Unit 22 08 2019 11:57:43:424 33,Shield 1 F20,None,RCP seq,,OTHER,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 500,,ERP116106,NextSeq 500 sequencing,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 08 22,,,975578636.0,12836561.0,ena RUN Computational Biology Unit 22 08 2019 11:57:43:424 33,0:76,A:398325549;C:237563934;G:230721299;T:108957698;N:10156,76,,,,398325549,237563934,230721299,108957698,10156,ERX3511296,ERS3556004,ERA2100634,Computational Biology Unit|European Nucleotide Archive,Computational Biology Unit,1,0.33102,,0.19766,,0.99918,,0.12812,,76,,B,,usable mapping rate,illumina,nextseq,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2019-07-03,Gastrula,Embryo,Undetermined,Embryo Imprecise 9730,ERR3489880,ERX3511295,ERS3556004,ERP116106,PRJEB33323,Deconstructing the individual steps of vertebrate translation initiation,ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422,Other,In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate.,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03,,,Shield 1,SAMEA5752545,Computational Biology Unit,ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752545|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:8|common name:zebrafish|dev stage:Shield|sample name:8|scientific name:Danio rerio,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT Computational Biology Unit 22 08 2019 11:57:43:424 32,Shield 1 F19,None,RCP seq,,OTHER,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 500,,ERP116106,NextSeq 500 sequencing,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 08 22,,,931166668.0,12252193.0,ena RUN Computational Biology Unit 22 08 2019 11:57:43:424 32,0:76,A:271081669;C:253947035;G:272354427;T:133774815;N:8722,76,,,,271081669,253947035,272354427,133774815,8722,ERX3511295,ERS3556004,ERA2100634,Computational Biology Unit|European Nucleotide Archive,Computational Biology Unit,1,0.15598,,0.10707,,0.99902,,0.47314,,76,,B,,usable mapping rate,illumina,nextseq,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2019-07-03,Gastrula,Embryo,Undetermined,Embryo Imprecise 9731,ERR3489879,ERX3511294,ERS3556004,ERP116106,PRJEB33323,Deconstructing the individual steps of vertebrate translation initiation,ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422,Other,In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate.,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03,,,Shield 1,SAMEA5752545,Computational Biology Unit,ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752545|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:8|common name:zebrafish|dev stage:Shield|sample name:8|scientific name:Danio rerio,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT Computational Biology Unit 22 08 2019 11:57:43:424 31,Shield 1 F18,None,RCP seq,,OTHER,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 500,,ERP116106,NextSeq 500 sequencing,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 08 22,,,1506513268.0,19822543.0,ena RUN Computational Biology Unit 22 08 2019 11:57:43:424 31,0:76,A:493273515;C:456544968;G:391677033;T:165002559;N:15193,76,,,,493273515,456544968,391677033,165002559,15193,ERX3511294,ERS3556004,ERA2100634,Computational Biology Unit|European Nucleotide Archive,Computational Biology Unit,1,0.01562,,0.0053,,0.99908,,0.8127,,76,,B,,usable mapping rate,illumina,nextseq,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2019-07-03,Gastrula,Embryo,Undetermined,Embryo Imprecise 9732,ERR3489878,ERX3511293,ERS3556004,ERP116106,PRJEB33323,Deconstructing the individual steps of vertebrate translation initiation,ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422,Other,In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate.,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03,,,Shield 1,SAMEA5752545,Computational Biology Unit,ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752545|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:8|common name:zebrafish|dev stage:Shield|sample name:8|scientific name:Danio rerio,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT Computational Biology Unit 22 08 2019 11:57:43:424 30,Shield 1 F17,None,RCP seq,,OTHER,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 500,,ERP116106,NextSeq 500 sequencing,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 08 22,,,1259456496.0,16571796.0,ena RUN Computational Biology Unit 22 08 2019 11:57:43:424 30,0:76,A:471473123;C:333726472;G:302016190;T:152228002;N:12709,76,,,,471473123,333726472,302016190,152228002,12709,ERX3511293,ERS3556004,ERA2100634,Computational Biology Unit|European Nucleotide Archive,Computational Biology Unit,1,0.18339,,0.12544,,0.99928,,0.22368,,76,,B,,usable mapping rate,illumina,nextseq,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2019-07-03,Gastrula,Embryo,Undetermined,Embryo Imprecise 9733,ERR3489877,ERX3511292,ERS3556004,ERP116106,PRJEB33323,Deconstructing the individual steps of vertebrate translation initiation,ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422,Other,In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate.,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03,,,Shield 1,SAMEA5752545,Computational Biology Unit,ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752545|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:8|common name:zebrafish|dev stage:Shield|sample name:8|scientific name:Danio rerio,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT Computational Biology Unit 22 08 2019 11:57:43:424 29,Shield 1 F16,None,RCP seq,,OTHER,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 500,,ERP116106,NextSeq 500 sequencing,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 08 22,,,1364615872.0,17955472.0,ena RUN Computational Biology Unit 22 08 2019 11:57:43:424 29,0:76,A:539462776;C:341141880;G:314571683;T:169426048;N:13485,76,,,,539462776,341141880,314571683,169426048,13485,ERX3511292,ERS3556004,ERA2100634,Computational Biology Unit|European Nucleotide Archive,Computational Biology Unit,1,0.11663,,0.07319,,0.99939,,0.25377,,76,,B,,usable mapping rate,illumina,nextseq,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2019-07-03,Gastrula,Embryo,Undetermined,Embryo Imprecise 9734,ERR3489876,ERX3511291,ERS3556004,ERP116106,PRJEB33323,Deconstructing the individual steps of vertebrate translation initiation,ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422,Other,In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate.,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03,,,Shield 1,SAMEA5752545,Computational Biology Unit,ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752545|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:8|common name:zebrafish|dev stage:Shield|sample name:8|scientific name:Danio rerio,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT Computational Biology Unit 22 08 2019 11:57:43:424 28,Shield 1 F15,None,RCP seq,,OTHER,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 500,,ERP116106,NextSeq 500 sequencing,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 08 22,,,952605888.0,12534288.0,ena RUN Computational Biology Unit 22 08 2019 11:57:43:424 28,0:76,A:414133320;C:219437277;G:207418049;T:111607418;N:9824,76,,,,414133320,219437277,207418049,111607418,9824,ERX3511291,ERS3556004,ERA2100634,Computational Biology Unit|European Nucleotide Archive,Computational Biology Unit,1,0.17603,,0.10972,,0.99935,,0.13311,,76,,B,,usable mapping rate,illumina,nextseq,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2019-07-03,Gastrula,Embryo,Undetermined,Embryo Imprecise 9735,ERR3489875,ERX3511290,ERS3556004,ERP116106,PRJEB33323,Deconstructing the individual steps of vertebrate translation initiation,ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422,Other,In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate.,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03,,,Shield 1,SAMEA5752545,Computational Biology Unit,ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752545|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:8|common name:zebrafish|dev stage:Shield|sample name:8|scientific name:Danio rerio,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT Computational Biology Unit 22 08 2019 11:57:43:424 27,Shield 1 F14,None,RCP seq,,OTHER,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 500,,ERP116106,NextSeq 500 sequencing,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 08 22,,,870952628.0,11459903.0,ena RUN Computational Biology Unit 22 08 2019 11:57:43:424 27,0:76,A:357710338;C:221475453;G:191231014;T:100526675;N:9148,76,,,,357710338,221475453,191231014,100526675,9148,ERX3511290,ERS3556004,ERA2100634,Computational Biology Unit|European Nucleotide Archive,Computational Biology Unit,1,0.1248,,0.06422,,0.99896,,0.34819,,76,,B,,usable mapping rate,illumina,nextseq,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2019-07-03,Gastrula,Embryo,Undetermined,Embryo Imprecise 9736,ERR3489874,ERX3511289,ERS3556004,ERP116106,PRJEB33323,Deconstructing the individual steps of vertebrate translation initiation,ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422,Other,In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate.,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03,,,Shield 1,SAMEA5752545,Computational Biology Unit,ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752545|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:8|common name:zebrafish|dev stage:Shield|sample name:8|scientific name:Danio rerio,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT Computational Biology Unit 22 08 2019 11:57:43:424 26,Shield 1 F13,None,RCP seq,,OTHER,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 500,,ERP116106,NextSeq 500 sequencing,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 08 22,,,981672620.0,12916745.0,ena RUN Computational Biology Unit 22 08 2019 11:57:43:424 26,0:76,A:434153198;C:223317075;G:198260771;T:125932145;N:9431,76,,,,434153198,223317075,198260771,125932145,9431,ERX3511289,ERS3556004,ERA2100634,Computational Biology Unit|European Nucleotide Archive,Computational Biology Unit,1,0.44603,,0.25602,,0.99874,,0.18074,,76,,B,,usable mapping rate,illumina,nextseq,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2019-07-03,Gastrula,Embryo,Undetermined,Embryo Imprecise 9737,ERR3489873,ERX3511288,ERS3556004,ERP116106,PRJEB33323,Deconstructing the individual steps of vertebrate translation initiation,ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422,Other,In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate.,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03,,,Shield 1,SAMEA5752545,Computational Biology Unit,ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752545|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:8|common name:zebrafish|dev stage:Shield|sample name:8|scientific name:Danio rerio,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT Computational Biology Unit 22 08 2019 11:57:43:424 25,Shield 1 F12,None,RCP seq,,OTHER,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 500,,ERP116106,NextSeq 500 sequencing,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 08 22,,,1304618128.0,17166028.0,ena RUN Computational Biology Unit 22 08 2019 11:57:43:424 25,0:76,A:651341516;C:270458496;G:243929520;T:138874830;N:13766,76,,,,651341516,270458496,243929520,138874830,13766,ERX3511288,ERS3556004,ERA2100634,Computational Biology Unit|European Nucleotide Archive,Computational Biology Unit,1,0.64293,,0.38159,,0.99886,,0.07313,,76,,B,,usable mapping rate,illumina,nextseq,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2019-07-03,Gastrula,Embryo,Undetermined,Embryo Imprecise 9738,ERR3489872,ERX3511287,ERS3556004,ERP116106,PRJEB33323,Deconstructing the individual steps of vertebrate translation initiation,ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422,Other,In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate.,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03,,,Shield 1,SAMEA5752545,Computational Biology Unit,ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752545|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:8|common name:zebrafish|dev stage:Shield|sample name:8|scientific name:Danio rerio,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT Computational Biology Unit 22 08 2019 11:57:43:424 24,Shield 1 F10,None,RCP seq,,OTHER,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 500,,ERP116106,NextSeq 500 sequencing,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 08 22,,,1336115948.0,17580473.0,ena RUN Computational Biology Unit 22 08 2019 11:57:43:424 24,0:76,A:608634206;C:295943144;G:286494431;T:145029697;N:14470,76,,,,608634206,295943144,286494431,145029697,14470,ERX3511287,ERS3556004,ERA2100634,Computational Biology Unit|European Nucleotide Archive,Computational Biology Unit,1,0.68758,,0.47517,,0.99898,,0.02301,,76,,B,,usable mapping rate,illumina,nextseq,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2019-07-03,Gastrula,Embryo,Undetermined,Embryo Imprecise 9739,ERR3489871,ERX3511286,ERS3556004,ERP116106,PRJEB33323,Deconstructing the individual steps of vertebrate translation initiation,ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422,Other,In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate.,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03,,,Shield 1,SAMEA5752545,Computational Biology Unit,ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752545|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:8|common name:zebrafish|dev stage:Shield|sample name:8|scientific name:Danio rerio,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT Computational Biology Unit 22 08 2019 11:57:43:424 23,Shield 1 F9,None,RCP seq,,OTHER,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 500,,ERP116106,NextSeq 500 sequencing,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 08 22,,,1434402492.0,18873717.0,ena RUN Computational Biology Unit 22 08 2019 11:57:43:424 23,0:76,A:658705664;C:297967081;G:295595736;T:182118632;N:15379,76,,,,658705664,297967081,295595736,182118632,15379,ERX3511286,ERS3556004,ERA2100634,Computational Biology Unit|European Nucleotide Archive,Computational Biology Unit,1,0.74246,,0.44235,,0.99701,,0.03112,,76,,B,,usable mapping rate,illumina,nextseq,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2019-07-03,Gastrula,Embryo,Undetermined,Embryo Imprecise 9740,ERR3489870,ERX3511285,ERS3556007,ERP116106,PRJEB33323,Deconstructing the individual steps of vertebrate translation initiation,ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422,Other,In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate.,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03,,,Shield 4150NT,SAMEA5752548,Computational Biology Unit,ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752548|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:11|common name:zebrafish|dev stage:Shield|sample name:11|scientific name:Danio rerio,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT Computational Biology Unit 22 08 2019 11:57:43:424 22,Shield 4150NT LSU,None,RCP seq,,OTHER,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 500,,ERP116106,NextSeq 500 sequencing,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 08 24,,,24063208094.0,159358994.0,ena RUN Computational Biology Unit 22 08 2019 11:57:43:424 22,0:151,A:7153064588;C:5242791119;G:8513736630;T:3152547276;N:1068481,151,,,,7153064588,5242791119,8513736630,3152547276,1068481,ERX3511285,ERS3556007,ERA2100634,Computational Biology Unit|European Nucleotide Archive,Computational Biology Unit,1,0.81267,,0.27138,,0.99868,,0.91938,,151,,B,,usable mapping rate,illumina,nextseq,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2019-07-03,Gastrula,Embryo,Undetermined,Embryo Imprecise 9741,ERR3489869,ERX3511284,ERS3556007,ERP116106,PRJEB33323,Deconstructing the individual steps of vertebrate translation initiation,ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422,Other,In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate.,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03,,,Shield 4150NT,SAMEA5752548,Computational Biology Unit,ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752548|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:11|common name:zebrafish|dev stage:Shield|sample name:11|scientific name:Danio rerio,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT Computational Biology Unit 22 08 2019 11:57:43:424 21,Shield 4150NT SSU,None,RCP seq,,OTHER,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 500,,ERP116106,NextSeq 500 sequencing,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 08 24,,,14987998619.0,99258269.0,ena RUN Computational Biology Unit 22 08 2019 11:57:43:424 21,0:151,A:4578051806;C:2616328922;G:5914185813;T:1878780090;N:651988,151,,,,4578051806,2616328922,5914185813,1878780090,651988,ERX3511284,ERS3556007,ERA2100634,Computational Biology Unit|European Nucleotide Archive,Computational Biology Unit,1,0.77096,,0.5278,,0.99833,,0.42635,,151,,B,,usable mapping rate,illumina,nextseq,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2019-07-03,Gastrula,Embryo,Undetermined,Embryo Imprecise 9746,ERR3489864,ERX3511279,ERS3556006,ERP116106,PRJEB33323,Deconstructing the individual steps of vertebrate translation initiation,ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422,Other,In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate.,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03,,,Shield 3,SAMEA5752547,Computational Biology Unit,ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752547|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:10|common name:zebrafish|dev stage:Shield|sample name:10|scientific name:Danio rerio,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT Computational Biology Unit 22 08 2019 11:57:43:424 16,Shield 3 LSU,None,RCP seq,,OTHER,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 500,,ERP116106,NextSeq 500 sequencing,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 08 22,,,11777220072.0,154963422.0,ena RUN Computational Biology Unit 22 08 2019 11:57:43:424 16,0:76,A:3368038444;C:3190496935;G:3529701152;T:1688766119;N:217422,76,,,,3368038444,3190496935,3529701152,1688766119,217422,ERX3511279,ERS3556006,ERA2100634,Computational Biology Unit|European Nucleotide Archive,Computational Biology Unit,1,0.70681,,0.18846,,0.99332,,0.71978,,76,,B,,usable mapping rate,illumina,nextseq,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2019-07-03,Gastrula,Embryo,Undetermined,Embryo Imprecise 9747,ERR3489863,ERX3511278,ERS3556006,ERP116106,PRJEB33323,Deconstructing the individual steps of vertebrate translation initiation,ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422,Other,In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate.,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03,,,Shield 