rowid,run.accession,experiment.accession,sample.accession,study.accession,bioproject,study.title,study.alias,study.type,study.abstract,study.attributes,study.PMIDs,sample.description,sample.title,sample.alias,sample.centername,sample.attributes,GEOsample.title,GEOsample.dataprocessing,GEOsample.source,GEOsample.treatmentprotocol,GEOsample.extractprotocol,GEOsample.growthprotocol,GEOsample.characteristics,GEOsample.accession,experiment.title,experiment.alias,experiment.library_name,experiment.design_description,experiment.library_construction_protocol,experiment.attributes,experiment.library_strategy,experiment.library_source,experiment.library_selection,experiment.library_layout,experiment.platform,experiment.instrument_model,experiment.spot_descriptor,experiment.study_ref,run.title,run.attributes,run.filename,run.semantic_name,run.total_bases,run.total_spots,run.alias,run.read_lengths,run.base_counts,run.r1_length,run.r2_length,run.r3_length,run.r4_length,run.Acount,run.Ccount,run.Gcount,run.Tcount,run.Ncount,run.experiment,run.pool_member,submission.accession,submission.srasource,submission.bioprojectsource,seqdetective.n_mates,seqdetective.mapping_rate.mate1,seqdetective.mapping_rate.mate2,seqdetective.nofeature_rate.mate1,seqdetective.nofeature_rate.mate2,seqdetective.sparsity.mate1,seqdetective.sparsity.mate2,seqdetective.pos_strand_rate.mate1,seqdetective.pos_strand_rate.mate2,seqdetective.readlen.mate1,seqdetective.readlen.mate2,seqdetective.judgement.mate1,seqdetective.judgement.mate2,seqdetective.judgement.reason,platform_family,instrument_generation,read_bias,selection_class,prep_kit,sc_or_bulk,tech_class,technology,tech_variant,submission.bioprojectsource.country,earliest_date,devstage_curation,devstage_curation_coarse,tissue_curation,tissue_curation_coarse
71,DRR032753,DRX029559,DRS049958,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 114 individuals,Dr 8cell 2,SAMD00028150,,sample name:Dr 8cell 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:8cell|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028150,DRX029559,Dr 8cell 2,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028150,,,,3708921900.0,37089219.0,DRR032753,0:100 1:0,A:985502141;C:874161613;G:869551685;T:979663686;N:42775,100,0,,,985502141,874161613,869551685,979663686,42775,DRX029559,DRS049958,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.93329,,0.02366,,0.78896,,0.47447,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Cleavage,Embryo,Whole Organism,All anatomical structures
72,DRR032752,DRX029558,DRS049957,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 96 individuals,Dr 8cell 1,SAMD00028149,,sample name:Dr 8cell 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:8cell|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028149,DRX029558,Dr 8cell 1,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028149,,,,3666991200.0,36669912.0,DRR032752,0:100 1:0,A:976118513;C:862559696;G:858017821;T:970254302;N:40868,100,0,,,976118513,862559696,858017821,970254302,40868,DRX029558,DRS049957,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.934,,0.02403,,0.78877,,0.46902,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Cleavage,Embryo,Whole Organism,All anatomical structures
86,DRR032738,DRX029544,DRS049943,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 100 individuals,Dr 32cell 2,SAMD00028135,,sample name:Dr 32cell 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:32cell|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028135,DRX029544,Dr 32cell 2,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028135,,,,3678713000.0,36787130.0,DRR032738,0:100 1:0,A:981005900;C:863203049;G:859660640;T:974807835;N:35576,100,0,,,981005900,863203049,859660640,974807835,35576,DRX029544,DRS049943,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.93302,,0.02468,,0.77441,,0.47485,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Cleavage,Embryo,Whole Organism,All anatomical structures
87,DRR032737,DRX029543,DRS049942,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 95 individuals,Dr 32cell 1,SAMD00028134,,sample name:Dr 32cell 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:32cell|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028134,DRX029543,Dr 32cell 1,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028134,,,,3870906500.0,38709065.0,DRR032737,0:100 1:0,A:1030407751;C:909948718;G:905608620;T:1024897443;N:43968,100,0,,,1030407751,909948718,905608620,1024897443,43968,DRX029543,DRS049942,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.93364,,0.02484,,0.77307,,0.47588,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Cleavage,Embryo,Whole Organism,All anatomical structures
90,DRR032734,DRX029540,DRS049939,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 107 individuals,Dr 2cell 2,SAMD00028131,,sample name:Dr 2cell 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:2cell|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028131,DRX029540,Dr 2cell 2,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028131,,,,3687517000.0,36875170.0,DRR032734,0:100 1:0,A:975272080;C:873518282;G:869743434;T:968941851;N:41353,100,0,,,975272080,873518282,869743434,968941851,41353,DRX029540,DRS049939,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.93204,,0.02088,,0.81639,,0.47553,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Cleavage,Embryo,Whole Organism,All anatomical structures
91,DRR032733,DRX029539,DRS049938,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 108 individuals,Dr 2cell 1,SAMD00028130,,sample name:Dr 2cell 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:2cell|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028130,DRX029539,Dr 2cell 1,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028130,,,,4156651100.0,41566511.0,DRR032733,0:100 1:0,A:1099943617;C:985498415;G:978884426;T:1092278665;N:45977,100,0,,,1099943617,985498415,978884426,1092278665,45977,DRX029539,DRS049938,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.93452,,0.02198,,0.81197,,0.47342,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Cleavage,Embryo,Whole Organism,All anatomical structures
3155,ERR1410225,ERX1481464,ERS1021813,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 pool12,SAMEA3714664,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714664|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:11Z|INSDC status:public|Submitter Id:e9237f50 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TTCAGCTC is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e9237f50 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#24,15565967,Illumina sequencing of library 15565967 constructed from sample accession ERS1021813 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TTCAGCTC.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#24.cram,cram,682856330.0,5252741.0,SC RUN 18730 4#24,0:55 1:75,A:168217714;C:139075008;G:141169282;T:234338870;N:55456,55,75,,,168217714,139075008,141169282,234338870,55456,ERX1481464,ERS1021813,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.22601,0.6266,0.06302,0.07433,0.95848,0.87767,0.77147,0.72121,55,75,B,B,mate1-mate2 similar by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3156,ERR1410224,ERX1481463,ERS1021812,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 pool11,SAMEA3714663,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714663|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:10Z|INSDC status:public|Submitter Id:e91834b0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TACTAGTC is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e91834b0 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#23,15565966,Illumina sequencing of library 15565966 constructed from sample accession ERS1021812 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TACTAGTC.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#23.cram,cram,784669730.0,6035921.0,SC RUN 18730 4#23,0:55 1:75,A:193369040;C:154930839;G:157589012;T:278718023;N:62816,55,75,,,193369040,154930839,157589012,278718023,62816,ERX1481463,ERS1021812,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.22113,0.66423,0.05856,0.07177,0.95899,0.86705,0.76036,0.71777,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3157,ERR1410223,ERX1481462,ERS1021811,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 pool10,SAMEA3714662,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714662|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:10Z|INSDC status:public|Submitter Id:e90c9bf0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TCAGATTC is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e90c9bf0 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#22,15565965,Illumina sequencing of library 15565965 constructed from sample accession ERS1021811 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TCAGATTC.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#22.cram,cram,1247901590.0,9599243.0,SC RUN 18730 4#22,0:55 1:75,A:314703461;C:244320464;G:241561095;T:447214667;N:101903,55,75,,,314703461,244320464,241561095,447214667,101903,ERX1481462,ERS1021811,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.20694,0.62963,0.04856,0.05487,0.95763,0.87026,0.7137,0.71273,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3158,ERR1410222,ERX1481461,ERS1021810,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 pool9,SAMEA3714661,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714661|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:09Z|INSDC status:public|Submitter Id:e8fe4410 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TATGCCAG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8fe4410 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#21,15565964,Illumina sequencing of library 15565964 constructed from sample accession ERS1021810 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TATGCCAG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#21.cram,cram,1160974880.0,8930576.0,SC RUN 18730 4#21,0:55 1:75,A:287583127;C:233701395;G:225242195;T:414354028;N:94135,55,75,,,287583127,233701395,225242195,414354028,94135,ERX1481461,ERS1021810,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.20242,0.60852,0.05828,0.06484,0.95568,0.87456,0.67452,0.38749,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3159,ERR1410221,ERX1481460,ERS1021809,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 pool8,SAMEA3714660,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714660|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:08Z|INSDC status:public|Submitter Id:e8f2d260 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TGGCTCAG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8f2d260 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#20,15565963,Illumina sequencing of library 15565963 constructed from sample accession ERS1021809 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TGGCTCAG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#20.cram,cram,1041644630.0,8012651.0,SC RUN 18730 4#20,0:55 1:75,A:250361997;C:216927117;G:209137594;T:365137042;N:80880,55,75,,,250361997,216927117,209137594,365137042,80880,ERX1481460,ERS1021809,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.23722,0.6381,0.05317,0.07562,0.95503,0.87671,0.75995,0.72353,55,75,B,B,mate1-mate2 similar by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3160,ERR1410220,ERX1481459,ERS1021808,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 pool7,SAMEA3714659,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714659|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:08Z|INSDC status:public|Submitter Id:e8e787c0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TCATTGAG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8e787c0 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#19,15565962,Illumina sequencing of library 15565962 constructed from sample accession ERS1021808 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TCATTGAG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#19.cram,cram,1002402180.0,7710786.0,SC RUN 18730 4#19,0:55 1:75,A:249654737;C:203437995;G:194586976;T:354640685;N:81787,55,75,,,249654737,203437995,194586976,354640685,81787,ERX1481459,ERS1021808,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.21081,0.61197,0.04352,0.05852,0.9529,0.86815,0.65385,0.64824,55,75,B,B,mate1-mate2 