3,SAMEA5752547,Computational Biology Unit,ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752547|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:10|common name:zebrafish|dev stage:Shield|sample name:10|scientific name:Danio rerio,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT Computational Biology Unit 22 08 2019 11:57:43:424 15,Shield 3 SSU,None,RCP seq,,OTHER,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 500,,ERP116106,NextSeq 500 sequencing,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 08 22,,,7920419952.0,104216052.0,ena RUN Computational Biology Unit 22 08 2019 11:57:43:424 15,0:76,A:2990167185;C:1767708808;G:2104830363;T:1057568560;N:145036,76,,,,2990167185,1767708808,2104830363,1057568560,145036,ERX3511278,ERS3556006,ERA2100634,Computational Biology Unit|European Nucleotide Archive,Computational Biology Unit,1,0.5052,,0.30841,,0.99129,,0.60948,,76,,B,,usable mapping rate,illumina,nextseq,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2019-07-03,Gastrula,Embryo,Undetermined,Embryo Imprecise 9748,ERR3489862,ERX3511277,ERS3556005,ERP116106,PRJEB33323,Deconstructing the individual steps of vertebrate translation initiation,ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422,Other,In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate.,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03,,,Shield 2,SAMEA5752546,Computational Biology Unit,ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752546|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:9|common name:zebrafish|dev stage:Shield|sample name:9|scientific name:Danio rerio,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT Computational Biology Unit 22 08 2019 11:57:43:424 14,Shield 2 LSU,None,RCP seq,,OTHER,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 500,,ERP116106,NextSeq 500 sequencing,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 08 22,,,9775297004.0,128622329.0,ena RUN Computational Biology Unit 22 08 2019 11:57:43:424 14,0:76,A:4750565405;C:2540992255;G:1698817649;T:784832634;N:89061,76,,,,4750565405,2540992255,1698817649,784832634,89061,ERX3511277,ERS3556005,ERA2100634,Computational Biology Unit|European Nucleotide Archive,Computational Biology Unit,1,0.74003,,0.5616,,0.99855,,0.03607,,76,,B,,usable mapping rate,illumina,nextseq,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2019-07-03,Gastrula,Embryo,Undetermined,Embryo Imprecise 9749,ERR3489861,ERX3511276,ERS3556005,ERP116106,PRJEB33323,Deconstructing the individual steps of vertebrate translation initiation,ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422,Other,In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate.,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03,,,Shield 2,SAMEA5752546,Computational Biology Unit,ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752546|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:9|common name:zebrafish|dev stage:Shield|sample name:9|scientific name:Danio rerio,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT Computational Biology Unit 22 08 2019 11:57:43:424 13,Shield 2 SSU,None,RCP seq,,OTHER,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 500,,ERP116106,NextSeq 500 sequencing,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 08 22,,,8210103300.0,108027675.0,ena RUN Computational Biology Unit 22 08 2019 11:57:43:424 13,0:76,A:3300825043;C:2576709678;G:1707115198;T:625376255;N:77126,76,,,,3300825043,2576709678,1707115198,625376255,77126,ERX3511276,ERS3556005,ERA2100634,Computational Biology Unit|European Nucleotide Archive,Computational Biology Unit,1,0.2787,,0.17583,,0.99752,,0.50171,,76,,B,,usable mapping rate,illumina,nextseq,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2019-07-03,Gastrula,Embryo,Undetermined,Embryo Imprecise 9750,ERR3489860,ERX3511275,ERS3556004,ERP116106,PRJEB33323,Deconstructing the individual steps of vertebrate translation initiation,ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422,Other,In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate.,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03,,,Shield 1,SAMEA5752545,Computational Biology Unit,ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752545|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:8|common name:zebrafish|dev stage:Shield|sample name:8|scientific name:Danio rerio,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT Computational Biology Unit 22 08 2019 11:57:43:424 12,Shield 1 LSU,None,RCP seq,,OTHER,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 500,,ERP116106,NextSeq 500 sequencing,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 08 22,,,2437679936.0,32074736.0,ena RUN Computational Biology Unit 22 08 2019 11:57:43:424 12,0:76,A:764355184;C:710492003;G:664031460;T:298777374;N:23915,76,,,,764355184,710492003,664031460,298777374,23915,ERX3511275,ERS3556004,ERA2100634,Computational Biology Unit|European Nucleotide Archive,Computational Biology Unit,1,0.0406,,0.02417,,0.99908,,0.61299,,76,,B,,usable mapping rate,illumina,nextseq,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2019-07-03,Gastrula,Embryo,Undetermined,Embryo Imprecise 9751,ERR3489859,ERX3511274,ERS3556004,ERP116106,PRJEB33323,Deconstructing the individual steps of vertebrate translation initiation,ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422,Other,In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate.,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03,,,Shield 1,SAMEA5752545,Computational Biology Unit,ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752545|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:8|common name:zebrafish|dev stage:Shield|sample name:8|scientific name:Danio rerio,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT Computational Biology Unit 22 08 2019 11:57:43:424 11,Shield 1 SSU,None,RCP seq,,OTHER,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 500,,ERP116106,NextSeq 500 sequencing,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 08 22,,,3157243376.0,41542676.0,ena RUN Computational Biology Unit 22 08 2019 11:57:43:424 11,0:76,A:1443205052;C:715251024;G:633421305;T:365333650;N:32345,76,,,,1443205052,715251024,633421305,365333650,32345,ERX3511274,ERS3556004,ERA2100634,Computational Biology Unit|European Nucleotide Archive,Computational Biology Unit,1,0.47643,,0.27944,,0.99896,,0.11464,,76,,B,,usable mapping rate,illumina,nextseq,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2019-07-03,Gastrula,Embryo,Undetermined,Embryo Imprecise 10060,ERR4795364,ERX4665135,ERS5281176,ERP124847,PRJEB41113,Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma,E-MTAB-9727,Transcriptome Analysis,The mesothelium forms epithelial membranes that line the bodies cavities and surround the internal organs. Mesothelia widely contribute to organ homeostasis and regeneration and their dysregulation can result in congenital anomalies of the viscera ventral wall defects and mesothelioma tumors. Nonetheless the embryonic ontogeny and developmental regulation of mesothelium formation has remained uncharted. Here we combine genetic lineage tracing in toto live imaging and single cell transcriptomics in zebrafish to track mesothelial progenitor origins from the lateral plate mesoderm LPM. Our single cell analysis uncovers a post gastrulation gene expression signature centered on hand2 that delineates distinct progenitor populations within the forming LPM. Combining gene expression analysis and imaging of transgenic reporter zebrafish embryos we chart the origin of mesothelial progenitors to the lateral most hand2 expressing LPM and confirm evolutionary conservation in mouse. Our time lapse imaging of transgenic hand2 reporter embryos captures zebrafish mesothelium formation documenting the coordinated cell movements that form pericardium and visceral and parietal peritoneum. We establish that the primordial germ cells migrate associated with the forming mesothelium as ventral migration boundary. Functionally hand2 mutants fail to close the ventral mesothelium due to perturbed migration of mesothelium progenitors. Analyzing mouse and human mesothelioma tumors hypothesized to emerge from transformed mesothelium we find de novo expression of LPM associated transcription factors and in particular of Hand2 indicating the re initiation of a developmental transcriptional program in mesothelioma. Taken together our work outlines a genetic and developmental signature of mesothelial origins centered around Hand2 contributing to our understanding of mesothelial pathologies and mesothelioma.,ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14,,Protocols: Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse transcription and second strand synthesis reagents were dispensed using the Nanodrop II GC biotech. post generation of cDNA from the original mRNA all cells from one plate were pooled and the pooled sample was amplified linearly with in vitro transcription. The amplified RNA was then reverse transcribed to cDNA using a random hexamer primers Hashimshony et al. 2016. To generate sequencing libraries RPI series index primers were used for library PCR.,Sample 4,E MTAB 9727:Sample 4,,isolate:not applicable|organism:Danio rerio|sex:mixed|age:10|developmental stage:tailbud stage|organism part:lateral plate mesoderm plate|genotype:drl:mCherry|ENA FIRST PUBLIC:2021 04 01|ENA LAST UPDATE:2021 09 01,,,,,,,,,NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma,E MTAB 9727:Sample 4 s,Sample 4 s,Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma,Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse transcription and second strand synthesis reagents were dispensed using the Nanodrop II GC biotech. post generation of cDNA from the original mRNA all cells from one plate were pooled and the pooled sample was amplified linearly with in vitro transcription. The amplified RNA was then reverse transcribed to cDNA using a random hexamer primers Hashimshony et al. 2016. To generate sequencing libraries RPI series index primers were used for library PCR.,Experimental Factor: replicate:lateral plate mesoderm plate 4,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,RANDOM,SINGLE,ILLUMINA,NextSeq 500,,ERP124847,NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma,ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14,SN4_AH2TW3BGX5_S1_R1_cat.fastq.gz,fastq,5410723202.0,71707309.0,E MTAB 9727:Sample 4,0:75.46 1:0,A:1330416803;C:531269504;G:734031980;T:2814959249;N:45666,75,0,,,1330416803,531269504,734031980,2814959249,45666,ERX4665135,ERS5281176,ERA3048543,University of Zurich|European Nucleotide Archive,University of Zurich|European Nucleotide Archive,1,0.33614,,0.21532,,0.99019,,0.41002,,76,,B,,usable mapping rate,illumina,nextseq,unknown,random_priming,trueseq,sc,single_cell_plate,celseq,,Switzerland,2021-04-01,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 10061,ERR4795365,ERX4665135,ERS5281176,ERP124847,PRJEB41113,Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma,E-MTAB-9727,Transcriptome Analysis,The mesothelium forms epithelial membranes that line the bodies cavities and surround the internal organs. Mesothelia widely contribute to organ homeostasis and regeneration and their dysregulation can result in congenital anomalies of the viscera ventral wall defects and mesothelioma tumors. Nonetheless the embryonic ontogeny and developmental regulation of mesothelium formation has remained uncharted. Here we combine genetic lineage tracing in toto live imaging and single cell transcriptomics in zebrafish to track mesothelial progenitor origins from the lateral plate mesoderm LPM. Our single cell analysis uncovers a post gastrulation gene expression signature centered on hand2 that delineates distinct progenitor populations within the forming LPM. Combining gene expression analysis and imaging of transgenic reporter zebrafish embryos we chart the origin of mesothelial progenitors to the lateral most hand2 expressing LPM and confirm evolutionary conservation in mouse. Our time lapse imaging of transgenic hand2 reporter embryos captures zebrafish mesothelium formation documenting the coordinated cell movements that form pericardium and visceral and parietal peritoneum. We establish that the primordial germ cells migrate associated with the forming mesothelium as ventral migration boundary. Functionally hand2 mutants fail to close the ventral mesothelium due to perturbed migration of mesothelium progenitors. Analyzing mouse and human mesothelioma tumors hypothesized to emerge from transformed mesothelium we find de novo expression of LPM associated transcription factors and in particular of Hand2 indicating the re initiation of a developmental transcriptional program in mesothelioma. Taken together our work outlines a genetic and developmental signature of mesothelial origins centered around Hand2 contributing to our understanding of mesothelial pathologies and mesothelioma.,ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14,,Protocols: Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse transcription and second strand synthesis reagents were dispensed using the Nanodrop II GC biotech. post generation of cDNA from the original mRNA all cells from one plate were pooled and the pooled sample was amplified linearly with in vitro transcription. The amplified RNA was then reverse transcribed to cDNA using a random hexamer primers Hashimshony et al. 2016. To generate sequencing libraries RPI series index primers were used for library PCR.,Sample 4,E MTAB 9727:Sample 4,,isolate:not applicable|organism:Danio rerio|sex:mixed|age:10|developmental stage:tailbud stage|organism part:lateral plate mesoderm plate|genotype:drl:mCherry|ENA FIRST PUBLIC:2021 04 01|ENA LAST UPDATE:2021 09 01,,,,,,,,,NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma,E MTAB 9727:Sample 4 s,Sample 4 s,Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma,Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse transcription and second strand synthesis reagents were dispensed using the Nanodrop II GC biotech. post generation of cDNA from the original mRNA all cells from one plate were pooled and the pooled sample was amplified linearly with in vitro transcription. The amplified RNA was then reverse transcribed to cDNA using a random hexamer primers Hashimshony et al. 2016. To generate sequencing libraries RPI series index primers were used for library PCR.,Experimental Factor: replicate:lateral plate mesoderm plate 4,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,RANDOM,SINGLE,ILLUMINA,NextSeq 500,,ERP124847,NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma,ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14,SN4_AH2TW3BGX5_S1_R2_cat.fastq.gz,fastq,5414184547.0,71707309.0,E MTAB 9727:Sample 4 1,0:0 1:75.50,A:1582938104;C:1052565419;G:1177180395;T:1600161662;N:1338967,0,75,,,1582938104,1052565419,1177180395,1600161662,1338967,ERX4665135,ERS5281176,ERA3048543,University of Zurich|European Nucleotide Archive,University of Zurich|European Nucleotide Archive,1,0.84976,,0.28521,,0.85038,,0.5124,,75,,B,,usable mapping rate,illumina,nextseq,unknown,random_priming,trueseq,sc,single_cell_plate,celseq,,Switzerland,2021-04-01,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 10062,ERR4795362,ERX4665134,ERS5281175,ERP124847,PRJEB41113,Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma,E-MTAB-9727,Transcriptome Analysis,The mesothelium forms epithelial membranes that line the bodies cavities and surround the internal organs. Mesothelia widely contribute to organ homeostasis and regeneration and their dysregulation can result in congenital anomalies of the viscera ventral wall defects and mesothelioma tumors. Nonetheless the embryonic ontogeny and developmental regulation of mesothelium formation has remained uncharted. Here we combine genetic lineage tracing in toto live imaging and single cell transcriptomics in zebrafish to track mesothelial progenitor origins from the lateral plate mesoderm LPM. Our single cell analysis uncovers a post gastrulation gene expression signature centered on hand2 that delineates distinct progenitor populations within the forming LPM. Combining gene expression analysis and imaging of transgenic reporter zebrafish embryos we chart the origin of mesothelial progenitors to the lateral most hand2 expressing LPM and confirm evolutionary conservation in mouse. Our time lapse imaging of transgenic hand2 reporter embryos captures zebrafish mesothelium formation documenting the coordinated cell movements that form pericardium and visceral and parietal peritoneum. We establish that the primordial germ cells migrate associated with the forming mesothelium as ventral migration boundary. Functionally hand2 mutants fail to close the ventral mesothelium due to perturbed migration of mesothelium progenitors. Analyzing mouse and human mesothelioma tumors hypothesized to emerge from transformed mesothelium we find de novo expression of LPM associated transcription factors and in particular of Hand2 indicating the re initiation of a developmental transcriptional program in mesothelioma. Taken together our work outlines a genetic and developmental signature of mesothelial origins centered around Hand2 contributing to our understanding of mesothelial pathologies and mesothelioma.,ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14,,Protocols: Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse transcription and second strand synthesis reagents were dispensed using the Nanodrop II GC biotech. post generation of cDNA from the original mRNA all cells from one plate were pooled and the pooled sample was amplified linearly with in vitro transcription. The amplified RNA was then reverse transcribed to cDNA using a random hexamer primers Hashimshony et al. 2016. To generate sequencing libraries RPI series index primers were used for library PCR.,Sample 3,E MTAB 9727:Sample 3,,isolate:not applicable|organism:Danio rerio|sex:mixed|age:10|developmental stage:tailbud stage|organism part:lateral plate mesoderm plate|genotype:drl:mCherry|ENA FIRST PUBLIC:2021 04 01|ENA LAST UPDATE:2021 09 01,,,,,,,,,NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma,E MTAB 9727:Sample 3 s,Sample 3 s,Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma,Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse transcription and second strand synthesis reagents were dispensed using the Nanodrop II GC biotech. post generation of cDNA from the original mRNA all cells from one plate were pooled and the pooled sample was amplified linearly with in vitro transcription. The amplified