similar by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3161,ERR1410219,ERX1481458,ERS1021807,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 pool6,SAMEA3714658,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714658|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:07Z|INSDC status:public|Submitter Id:e8dc3d20 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TGTATGCG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8dc3d20 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#18,15565961,Illumina sequencing of library 15565961 constructed from sample accession ERS1021807 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TGTATGCG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#18.cram,cram,1001271050.0,7702085.0,SC RUN 18730 4#18,0:55 1:75,A:249131077;C:206043698;G:193568917;T:352446609;N:80749,55,75,,,249131077,206043698,193568917,352446609,80749,ERX1481458,ERS1021807,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.22004,0.6117,0.05313,0.0656,0.95095,0.8758,0.70135,0.69364,55,75,B,B,mate1-mate2 similar by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3162,ERR1410218,ERX1481457,ERS1021806,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 pool5,SAMEA3714657,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714657|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:06Z|INSDC status:public|Submitter Id:e8b183a0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TCCAGTCG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8b183a0 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#17,15565960,Illumina sequencing of library 15565960 constructed from sample accession ERS1021806 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TCCAGTCG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#17.cram,cram,1240938140.0,9545678.0,SC RUN 18730 4#17,0:55 1:75,A:302318036;C:249218633;G:246601321;T:442702025;N:98125,55,75,,,302318036,249218633,246601321,442702025,98125,ERX1481457,ERS1021806,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.23057,0.63523,0.05319,0.067,0.95213,0.86695,0.69753,0.68537,55,75,B,B,mate1-mate2 similar by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3163,ERR1410217,ERX1481456,ERS1021805,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 pool4,SAMEA3714656,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714656|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:06Z|INSDC status:public|Submitter Id:e8ab9030 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TAAGTTCG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8ab9030 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#16,15565959,Illumina sequencing of library 15565959 constructed from sample accession ERS1021805 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TAAGTTCG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#16.cram,cram,942829030.0,7252531.0,SC RUN 18730 4#16,0:55 1:75,A:225274547;C:196341691;G:188483755;T:332654028;N:75009,55,75,,,225274547,196341691,188483755,332654028,75009,ERX1481456,ERS1021805,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.21889,0.64365,0.04363,0.07265,0.95181,0.87478,0.70501,0.69162,55,75,B,B,mate1-mate2 similar by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3164,ERR1410216,ERX1481455,ERS1021804,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 pool3,SAMEA3714655,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714655|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:05Z|INSDC status:public|Submitter Id:e8a5eae0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TCAGGAGG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8a5eae0 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#15,15565958,Illumina sequencing of library 15565958 constructed from sample accession ERS1021804 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TCAGGAGG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#15.cram,cram,992671030.0,7635931.0,SC RUN 18730 4#15,0:55 1:75,A:241776762;C:210080049;G:195284057;T:345448849;N:81313,55,75,,,241776762,210080049,195284057,345448849,81313,ERX1481455,ERS1021804,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.21439,0.6195,0.04725,0.05379,0.95191,0.87606,0.67336,0.65016,55,75,B,B,mate1-mate2 similar by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3165,ERR1410215,ERX1481454,ERS1021803,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 pool2,SAMEA3714654,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714654|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:05Z|INSDC status:public|Submitter Id:e89cc320 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TCTCACGG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e89cc320 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#14,15565957,Illumina sequencing of library 15565957 constructed from sample accession ERS1021803 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TCTCACGG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#14.cram,cram,1234311910.0,9494707.0,SC RUN 18730 4#14,0:55 1:75,A:301439259;C:257228602;G:244500849;T:431043241;N:99959,55,75,,,301439259,257228602,244500849,431043241,99959,ERX1481454,ERS1021803,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.19348,0.62337,0.04021,0.05986,0.95574,0.87941,0.67064,0.69696,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3166,ERR1410214,ERX1481453,ERS1021802,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 pool1,SAMEA3714653,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714653|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:04Z|INSDC status:public|Submitter Id:e897ba10 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TACTTCGG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e897ba10 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#13,15565956,Illumina sequencing of library 15565956 constructed from sample accession ERS1021802 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TACTTCGG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#13.cram,cram,1039867140.0,7998978.0,SC RUN 18730 4#13,0:55 1:75,A:252384576;C:218519074;G:206578085;T:362298880;N:86525,55,75,,,252384576,218519074,206578085,362298880,86525,ERX1481453,ERS1021802,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.18713,0.60956,0.05049,0.0817,0.95556,0.87618,0.66594,0.68034,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3167,ERR1410213,ERX1481452,ERS1021801,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 12,SAMEA3714652,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714652|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:04Z|INSDC status:public|Submitter Id:e89262e0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TGAACTGG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e89262e0 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#12,15565955,Illumina sequencing of library 15565955 constructed from sample accession ERS1021801 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TGAACTGG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#12.cram,cram,1071792020.0,8244554.0,SC RUN 18730 4#12,0:55 1:75,A:266291261;C:216074486;G:207838804;T:381495628;N:91841,55,75,,,266291261,216074486,207838804,381495628,91841,ERX1481452,ERS1021801,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.19027,0.64477,0.0489,0.06997,0.95268,0.86371,0.66594,0.67162,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3168,ERR1410212,ERX1481451,ERS1021800,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 11,SAMEA3714651,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714651|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:03Z|INSDC status:public|Submitter Id:e88d59d0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TTGGTATG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e88d59d0 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#11,15565954,Illumina sequencing of library 15565954 constructed from sample accession ERS1021800 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TTGGTATG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#11.cram,cram,686164570.0,5278189.0,SC RUN 18730 4#11,0:55 1:75,A:165352345;C:146328635;G:134343947;T:240083817;N:55826,55,75,,,165352345,146328635,134343947,240083817,55826,ERX1481451,ERS1021800,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.22823,0.61844,0.08567,0.10696,0.95106,0.86797,0.62805,0.63179,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3169,ERR1410211,ERX1481450,ERS1021799,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 10,SAMEA3714650,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714650|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:03Z|INSDC status:public|Submitter Id:e88829b0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TAACGCTG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e88829b0 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#10,15565953,Illumina sequencing of library 15565953 constructed from sample accession ERS1021799 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TAACGCTG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#10.cram,cram,889043870.0,6838799.0,SC RUN 18730 4#10,0:55 1:75,A:223435089;C:179282347;G:171273337;T:314981588;N:71509,55,75,,,223435089,179282347,171273337,314981588,71509,ERX1481450,ERS1021799,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.19054,0.6472,0.0467,0.06495,0.953,0.86519,0.68221,0.68725,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3170,ERR1410210,ERX1481449,ERS1021798,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 9,SAMEA3714649,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714649|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:02Z|INSDC status:public|Submitter Id:e88320a0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TCGAAGTG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e88320a0 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#9,15565952,Illumina sequencing of library 15565952 constructed from sample accession ERS1021798 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TCGAAGTG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#9.cram,cram,987809940.0,7598538.0,SC RUN 18730 4#9,0:55 1:75,A:248484130;C:197140774;G:188385871;T:353715305;N:83860,55,75,,,248484130,197140774,188385871,353715305,83860,ERX1481449,ERS1021798,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.2215,0.62639,0.05009,0.06362,0.94959,0.86689,0.63702,0.63984,55,75,B,B,mate1-mate2 similar by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3171,ERR1410209,ERX1481448,ERS1021797,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 8,SAMEA3714648,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714648|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:02Z|INSDC status:public|Submitter Id:e87d5440 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TTCCATTG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e87d5440 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#8,15565951,Illumina sequencing of library 15565951 constructed from sample accession ERS1021797 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TTCCATTG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#8.cram,cram,991993340.0,7630718.0,SC RUN 18730 4#8,0:55 1:75,A:248601530;C:201637312;G:190701521;T:350971271;N:81706,55,75,,,248601530,201637312,190701521,350971271,81706,ERX1481448,ERS1021797,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.18071,0.60546,0.04372,0.05614,0.95556,0.87182,0.64904,0.68316,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3172,ERR1410208,ERX1481447,ERS1021796,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 7,SAMEA3714647,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714647|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:01Z|INSDC status:public|Submitter Id:e871e290 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TAGTCTTG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e871e290 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#7,15565950,Illumina sequencing of library 15565950 constructed from sample accession ERS1021796 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TAGTCTTG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#7.cram,cram,1355591770.0,10427629.0,SC RUN 18730 4#7,0:55 