RNA was then reverse transcribed to cDNA using a random hexamer primers Hashimshony et al. 2016. To generate sequencing libraries RPI series index primers were used for library PCR.,Experimental Factor: replicate:lateral plate mesoderm plate 3,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,RANDOM,SINGLE,ILLUMINA,NextSeq 500,,ERP124847,NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma,ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14,SN3_AHY3WGBGX3_S7_R1_cat.fastq.gz,fastq,4823193891.0,63965519.0,E MTAB 9727:Sample 3,0:75.40 1:0,A:1323978162;C:446831209;G:581746343;T:2470114091;N:524086,75,0,,,1323978162,446831209,581746343,2470114091,524086,ERX4665134,ERS5281175,ERA3048543,University of Zurich|European Nucleotide Archive,University of Zurich|European Nucleotide Archive,1,0.36549,,0.19722,,0.95552,,0.4702,,76,,B,,usable mapping rate,illumina,nextseq,unknown,random_priming,trueseq,sc,single_cell_plate,celseq,,Switzerland,2021-04-01,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 10063,ERR4795363,ERX4665134,ERS5281175,ERP124847,PRJEB41113,Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma,E-MTAB-9727,Transcriptome Analysis,The mesothelium forms epithelial membranes that line the bodies cavities and surround the internal organs. Mesothelia widely contribute to organ homeostasis and regeneration and their dysregulation can result in congenital anomalies of the viscera ventral wall defects and mesothelioma tumors. Nonetheless the embryonic ontogeny and developmental regulation of mesothelium formation has remained uncharted. Here we combine genetic lineage tracing in toto live imaging and single cell transcriptomics in zebrafish to track mesothelial progenitor origins from the lateral plate mesoderm LPM. Our single cell analysis uncovers a post gastrulation gene expression signature centered on hand2 that delineates distinct progenitor populations within the forming LPM. Combining gene expression analysis and imaging of transgenic reporter zebrafish embryos we chart the origin of mesothelial progenitors to the lateral most hand2 expressing LPM and confirm evolutionary conservation in mouse. Our time lapse imaging of transgenic hand2 reporter embryos captures zebrafish mesothelium formation documenting the coordinated cell movements that form pericardium and visceral and parietal peritoneum. We establish that the primordial germ cells migrate associated with the forming mesothelium as ventral migration boundary. Functionally hand2 mutants fail to close the ventral mesothelium due to perturbed migration of mesothelium progenitors. Analyzing mouse and human mesothelioma tumors hypothesized to emerge from transformed mesothelium we find de novo expression of LPM associated transcription factors and in particular of Hand2 indicating the re initiation of a developmental transcriptional program in mesothelioma. Taken together our work outlines a genetic and developmental signature of mesothelial origins centered around Hand2 contributing to our understanding of mesothelial pathologies and mesothelioma.,ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14,,Protocols: Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse transcription and second strand synthesis reagents were dispensed using the Nanodrop II GC biotech. post generation of cDNA from the original mRNA all cells from one plate were pooled and the pooled sample was amplified linearly with in vitro transcription. The amplified RNA was then reverse transcribed to cDNA using a random hexamer primers Hashimshony et al. 2016. To generate sequencing libraries RPI series index primers were used for library PCR.,Sample 3,E MTAB 9727:Sample 3,,isolate:not applicable|organism:Danio rerio|sex:mixed|age:10|developmental stage:tailbud stage|organism part:lateral plate mesoderm plate|genotype:drl:mCherry|ENA FIRST PUBLIC:2021 04 01|ENA LAST UPDATE:2021 09 01,,,,,,,,,NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma,E MTAB 9727:Sample 3 s,Sample 3 s,Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma,Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse transcription and second strand synthesis reagents were dispensed using the Nanodrop II GC biotech. post generation of cDNA from the original mRNA all cells from one plate were pooled and the pooled sample was amplified linearly with in vitro transcription. The amplified RNA was then reverse transcribed to cDNA using a random hexamer primers Hashimshony et al. 2016. To generate sequencing libraries RPI series index primers were used for library PCR.,Experimental Factor: replicate:lateral plate mesoderm plate 3,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,RANDOM,SINGLE,ILLUMINA,NextSeq 500,,ERP124847,NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma,ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14,SN3_AHY3WGBGX3_S7_R2_cat.fastq.gz,fastq,4828889391.0,63965519.0,E MTAB 9727:Sample 3 1,0:0 1:75.49,A:1434099697;C:964508763;G:893584575;T:1534727600;N:1968756,0,75,,,1434099697,964508763,893584575,1534727600,1968756,ERX4665134,ERS5281175,ERA3048543,University of Zurich|European Nucleotide Archive,University of Zurich|European Nucleotide Archive,1,0.85811,,0.26231,,0.82731,,0.48618,,76,,B,,usable mapping rate,illumina,nextseq,unknown,random_priming,trueseq,sc,single_cell_plate,celseq,,Switzerland,2021-04-01,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 10064,ERR4795360,ERX4665133,ERS5281174,ERP124847,PRJEB41113,Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma,E-MTAB-9727,Transcriptome Analysis,The mesothelium forms epithelial membranes that line the bodies cavities and surround the internal organs. Mesothelia widely contribute to organ homeostasis and regeneration and their dysregulation can result in congenital anomalies of the viscera ventral wall defects and mesothelioma tumors. Nonetheless the embryonic ontogeny and developmental regulation of mesothelium formation has remained uncharted. Here we combine genetic lineage tracing in toto live imaging and single cell transcriptomics in zebrafish to track mesothelial progenitor origins from the lateral plate mesoderm LPM. Our single cell analysis uncovers a post gastrulation gene expression signature centered on hand2 that delineates distinct progenitor populations within the forming LPM. Combining gene expression analysis and imaging of transgenic reporter zebrafish embryos we chart the origin of mesothelial progenitors to the lateral most hand2 expressing LPM and confirm evolutionary conservation in mouse. Our time lapse imaging of transgenic hand2 reporter embryos captures zebrafish mesothelium formation documenting the coordinated cell movements that form pericardium and visceral and parietal peritoneum. We establish that the primordial germ cells migrate associated with the forming mesothelium as ventral migration boundary. Functionally hand2 mutants fail to close the ventral mesothelium due to perturbed migration of mesothelium progenitors. Analyzing mouse and human mesothelioma tumors hypothesized to emerge from transformed mesothelium we find de novo expression of LPM associated transcription factors and in particular of Hand2 indicating the re initiation of a developmental transcriptional program in mesothelioma. Taken together our work outlines a genetic and developmental signature of mesothelial origins centered around Hand2 contributing to our understanding of mesothelial pathologies and mesothelioma.,ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14,,Protocols: Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse transcription and second strand synthesis reagents were dispensed using the Nanodrop II GC biotech. post generation of cDNA from the original mRNA all cells from one plate were pooled and the pooled sample was amplified linearly with in vitro transcription. The amplified RNA was then reverse transcribed to cDNA using a random hexamer primers Hashimshony et al. 2016. To generate sequencing libraries RPI series index primers were used for library PCR.,Sample 2,E MTAB 9727:Sample 2,,isolate:not applicable|organism:Danio rerio|sex:mixed|age:10|developmental stage:tailbud stage|organism part:lateral plate mesoderm plate|genotype:drl:mCherry|ENA FIRST PUBLIC:2021 04 01|ENA LAST UPDATE:2021 09 01,,,,,,,,,NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma,E MTAB 9727:Sample 2 s,Sample 2 s,Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma,Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse transcription and second strand synthesis reagents were dispensed using the Nanodrop II GC biotech. post generation of cDNA from the original mRNA all cells from one plate were pooled and the pooled sample was amplified linearly with in vitro transcription. The amplified RNA was then reverse transcribed to cDNA using a random hexamer primers Hashimshony et al. 2016. To generate sequencing libraries RPI series index primers were used for library PCR.,Experimental Factor: replicate:lateral plate mesoderm plate 2,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,RANDOM,SINGLE,ILLUMINA,NextSeq 500,,ERP124847,NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma,ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14,SN2_AHY3WGBGX3_S6_R1_cat.fastq.gz,fastq,5598371393.0,74235388.0,E MTAB 9727:Sample 2,0:75.41 1:0,A:1526486973;C:558020193;G:717587491;T:2795646081;N:630655,75,0,,,1526486973,558020193,717587491,2795646081,630655,ERX4665133,ERS5281174,ERA3048543,University of Zurich|European Nucleotide Archive,University of Zurich|European Nucleotide Archive,1,0.28059,,0.19252,,0.96404,,0.4874,,75,,B,,usable mapping rate,illumina,nextseq,unknown,random_priming,trueseq,sc,single_cell_plate,celseq,,Switzerland,2021-04-01,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 10065,ERR4795361,ERX4665133,ERS5281174,ERP124847,PRJEB41113,Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma,E-MTAB-9727,Transcriptome Analysis,The mesothelium forms epithelial membranes that line the bodies cavities and surround the internal organs. Mesothelia widely contribute to organ homeostasis and regeneration and their dysregulation can result in congenital anomalies of the viscera ventral wall defects and mesothelioma tumors. Nonetheless the embryonic ontogeny and developmental regulation of mesothelium formation has remained uncharted. Here we combine genetic lineage tracing in toto live imaging and single cell transcriptomics in zebrafish to track mesothelial progenitor origins from the lateral plate mesoderm LPM. Our single cell analysis uncovers a post gastrulation gene expression signature centered on hand2 that delineates distinct progenitor populations within the forming LPM. Combining gene expression analysis and imaging of transgenic reporter zebrafish embryos we chart the origin of mesothelial progenitors to the lateral most hand2 expressing LPM and confirm evolutionary conservation in mouse. Our time lapse imaging of transgenic hand2 reporter embryos captures zebrafish mesothelium formation documenting the coordinated cell movements that form pericardium and visceral and parietal peritoneum. We establish that the primordial germ cells migrate associated with the forming mesothelium as ventral migration boundary. Functionally hand2 mutants fail to close the ventral mesothelium due to perturbed migration of mesothelium progenitors. Analyzing mouse and human mesothelioma tumors hypothesized to emerge from transformed mesothelium we find de novo expression of LPM associated transcription factors and in particular of Hand2 indicating the re initiation of a developmental transcriptional program in mesothelioma. Taken together our work outlines a genetic and developmental signature of mesothelial origins centered around Hand2 contributing to our understanding of mesothelial pathologies and mesothelioma.,ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14,,Protocols: Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse transcription and second strand synthesis reagents were dispensed using the Nanodrop II GC biotech. post generation of cDNA from the original mRNA all cells from one plate were pooled and the pooled sample was amplified linearly with in vitro transcription. The amplified RNA was then reverse transcribed to cDNA using a random hexamer primers Hashimshony et al. 2016. To generate sequencing libraries RPI series index primers were used for library PCR.,Sample 2,E MTAB 9727:Sample 2,,isolate:not applicable|organism:Danio rerio|sex:mixed|age:10|developmental stage:tailbud stage|organism part:lateral plate mesoderm plate|genotype:drl:mCherry|ENA FIRST PUBLIC:2021 04 01|ENA LAST UPDATE:2021 09 01,,,,,,,,,NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma,E MTAB 9727:Sample 2 s,Sample 2 s,Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma,Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse transcription and second strand synthesis reagents were dispensed using the Nanodrop II GC biotech. post generation of cDNA from the original mRNA all cells from one plate were pooled and the pooled sample was amplified linearly with in vitro transcription. The amplified RNA was then reverse transcribed to cDNA using a random hexamer primers Hashimshony et al. 2016. To generate sequencing libraries RPI series index primers were used for library PCR.,Experimental Factor: replicate:lateral plate mesoderm plate 2,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,RANDOM,SINGLE,ILLUMINA,NextSeq 500,,ERP124847,NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma,ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14,SN2_AHY3WGBGX3_S6_R2_cat.fastq.gz,fastq,5600151371.0,74235388.0,E MTAB 9727:Sample 2 1,0:0 1:75.44,A:1850568176;C:1035622971;G:1071138281;T:1640475883;N:2346060,0,75,,,1850568176,1035622971,1071138281,1640475883,2346060,ERX4665133,ERS5281174,ERA3048543,University of Zurich|European Nucleotide Archive,University of Zurich|European Nucleotide Archive,1,0.7679,,0.30371,,0.82651,,0.43401,,75,,B,,usable mapping rate,illumina,nextseq,unknown,random_priming,trueseq,sc,single_cell_plate,celseq,,Switzerland,2021-04-01,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 10066,ERR4795358,ERX4665132,ERS5281173,ERP124847,PRJEB41113,Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma,E-MTAB-9727,Transcriptome Analysis,The mesothelium forms epithelial membranes that line the bodies cavities and surround the internal organs. Mesothelia widely contribute to organ homeostasis and regeneration and their dysregulation can result in congenital anomalies of the viscera ventral wall defects and mesothelioma tumors. Nonetheless the embryonic ontogeny and developmental regulation of mesothelium formation has remained uncharted. Here we combine genetic lineage tracing in toto live imaging and single cell transcriptomics in zebrafish to track mesothelial progenitor origins from the lateral plate mesoderm LPM. Our single cell analysis uncovers a post gastrulation gene expression signature centered on hand2 that delineates distinct progenitor populations within the forming LPM. Combining gene expression analysis and imaging of transgenic reporter zebrafish embryos we chart the origin of mesothelial progenitors to the lateral most hand2 expressing LPM and confirm evolutionary conservation in mouse. Our time lapse imaging of transgenic hand2 reporter embryos captures zebrafish mesothelium formation documenting the coordinated cell movements that form pericardium and visceral and parietal peritoneum. We establish that the primordial germ cells migrate associated with the forming mesothelium as ventral migration boundary. Functionally hand2 mutants fail to close the ventral mesothelium due to perturbed migration of mesothelium progenitors. Analyzing mouse and human mesothelioma tumors hypothesized to emerge from transformed mesothelium we find de novo expression of LPM associated transcription factors and in particular of Hand2 indicating the re initiation of a developmental transcriptional program in mesothelioma. Taken together our work outlines a genetic and developmental signature of mesothelial origins centered around Hand2 contributing to our understanding of mesothelial pathologies and mesothelioma.,ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14,,Protocols: Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse transcription and second strand synthesis reagents were dispensed using the Nanodrop II GC biotech. post generation of cDNA from the original mRNA all cells from one plate were pooled and the pooled sample was amplified linearly with in vitro transcription. The amplified RNA was then reverse transcribed to cDNA using a random hexamer primers Hashimshony et al. 2016. To generate sequencing libraries RPI series index primers were used for library PCR.,Sample 1,E MTAB 9727:Sample 1,,isolate:not applicable|organism:Danio rerio|sex:mixed|age:10|developmental stage:tailbud stage|organism part:lateral plate mesoderm plate|genotype:drl:mCherry|ENA FIRST PUBLIC:2021 04 01|ENA LAST UPDATE:2021 09 01,,,,,,,,,NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma,E MTAB 9727:Sample 1 s,Sample 1 s,Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma,Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse transcription and second strand synthesis reagents were dispensed using the Nanodrop II GC biotech. post generation of cDNA from the original mRNA all cells from one plate were pooled and the pooled sample was amplified linearly with in vitro transcription. The amplified RNA was then reverse transcribed to cDNA using a random hexamer primers Hashimshony et al. 2016. To generate sequencing libraries RPI series index primers were used for library PCR.,Experimental Factor: replicate:lateral plate mesoderm plate 1,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,RANDOM,SINGLE,ILLUMINA,NextSeq 500,,ERP124847,NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma,ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14,SN1_AHY3WGBGX3_S5_R1_cat.fastq.gz,fastq,4996502316.0,66258508.0,E MTAB 9727:Sample 1,0:75.41 1:0,A:1330744174;C:451622042;G:591151500;T:2622422664;N:561936,75,0,,,1330744174,451622042,591151500,2622422664,561936,ERX4665132,ERS5281173,ERA3048543,University of Zurich|European Nucleotide Archive,University of Zurich|European Nucleotide Archive,1,0.29754,,0.17671,,0.9669,,0.45463,,75,,B,,usable mapping rate,illumina,nextseq,unknown,random_priming,trueseq,sc,single_cell_plate,celseq,,Switzerland,2021-04-01,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 10067,ERR4795359,ERX4665132,ERS5281173,ERP124847,PRJEB41113,Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma,E-MTAB-9727,Transcriptome Analysis,The mesothelium forms epithelial membranes that line the bodies cavities and surround the internal organs. Mesothelia widely contribute to organ homeostasis and regeneration and their dysregulation can result in congenital anomalies of the viscera ventral wall defects and mesothelioma tumors. Nonetheless the embryonic ontogeny and developmental regulation of mesothelium formation has remained uncharted. Here we combine genetic lineage tracing in toto live imaging and single cell transcriptomics in zebrafish to track mesothelial progenitor origins from the lateral plate mesoderm LPM. Our single cell analysis uncovers a post gastrulation gene expression signature centered on hand2 that delineates distinct progenitor populations within the forming LPM. Combining gene expression analysis and imaging of transgenic reporter zebrafish embryos we chart the origin of mesothelial progenitors to the lateral most hand2 expressing LPM and confirm evolutionary conservation in mouse. Our time lapse imaging of transgenic hand2 reporter embryos captures zebrafish mesothelium formation documenting the coordinated cell movements that form pericardium and visceral and parietal peritoneum. We establish that the primordial germ cells migrate associated with the forming mesothelium as ventral migration boundary. Functionally hand2 mutants fail to close the ventral mesothelium due to perturbed migration of mesothelium progenitors. Analyzing mouse and human mesothelioma tumors hypothesized to emerge from transformed mesothelium we find de novo expression of LPM associated transcription factors and in particular of Hand2 indicating the re initiation of a developmental transcriptional program in mesothelioma. Taken together our work outlines a genetic and developmental signature of mesothelial origins centered around Hand2 contributing to our understanding of mesothelial pathologies and mesothelioma.,ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14,,Protocols: Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse transcription and second strand synthesis reagents were dispensed using the Nanodrop II GC biotech. post generation of cDNA from the original mRNA all cells from one plate were pooled and the pooled sample was amplified linearly with in vitro transcription. The amplified RNA was then reverse transcribed to cDNA using a random hexamer primers Hashimshony et al. 2016. To generate sequencing libraries RPI series index primers were used for library PCR.,Sample 1,E MTAB 9727:Sample 1,,isolate:not applicable|organism:Danio rerio|sex:mixed|age:10|developmental stage:tailbud stage|organism part:lateral plate mesoderm plate|genotype:drl:mCherry|ENA FIRST PUBLIC:2021 04 01|ENA LAST UPDATE:2021 09 01,,,,,,,,,NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma,E MTAB 9727:Sample 1 s,Sample 1 s,Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma,Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse transcription and second strand synthesis reagents were dispensed using the Nanodrop II GC biotech. post generation of cDNA from the original mRNA all cells from one plate were pooled and the pooled sample was amplified linearly with in vitro transcription. The amplified RNA was then reverse transcribed to cDNA using a random hexamer primers Hashimshony et al. 2016. To generate sequencing libraries RPI series index primers were used for library PCR.,Experimental Factor: replicate:lateral plate mesoderm plate 1,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,RANDOM,SINGLE,ILLUMINA,NextSeq 500,,ERP124847,NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma,ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14,SN1_AHY3WGBGX3_S5_R2_cat.fastq.gz,fastq,4999908389.0,66258508.0,E MTAB 9727:Sample 1 1,0:0 1:75.46,A:1591945117;C:933968124;G:986108614;T:1485824022;N:2062512,0,75,,,1591945117,933968124,986108614,1485824022,2062512,ERX4665132,ERS5281173,ERA3048543,University of Zurich|European Nucleotide Archive,University of Zurich|European Nucleotide Archive,1,0.81333,,0.2466,,0.83027,,0.51572,,75,,B,,usable mapping rate,illumina,nextseq,unknown,random_priming,trueseq,sc,single_cell_plate,celseq,,Switzerland,2021-04-01,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 24547,ERR964670,ERX1041633,ERS792104,ERP011038,PRJEB9889,The Zebrafish transcriptome during early development,ena-STUDY-KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION-15-07-2015-15:13:51:747-22,Other,Zebrafish has emerged as a model organism to investigate vertebrate development and human genetic diseases. However currently zebrafish annotation is still ongoing and clearly not sufficed therefore providing opportunity for novel transcript finding. With the introduction of massive parallel sequencing whole transcriptome investigations became possible through assembling entire transcriptome from overlapped sequencing reads. In the study we were aiming to discover novel transcribed regions NTRs using data from RNA sequencing. We have developed an in house bioinformatics pipeline for NTR discovery. Using the pipeline we detected 165 putative NTRs which could involve in early zebrafish development and not annotated anywhere. Six randomly selected NTRs were successfully validated experimentally using RT PCR. These NTRs provided new candidates for zebrafish transcriptome studies and zebrafish genome annotation.,,,,KI BN JKE DRERIO RNASEQ,SAMEA3484819,KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION,ENA first public:2015 07 16|ENA last update:2015 07 15|External Id:SAMEA3484819|INSDC center alias:KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION|INSDC center name:KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION|INSDC first public:2015 07 16T15:54:30Z|INSDC last update:2015 07 15T15:02:15Z|INSDC status:public|Submitter Id:KI BN JKE DRERIO RNASEQ 2009 50epiboly|common name:zebrafish|dev stage:50% epiboly|sample name:KI BN JKE DRERIO RNASEQ 2009 50epiboly|strain:Tuebingen,,,,,,,,,AB SOLiD System 3.0 sequencing,ena EXPERIMENT KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION 15 07 2015 15:13:47:871 4,unspecified,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ABI_SOLID,AB SOLiD System 3.0,,ERP011038,AB SOLiD System 3.0 sequencing,ENA FIRST PUBLIC:2015 07 16|ENA LAST UPDATE:2018 11 16,KI-BN-JKE-DRERIO-RNASEQ-20090709-50epiboly_F3.csfasta.gz KI-BN-JKE-DRERIO-RNASEQ-20090709-50epiboly_F3_QV.qual.gz,SOLiD_native SOLiD_native,5325942150.0,106518843.0,ena RUN KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION 15 07 2015 15:13:47:871 4,0:50,0:1376469323;1:1227617853;2:1499234750;3:1210700143;.:11920081,50,,,,,,,,,ERX1041633,ERS792104,ERA458495,KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION|European Nucleotide Archive,KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION,1,0.7059,,0.10511,,0.91492,,0.75125,,50,,B,,usable mapping rate,legacy,early,full_length,random_priming,unknown,bulk,unknown,unknown,,Sweden,2015-07-15,Gastrula,Embryo,Undetermined,Embryo Imprecise 24551,ERR964674,ERX1041637,ERS792104,ERP011038,PRJEB9889,The Zebrafish transcriptome during early development,ena-STUDY-KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION-15-07-2015-15:13:51:747-22,Other,Zebrafish has emerged as a model organism to investigate vertebrate development and human genetic diseases. However currently zebrafish annotation is still ongoing and clearly not sufficed therefore providing opportunity for novel transcript finding. With the introduction of massive parallel sequencing whole transcriptome investigations became possible through assembling entire transcriptome from overlapped sequencing reads. In the study we were aiming to discover novel transcribed regions NTRs using data from RNA sequencing. We have developed an in house bioinformatics pipeline for NTR discovery. Using the pipeline we detected 165 putative NTRs which could involve in early zebrafish development and not annotated anywhere. Six randomly selected NTRs were successfully validated experimentally using RT PCR. These NTRs provided new candidates for zebrafish transcriptome studies and zebrafish genome annotation.,,,,KI BN JKE DRERIO RNASEQ,SAMEA3484819,KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION,ENA first public:2015 07 16|ENA last update:2015 07 15|External Id:SAMEA3484819|INSDC center alias:KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION|INSDC center name:KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION|INSDC first public:2015 07 16T15:54:30Z|INSDC last update:2015 07 15T15:02:15Z|INSDC status:public|Submitter Id:KI BN JKE DRERIO RNASEQ 2009 50epiboly|common name:zebrafish|dev stage:50% epiboly|sample name:KI BN JKE DRERIO RNASEQ 2009 50epiboly|strain:Tuebingen,,,,,,,,,AB SOLiD System 3.0 sequencing,ena EXPERIMENT KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION 15 07 2015 15:13:47:873 8,unspecified,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ABI_SOLID,AB SOLiD System 3.0,,ERP011038,AB SOLiD System 3.0 sequencing,ENA FIRST PUBLIC:2015 07 16|ENA LAST UPDATE:2018 11 16,KI-BN-JKE-DRERIO-RNASEQ-20091014-50epiboly_F3.csfasta.gz KI-BN-JKE-DRERIO-RNASEQ-20091014-50epiboly_F3_QV.qual.gz,SOLiD_native SOLiD_native,2541596650.0,50831933.0,ena RUN KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION 15 07 2015 15:13:47:873 8,0:50,0:670988333;1:585266057;2:708634642;3:574052618;.:2655000,50,,,,,,,,,ERX1041637,ERS792104,ERA458495,KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION|European Nucleotide Archive,KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION,1,0.72135,,0.10529,,0.90997,,0.76049,,50,,B,,usable mapping rate,legacy,early,full_length,random_priming,unknown,bulk,unknown,unknown,,Sweden,2015-07-15,Gastrula,Embryo,Undetermined,Embryo Imprecise 25273,SRR25764091,SRX21486763,SRS18719063,SRP457108,PRJNA1009807,Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [RNA Seq],GSE241752,Transcriptome Analysis,Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.,parent bioproject:PRJNA1009800,pubmed:39402326,,WT bud 10 hpf RNA seq rep2,GSM7734768,,source name:Gastrula|strain:TLAB strain|tissue:Gastrula|developmental stage:Bud 10 hpf|genotype:WT|geo loc name:missing|collection date:missing,WT bud 10 hpf RNA seq rep2,3’ adapters were trimmed using Trim Galore v0.6.4 with default settings retaining reads of length ≥20. Reads were aligned to the GRCz11 zebrafish genome using STAR v2.6.1c with the following parameters: outSAMtype BAM SortedByCoordinate outFilterMultimapNmax 1 outFilterMismatchNmax 1 quantMode TranscriptomeSAM GeneCounts alignEndsType Local seedSearchStartLmax 14 alignIntronMax 10000 outFilterIntronMotifs RemoveNoncanonicalUnannotated. featureCounts v1.6.2 was used to count reads overlapping a filtered set of protein coding gene annotations from the GENCODE basic gene annotation. Differential gene expression analysis was performed using DESEq2 v1.38.1 with default settings and gene counts from featureCounts. Assembly: GRCz11 Supplementary files format and content: csv; transcripts per million TPM counts per transcript in MANE annotation,Gastrula,unperturbed growth conditions in E3 medium for zebrafish embryos.,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. 250 ng of the same total RNA used for mim tRNAseq library preparation were used for mRNA Seq library construction with the Zymo Seq RiboFree Total RNA Library Kit Zymo Research #R3000. Libraries were sequenced on a NextSeq 500 platform.,Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle.,strain:TLAB strain|tissue:Gastrula|developmental stage:Bud 10 hpf|genotype:WT,GSM7734768,GSM7734768: WT bud 10 hpf RNA seq rep2; Danio rerio; RNA Seq,GSM7734768 r1,GSM7734768,1,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. 250 ng of the same total RNA used for mim tRNAseq library preparation were used for mRNA Seq library construction with the Zymo Seq RiboFree Total RNA Library Kit Zymo Research #R3000. Libraries were sequenced on a NextSeq 500 platform.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP457108,,,WT_mRNA_bud_2.fastq.gz,fastq,2470912004.0,31168086.0,GSM7734768 r1,0:79.28,A:656817108;C:568241258;G:504262095;T:741507737;N:83806,79,,,,656817108,568241258,504262095,741507737,83806,SRX21486763,SRS18719063,SRA1700431,"Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry",Max Planck Institute of Biochemistry,1,0.91479,,0.27298,,0.74231,,0.57302,,79,,B,,usable mapping rate,illumina,nextseq,unknown,small_rna,unknown,bulk,bulk,bulk,,Germany,2023-08-28,Gastrula,Embryo,Whole Organism,All anatomical structures 25274,SRR25764092,SRX21486762,SRS18719064,SRP457108,PRJNA1009807,Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [RNA Seq],GSE241752,Transcriptome Analysis,Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.,parent bioproject:PRJNA1009800,pubmed:39402326,,WT bud 10 hpf RNA seq rep1,GSM7734767,,source name:Gastrula|strain:TLAB strain|tissue:Gastrula|developmental stage:Bud 10 hpf|genotype:WT|geo loc name:missing|collection date:missing,WT bud 10 hpf RNA seq rep1,3’ adapters were trimmed using Trim Galore v0.6.4 with default settings retaining reads of length ≥20. Reads were aligned to the GRCz11 zebrafish genome using STAR v2.6.1c with the following parameters: outSAMtype BAM SortedByCoordinate outFilterMultimapNmax 1 outFilterMismatchNmax 1 quantMode TranscriptomeSAM GeneCounts alignEndsType Local seedSearchStartLmax 14 alignIntronMax 10000 outFilterIntronMotifs RemoveNoncanonicalUnannotated. featureCounts v1.6.2 was used to count reads overlapping a filtered set of protein coding gene annotations from the GENCODE basic gene annotation. Differential gene expression analysis was performed using DESEq2 v1.38.1 with default settings and gene counts from featureCounts. Assembly: GRCz11 Supplementary files format and content: csv; transcripts per million TPM counts per transcript in MANE annotation,Gastrula,unperturbed growth conditions in E3 medium for zebrafish embryos.,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. 250 ng of the same total RNA used for mim tRNAseq library preparation were used for mRNA Seq library construction with the Zymo Seq RiboFree Total RNA Library Kit Zymo Research #R3000. Libraries were sequenced on a NextSeq 500 platform.,Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle.,strain:TLAB strain|tissue:Gastrula|developmental stage:Bud 10 hpf|genotype:WT,GSM7734767,GSM7734767: WT bud 10 hpf RNA seq rep1; Danio rerio; RNA Seq,GSM7734767 r1,GSM7734767,1,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. 250 ng of the same total RNA used for mim tRNAseq library preparation were used for mRNA Seq library construction with the Zymo Seq RiboFree Total RNA Library Kit Zymo Research #R3000. Libraries were sequenced on a NextSeq 500 platform.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP457108,,,WT_mRNA_bud_1.fastq.gz,fastq,2153494756.0,27140032.0,GSM7734767 r1,0:79.35,A:560793143;C:508962676;G:445126772;T:638539310;N:72855,79,,,,560793143,508962676,445126772,638539310,72855,SRX21486762,SRS18719064,SRA1700431,"Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry",Max Planck Institute of Biochemistry,1,0.88728,,0.25493,,0.74369,,0.56589,,80,,B,,usable mapping rate,illumina,nextseq,unknown,small_rna,unknown,bulk,bulk,bulk,,Germany,2023-08-28,Gastrula,Embryo,Whole Organism,All anatomical structures 25283,SRR25764121,SRX21486801,SRS18719093,SRP457111,PRJNA1009808,Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq],GSE241754,Transcriptome Analysis,Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.,parent bioproject:PRJNA1009800,pubmed:39402326,,WT bud 10 hpf tRNA seq rep2,GSM7734782,,source name:Gastrula|strain:TLAB strain|tissue:Gastrula|developmental stage:Bud 10 hpf|genotype:WT|geo loc name:missing|collection date:missing,WT bud 10 hpf tRNA seq rep2,Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts,Gastrula,unperturbed growth conditions in E3 medium for zebrafish embryos.,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle.,strain:TLAB strain|tissue:Gastrula|developmental stage:Bud 10 hpf|genotype:WT,GSM7734782,GSM7734782: WT bud 10 hpf tRNA seq rep2; Danio rerio; ncRNA Seq,GSM7734782 r1,GSM7734782,1,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP457111,,,WT_tRNA_bud_2.fastq.gz,fastq,278145656.0,4215107.0,GSM7734782 r1,0:65.99,A:52499947;C:77161357;G:79314034;T:69169753;N:565,65,,,,52499947,77161357,79314034,69169753,565,SRX21486801,SRS18719093,SRA1700461,"Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry",Max Planck Institute of Biochemistry,1,0.31888,,0.01661,,0.92348,,0.40156,,75,,B,,usable mapping rate,illumina,nextseq,5prime,size_fractionation,unknown,bulk,unknown,unknown,,Germany,2023-08-28,Gastrula,Embryo,Whole Organism,All anatomical structures 25284,SRR25764122,SRX21486800,SRS18719092,SRP457111,PRJNA1009808,Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq],GSE241754,Transcriptome Analysis,Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.,parent bioproject:PRJNA1009800,pubmed:39402326,,WT bud 10 hpf tRNA seq rep1,GSM7734781,,source name:Gastrula|strain:TLAB strain|tissue:Gastrula|developmental stage:Bud 10 hpf|genotype:WT|geo loc name:missing|collection date:missing,WT bud 10 hpf tRNA seq rep1,Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts,Gastrula,unperturbed growth conditions in E3 medium for zebrafish embryos.,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle.,strain:TLAB strain|tissue:Gastrula|developmental stage:Bud 10 hpf|genotype:WT,GSM7734781,GSM7734781: WT bud 10 hpf tRNA seq rep1; Danio rerio; ncRNA Seq,GSM7734781 r1,GSM7734781,1,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP457111,,,WT_tRNA_bud_1.fastq.gz,fastq,385514625.0,5770392.0,GSM7734781 r1,0:66.81,A:73305393;C:107155246;G:109793285;T:95259823;N:878,66,,,,73305393,107155246,109793285,95259823,878,SRX21486800,SRS18719092,SRA1700461,"Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry",Max Planck Institute of Biochemistry,1,0.33213,,0.01782,,0.92354,,0.42724,,39,,B,,usable mapping rate,illumina,nextseq,5prime,size_fractionation,unknown,bulk,unknown,unknown,,Germany,2023-08-28,Gastrula,Embryo,Whole Organism,All anatomical structures 25285,SRR25764123,SRX21486799,SRS18719098,SRP457111,PRJNA1009808,Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq],GSE241754,Transcriptome Analysis,Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.,parent bioproject:PRJNA1009800,pubmed:39402326,,WT shield 6 hpf tRNA seq rep2,GSM7734780,,source name:Gastrula|strain:TLAB strain|tissue:Gastrula|developmental stage:Shield 6 hpf|genotype:WT|geo loc name:missing|collection date:missing,WT shield 6 hpf tRNA seq rep2,Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts,Gastrula,unperturbed