1:75,A:333761549;C:285155703;G:270975293;T:465589806;N:109419,55,75,,,333761549,285155703,270975293,465589806,109419,ERX1481447,ERS1021796,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.19403,0.63995,0.03449,0.07104,0.957,0.88641,0.73288,0.71598,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3173,ERR1410207,ERX1481446,ERS1021795,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 6,SAMEA3714646,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714646|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:01Z|INSDC status:public|Submitter Id:e86670e0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TGTGGTTG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e86670e0 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#6,15565949,Illumina sequencing of library 15565949 constructed from sample accession ERS1021795 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TGTGGTTG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#6.cram,cram,1121411330.0,8626241.0,SC RUN 18730 4#6,0:55 1:75,A:275436070;C:245845272;G:219970219;T:380067436;N:92333,55,75,,,275436070,245845272,219970219,380067436,92333,ERX1481446,ERS1021795,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.185,0.59026,0.03934,0.06143,0.95268,0.88968,0.59393,0.69736,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3174,ERR1410206,ERX1481445,ERS1021794,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 5,SAMEA3714645,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714645|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:01Z|INSDC status:public|Submitter Id:e85b2640 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TCCTCAAT is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e85b2640 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#5,15565948,Illumina sequencing of library 15565948 constructed from sample accession ERS1021794 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TCCTCAAT.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#5.cram,cram,852544290.0,6558033.0,SC RUN 18730 4#5,0:55 1:75,A:202033234;C:177211087;G:169900063;T:303332405;N:67501,55,75,,,202033234,177211087,169900063,303332405,67501,ERX1481445,ERS1021794,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.21445,0.62891,0.0753,0.09655,0.95278,0.86929,0.61569,0.48656,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3175,ERR1410205,ERX1481444,ERS1021793,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 4,SAMEA3714644,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714644|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:00Z|INSDC status:public|Submitter Id:e84f8d80 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TACAGGAT is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e84f8d80 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#4,15565947,Illumina sequencing of library 15565947 constructed from sample accession ERS1021793 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TACAGGAT.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#4.cram,cram,989803880.0,7613876.0,SC RUN 18730 4#4,0:55 1:75,A:241562947;C:196888151;G:193862254;T:357404172;N:86356,55,75,,,241562947,196888151,193862254,357404172,86356,ERX1481444,ERS1021793,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.27131,0.63988,0.04128,0.04919,0.95923,0.88292,0.81011,0.7508,55,75,B,B,mate1-mate2 similar by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3176,ERR1410204,ERX1481443,ERS1021792,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 3,SAMEA3714643,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714643|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:00Z|INSDC status:public|Submitter Id:e8441bd0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TAGTGACT is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8441bd0 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#3,15565946,Illumina sequencing of library 15565946 constructed from sample accession ERS1021792 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TAGTGACT.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#3.cram,cram,1144202930.0,8801561.0,SC RUN 18730 4#3,0:55 1:75,A:278906912;C:230946498;G:229591661;T:404660425;N:97434,55,75,,,278906912,230946498,229591661,404660425,97434,ERX1481443,ERS1021792,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.24055,0.6437,0.04616,0.05861,0.9554,0.88221,0.30306,0.73916,55,75,B,B,mate1-mate2 similar by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3177,ERR1410203,ERX1481442,ERS1021791,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 2,SAMEA3714642,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714642|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:41:59Z|INSDC status:public|Submitter Id:e8385c00 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TTCCTGCT is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8385c00 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#2,15565945,Illumina sequencing of library 15565945 constructed from sample accession ERS1021791 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TTCCTGCT.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#2.cram,cram,1459339960.0,11225692.0,SC RUN 18730 4#2,0:55 1:75,A:361580033;C:294777861;G:295641568;T:507221717;N:118781,55,75,,,361580033,294777861,295641568,507221717,118781,ERX1481442,ERS1021791,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.25446,0.64481,0.04258,0.05864,0.95473,0.88562,0.32211,0.75437,55,75,B,B,mate1-mate2 similar by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3178,ERR1410202,ERX1481441,ERS1021790,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 1,SAMEA3714641,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714641|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:41:58Z|INSDC status:public|Submitter Id:e73ff240 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TGCGATCT is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e73ff240 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#1,15565944,Illumina sequencing of library 15565944 constructed from sample accession ERS1021790 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TGCGATCT.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#1.cram,cram,869624210.0,6689417.0,SC RUN 18730 4#1,0:55 1:75,A:211816407;C:178380016;G:176641186;T:302714073;N:72528,55,75,,,211816407,178380016,176641186,302714073,72528,ERX1481441,ERS1021790,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.26789,0.63129,0.0568,0.09239,0.95978,0.88978,0.82999,0.78005,55,75,B,B,mate1-mate2 similar by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3788,ERR1442900,ERX1513277,ERS1079219,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 F,SAMEA3892085,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892085|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:07Z|INSDC status:public|Submitter Id:744149e0 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:744149e0 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19912 2#70,16564972,Illumina sequencing of library 16564972 constructed from sample accession ERS1079219 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 2. This submission includes reads tagged with the sequence GATCTCTT.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19912_2#70.cram,cram,364410400.0,1822052.0,SC RUN 19912 2#70,0:100 1:100,A:96471898;C:85460940;G:85739185;T:96152266;N:586111,100,100,,,96471898,85460940,85739185,96152266,586111,ERX1513277,ERS1079219,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96377,0.96719,0.0976,0.09955,0.79667,0.79693,0.58832,0.58226,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures
3789,ERR1442899,ERX1513276,ERS1079218,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 E,SAMEA3892084,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892084|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74358a10 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74358a10 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19912 2#69,16564960,Illumina sequencing of library 16564960 constructed from sample accession ERS1079218 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 2. This submission includes reads tagged with the sequence GGTGAGTT.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19912_2#69.cram,cram,312144800.0,1560724.0,SC RUN 19912 2#69,0:100 1:100,A:82044388;C:74027006;G:73985684;T:81583681;N:504041,100,100,,,82044388,74027006,73985684,81583681,504041,ERX1513276,ERS1079218,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96275,0.9677,0.10631,0.10791,0.79496,0.79535,0.57643,0.57303,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures
3790,ERR1442898,ERX1513275,ERS1079217,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 D,SAMEA3892083,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892083|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74295510 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74295510 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19912 2#68,16564948,Illumina sequencing of library 16564948 constructed from sample accession ERS1079217 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 2. This submission includes reads tagged with the sequence TGCGTGAA.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19912_2#68.cram,cram,330453000.0,1652265.0,SC RUN 19912 2#68,0:100 1:100,A:87696659;C:77248972;G:77394239;T:87578108;N:535022,100,100,,,87696659,77248972,77394239,87578108,535022,ERX1513275,ERS1079217,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96171,0.96419,0.10779,0.11047,0.79902,0.80018,0.57383,0.56925,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures
3791,ERR1442897,ERX1513274,ERS1079216,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 C,SAMEA3892082,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892082|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:741d9540 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:741d9540 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19912 2#67,16564936,Illumina sequencing of library 16564936 constructed from sample accession ERS1079216 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 2. This submission includes reads tagged with the sequence TACCACCA.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19912_2#67.cram,cram,327261000.0,1636305.0,SC RUN 19912 2#67,0:100 1:100,A:87523901;C:75771535;G:75871608;T:87573282;N:520674,100,100,,,87523901,75771535,75871608,87573282,520674,ERX1513274,ERS1079216,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.95986,0.96354,0.1123,0.11468,0.80156,0.80229,0.58372,0.58338,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures
3792,ERR1442896,ERX1513273,ERS1079215,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 B,SAMEA3892081,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892081|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:05Z|INSDC status:public|Submitter Id:74118750 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74118750 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19912 2#66,16564924,Illumina sequencing of library 16564924 constructed from sample accession ERS1079215 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 2. This submission includes reads tagged with the sequence TGAAGCCA.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19912_2#66.cram,cram,328496600.0,1642483.0,SC RUN 19912 2#66,0:100 1:100,A:86841947;C:77278436;G:77262516;T:86589805;N:523896,100,100,,,86841947,77278436,77262516,86589805,523896,ERX1513273,ERS1079215,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96091,0.96535,0.1279,0.13047,0.79805,0.79857,0.58551,0.58209,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures
3878,ERR1442810,ERX1513187,ERS1079219,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 F,SAMEA3892085,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892085|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:07Z|INSDC status:public|Submitter Id:744149e0 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:744149e0 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19912 1#70,16564972,Illumina sequencing of library 16564972 constructed from sample accession ERS1079219 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 1. This submission includes reads tagged with the sequence GATCTCTT.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19912_1#70.cram,cram,364912600.0,1824563.0,SC RUN 19912 1#70,0:100 1:100,A:96642496;C:85588675;G:85883202;T:96301393;N:496834,100,100,,,96642496,85588675,85883202,96301393,496834,ERX1513187,ERS1079219,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96362,0.96689,0.09725,0.09882,0.79592,0.79703,0.59097,0.5784,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures
3879,ERR1442809,ERX1513186,ERS1079218,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 E,SAMEA3892084,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892084|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74358a10 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74358a10 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19912 1#69,16564960,Illumina sequencing of library 16564960 constructed from sample accession ERS1079218 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 1. This submission includes reads tagged with the sequence GGTGAGTT.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19912_1#69.cram,cram,312470400.0,1562352.0,SC RUN 19912 1#69,0:100 1:100,A:82160555;C:74100532;G:74069193;T:81696066;N:444054,100,100,,,82160555,74100532,74069193,81696066,444054,ERX1513186,ERS1079218,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96376,0.96859,0.10642,0.1079,0.79417,0.79474,0.5752,0.57,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures
3880,ERR1442808,ERX1513185,ERS1079217,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 D,SAMEA3892083,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892083|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74295510 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74295510 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19912 1#68,16564948,Illumina sequencing of library 16564948 constructed from sample accession ERS1079217 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 1. This submission includes reads tagged with the sequence TGCGTGAA.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19912_1#68.cram,cram,330554000.0,1652770.0,SC RUN 19912 1#68,0:100 1:100,A:87747224;C:77298685;G:77439701;T:87616982;N:451408,100,100,,,87747224,77298685,77439701,87616982,451408,ERX1513185,ERS1079217,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96163,0.96436,0.10875,0.1111,0.79928,0.79965,0.57561,0.5708,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures
3881,ERR1442807,ERX1513184,ERS1079216,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 C,SAMEA3892082,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892082|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:741d9540 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:741d9540 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19912 1#67,16564936,Illumina sequencing of library 16564936 constructed from sample accession ERS1079216 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 1. This submission includes reads tagged with the sequence TACCACCA.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19912_1#67.cram,cram,327019400.0,1635097.0,SC RUN 19912 1#67,0:100 1:100,A:87453957;C:75726607;G:75847551;T:87546870;N:444415,100,100,,,87453957,75726607,75847551,87546870,444415,ERX1513184,ERS1079216,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96147,0.9625,0.11258,0.11475,0.79825,0.79924,0.58372,0.56917,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures
3882,ERR1442806,ERX1513183,ERS1079215,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 B,SAMEA3892081,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892081|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:05Z|INSDC status:public|Submitter Id:74118750 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74118750 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19912 1#66,16564924,Illumina sequencing of library 16564924 constructed from sample accession ERS1079215 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 1. This submission includes reads tagged with the sequence TGAAGCCA.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19912_1#66.cram,cram,327613800.0,1638069.0,SC RUN 19912 1#66,0:100 1:100,A:86594522;C:77121933;G:77114321;T:86338082;N:444942,100,100,,,86594522,77121933,77114321,86338082,444942,ERX1513183,ERS1079215,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.9614,0.96527,0.12823,0.13043,0.79762,0.79922,0.58597,0.5851,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures
3968,ERR1442720,ERX1513097,ERS1079219,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 F,SAMEA3892085,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892085|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:07Z|INSDC status:public|Submitter Id:744149e0 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:744149e0 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19850 2#70,16564972,Illumina sequencing of library 16564972 constructed from sample accession ERS1079219 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 2. This submission includes reads tagged with the sequence GATCTCTT.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19850_2#70.cram,cram,371283800.0,1856419.0,SC RUN 19850 2#70,0:100 1:100,A:98443439;C:87187703;G:87417381;T:98100142;N:135135,100,100,,,98443439,87187703,87417381,98100142,135135,ERX1513097,ERS1079219,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96411,0.96451,0.09692,0.09902,0.79657,0.7964,0.58932,0.57779,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures
3969,ERR1442719,ERX1513096,ERS1079218,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 E,SAMEA3892084,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892084|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74358a10 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74358a10 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19850 2#69,16564960,Illumina sequencing of library 16564960 constructed from sample accession ERS1079218 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 2. This submission includes reads tagged with the sequence GGTGAGTT.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19850_2#69.cram,cram,318491400.0,1592457.0,SC RUN 19850 2#69,0:100 1:100,A:83845999;C:75642375;G:75561647;T:83330437;N:110942,100,100,,,83845999,75642375,75561647,83330437,110942,ERX1513096,ERS1079218,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96388,0.96834,0.10544,0.10741,0.79336,0.79417,0.57217,0.56939,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures
3970,ERR1442718,ERX1513095,ERS1079217,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 D,SAMEA3892083,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892083|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74295510 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74295510 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19850 2#68,16564948,Illumina sequencing of library 16564948 constructed from sample accession ERS1079217 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 2. This submission includes reads tagged with the sequence TGCGTGAA.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19850_2#68.cram,cram,335548800.0,1677744.0,SC RUN 19850 2#68,0:100 1:100,A:89188408;C:78543202;G:78653253;T:89044211;N:119726,100,100,,,89188408,78543202,78653253,89044211,119726,ERX1513095,ERS1079217,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96211,0.96612,0.10777,0.11055,0.79724,0.79876,0.57249,0.43044,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures
3971,ERR1442717,ERX1513094,ERS1079216,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 C,SAMEA3892082,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892082|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:741d9540 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:741d9540 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19850 2#67,16564936,Illumina sequencing of library 16564936 constructed from sample accession ERS1079216 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 2. This submission includes reads tagged with the sequence TACCACCA.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19850_2#67.cram,cram,331952200.0,1659761.0,SC RUN 19850 2#67,0:100 1:100,A:88872903;C:76957606;G:77065688;T:88935012;N:120991,100,100,,,88872903,76957606,77065688,88935012,120991,ERX1513094,ERS1079216,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96191,0.96393,0.11342,0.11468,0.799,0.79908,0.58219,0.58045,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures
3972,ERR1442716,ERX1513093,ERS1079215,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 B,SAMEA3892081,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892081|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:05Z|INSDC status:public|Submitter Id:74118750 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74118750 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19850 2#66,16564924,Illumina sequencing of library 16564924 constructed from sample accession ERS1079215 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 2. This submission includes reads tagged with the sequence TGAAGCCA.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19850_2#66.cram,cram,333024200.0,1665121.0,SC RUN 19850 2#66,0:100 1:100,A:88172616;C:78454066;G:78393792;T:87885914;N:117812,100,100,,,88172616,78454066,78393792,87885914,117812,ERX1513093,ERS1079215,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96249,0.96556,0.1289,0.13166,0.79945,0.79961,0.58336,0.58063,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures
4058,ERR1442630,ERX1513007,ERS1079219,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 F,SAMEA3892085,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892085|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:07Z|INSDC status:public|Submitter Id:744149e0 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:744149e0 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19850 1#70,16564972,Illumina sequencing of library 16564972 constructed from sample accession ERS1079219 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 1. This submission includes reads tagged with the sequence GATCTCTT.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19850_1#70.cram,cram,371578800.0,1857894.0,SC RUN 19850 1#70,0:100 1:100,A:98533022;C:87264222;G:87555118;T:98151909;N:74529,100,100,,,98533022,87264222,87555118,98151909,74529,ERX1513007,ERS1079219,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.9636,0.96761,0.09699,0.09916,0.79525,0.79553,0.58618,0.57988,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures
4059,ERR1442629,ERX1513006,ERS1079218,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 E,SAMEA3892084,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892084|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74358a10 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74358a10 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19850 1#69,16564960,Illumina sequencing of library 16564960 constructed from sample accession ERS1079218 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 1. This submission includes reads tagged with the sequence GGTGAGTT.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19850_1#69.cram,cram,318342200.0,1591711.0,SC RUN 19850 1#69,0:100 1:100,A:83801083;C:75621628;G:75578752;T:83271737;N:69000,100,100,,,83801083,75621628,75578752,83271737,69000,ERX1513006,ERS1079218,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96351,0.96877,0.10486,0.10713,0.79423,0.79444,0.57288,0.57375,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures
4060,ERR1442628,ERX1513005,ERS1079217,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 D,SAMEA3892083,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892083|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74295510 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74295510 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19850 1#68,16564948,Illumina sequencing of library 16564948 constructed from sample accession ERS1079217 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 1. This submission includes reads tagged with the sequence TGCGTGAA.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19850_1#68.cram,cram,334846000.0,1674230.0,SC RUN 19850 1#68,0:100 1:100,A:88989528;C:78413149;G:78541907;T:88833028;N:68388,100,100,,,88989528,78413149,78541907,88833028,68388,ERX1513005,ERS1079217,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96197,0.96681,0.10873,0.11111,0.79805,0.7992,0.57474,0.57198,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures
4061,ERR1442627,ERX1513004,ERS1079216,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 C,SAMEA3892082,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892082|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:741d9540 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:741d9540 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19850 1#67,16564936,Illumina sequencing of library 16564936 constructed from sample accession ERS1079216 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 1. This submission includes reads tagged with the sequence TACCACCA.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19850_1#67.cram,cram,332077800.0,1660389.0,SC RUN 19850 1#67,0:100 1:100,A:88958890;C:76946124;G:77079866;T:89022508;N:70412,100,100,,,88958890,76946124,77079866,89022508,70412,ERX1513004,ERS1079216,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96162,0.96369,0.11367,0.11586,0.7992,0.79855,0.58505,0.58088,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures
4062,ERR1442626,ERX1513003,ERS1079215,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 B,SAMEA3892081,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892081|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:05Z|INSDC status:public|Submitter Id:74118750 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74118750 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19850 1#66,16564924,Illumina sequencing of library 16564924 constructed from sample accession ERS1079215 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 1. This submission includes reads tagged with the sequence TGAAGCCA.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19850_1#66.cram,cram,332776400.0,1663882.0,SC RUN 19850 1#66,0:100 1:100,A:88108657;C:78400833;G:78371292;T:87823689;N:71929,100,100,,,88108657,78400833,78371292,87823689,71929,ERX1513003,ERS1079215,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96154,0.96535,0.12909,0.13161,0.79815,0.79959,0.58756,0.58417,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures
8055,ERR022484,ERX008924,ERS017427,ERP000400,PRJEB2333,Sequencing the Zebrafish transcriptome form a range of tissues and developmental stages using the Illumina Genome Analyzer,E-MTAB-434,Other,,,,,E MTAB 434:ZF 2cells,SAMEA898400,Wellcome Sanger Institute,Alias:E MTAB 434:ZF 2cells|Broker name:ArrayExpress|Description:Protocols: Zebrafish embyos or tissues were collected from a Tuebingen strain incross and grown at 28 C. Collected samples were snap frozen on dry ice and stored at 70 C Total RNA was extracted using Trizol Reagent Invitrogen following the manufacturer's instructions. Pellets were resuspended RNase free 10 mM Tris pH 7.5 and the RNA was quantified using a NanoDrop ND 1000 Spectrophotometer Axon Instruments. Total RNA was made into an RNAseq Illumina library following the manufacturer's protocol including a DNase treatment between to 2 rounds of polyA pull down. The libraries have fragment size of 250 to 300 bp.|DevelopmentalStage:embryo|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2011 03 10T17:55:05Z|INSDC last update:2018 03 08T15:25:14Z|INSDC status:public|SRA accession:ERS017427|Sample Name:ERS017427|Sex:mixed|StrainOrLine:Tuebingen|Title:ZF 2cells,,,,,,,,,Illumina Genome Analyzer II paired end sequencing; Sequencing the Zebrafish transcriptome form a range of tissues and developmental stages using the Illumina Genome Analyzer,E MTAB 434:sequencing of Zebrafish embryo 2cells,RNA from Zebrafish embryo 2cells,Sequencing the Zebrafish transcriptome form a range of tissues and developmental stages using the Illumina Genome Analyzer,Zebrafish embyos or tissues were collected from a Tuebingen strain incross and grown at 28 C. Collected samples were snap frozen on dry ice and stored at 70 C Total RNA was extracted using Trizol Reagent Invitrogen following the manufacturer's instructions. Pellets were resuspended RNase free 10 mM Tris pH 7.5 and the RNA was quantified using a NanoDrop ND 1000 Spectrophotometer Axon Instruments. Total RNA was made into an RNAseq Illumina library following the manufacturer's protocol including a DNase treatment between to 2 rounds of polyA pull down. The libraries have fragment size of 250 to 300 bp.,Experimental Factor: DEVELPOMENTAL STAGE:embryo|Experimental Factor: ORGANISM PART:cell,FL-cDNA,TRANSCRIPTOMIC,unspecified,PAIRED,ILLUMINA,Illumina Genome Analyzer II,,ERP000400,Illumina Genome Analyzer II paired end sequencing; Sequencing the Zebrafish transcriptome form a range of tissues and developmental stages using the Illumina Genome Analyzer,ENA FIRST PUBLIC:2011 03 10|ENA LAST UPDATE:2018 11 16,4946_5.srf,srf,3947547008.0,25970704.0,E MTAB 434:4946 5.srf,0:76 1:76,A:1069302461;C:914233601;G:902631356;T:1055986090;N:5393500,76,76,,,1069302461,914233601,902631356,1055986090,5393500,ERX008924,ERS017427,ERA015179,SC|Wellcome Trust Sanger Institute,SC|Wellcome Trust Sanger Institute,2,0.93356,0.93346,0.03988,0.04022,0.79135,0.79198,0.48864,0.48464,76,76,B,B,biological fallback assumption,illumina,early_illumina,unknown,poly_a,unknown,bulk,unknown,unknown,,United Kingdom,2011-03-10,Cleavage,Embryo,Embryo Imprecise,All anatomical structures
8090,ERR034125,ERX012651,ERS032266,ERP000635,PRJEB2512,The Zebrafish transcriptome during early development,KI-BN-JKE-DRERIO-RNASEQ-2011,Transcriptome Analysis,Background: Zebrafish Danio rerio is an important model for the study of early vertebrate development. The transition from fertilized egg to embryo is accompanied by a multitude of changes in gene expression and the transcriptional events that underlie these processes have not been fully characterized. In this study we use RNA Seq to characterize and compare the transcriptome of four early developmental stages in zebrafish on a global scale. Results: An average of 79M total reads were detected from the different stages. Out of the total number of reads 65% 73% reads were successfully mapped to the zebrafish genome and 36% 44% out of those were uniquely mapped. The total number of detected unique gene transcripts was 11187 of which 10096 of these were already present at 1 cell stage. The largest number of common transcripts was observed between 1 cell stage and 16 cell stage. An enrichment of gene transcripts with molecular functions of DNA binding protein folding and processing as well as metal ion binding was observed with progression of development. To confirm our RNA Seq results and to further investigate the developmental expression of specific genes the transcript levels of a subset of genes were analyzed using TaqMan® array micro fluidic card TLDA. Conclusion: Clustering analysis of the detected transcripts show a majority of gene transcripts being present at steady levels with a minority of the gene transcripts clustering as increasing or decreasing in expression during development. Developmental stages pre MBT were similar when comparing highly expressed genes whereas 50% epiboly stage differed from the earlier three stages in highly expressed genes number of uniquely expressed genes and enrichment of GO molecular functions.,,,RNA extracted from zebrafish embryo at 16 cell stage,zebrafish embryo 16 cell,SAMEA791631,"Department of Biosciences and Nutrition, Karolinska Institutet, Sweden",ENA first public:2011 06 09|ENA last update:2018 03 08|External Id:SAMEA791631|INSDC center alias:KI BN|INSDC center name:Department of Biosciences and Nutrition Karolinska Institutet Sweden|INSDC first public:2011 06 09T11:04:10Z|INSDC last update:2018 03 08T15:26:39Z|INSDC status:public|Submitter Id:KI BN JKE DRERIO RNASEQ 2011 16cell|common name:zebrafish|sample name:KI BN JKE DRERIO RNASEQ 2011 16cell|sex:mixed|strain:Tuebingen,,,,,,,,,Transcriptome profiling of early zebrafish development,KI BN JKE DRERIO RNASEQ 2011 16cell,JKE Drerio rna seq,Transcriptome profiling of 16 cell stage of zebrafish embryos.,Total RNA was extracted from approximately 150 embryos per developmental stage using Trireagent Sigma Aldrich. The total RNA was then processed further according to the Small RNA Expression Kit Applied Biosystems.,,RNA-Seq,TRANSCRIPTOMIC,RANDOM,SINGLE,ABI_SOLID,AB SOLiD System 3.0,500Application ReadForward1,ERP000635,AB SOLiD System 3.0 sequencing; Transcriptome profiling of early zebrafish development,ENA FIRST PUBLIC:2011 06 09|ENA LAST UPDATE:2018 11 16,KI-BN-JKE-DRERIO-RNASEQ-2011-16cell.csfasta.gz KI-BN-JKE-DRERIO-RNASEQ-2011-16cell_QV.qual.gz,SOLiD_native SOLiD_native,4256756500.0,85135130.0,KI BN JKE DRERIO RNASEQ 2011 16cell,0:50,,50,,,,,,,,,ERX012651,ERS032266,ERA029959,KI-BN|Department of Biosciences and Nutrition,"Department of Biosciences and Nutrition, Karolinska Institutet, Sweden",1,0.57946,,0.08115,,0.91896,,0.72164,,50,,B,,usable mapping rate,legacy,early,unknown,random_priming,unknown,bulk,unknown,unknown,,Sweden,2011-06-09,Cleavage,Embryo,Embryo Imprecise,All anatomical structures
9296,ERR202508,ERX177193,ERS092407,ERP001280,PRJEB2925,maternal to Zygotic Transition,maternal_to_Zygotic_Transition-sc-2012-03-12T11:38:43Z-599,Transcriptome Analysis,During early stages of embryonic development the genome is transcriptionally inactive and cells are under the control of maternally provided mRNA and proteins. At a key point in development known as the maternal to zygotic transition MZT the genome becomes activated and the maternally provided mRNAs begin to degrade. We plan to map the mRNA profiles of genes during the maternal to zygotic transition by using solexa sequencing.,,,,,SAMEA1570569,SC,ArrayExpress DevelopmentalStage:2 cell|ArrayExpress Genotype:T/LF|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Phenotype:WT|ArrayExpress Sex:mixed|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2012 11 28T14:59:05Z|ENA LAST UPDATE:2018 03 08T15:36:29Z|External Id:SAMEA1570569|INSDC center name:SC|INSDC first public:2012 11 28T14:59:05Z|INSDC last update:2018 03 08T15:36:29Z|INSDC status:public|Submitter Id:2C TotRNA sc 2012 02 06T13:12:17Z 1121923|common name:zebrafish|sample description:RNA seq|sample name:2C TotRNA sc 2012 02 06T13:12:17Z 1121923|scientific name:Danio rerio|strain:T/LF,,,,,,,,,1,SC EXP 6683 2,2532385,Illumina sequencing of library 2532385 constructed from sample accession ERS092407 for study accession ERP001280.,Illumina cDNA protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP001280,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2012 11 28|ENA LAST UPDATE:2018 11 16,6683_2.bam,bam,11463941550.0,76426277.0,SC RUN 6683 2,0:75 1:75,A:2384324967;C:3291391074;G:3291238330;T:2457078635;N:39908544,75,75,,,2384324967,3291391074,3291238330,2457078635,39908544,ERX177193,ERS092407,ERA176708,SC,Wellcome Sanger Institute,2,0.96484,0.95918,0.35968,0.35526,0.88404,0.88485,0.84949,0.8524,75,75,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2012-11-28,Cleavage,Embryo,Whole Organism,All anatomical structures
9298,ERR202506,ERX177191,ERS092405,ERP001280,PRJEB2925,maternal to Zygotic Transition,maternal_to_Zygotic_Transition-sc-2012-03-12T11:38:43Z-599,Transcriptome Analysis,During early stages of embryonic development the genome is transcriptionally inactive and cells are under the control of maternally provided mRNA and proteins. At a key point in development known as the maternal to zygotic transition MZT the genome becomes activated and the maternally provided mRNAs begin to degrade. We plan to map the mRNA profiles of genes during the maternal to zygotic transition by using solexa sequencing.,,,,,SAMEA1570534,SC,ArrayExpress DevelopmentalStage:16 cell|ArrayExpress Genotype:T/LF|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Phenotype:WT|ArrayExpress Sex:mixed|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2012 11 28T14:59:05Z|ENA LAST UPDATE:2018 03 08T15:36:25Z|External Id:SAMEA1570534|INSDC center name:SC|INSDC first public:2012 11 28T14:59:05Z|INSDC last update:2018 03 08T15:36:25Z|INSDC status:public|Submitter Id:16C stan pro sc 2012 02 06T13:12:14Z 1121921|common name:zebrafish|sample description:RNA seq|sample name:16C stan pro sc 2012 02 06T13:12:14Z 1121921|scientific name:Danio rerio|strain:T/LF,,,,,,,,,1,SC EXP 6317 5,2532383,Illumina sequencing of library 2532383 constructed from sample accession ERS092405 for study accession ERP001280.,Illumina cDNA protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP001280,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2012 11 28|ENA LAST UPDATE:2018 11 16,6317_5.bam,bam,7092438300.0,47282922.0,SC RUN 6317 5,0:75 1:75,A:1947926886;C:1582039071;G:1595096528;T:1959471222;N:7904593,75,75,,,1947926886,1582039071,1595096528,1959471222,7904593,ERX177191,ERS092405,ERA176708,SC,Wellcome Sanger Institute,2,0.90801,0.90631,0.0426,0.04216,0.78486,0.78539,0.4795,0.47872,75,75,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2012-11-28,Cleavage,Embryo,Whole Organism,All anatomical structures
9301,ERR202503,ERX177188,ERS092094,ERP001280,PRJEB2925,maternal to Zygotic Transition,maternal_to_Zygotic_Transition-sc-2012-03-12T11:38:43Z-599,Transcriptome Analysis,During early stages of embryonic development the genome is transcriptionally inactive and cells are under the control of maternally provided mRNA and proteins. At a key point in development known as the maternal to zygotic transition MZT the genome becomes activated and the maternally provided mRNAs begin to degrade. We plan to map the mRNA profiles of genes during the maternal to zygotic transition by using solexa sequencing.,,,,,SAMEA1570566,SC,ArrayExpress DevelopmentalStage:64 cell|ArrayExpress Genotype:SAT/WIK|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Phenotype:WT|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2012 11 28T14:59:05Z|ENA LAST UPDATE:2018 03 08T15:36:31Z|External Id:SAMEA1570566|INSDC center name:SC|INSDC first public:2012 11 28T14:59:05Z|INSDC last update:2018 03 08T15:36:31Z|INSDC status:public|Submitter Id:SAT b sc 2012 02 06T13:05:45Z 998060|common name:zebrafish|sample description:RNA seq|sample name:SAT b sc 2012 02 06T13:05:45Z 998060|scientific name:Danio rerio|strain:SAT,,,,,,,,,1,SC EXP 5552 6,1476240,Illumina sequencing of library 1476240 constructed from sample accession ERS092094 for study accession ERP001280.,Illumina cDNA protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina Genome Analyzer II,,ERP001280,Illumina Genome Analyzer II paired end sequencing,ENA FIRST PUBLIC:2012 11 28|ENA LAST UPDATE:2018 11 16,5552_6.bam,bam,3031861428.0,28072791.0,SC RUN 5552 6,0:54 1:54,A:827548202;C:685397282;G:689217947;T:827560833;N:2137164,54,54,,,827548202,685397282,689217947,827560833,2137164,ERX177188,ERS092094,ERA176708,SC,Wellcome Sanger Institute,2,0.88709,0.8867,0.04219,0.04381,0.76836,0.76978,0.48688,0.48607,54,54,B,B,biological fallback assumption,illumina,early_illumina,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2012-11-28,Cleavage,Embryo,Whole Organism,All anatomical structures
9304,ERR202500,ERX177185,ERS092093,ERP001280,PRJEB2925,maternal to Zygotic Transition,maternal_to_Zygotic_Transition-sc-2012-03-12T11:38:43Z-599,Transcriptome Analysis,During early stages of embryonic development the genome is transcriptionally inactive and cells are under the control of maternally provided mRNA and proteins. At a key point in development known as the maternal to zygotic transition MZT the genome becomes activated and the maternally provided mRNAs begin to degrade. We plan to map the mRNA profiles of genes during the maternal to zygotic transition by using solexa sequencing.,,,,,SAMEA1570541,SC,ArrayExpress DevelopmentalStage:2 cell|ArrayExpress Genotype:SAT/WIK|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Phenotype:WT|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2012 11 28T14:59:05Z|ENA LAST UPDATE:2018 03 08T15:36:13Z|External Id:SAMEA1570541|INSDC center name:SC|INSDC first public:2012 11 28T14:59:05Z|INSDC last update:2018 03 08T15:36:13Z|INSDC status:public|Submitter Id:SAT a sc 2012 02 06T13:05:43Z 998059|common name:zebrafish|sample description:RNA seq|sample name:SAT a sc 2012 02 06T13:05:43Z 998059|scientific name:Danio rerio|strain:SAT,,,,,,,,,1,SC EXP 5540 7,1392795,Illumina sequencing of library 1392795 constructed from sample accession ERS092093 for study accession ERP001280.,Illumina cDNA protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina Genome Analyzer II,,ERP001280,Illumina Genome Analyzer II paired end sequencing,ENA FIRST PUBLIC:2012 11 28|ENA LAST UPDATE:2018 11 16,5540_7.bam,bam,4139896608.0,38332376.0,SC RUN 5540 7,0:54 1:54,A:1123995667;C:935834208;G:933659183;T:1138309303;N:8098247,54,54,,,1123995667,935834208,933659183,1138309303,8098247,ERX177185,ERS092093,ERA176708,SC,Wellcome Sanger Institute,2,0.89473,0.89261,0.0475,0.0496,0.80413,0.80551,0.49672,0.49064,54,54,B,B,biological fallback assumption,illumina,early_illumina,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2012-11-28,Cleavage,Embryo,Whole Organism,All anatomical structures
9308,ERR202496,ERX177181,ERS092089,ERP001280,PRJEB2925,maternal to Zygotic Transition,maternal_to_Zygotic_Transition-sc-2012-03-12T11:38:43Z-599,Transcriptome Analysis,During early stages of embryonic development the genome is transcriptionally inactive and cells are under the control of maternally provided mRNA and proteins. At a key point in development known as the maternal to zygotic transition MZT the genome becomes activated and the maternally provided mRNAs begin to degrade. We plan to map the mRNA profiles of genes during the maternal to zygotic transition by using solexa sequencing.,,,,,SAMEA1570537,SC,ArrayExpress DevelopmentalStage:64 cell|ArrayExpress Genotype:WIK/SAT|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Phenotype:WT|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2012 11 28T14:59:05Z|ENA LAST UPDATE:2018 03 08T15:36:15Z|External Id:SAMEA1570537|INSDC center name:SC|INSDC first public:2012 11 28T14:59:05Z|INSDC last update:2018 03 08T15:36:15Z|INSDC status:public|Submitter Id:WIK b sc 2012 02 06T13:05:39Z 998055|common name:zebrafish|sample description:RNA seq|sample name:WIK b sc 2012 02 06T13:05:39Z 998055|scientific name:Danio rerio|strain:WIK,,,,,,,,,1,SC EXP 5540 2,1392791,Illumina sequencing of library 1392791 constructed from sample accession ERS092089 for study accession ERP001280.,Illumina cDNA protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina Genome Analyzer II,,ERP001280,Illumina Genome Analyzer II paired end sequencing,ENA FIRST PUBLIC:2012 11 28|ENA LAST UPDATE:2018 11 16,5540_2.bam,bam,3934066536.0,36426542.0,SC RUN 5540 2,0:54 1:54,A:1089272408;C:875257818;G:871131618;T:1090449345;N:7955347,54,54,,,1089272408,875257818,871131618,1090449345,7955347,ERX177181,ERS092089,ERA176708,SC,Wellcome Sanger Institute,2,0.92002,0.92014,0.04875,0.05104,0.76061,0.76161,0.4821,0.48296,54,54,B,B,biological fallback assumption,illumina,early_illumina,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2012-11-28,Cleavage,Embryo,Whole Organism,All anatomical structures
9309,ERR202495,ERX177180,ERS092088,ERP001280,PRJEB2925,maternal to Zygotic Transition,maternal_to_Zygotic_Transition-sc-2012-03-12T11:38:43Z-599,Transcriptome Analysis,During early stages of embryonic development the genome is transcriptionally inactive and cells are under the control of maternally provided mRNA and proteins. At a key point in development known as the maternal to zygotic transition MZT the genome becomes activated and the maternally provided mRNAs begin to degrade. We plan to map the mRNA profiles of genes during the maternal to zygotic transition by using solexa sequencing.,,,,,SAMEA1570572,SC,ArrayExpress DevelopmentalStage:2 cell|ArrayExpress Genotype:WIK/SAT|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Phenotype:WT|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2012 11 28T14:59:05Z|ENA LAST UPDATE:2018 03 08T15:36:31Z|External Id:SAMEA1570572|INSDC center name:SC|INSDC first public:2012 11 28T14:59:05Z|INSDC last update:2018 03 08T15:36:31Z|INSDC status:public|Submitter Id:WIK a sc 2012 02 06T13:05:37Z 998054|common name:zebrafish|sample description:RNA seq|sample name:WIK a sc 2012 02 06T13:05:37Z 998054|scientific name:Danio rerio|strain:WIK,,,,,,,,,1,SC EXP 5540 1,1392790,Illumina sequencing of library 1392790 constructed from sample accession ERS092088 for study accession ERP001280.,Illumina cDNA protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina Genome Analyzer II,,ERP001280,Illumina Genome Analyzer II paired end sequencing,ENA FIRST PUBLIC:2012 11 28|ENA LAST UPDATE:2018 11 16,5540_1.bam,bam,4120158204.0,38149613.0,SC RUN 5540 1,0:54 1:54,A:1165514767;C:896704109;G:892695229;T:1156428740;N:8815359,54,54,,,1165514767,896704109,892695229,1156428740,8815359,ERX177180,ERS092088,ERA176708,SC,Wellcome Sanger Institute,2,0.9228,0.92241,0.05498,0.05795,0.79091,0.79235,0.50034,0.50151,54,54,B,B,biological fallback assumption,illumina,early_illumina,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2012-11-28,Cleavage,Embryo,Whole Organism,All anatomical structures
28560,SRR26395034,SRX22100899,SRS19166025,SRP466518,PRJNA1028258,Zygotic activation of transposable elements during zebrafish early embryogenesis,PRJNA1028258,Other,Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age.,,pubmed:40246845,,,64 cell RNA seq rep8,,strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 64 8|BioSampleModel:Model organism or animal,,,,,,,,,Illumina RNA seq of zebrafish: 64 cell replicate8,DR 035,DR 035,mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage.,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,HiSeq X Ten,,SRP466518,,,C64-8_1.fq.gz C64-8_2.fq.gz,fastq fastq,13755975120.0,50948056.0,C64 8 1.fq.gz,0:135 1:135,A:3658420874;C:3226727105;G:3239474262;T:3628930832;N:2422047,135,135,,,3658420874,3226727105,3239474262,3628930832,2422047,SRX22100899,SRS19166025,SRA1731898,University of Michigan|Computational Medicine and Bioinformatics,University of Michigan,2,0.92463,0.92386,0.0253,0.02389,0.77441,0.77851,0.48196,0.47927,135,135,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,United States,2023-10-16,Cleavage,Embryo,Embryo Imprecise,All anatomical structures
28561,SRR26395035,SRX22100898,SRS19166024,SRP466518,PRJNA1028258,Zygotic activation of transposable elements during zebrafish early embryogenesis,PRJNA1028258,Other,Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age.,,pubmed:40246845,,,64 cell RNA seq rep7,,strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 64 7|BioSampleModel:Model organism or animal,,,,,,,,,Illumina RNA seq of zebrafish: 64 cell replicate7,DR 034,DR 034,mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage.,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,HiSeq X Ten,,SRP466518,,,C64-7_1.fq.gz C64-7_2.fq.gz,fastq fastq,14250954780.0,52781314.0,C64 7 1.fq.gz,0:135 1:135,A:3810945650;C:3320623800;G:3339892194;T:3776960886;N:2532250,135,135,,,3810945650,3320623800,3339892194,3776960886,2532250,SRX22100898,SRS19166024,SRA1731898,University of Michigan|Computational Medicine and Bioinformatics,University of Michigan,2,0.93734,0.93685,0.02705,0.02576,0.77553,0.7791,0.47481,0.47745,135,135,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,United States,2023-10-16,Cleavage,Embryo,Embryo Imprecise,All anatomical structures
28562,SRR26395036,SRX22100897,SRS19166023,SRP466518,PRJNA1028258,Zygotic activation of transposable elements during zebrafish early embryogenesis,PRJNA1028258,Other,Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age.,,pubmed:40246845,,,64 cell RNA seq rep6,,strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 64 6|BioSampleModel:Model organism or animal,,,,,,,,,Illumina RNA seq of zebrafish: 64 cell replicate6,DR 033,DR 033,mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage.,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,HiSeq X Ten,,SRP466518,,,C64-6_1.fq.gz C64-6_2.fq.gz,fastq fastq,14251193190.0,52782197.0,C64 6 1.fq.gz,0:135 1:135,A:3801408063;C:3332053069;G:3345233238;T:3769986735;N:2512085,135,135,,,3801408063,3332053069,3345233238,3769986735,2512085,SRX22100897,SRS19166023,SRA1731898,University of Michigan|Computational Medicine and Bioinformatics,University of Michigan,2,0.94348,0.94342,0.02571,0.02414,0.77112,0.77492,0.48218,0.4777,135,135,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,United States,2023-10-16,Cleavage,Embryo,Embryo Imprecise,All anatomical structures