growth conditions in E3 medium for zebrafish embryos.,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle.,strain:TLAB strain|tissue:Gastrula|developmental stage:Shield 6 hpf|genotype:WT,GSM7734780,GSM7734780: WT shield 6 hpf tRNA seq rep2; Danio rerio; ncRNA Seq,GSM7734780 r1,GSM7734780,1,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP457111,,,WT_tRNA_shield_2.fastq.gz,fastq,469031736.0,7421688.0,GSM7734780 r1,0:63.20,A:90257219;C:130440728;G:130549302;T:117783411;N:1076,63,,,,90257219,130440728,130549302,117783411,1076,SRX21486799,SRS18719098,SRA1700461,"Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry",Max Planck Institute of Biochemistry,1,0.29535,,0.02113,,0.91528,,0.43824,,37,,B,,usable mapping rate,illumina,nextseq,5prime,size_fractionation,unknown,bulk,unknown,unknown,,Germany,2023-08-28,Gastrula,Embryo,Whole Organism,All anatomical structures 25286,SRR25764124,SRX21486798,SRS18719100,SRP457111,PRJNA1009808,Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq],GSE241754,Transcriptome Analysis,Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.,parent bioproject:PRJNA1009800,pubmed:39402326,,WT shield 6 hpf tRNA seq rep1,GSM7734779,,source name:Gastrula|strain:TLAB strain|tissue:Gastrula|developmental stage:Shield 6 hpf|genotype:WT|geo loc name:missing|collection date:missing,WT shield 6 hpf tRNA seq rep1,Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts,Gastrula,unperturbed growth conditions in E3 medium for zebrafish embryos.,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle.,strain:TLAB strain|tissue:Gastrula|developmental stage:Shield 6 hpf|genotype:WT,GSM7734779,GSM7734779: WT shield 6 hpf tRNA seq rep1; Danio rerio; ncRNA Seq,GSM7734779 r1,GSM7734779,1,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP457111,,,WT_tRNA_shield_1.fastq.gz,fastq,487207771.0,7521930.0,GSM7734779 r1,0:64.77,A:94654510;C:134893975;G:135716906;T:121941280;N:1100,64,,,,94654510,134893975,135716906,121941280,1100,SRX21486798,SRS18719100,SRA1700461,"Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry",Max Planck Institute of Biochemistry,1,0.30664,,0.02274,,0.91297,,0.46012,,79,,B,,usable mapping rate,illumina,nextseq,5prime,size_fractionation,unknown,bulk,unknown,unknown,,Germany,2023-08-28,Gastrula,Embryo,Whole Organism,All anatomical structures 25295,SRR25764045,SRX21486723,SRS18719024,SRP457105,PRJNA1009809,Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [Ribo Seq],GSE241753,Other,Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.,parent bioproject:PRJNA1009800,pubmed:39402326,,WT bud 10 hpf Ribo seq rep1,GSM7734770,,source name:Gastrula|strain:TLAB strain|tissue:Gastrula|developmental stage:Bud 10 hpf|treatment:100 µg/ml CHX 100 µg/ml TIG|geo loc name:missing|collection date:missing,WT bud 10 hpf Ribo seq rep1,We identified the A site location in each mapped read with Scikit ribo [Fang et al. 2018] which uses a random forest with recursive feature selection and a generalized linear model for accurate A site prediction based on matched ribosome profiling and RNA Seq datasets. Kallisto 0.44.0 with parameters b 100 single l 180 s 20 t 40 was used to quantify transcript abundances in Transcripts Per Million TPM from RNA Seq data based on the reference set of MANE annotated transcripts see Codon usage analysis for description of this annotation. To avoid memory errors due to the large size of the human genome and the presence of multiple transcript isoforms all RNAfold dependencies in Scikit ribo were omitted and the index was built separately for each chromosome. To make the hg38 GTF compatible with Scikit ribo transcript/UTR annotations were removed. For each transcript the start codon in the first exon and the stop codon in the last exon were adjusted to represent transcript start and end coordinates taking into account the gene strand. To estimate codon dwell times short 20 23 nt and long 28 33 nt ribosome footprints were analyzed separately. rRNA filtered reads were aligned to GRCz11.108 using STAR v2.6.1c [Dobin et al. 2013] the following options: outFilterMultimapNmax 1 seedSearchStartLmax 15 outSAMtype BAM SortedByCoordinate outFilterMismatchNmax 2 alignEndsType EndToEnd quantMode TranscriptomeSAM outSAMattributes NH HI AS nM NM MD We identified the A site location in each mapped read with Scikit ribo [Fang et al. 2018] which uses a random forest with recursive feature selection and a generalized linear model for accurate A site prediction based on matched ribosome profiling and RNA Seq datasets. Kallisto 0.44.0 with parameters b 100 single l 180 s 20 t 40 was used to quantify transcript abundances in Transcripts Per Million TPM from RNA Seq data based on the reference set of MANE annotated transcripts see Codon usage analysis for description of this annotation. To avoid memory errors due to the large size of the human genome and the presence of multiple transcript isoforms all RNAfold dependencies in Scikit ribo were omitted and the index was built separately for each chromosome. To make the GRCz11 GTF compatible with Scikit ribo transcript/UTR annotations were removed. For each transcript the start codon in the first exon and the stop codon in the last exon were adjusted to represent transcript start and end coordinates taking into account the gene strand. To estimate codon dwell times we utilised ribosome footprints with length 30 34 nt. Assembly: GRCz11 Supplementary files format and content: csv; codon dwell times from scikit ribo for all samples Supplementary files format and content: csv; transcript per million TPM counts per transcript in MANE annotation Library strategy: Ribo Seq,Gastrula,unperturbed growth conditions in E3 medium for zebrafish embryos.,200 whole embryos were flash frozen in liquid nitrogen and subsequently lysed in footprint lysis buffer containing 100 µg/ml CHX and 100 µg/ml TIG 0.1% NP 40 10 µg/ml aprotinin 20 µM leupeptin 2.5 µM pepstatin A 0.5 mM AEBSF and 1x Phosphatase Inhibitor Cocktail. Samples were vortexed vigorously triturated through a 26G gauge needle and spun down for 7 minutes at 16 000xg/ 4°C. Supernatant was transferred to a new tube. 20 µg RNA in 200 µl polysome lysis buffer were digested with 50 U RNase I for 45 minutes at 2 000 rpm/22°C. post incubation on ice for 5 minutes extracts were pre cleared by centrifugation for 5 minutes at 3 000 g/ 4°C. Ribosomes were pelleted through 3 ml of a sucrose cushion 1 M sucrose 20 mM Tris pH=8.0 140 mM KCl 5 mM MgCl2 1 mM DTT by spinning the layered solutions in the Type 70 Ti rotor for 120 minutes at 50 000 rpm/ 4°C. Ribosome pellets were rinsed once dissolved in 200 µl drug free polysome lysis buffer and incubated with 200 U hiPSC or 300 U NPC RNase I for 45 minutes at 2 000 rpm/22°C. Ribosome footprint libraries were prepared essentially as described McGlincy and Ingolia 2017; Wu 2019 with minor modifications. RNase I digestion was stopped by addition of 100 U Superase In and extracts were loaded on a sucrose cushion. The pellet was dissolved in 400 µl LiDS/LET lysis buffer and RNA was extracted with the acid phenol protocol. Fragments in the range of 19 to 32 nucleotides were isolated by gel size selection with T4 PNK and ligated to pre adenylated adapters containing 5 random nucleotides at their 5’ ends McGlinzy 2017 with T4 RNA Ligase 2 truncated KQ. Adapter ligated RNA was subjected to rRNA depletion using the Ribo Seq riboPOOL h/m/r depletion kit siTOOLs for CHX only samples and legacy RiboZero Gold kit Illumina for CHX+TIG samples The rRNA depleted footprints were reverse transcribed with Protoscript II and cDNA was circularized with recombinant TS2126 RNA ligase 1 commercially available as CircLigase. Libraries were constructed from circularized cDNA with KAPA HiFi DNA Polymerase and single end sequencing was performed on a NextSeq 500 platform Illumina.,Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle.,strain:TLAB strain|tissue:Gastrula|developmental stage:Bud 10 hpf|treatment:100 µg/ml CHX 100 µg/ml TIG,GSM7734770,GSM7734770: WT bud 10 hpf Ribo seq rep1; Danio rerio; OTHER,GSM7734770 r1,GSM7734770,1,200 whole embryos were flash frozen in liquid nitrogen and subsequently lysed in footprint lysis buffer containing 100 µg/ml CHX and 100 µg/ml TIG 0.1% NP 40 10 µg/ml aprotinin 20 µM leupeptin 2.5 µM pepstatin A 0.5 mM AEBSF and 1x Phosphatase Inhibitor Cocktail. Samples were vortexed vigorously triturated through a 26G gauge needle and spun down for 7 minutes at 16 000xg/ 4°C. Supernatant was transferred to a new tube. 20 µg RNA in 200 µl polysome lysis buffer were digested with 50 U RNase I for 45 minutes at 2 000 rpm/22°C. post incubation on ice for 5 minutes extracts were pre cleared by centrifugation for 5 minutes at 3 000 g/ 4°C. Ribosomes were pelleted through 3 ml of a sucrose cushion 1 M sucrose 20 mM Tris pH=8.0 140 mM KCl 5 mM MgCl2 1 mM DTT by spinning the layered solutions in the Type 70 Ti rotor for 120 minutes at 50 000 rpm/ 4°C. Ribosome pellets were rinsed once dissolved in 200 µl drug free polysome lysis buffer and incubated with 200 U hiPSC or 300 U NPC RNase I for 45 minutes at 2 000 rpm/22°C. Ribosome footprint libraries were prepared essentially as described McGlincy and Ingolia 2017; Wu 2019 with minor modifications. RNase I digestion was stopped by addition of 100 U Superase In and extracts were loaded on a sucrose cushion. The pellet was dissolved in 400 µl LiDS/LET lysis buffer and RNA was extracted with the acid phenol protocol. Fragments in the range of 19 to 32 nucleotides were isolated by gel size selection with T4 PNK and ligated to pre adenylated adapters containing 5 random nucleotides at their five prime ends McGlinzy 2017 with T4 RNA Ligase 2 truncated KQ. Adapter ligated RNA was subjected to rRNA depletion using the Ribo Seq riboPOOL h/m/r depletion kit siTOOLs for CHX only samples and legacy RiboZero Gold kit Illumina for CHX+TIG samples The rRNA depleted footprints were reverse transcribed with Protoscript II and cDNA was circularized with recombinant TS2126 RNA ligase 1 commercially available as CircLigase. Libraries were constructed from circularized cDNA with KAPA HiFi DNA Polymerase and single end sequencing was performed on a NextSeq 500 platform Illumina.,,OTHER,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 500,,SRP457105,,,WT_ribo_bud_1.fastq.gz,fastq,1476985703.0,55745002.0,GSM7734770 r1,0:26.50,A:266369385;C:466461341;G:473469631;T:270671671;N:13675,26,,,,266369385,466461341,473469631,270671671,13675,SRX21486723,SRS18719024,SRA1700409,"Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry",Max Planck Institute of Biochemistry,1,0.773,,0.14121,,0.82242,,0.78464,,30,,B,,usable mapping rate,illumina,nextseq,5prime,rrna_depletion,ribozero,bulk,unknown,unknown,,Germany,2023-08-28,Gastrula,Embryo,Whole Organism,All anatomical structures 28538,SRR26395012,SRX22100922,SRS19166048,SRP466518,PRJNA1028258,Zygotic activation of transposable elements during zebrafish early embryogenesis,PRJNA1028258,Other,Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age.,,pubmed:40246845,,,50% epiboly Iso seq,,strain:AB x India|age:5.3 hpf|dev stage:50% epiboly|collection date:2021 01|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:LR 10|BioSampleModel:Model organism or animal,,,,,,,,,PacBio Iso seq of zebrafish: 50% epiboly,DR 010,DR 010,Total RNA was isolated from each developmental stages of zebrafish embryos using TRIzolTM Reagent Invitrogen. RNA purity and concentration were assessed with the NanoPhotometer spectrophotometer IMPLEN CA USA and the Qubit RNA Assay Kit in the Qubit 3.0 Fluorometer Life Technologies CA USA. The RNA integrity number RIN was determined using the RNA Nano 6000 Assay Kit and Agilent Bioanalyzer 2100 system Agilent Technologies CA USA. RNA samples with a RIN 8 were used to synthesize cDNA with SMARTerPCR cDNA Synthesis Kit Takara Bio USA Inc. Mountain View CA USA. PCR amplification was performed using a KAPA HiFi PCR Kit Kapa Biosystems Wilmington MA USA with the optimized number of cycles. Size selection of PCR products cDNA for each sample was applied using the BluePippin System: <3 kb and >3 kb. Subsequently two cDNA libraries <3 kb >3 kb were prepared using a SMRTbell Template Prep Kit 1.0 Pacific Biosciences Menlo Park CA USA and sequenced on the PacBio sequel II platform.,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,PACBIO_SMRT,Sequel II,,SRP466518,,,50epiboly.ccs.fq.gz,fastq,6994871304.0,1739615.0,50epiboly.ccs.fq.gz,0:4020.93,A:1886646970;C:1618863911;G:1609321304;T:1880039119;N:0,4020,,,,1886646970,1618863911,1609321304,1880039119,0,SRX22100922,SRS19166048,SRA1731898,University of Michigan|Computational Medicine and Bioinformatics,University of Michigan,1,0.2059,,0.00164,,0.92101,,0.06119,,3367,,T,,long read,pacbio,pacbio_modern,full_length,poly_a,unknown,bulk,unknown,unknown,,United States,2023-10-16,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28586,SRR26395062,SRX22100872,SRS19165998,SRP466518,PRJNA1028258,Zygotic activation of transposable elements during zebrafish early embryogenesis,PRJNA1028258,Other,Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age.,,pubmed:40246845,,,Shield Iso seq,,strain:AB x India|age:6 hpf|dev stage:shield|collection date:2021 01|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:LR 11|BioSampleModel:Model organism or animal,,,,,,,,,PacBio Iso seq of zebrafish: shield,DR 011,DR 011,Total RNA was isolated from each developmental stages of zebrafish embryos using TRIzolTM Reagent Invitrogen. RNA purity and concentration were assessed with the NanoPhotometer spectrophotometer IMPLEN CA USA and the Qubit RNA Assay Kit in the Qubit 3.0 Fluorometer Life Technologies CA USA. The RNA integrity number RIN was determined using the RNA Nano 6000 Assay Kit and Agilent Bioanalyzer 2100 system Agilent Technologies CA USA. RNA samples with a RIN 8 were used to synthesize cDNA with SMARTerPCR cDNA Synthesis Kit Takara Bio USA Inc. Mountain View CA USA. PCR amplification was performed using a KAPA HiFi PCR Kit Kapa Biosystems Wilmington MA USA with the optimized number of cycles. Size selection of PCR products cDNA for each sample was applied using the BluePippin System: <3 kb and >3 kb. Subsequently two cDNA libraries <3 kb >3 kb were prepared using a SMRTbell Template Prep Kit 1.0 Pacific Biosciences Menlo Park CA USA and sequenced on the PacBio sequel II platform.,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,PACBIO_SMRT,Sequel II,,SRP466518,,,shield.ccs.fq.gz,fastq,7256029471.0,1854553.0,shield.ccs.fq.gz,0:3912.55,A:1984833012;C:1651523494;G:1642156033;T:1977516932;N:0,3912,,,,1984833012,1651523494,1642156033,1977516932,0,SRX22100872,SRS19165998,SRA1731898,University of Michigan|Computational Medicine and Bioinformatics,University of Michigan,1,0.2041,,0.00298,,0.91837,,0.08263,,2962,,T,,long read,pacbio,pacbio_modern,full_length,poly_a,unknown,bulk,unknown,unknown,,United States,2023-10-16,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28906,SRR26845640,SRX22541146,SRS19550731,SRP472251,PRJNA1040920,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data],GSE247930,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP plus 20µM of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish shield 20µM lnamir430 50mM s4u r6,GSM7903226,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lna against miR 430 seed and 50mM s4UTP injection|geo loc name:missing|collection date:missing,zebrafish shield 20µM lnamir430 50mM s4u r6,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were injected with 1000pL of 50mM s4 UTP plus 20µM of either locked nucleic acid against miR 430 seed or a mismatch oligo.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lna against miR 430 seed and 50mM s4UTP injection,GSM7903226,GSM7903226: zebrafish shield 20µM lnamir430 50mM s4u r6; Danio rerio; RNA Seq,GSM7903226 r1,GSM7903226,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472251,,loader:fastq load.py,shield_LNA430_6.fastq.gz,fastq,7432626966.0,73590366.0,GSM7903226 r1,0:101,A:2650382519;C:1367541457;G:1415587402;T:1999115588;N:0,101,,,,2650382519,1367541457,1415587402,1999115588,0,SRX22541146,SRS19550731,SRA1751929,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.66888,,0.17305,,0.83465,,0.69037,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28907,SRR26845641,SRX22541145,SRS19550730,SRP472251,PRJNA1040920,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data],GSE247930,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP plus 20µM of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish shield 20µM lnamir430 50mM s4u r5,GSM7903225,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lna against miR 430 seed and 50mM s4UTP injection|geo loc name:missing|collection date:missing,zebrafish shield 20µM lnamir430 50mM s4u r5,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were injected with 1000pL of 50mM s4 UTP plus 20µM of either locked nucleic acid against miR 430 seed or a mismatch oligo.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lna against miR 430 seed and 50mM s4UTP injection,GSM7903225,GSM7903225: zebrafish shield 20µM lnamir430 50mM s4u r5; Danio rerio; RNA Seq,GSM7903225 r1,GSM7903225,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472251,,loader:fastq load.py,shield_LNA430_5.fastq.gz,fastq,5517442847.0,54628147.0,GSM7903225 r1,0:101,A:1830971596;C:1020448830;G:1068982055;T:1597040366;N:0,101,,,,1830971596,1020448830,1068982055,1597040366,0,SRX22541145,SRS19550730,SRA1751929,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.7123,,0.14169,,0.81785,,0.61343,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28908,SRR26845642,SRX22541144,SRS19550729,SRP472251,PRJNA1040920,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data],GSE247930,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP plus 20µM of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish shield 20µM lnamir430 50mM s4u r4,GSM7903224,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lna against miR 430 seed and 50mM s4UTP injection|geo loc name:missing|collection date:missing,zebrafish shield 20µM lnamir430 50mM s4u r4,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were injected with 1000pL of 50mM s4 UTP plus 20µM of either locked nucleic acid against miR 430 seed or a mismatch oligo.