28563,SRR26395037,SRX22100896,SRS19166022,SRP466518,PRJNA1028258,Zygotic activation of transposable elements during zebrafish early embryogenesis,PRJNA1028258,Other,Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age.,,pubmed:40246845,,,64 cell RNA seq rep5,,strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 64 5|BioSampleModel:Model organism or animal,,,,,,,,,Illumina RNA seq of zebrafish: 64 cell replicate5,DR 032,DR 032,mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage.,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,HiSeq X Ten,,SRP466518,,,C64-5_1.fq.gz C64-5_2.fq.gz,fastq fastq,15142948650.0,56084995.0,C64 5 1.fq.gz,0:135 1:135,A:4031434744;C:3549307228;G:3562636129;T:3996868396;N:2702153,135,135,,,4031434744,3549307228,3562636129,3996868396,2702153,SRX22100896,SRS19166022,SRA1731898,University of Michigan|Computational Medicine and Bioinformatics,University of Michigan,2,0.93753,0.93663,0.02519,0.024,0.77301,0.77674,0.47421,0.46951,135,135,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,United States,2023-10-16,Cleavage,Embryo,Embryo Imprecise,All anatomical structures
28564,SRR26395038,SRX22100895,SRS19166021,SRP466518,PRJNA1028258,Zygotic activation of transposable elements during zebrafish early embryogenesis,PRJNA1028258,Other,Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age.,,pubmed:40246845,,,64 cell RNA seq rep4,,strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 64 4|BioSampleModel:Model organism or animal,,,,,,,,,Illumina RNA seq of zebrafish: 64 cell replicate4,DR 031,DR 031,mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage.,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,HiSeq X Ten,,SRP466518,,,C64-4_1.fq.gz C64-4_2.fq.gz,fastq fastq,14488466220.0,53660986.0,C64 4 1.fq.gz,0:135 1:135,A:3863267905;C:3389148218;G:3402037749;T:3831469669;N:2542679,135,135,,,3863267905,3389148218,3402037749,3831469669,2542679,SRX22100895,SRS19166021,SRA1731898,University of Michigan|Computational Medicine and Bioinformatics,University of Michigan,2,0.93879,0.93825,0.02613,0.02437,0.77212,0.77577,0.47796,0.47196,135,135,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,United States,2023-10-16,Cleavage,Embryo,Embryo Imprecise,All anatomical structures
28566,SRR26395040,SRX22100893,SRS19166019,SRP466518,PRJNA1028258,Zygotic activation of transposable elements during zebrafish early embryogenesis,PRJNA1028258,Other,Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age.,,pubmed:40246845,,,64 cell RNA seq rep3,,strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 64 3|BioSampleModel:Model organism or animal,,,,,,,,,Illumina RNA seq of zebrafish: 64 cell replicate3,DR 030,DR 030,mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage.,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,HiSeq X Ten,,SRP466518,,,C64-3_1.fq.gz C64-3_2.fq.gz,fastq fastq,16017940620.0,59325706.0,C64 3 1.fq.gz,0:135 1:135,A:4273558549;C:3744205640;G:3760255830;T:4237074764;N:2845837,135,135,,,4273558549,3744205640,3760255830,4237074764,2845837,SRX22100893,SRS19166019,SRA1731898,University of Michigan|Computational Medicine and Bioinformatics,University of Michigan,2,0.93688,0.9383,0.02702,0.02595,0.77433,0.7767,0.47319,0.47413,135,135,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,United States,2023-10-16,Cleavage,Embryo,Embryo Imprecise,All anatomical structures
28567,SRR26395041,SRX22100892,SRS19166018,SRP466518,PRJNA1028258,Zygotic activation of transposable elements during zebrafish early embryogenesis,PRJNA1028258,Other,Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age.,,pubmed:40246845,,,64 cell RNA seq rep2,,strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 64 2|BioSampleModel:Model organism or animal,,,,,,,,,Illumina RNA seq of zebrafish: 64 cell replicate2,DR 029,DR 029,mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage.,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,HiSeq X Ten,,SRP466518,,,C64-2_1.fq.gz C64-2_2.fq.gz,fastq fastq,16732836630.0,61973469.0,C64 2 1.fq.gz,0:135 1:135,A:4451249064;C:3924735460;G:3940154978;T:4413679398;N:3017730,135,135,,,4451249064,3924735460,3940154978,4413679398,3017730,SRX22100892,SRS19166018,SRA1731898,University of Michigan|Computational Medicine and Bioinformatics,University of Michigan,2,0.94302,0.94257,0.02459,0.02333,0.77248,0.77479,0.47902,0.47678,135,135,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,United States,2023-10-16,Cleavage,Embryo,Embryo Imprecise,All anatomical structures
28568,SRR26395042,SRX22100891,SRS19166017,SRP466518,PRJNA1028258,Zygotic activation of transposable elements during zebrafish early embryogenesis,PRJNA1028258,Other,Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age.,,pubmed:40246845,,,64 cell RNA seq rep1,,strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 64 1|BioSampleModel:Model organism or animal,,,,,,,,,Illumina RNA seq of zebrafish: 64 cell replicate1,DR 028,DR 028,mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage.,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,HiSeq X Ten,,SRP466518,,,C64-1_1.fq.gz C64-1_2.fq.gz,fastq fastq,16459047450.0,60959435.0,C64 1 1.fq.gz,0:135 1:135,A:4391773658;C:3847087464;G:3866793612;T:4350489494;N:2903222,135,135,,,4391773658,3847087464,3866793612,4350489494,2903222,SRX22100891,SRS19166017,SRA1731898,University of Michigan|Computational Medicine and Bioinformatics,University of Michigan,2,0.94676,0.94707,0.02568,0.0244,0.77236,0.77593,0.48374,0.47691,135,135,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,United States,2023-10-16,Cleavage,Embryo,Embryo Imprecise,All anatomical structures
28576,SRR26395050,SRX22100883,SRS19166009,SRP466518,PRJNA1028258,Zygotic activation of transposable elements during zebrafish early embryogenesis,PRJNA1028258,Other,Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age.,,pubmed:40246845,,,64 cell Iso seq,,strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:LR 3|BioSampleModel:Model organism or animal,,,,,,,,,PacBio Iso seq of zebrafish: 64 cell,DR 003,DR 003,Total RNA was isolated from each developmental stages of zebrafish embryos using TRIzolTM Reagent Invitrogen. RNA purity and concentration were assessed with the NanoPhotometer spectrophotometer IMPLEN CA USA and the Qubit RNA Assay Kit in the Qubit 3.0 Fluorometer Life Technologies CA USA. The RNA integrity number RIN was determined using the RNA Nano 6000 Assay Kit and Agilent Bioanalyzer 2100 system Agilent Technologies CA USA. RNA samples with a RIN 8 were used to synthesize cDNA with SMARTerPCR cDNA Synthesis Kit Takara Bio USA Inc. Mountain View CA USA. PCR amplification was performed using a KAPA HiFi PCR Kit Kapa Biosystems Wilmington MA USA with the optimized number of cycles. Size selection of PCR products cDNA for each sample was applied using the BluePippin System: <3 kb and >3 kb. Subsequently two cDNA libraries <3 kb >3 kb were prepared using a SMRTbell Template Prep Kit 1.0 Pacific Biosciences Menlo Park CA USA and sequenced on the PacBio sequel II platform.,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,PACBIO_SMRT,Sequel,,SRP466518,,,cell64_1.ccs.fq.gz cell64_2.ccs.fq.gz,fastq fastq,2829660788.0,1238867.0,cell64 1.ccs.fq.gz,0:2284.07,A:765802910;C:646754322;G:668768985;T:748334571;N:0,2284,,,,765802910,646754322,668768985,748334571,0,SRX22100883,SRS19166009,SRA1731898,University of Michigan|Computational Medicine and Bioinformatics,University of Michigan,1,0.37504,,0.00108,,0.91149,,0.48939,,1913,,T,,long read,pacbio,pacbio_modern,full_length,poly_a,unknown,bulk,unknown,unknown,,United States,2023-10-16,Cleavage,Embryo,Embryo Imprecise,All anatomical structures
28935,SRR26845669,SRX22541151,SRS19550737,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 2hour wt 75mM s4u r2,GSM7903257,,tissue:Embryos at 2 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 2hour wt 75mM s4u r2,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 2 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:2 hpf of [AB TU]x[TL TLF],GSM7903257,GSM7903257: zebrafish 2hour wt 75mM s4u r2; Danio rerio; RNA Seq,GSM7903257 r1,GSM7903257,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s2h_2.fastq.gz,fastq,4440596805.0,43966305.0,GSM7903257 r1,0:101,A:1543708731;C:806593065;G:905733733;T:1182095254;N:2466022,101,,,,1543708731,806593065,905733733,1182095254,2466022,SRX22541151,SRS19550737,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.63778,,0.15677,,0.82676,,0.61166,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Cleavage,Embryo,Embryo Imprecise,All anatomical structures
28936,SRR26845670,SRX22541150,SRS19550735,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 2hour wt 75mM s4u r1,GSM7903256,,tissue:Embryos at 2 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 2hour wt 75mM s4u r1,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 2 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:2 hpf of [AB TU]x[TL TLF],GSM7903256,GSM7903256: zebrafish 2hour wt 75mM s4u r1; Danio rerio; RNA Seq,GSM7903256 r1,GSM7903256,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s2h_1.fastq.gz,fastq,4689849655.0,46434155.0,GSM7903256 r1,0:101,A:1611038201;C:846984275;G:953714532;T:1275424861;N:2687786,101,,,,1611038201,846984275,953714532,1275424861,2687786,SRX22541150,SRS19550735,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.67301,,0.15612,,0.82171,,0.63462,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Cleavage,Embryo,Embryo Imprecise,All anatomical structures
28937,SRR26845671,SRX22541149,SRS19550733,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 1hour wt 75mM s4u r3,GSM7903255,,tissue:Embryos at 1 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 1hour wt 75mM s4u r3,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 1 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:1 hpf of [AB TU]x[TL TLF],GSM7903255,GSM7903255: zebrafish 1hour wt 75mM s4u r3; Danio rerio; RNA Seq,GSM7903255 r1,GSM7903255,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s1h_3.fastq.gz,fastq,5540992108.0,54861308.0,GSM7903255 r1,0:101,A:1856189531;C:1011042624;G:1124613529;T:1546055477;N:3090947,101,,,,1856189531,1011042624,1124613529,1546055477,3090947,SRX22541149,SRS19550733,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.72187,,0.16436,,0.82416,,0.64431,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Cleavage,Embryo,Embryo Imprecise,All anatomical structures
28938,SRR26845672,SRX22541148,SRS19550734,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 1hour wt 75mM s4u r2,GSM7903254,,tissue:Embryos at 1 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 1hour wt 75mM s4u r2,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 1 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:1 hpf of [AB TU]x[TL TLF],GSM7903254,GSM7903254: zebrafish 1hour wt 75mM s4u r2; Danio rerio; RNA Seq,GSM7903254 r1,GSM7903254,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s1h_2.fastq.gz,fastq,4572239397.0,45269697.0,GSM7903254 r1,0:101,A:1530268631;C:831534079;G:915378596;T:1292534173;N:2523918,101,,,,1530268631,831534079,915378596,1292534173,2523918,SRX22541148,SRS19550734,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.72394,,0.15187,,0.81753,,0.63236,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Cleavage,Embryo,Embryo Imprecise,All anatomical structures
28939,SRR26845673,SRX22541147,SRS19550732,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 1hour wt 75mM s4u r1,GSM7903253,,tissue:Embryos at 1 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 1hour wt 75mM s4u r1,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 1 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:1 hpf of [AB TU]x[TL TLF],GSM7903253,GSM7903253: zebrafish 1hour wt 75mM s4u r1; Danio rerio; RNA Seq,GSM7903253 r1,GSM7903253,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s1h_1.fastq.gz,fastq,4271986597.0,42296897.0,GSM7903253 r1,0:101,A:1447221671;C:787487923;G:887526673;T:1147409594;N:2340736,101,,,,1447221671,787487923,887526673,1147409594,2340736,SRX22541147,SRS19550732,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.68805,,0.18469,,0.83175,,0.62945,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Cleavage,Embryo,Embryo Imprecise,All anatomical structures