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lna against miR 430 seed and 50mM s4UTP injection,GSM7903224,GSM7903224: zebrafish shield 20µM lnamir430 50mM s4u r4; Danio rerio; RNA Seq,GSM7903224 r1,GSM7903224,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472251,,loader:fastq load.py,shield_LNA430_4.fastq.gz,fastq,7633894514.0,75583114.0,GSM7903224 r1,0:101,A:2522715535;C:1462363691;G:1540381861;T:2108433427;N:0,101,,,,2522715535,1462363691,1540381861,2108433427,0,SRX22541144,SRS19550729,SRA1751929,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.71858,,0.20656,,0.83522,,0.6748,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28909,SRR26845643,SRX22541143,SRS19550728,SRP472251,PRJNA1040920,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data],GSE247930,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP plus 20µM of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish shield 20µM lnamir430 50mM s4u r3,GSM7903223,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lna against miR 430 seed and 50mM s4UTP injection|geo loc name:missing|collection date:missing,zebrafish shield 20µM lnamir430 50mM s4u r3,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were injected with 1000pL of 50mM s4 UTP plus 20µM of either locked nucleic acid against miR 430 seed or a mismatch oligo.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lna against miR 430 seed and 50mM s4UTP injection,GSM7903223,GSM7903223: zebrafish shield 20µM lnamir430 50mM s4u r3; Danio rerio; RNA Seq,GSM7903223 r1,GSM7903223,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472251,,loader:fastq load.py,shield_LNA430_3.fastq.gz,fastq,6740922911.0,66741811.0,GSM7903223 r1,0:101,A:2320670868;C:1251436299;G:1316606507;T:1852209237;N:0,101,,,,2320670868,1251436299,1316606507,1852209237,0,SRX22541143,SRS19550728,SRA1751929,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.69597,,0.18028,,0.8341,,0.68324,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28910,SRR26845644,SRX22541142,SRS19550727,SRP472251,PRJNA1040920,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data],GSE247930,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP plus 20µM of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish shield 20µM lnamir430 50mM s4u r2,GSM7903222,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lna against miR 430 seed and 50mM s4UTP injection|geo loc name:missing|collection date:missing,zebrafish shield 20µM lnamir430 50mM s4u r2,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were injected with 1000pL of 50mM s4 UTP plus 20µM of either locked nucleic acid against miR 430 seed or a mismatch oligo.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lna against miR 430 seed and 50mM s4UTP injection,GSM7903222,GSM7903222: zebrafish shield 20µM lnamir430 50mM s4u r2; Danio rerio; RNA Seq,GSM7903222 r1,GSM7903222,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472251,,loader:fastq load.py,shield_LNA430_2.fastq.gz,fastq,4965369272.0,49162072.0,GSM7903222 r1,0:101,A:1663212628;C:946084438;G:1026397565;T:1326957174;N:2717467,101,,,,1663212628,946084438,1026397565,1326957174,2717467,SRX22541142,SRS19550727,SRA1751929,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.67731,,0.17959,,0.84758,,0.35494,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28911,SRR26845645,SRX22541141,SRS19550724,SRP472251,PRJNA1040920,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data],GSE247930,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP plus 20µM of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish shield 20µM lnamir430 50mM s4u r1,GSM7903221,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lna against miR 430 seed and 50mM s4UTP injection|geo loc name:missing|collection date:missing,zebrafish shield 20µM lnamir430 50mM s4u r1,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were injected with 1000pL of 50mM s4 UTP plus 20µM of either locked nucleic acid against miR 430 seed or a mismatch oligo.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lna against miR 430 seed and 50mM s4UTP injection,GSM7903221,GSM7903221: zebrafish shield 20µM lnamir430 50mM s4u r1; Danio rerio; RNA Seq,GSM7903221 r1,GSM7903221,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472251,,loader:fastq load.py,shield_LNA430_1.fastq.gz,fastq,4180419189.0,41390289.0,GSM7903221 r1,0:101,A:1388136145;C:781877911;G:841117776;T:1166988154;N:2299203,101,,,,1388136145,781877911,841117776,1166988154,2299203,SRX22541141,SRS19550724,SRA1751929,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.7194,,0.16361,,0.8326,,0.36766,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28912,SRR26845646,SRX22541140,SRS19550726,SRP472251,PRJNA1040920,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data],GSE247930,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP plus 20µM of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish shield 20µM lnacontrol 50mM s4u r6,GSM7903220,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lnacontrol and 50mM s4UTP injection|geo loc name:missing|collection date:missing,zebrafish shield 20µM lnacontrol 50mM s4u r6,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were injected with 1000pL of 50mM s4 UTP plus 20µM of either locked nucleic acid against miR 430 seed or a mismatch oligo.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lnacontrol and 50mM s4UTP injection,GSM7903220,GSM7903220: zebrafish shield 20µM lnacontrol 50mM s4u r6; Danio rerio; RNA Seq,GSM7903220 r1,GSM7903220,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472251,,loader:fastq load.py,shield_LNA_Mis_6.fastq.gz,fastq,3528723355.0,34937855.0,GSM7903220 r1,0:101,A:1169270874;C:664348337;G:701284585;T:993819559;N:0,101,,,,1169270874,664348337,701284585,993819559,0,SRX22541140,SRS19550726,SRA1751929,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.73609,,0.18234,,0.82789,,0.67273,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28913,SRR26845647,SRX22541139,SRS19550725,SRP472251,PRJNA1040920,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data],GSE247930,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP plus 20µM of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish shield 20µM lnacontrol 50mM s4u r5,GSM7903219,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lnacontrol and 50mM s4UTP injection|geo loc name:missing|collection date:missing,zebrafish shield 20µM lnacontrol 50mM s4u r5,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were injected with 1000pL of 50mM s4 UTP plus 20µM of either locked nucleic acid against miR 430 seed or a mismatch oligo.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lnacontrol and 50mM s4UTP injection,GSM7903219,GSM7903219: zebrafish shield 20µM lnacontrol 50mM s4u r5; Danio rerio; RNA Seq,GSM7903219 r1,GSM7903219,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472251,,loader:fastq load.py,shield_LNA_Mis_5.fastq.gz,fastq,6194543716.0,61332116.0,GSM7903219 r1,0:101,A:2097813326;C:1118975109;G:1172439642;T:1805315639;N:0,101,,,,2097813326,1118975109,1172439642,1805315639,0,SRX22541139,SRS19550725,SRA1751929,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.68662,,0.14858,,0.81931,,0.58494,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28914,SRR26845648,SRX22541138,SRS19550721,SRP472251,PRJNA1040920,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data],GSE247930,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP plus 20µM of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish shield 20µM lnacontrol 50mM s4u r4,GSM7903218,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lnacontrol and 50mM s4UTP injection|geo loc name:missing|collection date:missing,zebrafish shield 20µM lnacontrol 50mM s4u r4,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were injected with 1000pL of 50mM s4 UTP plus 20µM of either locked nucleic acid against miR 430 seed or a mismatch oligo.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lnacontrol and 50mM s4UTP injection,GSM7903218,GSM7903218: zebrafish shield 20µM lnacontrol 50mM s4u r4; Danio rerio; RNA Seq,GSM7903218 r1,GSM7903218,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472251,,loader:fastq load.py,shield_LNA_Mis_4.fastq.gz,fastq,7267022619.0,71950719.0,GSM7903218 r1,0:101,A:2506840526;C:1345281143;G:1405742068;T:2009158882;N:0,101,,,,2506840526,1345281143,1405742068,2009158882,0,SRX22541138,SRS19550721,SRA1751929,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.66968,,0.17594,,0.83151,,0.65157,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28915,SRR26845649,SRX22541137,SRS19550722,SRP472251,PRJNA1040920,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data],GSE247930,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP plus 20µM of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish shield 20µM lnacontrol 50mM s4u r3,GSM7903217,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lnacontrol and 50mM s4UTP injection|geo loc name:missing|collection date:missing,zebrafish shield 20µM lnacontrol 50mM s4u r3,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were injected with 1000pL of 50mM s4 UTP plus 20µM of either locked nucleic acid against miR 430 seed or a mismatch oligo.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lnacontrol and 50mM s4UTP injection,GSM7903217,GSM7903217: zebrafish shield 20µM lnacontrol 50mM s4u r3; Danio rerio; RNA Seq,GSM7903217 r1,GSM7903217,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472251,,loader:fastq load.py,shield_LNA_Mis_3.fastq.gz,fastq,5967073536.0,59079936.0,GSM7903217 r1,0:101,A:2104721652;C:1097559356;G:1127515791;T:1637276737;N:0,101,,,,2104721652,1097559356,1127515791,1637276737,0,SRX22541137,SRS19550722,SRA1751929,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.63706,,0.16097,,0.83461,,0.66484,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28916,SRR26845650,SRX22541136,SRS19550723,SRP472251,PRJNA1040920,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data],GSE247930,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP plus 20µM of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish shield 20µM lnacontrol 50mM s4u r2,GSM7903216,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lnacontrol and 50mM s4UTP injection|geo loc name:missing|collection date:missing,zebrafish shield 20µM lnacontrol 50mM s4u r2,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were injected with 1000pL of 50mM s4 UTP plus 20µM of either locked nucleic acid against miR 430 seed or a mismatch oligo.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lnacontrol and 50mM s4UTP injection,GSM7903216,GSM7903216: zebrafish shield 20µM lnacontrol 50mM s4u r2; Danio rerio; RNA Seq,GSM7903216 r1,GSM7903216,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472251,,loader:fastq load.py,shield_LNA_Mis_2.fastq.gz,fastq,3643975465.0,36078965.0,GSM7903216 r1,0:101,A:1169767894;C:685310134;G:753541931;T:1033295416;N:2060090,101,,,,1169767894,685310134,753541931,1033295416,2060090,SRX22541136,SRS19550723,SRA1751929,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.7292,,0.18508,,0.83424,,0.62718,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28917,SRR26845651,SRX22541135,SRS19550720,SRP472251,PRJNA1040920,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data],GSE247930,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP plus 20µM of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish shield 20µM lnacontrol 50mM s4u r1,GSM7903215,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lnacontrol and 50mM s4UTP injection|geo loc name:missing|collection date:missing,zebrafish shield 20µM lnacontrol 50mM s4u r1,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were injected with 1000pL of 50mM s4 UTP plus 20µM of either locked nucleic acid against miR 430 seed or a mismatch oligo.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lnacontrol and 50mM s4UTP injection,GSM7903215,GSM7903215: zebrafish shield 20µM lnacontrol 50mM s4u r1; Danio rerio; RNA Seq,GSM7903215 r1,GSM7903215,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472251,,loader:fastq load.py,shield_LNA_Mis_1.fastq.gz,fastq,4881473117.0,48331417.0,GSM7903215 r1,0:101,A:1562562452;C:901372607;G:981986460;T:1432839789;N:2711809,101,,,,1562562452,901372607,981986460,1432839789,2711809,SRX22541135,SRS19550720,SRA1751929,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.72355,,0.15423,,0.82262,,0.58105,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28918,SRR26845652,SRX22541168,SRS19550753,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 8hour wt 75mM s4u r3,GSM7903274,,tissue:Embryos at 8 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 8hour wt 75mM s4u r3,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 8 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:8 hpf of [AB TU]x[TL TLF],GSM7903274,GSM7903274: zebrafish 8hour wt 75mM s4u r3; Danio rerio; RNA Seq,GSM7903274 r1,GSM7903274,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s8h_4.fastq.gz,fastq,5796273345.0,57388845.0,GSM7903274 r1,0:101,A:1987532805;C:1079193337;G:1164388405;T:1561938100;N:3220698,101,,,,1987532805,1079193337,1164388405,1561938100,3220698,SRX22541168,SRS19550753,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.64204,,0.18985,,0.84348,,0.60294,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28919,SRR26845653,SRX22541167,SRS19550752,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 8hour wt 75mM s4u r2,GSM7903273,,tissue:Embryos at 8 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 8hour wt 75mM s4u r2,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 8 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:8 hpf of [AB TU]x[TL TLF],GSM7903273,GSM7903273: zebrafish 8hour wt 75mM s4u r2; Danio rerio; RNA Seq,GSM7903273 r1,GSM7903273,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s8h_2.fastq.gz,fastq,4897372941.0,48488841.0,GSM7903273 r1,0:101,A:1699755610;C:929418233;G:1005848571;T:1259595469;N:2755058,101,,,,1699755610,929418233,1005848571,1259595469,2755058,SRX22541167,SRS19550752,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.62249,,0.23058,,0.85782,,0.62172,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28920,SRR26845654,SRX22541166,SRS19550750,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 8hour wt 75mM s4u r1,GSM7903272,,tissue:Embryos at 8 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 8hour wt 75mM s4u r1,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 8 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:8 hpf of [AB TU]x[TL TLF],GSM7903272,GSM7903272: zebrafish 8hour wt 75mM s4u r1; Danio rerio; RNA Seq,GSM7903272 r1,GSM7903272,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s8h_1.fastq.gz,fastq,4081964490.0,40415490.0,GSM7903272 r1,0:101,A:1381746632;C:779891737;G:836779689;T:1081260235;N:2286197,101,,,,1381746632,779891737,836779689,1081260235,2286197,SRX22541166,SRS19550750,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.63669,,0.23628,,0.8578,,0.61689,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28921,SRR26845655,SRX22541165,SRS19550751,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 7hour wt 75mM s4u r3,GSM7903271,,tissue:Embryos at 7 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 7hour wt 75mM s4u r3,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 7 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:7 hpf of [AB TU]x[TL TLF],GSM7903271,GSM7903271: zebrafish 7hour wt 75mM s4u r3; Danio rerio; RNA Seq,GSM7903271 r1,GSM7903271,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s7h_4.fastq.gz,fastq,4851172511.0,48031411.0,GSM7903271 r1,0:101,A:1617620537;C:932157064;G:983796569;T:1314884644;N:2713697,101,,,,1617620537,932157064,983796569,1314884644,2713697,SRX22541165,SRS19550751,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.63288,,0.17507,,0.84122,,0.6377,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28922,SRR26845656,SRX22541164,SRS19550748,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 7hour wt 75mM s4u r2,GSM7903270,,tissue:Embryos at 7 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 7hour wt 75mM s4u r2,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 7 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:7 hpf of [AB TU]x[TL TLF],GSM7903270,GSM7903270: zebrafish 7hour wt 75mM s4u r2; Danio rerio; RNA Seq,GSM7903270 r1,GSM7903270,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s7h_2.fastq.gz,fastq,4762466029.0,47153129.0,GSM7903270 r1,0:101,A:1617990526;C:900885384;G:944898805;T:1296064007;N:2627307,101,,,,1617990526,900885384,944898805,1296064007,2627307,SRX22541164,SRS19550748,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.64254,,0.23162,,0.84504,,0.62634,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28923,SRR26845657,SRX22541163,SRS19550749,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 7hour wt 75mM s4u r1,GSM7903269,,tissue:Embryos at 7 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 7hour wt 75mM s4u r1,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 7 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:7 hpf of [AB TU]x[TL TLF],GSM7903269,GSM7903269: zebrafish 7hour wt 75mM s4u r1; Danio rerio; RNA Seq,GSM7903269 r1,GSM7903269,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s7h_1.fastq.gz,fastq,5021159147.0,49714447.0,GSM7903269 r1,0:101,A:1658742605;C:951972011;G:1025355321;T:1382277303;N:2811907,101,,,,1658742605,951972011,1025355321,1382277303,2811907,SRX22541163,SRS19550749,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.71548,,0.24849,,0.82704,,0.65095,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28924,SRR26845658,SRX22541162,SRS19550747,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 6hour wt 75mM s4u r3,GSM7903268,,tissue:Embryos at 6 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 6hour wt 75mM s4u r3,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 6 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:6 hpf of [AB TU]x[TL TLF],GSM7903268,GSM7903268: zebrafish 6hour wt 75mM s4u r3; Danio rerio; RNA Seq,GSM7903268 r1,GSM7903268,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s6h_3.fastq.gz,fastq,4548634990.0,45035990.0,GSM7903268 r1,0:101,A:1519559786;C:870914391;G:937154183;T:1218472088;N:2534542,101,,,,1519559786,870914391,937154183,1218472088,2534542,SRX22541162,SRS19550747,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.6699,,0.26195,,0.84756,,0.61557,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28925,SRR26845659,SRX22541161,SRS19550746,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 6hour wt 75mM s4u r2,GSM7903267,,tissue:Embryos at 6 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 6hour wt 75mM s4u r2,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 6 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:6 hpf of [AB TU]x[TL TLF],GSM7903267,GSM7903267: zebrafish 6hour wt 75mM s4u r2; Danio rerio; RNA Seq,GSM7903267 r1,GSM7903267,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s6h_2.fastq.gz,fastq,5673879525.0,56177025.0,GSM7903267 r1,0:101,A:1889309422;C:1079098000;G:1157406188;T:1544899367;N:3166548,101,,,,1889309422,1079098000,1157406188,1544899367,3166548,SRX22541161,SRS19550746,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.6803,,0.2063,,0.83078,,0.64225,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28940,SRR26846105,SRX22541614,SRS19551199,SRP472260,PRJNA1040930,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [titration data],GSE247934,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200µg/µl Alpha Amanitin. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,pubmed:38504288,,zebrafish 7hours aamanitin 75mM s4u r3,GSM7903289,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:aamanitin 75mM s4u|geo loc name:missing|collection date:missing,zebrafish 7hours aamanitin 75mM s4u r3,Slamdunk 0.4.3. Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200mg/mL Alpha Amanitin,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:aamanitin 75mM s4u,GSM7903289,GSM7903289: zebrafish 7hours aamanitin 75mM s4u r3; Danio rerio; RNA Seq,GSM7903289 r1,GSM7903289,1,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP472260,,,s75mM_s4U_Alpha_AM_3_7.2hpf.fastq,fastq,2324253052.0,30582277.0,GSM7903289 r1,0:76,A:730230137;C:445929142;G:497720807;T:650150631;N:222335,76,,,,730230137,445929142,497720807,650150631,222335,SRX22541614,SRS19551199,SRA1751942,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.91664,,0.09242,,0.85141,,0.83766,,76,,B,,usable mapping rate,illumina,nextseq,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28941,SRR26846106,SRX22541613,SRS19551197,SRP472260,PRJNA1040930,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [titration data],GSE247934,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200µg/µl Alpha Amanitin. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,pubmed:38504288,,zebrafish 7hours aamanitin 75mM s4u r2,GSM7903288,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:aamanitin 75mM s4u|geo loc name:missing|collection date:missing,zebrafish 7hours aamanitin 75mM s4u r2,Slamdunk 0.4.3. Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200mg/mL Alpha Amanitin,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:aamanitin 75mM s4u,GSM7903288,GSM7903288: zebrafish 7hours aamanitin 75mM s4u r2; Danio rerio; RNA Seq,GSM7903288 r1,GSM7903288,1,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP472260,,,s75mM_s4U_Alpha_AM_2_7.2hpf.fastq,fastq,2258390388.0,29715663.0,GSM7903288 r1,0:76,A:730303334;C:433847002;G:477372738;T:616648008;N:219306,76,,,,730303334,433847002,477372738,616648008,219306,SRX22541613,SRS19551197,SRA1751942,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.90032,,0.09917,,0.85456,,0.82527,,76,,B,,usable mapping rate,illumina,nextseq,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28942,SRR26846107,SRX22541612,SRS19551198,SRP472260,PRJNA1040930,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [titration data],GSE247934,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200µg/µl Alpha Amanitin. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,pubmed:38504288,,zebrafish 7hours aamanitin 75mM s4u r1,GSM7903287,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:aamanitin 75mM s4u|geo loc name:missing|collection date:missing,zebrafish 7hours aamanitin 75mM s4u r1,Slamdunk 0.4.3. Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200mg/mL Alpha Amanitin,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:aamanitin 75mM s4u,GSM7903287,GSM7903287: zebrafish 7hours aamanitin 75mM s4u r1; Danio rerio; RNA Seq,GSM7903287 r1,GSM7903287,1,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP472260,,,s75mM_s4U_Alpha_AM_1_7.2hpf.fastq,fastq,2448732008.0,32220158.0,GSM7903287 r1,0:76,A:762363800;C:470381296;G:528015897;T:687735325;N:235690,76,,,,762363800,470381296,528015897,687735325,235690,SRX22541612,SRS19551198,SRA1751942,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.92405,,0.09134,,0.85086,,0.83762,,76,,B,,usable mapping rate,illumina,nextseq,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28943,SRR26846108,SRX22541611,SRS19551195,SRP472260,PRJNA1040930,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [titration data],GSE247934,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200µg/µl Alpha Amanitin. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,pubmed:38504288,,zebrafish 7hours wt 75mM s4u r3,GSM7903286,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 75mM s4u|geo loc name:missing|collection date:missing,zebrafish 7hours wt 75mM s4u r3,Slamdunk 0.4.3. Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200mg/mL Alpha Amanitin,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 75mM s4u,GSM7903286,GSM7903286: zebrafish 7hours wt 75mM s4u r3; Danio rerio; RNA Seq,GSM7903286 r1,GSM7903286,1,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP472260,,,s75mM_s4U_3_shield.fastq,fastq,1972068596.0,25948271.0,GSM7903286 r1,0:76,A:624727984;C:405741582;G:403474252;T:537931982;N:192796,76,,,,624727984,405741582,403474252,537931982,192796,SRX22541611,SRS19551195,SRA1751942,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.69551,,0.10734,,0.85922,,0.81475,,76,,B,,usable mapping rate,illumina,nextseq,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28944,SRR26846109,SRX22541610,SRS19551196,SRP472260,PRJNA1040930,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [titration data],GSE247934,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200µg/µl Alpha Amanitin. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,pubmed:38504288,,zebrafish 7hours wt 75mM s4u r2,GSM7903285,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 75mM s4u|geo loc name:missing|collection date:missing,zebrafish 7hours wt 75mM s4u r2,Slamdunk 0.4.3. Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200mg/mL Alpha Amanitin,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 75mM s4u,GSM7903285,GSM7903285: zebrafish 7hours wt 75mM s4u r2; Danio rerio; RNA Seq,GSM7903285 r1,GSM7903285,1,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP472260,,,s75mM_s4U_2_shield.fastq,fastq,2516506300.0,33111925.0,GSM7903285 r1,0:76,A:831930759;C:501602051;G:506951200;T:675776222;N:246068,76,,,,831930759,501602051,506951200,675776222,246068,SRX22541610,SRS19551196,SRA1751942,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.71823,,0.11734,,0.85626,,0.82109,,76,,B,,usable mapping rate,illumina,nextseq,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28945,SRR26846110,SRX22541609,SRS19551194,SRP472260,PRJNA1040930,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [titration data],GSE247934,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200µg/µl Alpha Amanitin. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,pubmed:38504288,,zebrafish 7hours wt 75mM s4u r1,GSM7903284,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 75mM s4u|geo loc name:missing|collection date:missing,zebrafish 7hours wt 75mM s4u r1,Slamdunk 0.4.3. Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200mg/mL Alpha Amanitin,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 75mM s4u,GSM7903284,GSM7903284: zebrafish 7hours wt 75mM s4u r1; Danio rerio; RNA Seq,GSM7903284 r1,GSM7903284,1,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP472260,,,s75mM_s4U_1_shield.fastq,fastq,2549071616.0,33540416.0,GSM7903284 r1,0:76,A:818805455;C:519667619;G:516651535;T:693699280;N:247727,76,,,,818805455,519667619,516651535,693699280,247727,SRX22541609,SRS19551194,SRA1751942,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.6955,,0.10765,,0.86076,,0.8198,,76,,B,,usable mapping rate,illumina,nextseq,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28946,SRR26846111,SRX22541608,SRS19551193,SRP472260,PRJNA1040930,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [titration data],GSE247934,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200µg/µl Alpha Amanitin. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,pubmed:38504288,,zebrafish 7hours wt 50mM s4u r3,GSM7903283,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 50mM s4u|geo loc name:missing|collection date:missing,zebrafish 7hours wt 50mM s4u r3,Slamdunk 0.4.3. Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200mg/mL Alpha Amanitin,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 50mM s4u,GSM7903283,GSM7903283: zebrafish 7hours wt 50mM s4u r3; Danio rerio; RNA Seq,GSM7903283 r1,GSM7903283,1,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP472260,,,s50mM_s4U_3_shield.fastq,fastq,2618751456.0,34457256.0,GSM7903283 r1,0:76,A:825375324;C:516006422;G:537742430;T:739370895;N:256385,76,,,,825375324,516006422,537742430,739370895,256385,SRX22541608,SRS19551193,SRA1751942,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.79157,,0.12783,,0.83591,,0.7815,,76,,B,,usable mapping rate,illumina,nextseq,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28947,SRR26846112,SRX22541607,SRS19551192,SRP472260,PRJNA1040930,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [titration data],GSE247934,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200µg/µl Alpha Amanitin. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,pubmed:38504288,,zebrafish 7hours wt 50mM s4u r2,GSM7903282,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 50mM s4u|geo loc name:missing|collection date:missing,zebrafish 7hours wt 50mM s4u r2,Slamdunk 0.4.3. Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200mg/mL Alpha Amanitin,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 50mM s4u,GSM7903282,GSM7903282: zebrafish 7hours wt 50mM s4u r2; Danio rerio; RNA Seq,GSM7903282 r1,GSM7903282,1,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP472260,,,s50mM_s4U_2_shield.fastq,fastq,2728810932.0,35905407.0,GSM7903282 r1,0:76,A:862839647;C:533956089;G:555216318;T:776529555;N:269323,76,,,,862839647,533956089,555216318,776529555,269323,SRX22541607,SRS19551192,SRA1751942,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.78249,,0.13163,,0.83558,,0.7725,,76,,B,,usable mapping rate,illumina,nextseq,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28948,SRR26846113,SRX22541606,SRS19551191,SRP472260,PRJNA1040930,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [titration data],GSE247934,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200µg/µl Alpha Amanitin. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,pubmed:38504288,,zebrafish 7hours wt 50mM s4u r1,GSM7903281,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 50mM s4u|geo loc name:missing|collection date:missing,zebrafish 7hours wt 50mM s4u r1,Slamdunk 0.4.3. Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200mg/mL Alpha Amanitin,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 50mM s4u,GSM7903281,GSM7903281: zebrafish 7hours wt 50mM s4u r1; Danio rerio; RNA Seq,GSM7903281 r1,GSM7903281,1,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP472260,,,s50mM_s4U_1_shield.fastq,fastq,2799942904.0,36841354.0,GSM7903281 r1,0:76,A:896568389;C:543434921;G:571731242;T:787934334;N:274018,76,,,,896568389,543434921,571731242,787934334,274018,SRX22541606,SRS19551191,SRA1751942,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.77902,,0.1234,,0.83976,,0.77809,,76,,B,,usable mapping rate,illumina,nextseq,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28949,SRR26846114,SRX22541605,SRS19551190,SRP472260,PRJNA1040930,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [titration data],GSE247934,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200µg/µl Alpha Amanitin. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,pubmed:38504288,,zebrafish 7hours wt 25mM s4u r3,GSM7903280,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 25mM s4u|geo loc name:missing|collection date:missing,zebrafish 7hours wt 25mM s4u r3,Slamdunk 0.4.3. Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200mg/mL Alpha Amanitin,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 25mM s4u,GSM7903280,GSM7903280: zebrafish 7hours wt 25mM s4u r3; Danio rerio; RNA Seq,GSM7903280 r1,GSM7903280,1,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP472260,,,s25mM_s4U_3_shield.fastq,fastq,2472530952.0,32533302.0,GSM7903280 r1,0:76,A:792442838;C:471795434;G:509242670;T:698813712;N:236298,76,,,,792442838,471795434,509242670,698813712,236298,SRX22541605,SRS19551190,SRA1751942,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.84425,,0.13847,,0.83569,,0.77265,,76,,B,,usable mapping rate,illumina,nextseq,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28950,SRR26846115,SRX22541604,SRS19551188,SRP472260,PRJNA1040930,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [titration data],GSE247934,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200µg/µl Alpha Amanitin. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,pubmed:38504288,,zebrafish 7hours wt 25mM s4u r2,GSM7903279,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 25mM s4u|geo loc name:missing|collection date:missing,zebrafish 7hours wt 25mM s4u r2,Slamdunk 0.4.3. Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200mg/mL Alpha Amanitin,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 25mM s4u,GSM7903279,GSM7903279: zebrafish 7hours wt 25mM s4u r2; Danio rerio; RNA Seq,GSM7903279 r1,GSM7903279,1,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP472260,,,s25mM_s4U_2_shield.fastq,fastq,2558649668.0,33666443.0,GSM7903279 r1,0:76,A:828026391;C:485923982;G:520165153;T:724284266;N:249876,76,,,,828026391,485923982,520165153,724284266,249876,SRX22541604,SRS19551188,SRA1751942,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.83816,,0.14018,,0.83465,,0.77309,,76,,B,,usable mapping rate,illumina,nextseq,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28951,SRR26846116,SRX22541603,SRS19551189,SRP472260,PRJNA1040930,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [titration data],GSE247934,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200µg/µl Alpha Amanitin. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,pubmed:38504288,,zebrafish 7hours wt 25mM s4u r1,GSM7903278,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 25mM s4u|geo loc name:missing|collection date:missing,zebrafish 7hours wt 25mM s4u r1,Slamdunk 0.4.3. Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200mg/mL Alpha Amanitin,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 25mM s4u,GSM7903278,GSM7903278: zebrafish 7hours wt 25mM s4u r1; Danio rerio; RNA Seq,GSM7903278 r1,GSM7903278,1,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP472260,,,s25mM_s4U_1_shield.fastq,fastq,2520179304.0,33160254.0,GSM7903278 r1,0:76,A:799475887;C:482189329;G:519797461;T:718469119;N:247508,76,,,,799475887,482189329,519797461,718469119,247508,SRX22541603,SRS19551189,SRA1751942,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.83929,,0.13684,,0.83057,,0.75892,,76,,B,,usable mapping rate,illumina,nextseq,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28952,SRR26846117,SRX22541602,SRS19551186,SRP472260,PRJNA1040930,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [titration data],GSE247934,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200µg/µl Alpha Amanitin. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,pubmed:38504288,,zebrafish 7hours wt non injected r3,GSM7903277,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt non injected|geo loc name:missing|collection date:missing,zebrafish 7hours wt non injected r3,Slamdunk 0.4.3. Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200mg/mL Alpha Amanitin,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt non injected,GSM7903277,GSM7903277: zebrafish 7hours wt non injected r3; Danio rerio; RNA Seq,GSM7903277 r1,GSM7903277,1,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP472260,,,sNon_Inj_3_shield.fastq,fastq,2705811204.0,35602779.0,GSM7903277 r1,0:76,A:868795189;C:502830022;G:561015387;T:772908180;N:262426,76,,,,868795189,502830022,561015387,772908180,262426,SRX22541602,SRS19551186,SRA1751942,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.88878,,0.13872,,0.82964,,0.75597,,76,,B,,usable mapping rate,illumina,nextseq,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28953,SRR26846118,SRX22541601,SRS19551187,SRP472260,PRJNA1040930,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [titration data],GSE247934,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200µg/µl Alpha Amanitin. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,pubmed:38504288,,zebrafish 7hours wt non injected r2,GSM7903276,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt non injected|geo loc name:missing|collection date:missing,zebrafish 7hours wt non injected r2,Slamdunk 0.4.3. Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200mg/mL Alpha Amanitin,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt non injected,GSM7903276,GSM7903276: zebrafish 7hours wt non injected r2; Danio rerio; RNA Seq,GSM7903276 r1,GSM7903276,1,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP472260,,,sNon_Inj_2_shield.fastq,fastq,2231433112.0,29360962.0,GSM7903276 r1,0:76,A:730923613;C:410649775;G:458415817;T:631227720;N:216187,76,,,,730923613,410649775,458415817,631227720,216187,SRX22541601,SRS19551187,SRA1751942,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.87436,,0.13872,,0.83362,,0.75999,,76,,B,,usable mapping rate,illumina,nextseq,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28954,SRR26846119,SRX22541600,SRS19551185,SRP472260,PRJNA1040930,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [titration data],GSE247934,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200µg/µl Alpha Amanitin. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,pubmed:38504288,,zebrafish 7hours wt non injected r1,GSM7903275,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt non injected|geo loc name:missing|collection date:missing,zebrafish 7hours wt non injected r1,Slamdunk 0.4.3. Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200mg/mL Alpha Amanitin,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt non injected,GSM7903275,GSM7903275: zebrafish 7hours wt non injected r1; Danio rerio; RNA Seq,GSM7903275 r1,GSM7903275,1,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP472260,,,sNon_Inj_1_shield.fastq,fastq,2484687228.0,32693253.0,GSM7903275 r1,0:76,A:768617118;C:464380698;G:526374755;T:725072055;N:242602,76,,,,768617118,464380698,526374755,725072055,242602,SRX22541600,SRS19551185,SRA1751942,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.90371,,0.15268,,0.82538,,0.73889,,76,,B,,usable mapping rate,illumina,nextseq,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 29722,SRR27485667,SRX23156882,SRS20107303,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,Bud R2,,strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:10 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|replicate:2|BioSampleModel:Model organism or animal,,,,,,,,,mRNA seq of zebrafish: embryo 10 hpf rep4,EV06006,EV06006,RNA was extracted with Trizol and processed with QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina Lexogen. 500 ng total RNA per sample. Single indexed QuantSeq libraries were QC checked on a Bioanalyzer 2100 Agilent using a High Sensitivity DNA Kit for correct insert size and quantified using Qubit dsDNA HS Assay Invitrogen. Pooled libraries were sequenced on a NextSeq500 instrument Illumina in 1x75bp single end sequencing mode,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV06006.R1.fastq.gz,fastq,734373761.0,9740919.0,EV06006.R1.fastq.gz,0:75.39,A:217249501;C:141011173;G:161749180;T:214341396;N:22511,75,,,,217249501,141011173,161749180,214341396,22511,SRX23156882,SRS20107303,SRA1783314,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,0.902,,0.14583,,0.80937,,0.67478,,75,,B,,usable mapping rate,illumina,nextseq,3prime,poly_a,lexogen,bulk,unknown,unknown,,Austria,2024-01-11,Gastrula,Embryo,Whole Organism,All anatomical structures 29727,SRR27485672,SRX23156877,SRS20107298,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,Bud R3,,strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:10 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|replicate:3|BioSampleModel:Model organism or animal,,,,,,,,,mRNA seq of zebrafish: embryo 10 hpf rep4,EV06013,EV06013,RNA was extracted with Trizol and processed with QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina Lexogen. 500 ng total RNA per sample. Single indexed QuantSeq libraries were QC checked on a Bioanalyzer 2100 Agilent using a High Sensitivity DNA Kit for correct insert size and quantified using Qubit dsDNA HS Assay Invitrogen. Pooled libraries were sequenced on a NextSeq500 instrument Illumina in 1x75bp single end sequencing mode,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV06013.R1.fastq.gz,fastq,569494672.0,7557761.0,EV06013.R1.fastq.gz,0:75.35,A:170266388;C:110739260;G:124536859;T:163915551;N:36614,75,,,,170266388,110739260,124536859,163915551,36614,SRX23156877,SRS20107298,SRA1783314,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,0.90037,,0.16195,,0.81308,,0.71641,,75,,B,,usable mapping rate,illumina,nextseq,3prime,poly_a,lexogen,bulk,unknown,unknown,,Austria,2024-01-11,Gastrula,Embryo,Whole Organism,All anatomical structures 29733,SRR27477293,SRX23148654,SRS20099366,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,Bud R4,,strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:10 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|replicate:4|BioSampleModel:Model organism or animal,,,,,,,,,mRNA seq of zebrafish: embryo 10 hpf rep4,EV09006,EV09006,RNA was extracted with Trizol and processed with QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina Lexogen. 500 ng total RNA per sample. Single indexed QuantSeq libraries were QC checked on a Bioanalyzer 2100 Agilent using a High Sensitivity DNA Kit for correct insert size and quantified using Qubit dsDNA HS Assay Invitrogen. Pooled libraries were sequenced on a NextSeq500 instrument Illumina in 1x75bp single end sequencing mode,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV09006.R1.fastq.gz,fastq,476216388.0,6331468.0,EV09006.R1.fastq.gz,0:75.21,A:146002765;C:93329508;G:104039751;T:132799091;N:45273,75,,,,146002765,93329508,104039751,132799091,45273,SRX23148654,SRS20099366,SRA1782413,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,0.88768,,0.12305,,0.82696,,0.67338,,76,,B,,usable mapping rate,illumina,nextseq,3prime,poly_a,lexogen,bulk,unknown,unknown,,Austria,2024-01-10,Gastrula,Embryo,Whole Organism,All anatomical structures 29750,SRR27467683,SRX23139223,SRS20090265,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,Bud BS R2,,strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:10 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:BS|BioSampleModel:Model organism or animal,,,,,,,,,tRAM seq of zebrafish: embryo 10 hpf BS rep2,EV04014,EV04014,RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.,,,OTHER,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV04014.R1.fastq.gz,fastq,774901260.0,5535009.0,EV04014.R1.fastq.gz,0:140,A:193865579;C:138861953;G:251102013;T:191036071;N:35644,140,,,,193865579,138861953,251102013,191036071,35644,SRX23139223,SRS20090265,SRA1781872,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,0.0,,0.0,,1.0,,,,140,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Austria,2024-01-09,Gastrula,Embryo,Whole Organism,All anatomical structures 29751,SRR27467684,SRX23139222,SRS20090264,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,Bud DM R2,,strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:10 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:DM|BioSampleModel:Model organism or animal,,,,,,,,,tRAM seq of zebrafish: embryo 10 hpf DM rep2,EV04013,EV04013,RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.,,,OTHER,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV04013.R1.fastq.gz,fastq,666372840.0,4759806.0,EV04013.R1.fastq.gz,0:140,A:172923134;C:142243998;G:211584978;T:139591020;N:29710,140,,,,172923134,142243998,211584978,139591020,29710,SRX23139222,SRS20090264,SRA1781872,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,3e-05,,0.0,,0.99991,,1.0,,140,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Austria,2024-01-09,Gastrula,Embryo,Whole Organism,All anatomical structures 29752,SRR27467685,SRX23139221,SRS20090262,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,Bud mock R2,,strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:10 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:mock|BioSampleModel:Model organism or animal,,,,,,,,,tRAM seq of zebrafish: embryo 10 hpf mock rep2,EV04012,EV04012,RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.,,,OTHER,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV04012.R1.fastq.gz,fastq,628769540.0,4491211.0,EV04012.R1.fastq.gz,0:140,A:160925901;C:143204697;G:183224867;T:141385307;N:28768,140,,,,160925901,143204697,183224867,141385307,28768,SRX23139221,SRS20090262,SRA1781872,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,1e-05,,0.0,,0.99997,,1.0,,140,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Austria,2024-01-09,Gastrula,Embryo,Whole Organism,All anatomical structures 29768,SRR27437488,SRX23109809,SRS20064564,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,Bud BS R3,,strain:TLAB fish|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|dev stage:10 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:BS|BioSampleModel:Model organism or animal,,,,,,,,,tRAM seq of zebrafish: embryo 10 hpf BS rep3,EV07015,EV07015,RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.,,,OTHER,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV07015.R1.fastq.gz,fastq,598389400.0,4274210.0,EV07015.R1.fastq.gz,0:140,A:150315140;C:106310211;G:186765596;T:154982225;N:16228,140,,,,150315140,106310211,186765596,154982225,16228,SRX23109809,SRS20064564,SRA1780298,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,0.0,,0.0,,1.0,,,,140,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Austria,2024-01-06,Gastrula,Embryo,Whole Organism,All anatomical structures 29769,SRR27437489,SRX23109808,SRS20064562,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,Bud DM R3,,strain:TLAB fish|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|dev stage:10 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:DM|BioSampleModel:Model organism or animal,,,,,,,,,tRAM seq of zebrafish: embryo 10 hpf DM rep3,EV07014,EV07014,RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.,,,OTHER,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV07014.R1.fastq.gz,fastq,739056780.0,5278977.0,EV07014.R1.fastq.gz,0:140,A:197948890;C:178761090;G:200265458;T:162060992;N:20350,140,,,,197948890,178761090,200265458,162060992,20350,SRX23109808,SRS20064562,SRA1780298,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,3e-05,,0.0,,0.99995,,0.5,,140,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Austria,2024-01-06,Gastrula,Embryo,Whole Organism,All anatomical structures 29770,SRR27437490,SRX23109807,SRS20064561,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,Bud mock R3,,strain:TLAB fish|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|dev stage:10 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:mock|BioSampleModel:Model organism or animal,,,,,,,,,tRAM seq of zebrafish: embryo 10 hpf mock rep3,EV07013,EV07013,RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.,,,OTHER,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV07013.R1.fastq.gz,fastq,844338040.0,6030986.0,EV07013.R1.fastq.gz,0:140,A:217780710;C:182517044;G:251974206;T:192043675;N:22405,140,,,,217780710,182517044,251974206,192043675,22405,SRX23109807,SRS20064561,SRA1780298,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,4e-05,,0.0,,0.99993,,1.0,,140,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Austria,2024-01-06,Gastrula,Embryo,Whole Organism,All anatomical structures 29789,SRR27435874,SRX23108222,SRS20063057,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,Bud BS R4,,strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:10 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:BS|BioSampleModel:Model organism or animal,,,,,,,,,tRAM seq of zebrafish: embryo 10 hpf BS rep4,EV08018,EV08018,RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.,,,OTHER,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV08018.R1.fastq.gz,fastq,809203080.0,5780022.0,EV08018.R1.fastq.gz,0:140,A:209714496;C:130623600;G:197912909;T:270895413;N:56662,140,,,,209714496,130623600,197912909,270895413,56662,SRX23108222,SRS20063057,SRA1780265,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,0.0,,0.0,,1.0,,,,140,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Austria,2024-01-05,Gastrula,Embryo,Whole Organism,All anatomical structures 29790,SRR27435875,SRX23108221,SRS20063059,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,Bud DM R4,,strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:10 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:DM|BioSampleModel:Model organism or animal,,,,,,,,,tRAM seq of zebrafish: embryo 10 hpf DM rep4,EV08017,EV08017,RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.,,,OTHER,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV08017.R1.fastq.gz,fastq,722137500.0,5158125.0,EV08017.R1.fastq.gz,0:140,A:176408094;C:195907583;G:188487109;T:161283055;N:51659,140,,,,176408094,195907583,188487109,161283055,51659,SRX23108221,SRS20063059,SRA1780265,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,0.00053,,3e-05,,0.999,,0.70422,,140,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Austria,2024-01-05,Gastrula,Embryo,Whole Organism,All anatomical structures 29791,SRR27435876,SRX23108220,SRS20063058,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,Bud mock R4,,strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:10 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:mock|BioSampleModel:Model organism or animal,,,,,,,,,tRAM seq of zebrafish: embryo 10 hpf mock rep4,EV08016,EV08016,RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.,,,OTHER,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV08016.R1.fastq.gz,fastq,827605660.0,5911469.0,EV08016.R1.fastq.gz,0:140,A:204173663;C:224596562;G:206999037;T:191779555;N:56843,140,,,,204173663,224596562,206999037,191779555,56843,SRX23108220,SRS20063058,SRA1780265,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,0.00037,,2e-05,,0.99908,,0.7037,,140,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Austria,2024-01-05,Gastrula,Embryo,Whole Organism,All anatomical structures 30508,SRR27764648,SRX23429609,SRS20284060,SRP486518,PRJNA1070582,Gene expression profile of neighboring cells of cells with unfit Wnt morphogen gradient during cell competition,GSE254439,Transcriptome Analysis,Morphogen signalling forms an activity gradient and instructs cell identities in a signalling strength dependent manner to pattern developing tissues. However developing tissues also undergo dynamic morphogenesis which may produce cells with unfit morphogen signalling and consequent noisy morphogen gradient. Here we show that a cell competition related system corrects such noisy morphogen gradients. Zebrafish imaging analyses of the Wnt/ß catenin signalling gradient which acts as a morphogen to establish embryonic anterior posterior patterning revealed that unfit cells with abnormal Wnt/ß catenin activity spontaneously appear and produce noise in the gradient. Communication between unfit and neighbouring fit cells via cadherin proteins stimulates apoptosis of the unfit cells by activating Smad signalling and reactive oxygen species production. This unfit cell elimination is required for proper Wnt/ß catenin gradient formation and consequent anterior posterior patterning. Because this gradient controls patterning not only in the embryo but also in adult tissues this system may support tissue robustness and disease prevention. Overall design: ß catCA constitutive active form of ß catenin expressing GFP+ cells or ßcatCA unexpressing GFP cells from ß catCA mosaically introduced zebrafish early embryos were sorted by FACS cell sorter. Total RNAs were extracted and analyzed by RNA seq.,,pubmed:39546611,,Mosaic GFP control GFP min lot2,GSM8042248,,source name:early embryonic cell|strain:AB|tissue:early embryonic cell|developmental stage:9 hpf loc name:missing|collection date:missing,Mosaic GFP control GFP min lot2,Sequenced reads were mapped to the GRCz10 reference genome using Bowtie2 ver. 2.3.1. UMI counts were extracted per HTSeq ver. 0.6.1 from the CEL Seq2 pipeline. Assembly: GRCz10 Supplementary files format and content: Tab delimited text file for expression data normalized by regularized logarithm.,early embryonic cell,,Cells were dissolved in TRIzol reagent Invitrogen and extracted. Samples were prepared according to the CEL Seq2 protocol described in Hashimshony et al. Geneome Biology 2016. Libraries preparation was performed according to the published CEL Seq2 protocol.,,strain:AB|tissue:early embryonic cell|developmental stage:9 hpf,GSM8042248,GSM8042248: Mosaic GFP control GFP min lot2; Danio rerio; RNA Seq,GSM8042248 r1,GSM8042248,1,Cells were dissolved in TRIzol reagent Invitrogen and extracted. Samples were prepared according to the CEL Seq2 protocol described in Hashimshony et al. Geneome Biology 2016. Libraries preparation was performed according to the published CEL Seq2 protocol.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 1500,,SRP486518,,,Mosaic_GFP_control_GFP_min_lot2.fastq.gz,fastq,7474464.0,207624.0,GSM8042248 r1,0:36,A:1796571;C:1274347;G:1548876;T:2854637;N:33,36,,,,1796571,1274347,1548876,2854637,33,SRX23429609,SRS20284060,SRA1793856,"Department of Homeostatic Regulation, Research Institute for Microbial Diseases, Osaka University","Department of Homeostatic Regulation, Research Institute for Microbial Diseases, Osaka University",1,0.82922,,0.20207,,0.86143,,0.54661,,36,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,celseq,,Japan,2024-01-29,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 30509,SRR27764649,SRX23429608,SRS20284059,SRP486518,PRJNA1070582,Gene expression profile of neighboring cells of cells with unfit Wnt morphogen gradient during cell competition,GSE254439,Transcriptome Analysis,Morphogen signalling forms an activity gradient and instructs cell identities in a signalling strength dependent manner to pattern developing tissues. However developing tissues also undergo dynamic morphogenesis which may produce cells with unfit morphogen signalling and consequent noisy morphogen gradient. Here we show that a cell competition related system corrects such noisy morphogen gradients. Zebrafish imaging analyses of the Wnt/ß catenin signalling gradient which acts as a morphogen to establish embryonic anterior posterior patterning revealed that unfit cells with abnormal Wnt/ß catenin activity spontaneously appear and produce noise in the gradient. Communication between unfit and neighbouring fit cells via cadherin proteins stimulates apoptosis of the unfit cells by activating Smad signalling and reactive oxygen species production. This unfit cell elimination is required for proper Wnt/ß catenin gradient formation and consequent anterior posterior patterning. Because this gradient controls patterning not only in the embryo but also in adult tissues this system may support tissue robustness and disease prevention. Overall design: ß catCA constitutive active form of ß catenin expressing GFP+ cells or ßcatCA unexpressing GFP cells from ß catCA mosaically introduced zebrafish early embryos were sorted by FACS cell sorter. Total RNAs were extracted and analyzed by RNA seq.,,pubmed:39546611,,Mosaic GFP control GFP min lot1,GSM8042247,,source name:early embryonic cell|strain:AB|tissue:early embryonic cell|developmental stage:9 hpf loc name:missing|collection date:missing,Mosaic GFP control GFP min lot1,Sequenced reads were mapped to the GRCz10 reference genome using Bowtie2 ver. 2.3.1. UMI counts were extracted per HTSeq ver. 0.6.1 from the CEL Seq2 pipeline. Assembly: GRCz10 Supplementary files format and content: Tab delimited text file for expression data normalized by regularized logarithm.,early embryonic cell,,Cells were dissolved in TRIzol reagent Invitrogen and extracted. Samples were prepared according to the CEL Seq2 protocol described in Hashimshony et al. Geneome Biology 2016. Libraries preparation was performed according to the published CEL Seq2 protocol.,,strain:AB|tissue:early embryonic cell|developmental stage:9 hpf,GSM8042247,GSM8042247: Mosaic GFP control GFP min lot1; Danio rerio; RNA Seq,GSM8042247 r1,GSM8042247,1,Cells were dissolved in TRIzol reagent Invitrogen and extracted. Samples were prepared according to the CEL Seq2 protocol described in Hashimshony et al. Geneome Biology 2016. Libraries preparation was performed according to the published CEL Seq2 protocol.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 1500,,SRP486518,,,Mosaic_GFP_control_GFP_min_lot1.fastq.gz,fastq,8256240.0,229340.0,GSM8042247 r1,0:36,A:1947003;C:1345938;G:1692065;T:3271133;N:101,36,,,,1947003,1345938,1692065,3271133,101,SRX23429608,SRS20284059,SRA1793856,"Department of Homeostatic Regulation, Research Institute for Microbial Diseases, Osaka University","Department of Homeostatic Regulation, Research Institute for Microbial Diseases, Osaka University",1,0.83305,,0.17754,,0.8619,,0.61474,,36,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,celseq,,Japan,2024-01-29,Gastrula,Embryo,Embryo Imprecise,All anatomical structures