29229,SRR27489746,SRX23160963,SRS20111121,SRP483112,PRJNA1056276,five prime UTR MPRA during early zebrafish embryogenesis,PRJNA1056276,Other,The goal is to determine the contribution of zebrafish five prime UTR sequences to translation initiation. The five prime UTR MPRA reporter library was injected at the 1 cell stage and samples were collected during early stages of embryogenesis. Polysome profiling was performed to quantify ribosome occupancy of each five prime UTR reporter.,,,polysome fraction,HMW fraction 2hpf replica C,MPRA repC fractions 8 9 2hpf,,strain:TLAB|age:2 hpf|dev stage:64 cells|collection date:2022 05 16|geo loc name:Switzerland: Basel|sex:not applicable|tissue:whole embryo|biomaterial provider:Schier lab|collected by:Madalena M. Reimao Pinto|genotype:WT|growth protocol:E3 buffer standard conditions|sample type:100 embryos|sample number:36|replicate:replicate C|BioSampleModel:Model organism or animal,,,,,,,,,HMW fraction 2hpf replica C,Library 36,Library 36,Total RNA was extracted from polysome fractionated sample RT was performed with reporter specific primer UMI were introduced ath the five primeend and library was amplified to include adapters compatible with Illumina sequencing.,,,OTHER,TRANSCRIPTOMIC,RT-PCR,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP483112,,,BSSE_QGF_206671_HGWLYDSX3_3_MPRA_repC_fractions_8_9_2hpf_ATATGGAT_CTGTATTA_S36_L003_R1_001_MM_1.fastq.gz BSSE_QGF_206671_HGWLYDSX3_3_MPRA_repC_fractions_8_9_2hpf_ATATGGAT_CTGTATTA_S36_L003_R2_001_MM_1.fastq.gz,fastq fastq,13085558528.0,43329664.0,BSSE QGF 206671 HGWLYDSX3 3 MPRA repC fractions 8 9 2hpf ATATGGAT CTGTATTA S36 L003 R1 001 MM 1.fastq.gz,0:151 1:151,A:3305413622;C:3391845548;G:3249932870;T:3137708503;N:657985,151,151,,,3305413622,3391845548,3249932870,3137708503,657985,SRX23160963,SRS20111121,SRA1775336,University of Basel|Biozentrum Basel,University of Basel,2,0.01098,8e-05,0.00025,0.0,0.99216,0.99973,0.4317,0.61538,151,151,T,T,mates < 9% mapping rate,illumina,novaseq_era,5prime,other,unknown,bulk,unknown,unknown,,Switzerland,2024-01-11,Cleavage,Embryo,Whole Organism,All anatomical structures
29230,SRR27489747,SRX23160962,SRS20111119,SRP483112,PRJNA1056276,five prime UTR MPRA during early zebrafish embryogenesis,PRJNA1056276,Other,The goal is to determine the contribution of zebrafish five prime UTR sequences to translation initiation. The five prime UTR MPRA reporter library was injected at the 1 cell stage and samples were collected during early stages of embryogenesis. Polysome profiling was performed to quantify ribosome occupancy of each five prime UTR reporter.,,,polysome fraction,LMW fraction 2hpf replica C,MPRA repC fractions 6 7 2hpf,,strain:TLAB|age:2 hpf|dev stage:64 cells|collection date:2022 05 16|geo loc name:Switzerland: Basel|sex:not applicable|tissue:whole embryo|biomaterial provider:Schier lab|collected by:Madalena M. Reimao Pinto|genotype:WT|growth protocol:E3 buffer standard conditions|sample type:100 embryos|sample number:35|replicate:replicate C|BioSampleModel:Model organism or animal,,,,,,,,,LMW fraction 2hpf replica C,Library 35,Library 35,Total RNA was extracted from polysome fractionated sample RT was performed with reporter specific primer UMI were introduced ath the five primeend and library was amplified to include adapters compatible with Illumina sequencing.,,,OTHER,TRANSCRIPTOMIC,RT-PCR,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP483112,,,BSSE_QGF_206670_HGWLYDSX3_3_MPRA_repC_fractions_6_7_2hpf_CGGACAAC_TCCGGATT_S35_L003_R2_001_MM_1.fastq.gz BSSE_QGF_206670_HGWLYDSX3_3_MPRA_repC_fractions_6_7_2hpf_CGGACAAC_TCCGGATT_S35_L003_R1_001_MM_1.fastq.gz,fastq fastq,16647721914.0,55124907.0,BSSE QGF 206670 HGWLYDSX3 3 MPRA repC fractions 6 7 2hpf CGGACAAC TCCGGATT S35 L003 R1 001 MM 1.fastq.gz,0:151 1:151,A:4231542934;C:4348688006;G:4050131444;T:4016534422;N:825108,151,151,,,4231542934,4348688006,4050131444,4016534422,825108,SRX23160962,SRS20111119,SRA1775336,University of Basel|Biozentrum Basel,University of Basel,2,0.01514,0.00017,0.00035,3e-05,0.99109,0.99955,0.4372,0.30434,151,151,T,T,mates < 9% mapping rate,illumina,novaseq_era,5prime,other,unknown,bulk,unknown,unknown,,Switzerland,2024-01-11,Cleavage,Embryo,Whole Organism,All anatomical structures
29231,SRR27489748,SRX23160961,SRS20111118,SRP483112,PRJNA1056276,five prime UTR MPRA during early zebrafish embryogenesis,PRJNA1056276,Other,The goal is to determine the contribution of zebrafish five prime UTR sequences to translation initiation. The five prime UTR MPRA reporter library was injected at the 1 cell stage and samples were collected during early stages of embryogenesis. Polysome profiling was performed to quantify ribosome occupancy of each five prime UTR reporter.,,,polysome fraction,80S fraction 2hpf replica C,MPRA repC fractions 4 5 2hpf,,strain:TLAB|age:2 hpf|dev stage:64 cells|collection date:2022 05 16|geo loc name:Switzerland: Basel|sex:not applicable|tissue:whole embryo|biomaterial provider:Schier lab|collected by:Madalena M. Reimao Pinto|genotype:WT|growth protocol:E3 buffer standard conditions|sample type:100 embryos|sample number:34|replicate:replicate C|BioSampleModel:Model organism or animal,,,,,,,,,80S fraction 2hpf replica C,Library 34,Library 34,Total RNA was extracted from polysome fractionated sample RT was performed with reporter specific primer UMI were introduced ath the five primeend and library was amplified to include adapters compatible with Illumina sequencing.,,,OTHER,TRANSCRIPTOMIC,RT-PCR,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP483112,,,BSSE_QGF_206669_HGWLYDSX3_3_MPRA_repC_fractions_4_5_2hpf_TAAGTGGT_CTTAAGCC_S34_L003_R1_001_MM_1.fastq.gz BSSE_QGF_206669_HGWLYDSX3_3_MPRA_repC_fractions_4_5_2hpf_TAAGTGGT_CTTAAGCC_S34_L003_R2_001_MM_1.fastq.gz,fastq fastq,15431181052.0,51096626.0,BSSE QGF 206669 HGWLYDSX3 3 MPRA repC fractions 4 5 2hpf TAAGTGGT CTTAAGCC S34 L003 R1 001 MM 1.fastq.gz,0:151 1:151,A:3856018869;C:4036338306;G:3877988553;T:3660059325;N:775999,151,151,,,3856018869,4036338306,3877988553,3660059325,775999,SRX23160961,SRS20111118,SRA1775336,University of Basel|Biozentrum Basel,University of Basel,2,0.01114,8e-05,0.00028,0.0,0.99192,0.99975,0.42956,0.5,151,151,T,T,mates < 9% mapping rate,illumina,novaseq_era,5prime,other,unknown,bulk,unknown,unknown,,Switzerland,2024-01-11,Cleavage,Embryo,Whole Organism,All anatomical structures
29232,SRR27489749,SRX23160960,SRS20111117,SRP483112,PRJNA1056276,five prime UTR MPRA during early zebrafish embryogenesis,PRJNA1056276,Other,The goal is to determine the contribution of zebrafish five prime UTR sequences to translation initiation. The five prime UTR MPRA reporter library was injected at the 1 cell stage and samples were collected during early stages of embryogenesis. Polysome profiling was performed to quantify ribosome occupancy of each five prime UTR reporter.,,,input sample,Total 2hpf replica C,MPRA repC input 2hpf,,strain:TLAB|age:2 hpf|dev stage:64 cells|collection date:2022 05 16|geo loc name:Switzerland: Basel|sex:not applicable|tissue:whole embryo|biomaterial provider:Schier lab|collected by:Madalena M. Reimao Pinto|genotype:WT|growth protocol:E3 buffer standard conditions|sample type:100 embryos|sample number:33|replicate:replicate C|BioSampleModel:Model organism or animal,,,,,,,,,Total 2hpf replica C,Library 33,Library 33,Total RNA was extracted from input sample RT was performed with reporter specific primer UMI were introduced ath the five primeend and library was amplified to include adapters compatible with Illumina sequencing.,,,OTHER,TRANSCRIPTOMIC,RT-PCR,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP483112,,,BSSE_QGF_206668_HGWLYDSX3_3_MPRA_repC_input_2hpf_CTACGACA_GAGTCCAA_S33_L003_R2_001_MM_1.fastq.gz BSSE_QGF_206668_HGWLYDSX3_3_MPRA_repC_input_2hpf_CTACGACA_GAGTCCAA_S33_L003_R1_001_MM_1.fastq.gz,fastq fastq,11771229160.0,38977580.0,BSSE QGF 206668 HGWLYDSX3 3 MPRA repC input 2hpf CTACGACA GAGTCCAA S33 L003 R1 001 MM 1.fastq.gz,0:151 1:151,A:2999574420;C:3115525474;G:2806539264;T:2849003922;N:586080,151,151,,,2999574420,3115525474,2806539264,2849003922,586080,SRX23160960,SRS20111117,SRA1775336,University of Basel|Biozentrum Basel,University of Basel,2,0.01997,2e-05,0.00054,0.0,0.99022,0.99993,0.41853,0.33333,151,151,T,T,mates < 9% mapping rate,illumina,novaseq_era,5prime,other,unknown,bulk,unknown,unknown,,Switzerland,2024-01-11,Cleavage,Embryo,Whole Organism,All anatomical structures
29235,SRR27489752,SRX23160957,SRS20111114,SRP483112,PRJNA1056276,five prime UTR MPRA during early zebrafish embryogenesis,PRJNA1056276,Other,The goal is to determine the contribution of zebrafish five prime UTR sequences to translation initiation. The five prime UTR MPRA reporter library was injected at the 1 cell stage and samples were collected during early stages of embryogenesis. Polysome profiling was performed to quantify ribosome occupancy of each five prime UTR reporter.,,,polysome fraction,HMW fraction 2hpf replica A,MPRA repA fractions 8 9 2hpf,,strain:TLAB|age:2 hpf|dev stage:64 cells|collection date:2022 05 16|geo loc name:Switzerland: Basel|sex:not applicable|tissue:whole embryo|biomaterial provider:Schier lab|collected by:Madalena M. Reimao Pinto|genotype:WT|growth protocol:E3 buffer standard conditions|sample type:100 embryos|sample number:4|replicate:replicate A|BioSampleModel:Model organism or animal,,,,,,,,,HMW fraction 2hpf replica A,Library 4,Library 4,Total RNA was extracted from polysome fractionated sample RT was performed with reporter specific primer UMI were introduced ath the five primeend and library was amplified to include adapters compatible with Illumina sequencing.,,,OTHER,TRANSCRIPTOMIC,RT-PCR,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP483112,,,BSSE_QGF_206639_HGWLYDSX3_3_MPRA_repA_fractions_8_9_2hpf_GCTTGTCA_GAACATAC_S4_L003_R2_001_MM_1.fastq.gz BSSE_QGF_206639_HGWLYDSX3_3_MPRA_repA_fractions_8_9_2hpf_GCTTGTCA_GAACATAC_S4_L003_R1_001_MM_1.fastq.gz,fastq fastq,12108626278.0,40094789.0,BSSE QGF 206639 HGWLYDSX3 3 MPRA repA fractions 8 9 2hpf GCTTGTCA GAACATAC S4 L003 R1 001 MM 1.fastq.gz,0:151 1:151,A:3079403604;C:3149095123;G:2953175005;T:2926352278;N:600268,151,151,,,3079403604,3149095123,2953175005,2926352278,600268,SRX23160957,SRS20111114,SRA1775336,University of Basel|Biozentrum Basel,University of Basel,2,0.014,5e-05,0.00032,0.0,0.99137,0.99987,0.45127,0.28571,151,151,T,T,mates < 9% mapping rate,illumina,novaseq_era,5prime,other,unknown,bulk,unknown,unknown,,Switzerland,2024-01-11,Cleavage,Embryo,Whole Organism,All anatomical structures
29246,SRR27489763,SRX23160946,SRS20111108,SRP483112,PRJNA1056276,five prime UTR MPRA during early zebrafish embryogenesis,PRJNA1056276,Other,The goal is to determine the contribution of zebrafish five prime UTR sequences to translation initiation. The five prime UTR MPRA reporter library was injected at the 1 cell stage and samples were collected during early stages of embryogenesis. Polysome profiling was performed to quantify ribosome occupancy of each five prime UTR reporter.,,,polysome fraction,LMW fraction 2hpf replica A,MPRA repA fractions 6 7 2hpf,,strain:TLAB|age:2 hpf|dev stage:64 cells|collection date:2022 05 16|geo loc name:Switzerland: Basel|sex:not applicable|tissue:whole embryo|biomaterial provider:Schier lab|collected by:Madalena M. Reimao Pinto|genotype:WT|growth protocol:E3 buffer standard conditions|sample type:100 embryos|sample number:3|replicate:replicate A|BioSampleModel:Model organism or animal,,,,,,,,,LMW fraction 2hpf replica A,Library 3,Library 3,Total RNA was extracted from polysome fractionated sample RT was performed with reporter specific primer UMI were introduced ath the five primeend and library was amplified to include adapters compatible with Illumina sequencing.,,,OTHER,TRANSCRIPTOMIC,RT-PCR,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP483112,,,BSSE_QGF_206638_HGWLYDSX3_3_MPRA_repA_fractions_6_7_2hpf_ATCCACTG_AGGTGCGT_S3_L003_R2_001_MM_1.fastq.gz BSSE_QGF_206638_HGWLYDSX3_3_MPRA_repA_fractions_6_7_2hpf_ATCCACTG_AGGTGCGT_S3_L003_R1_001_MM_1.fastq.gz,fastq fastq,12524202136.0,41470868.0,BSSE QGF 206638 HGWLYDSX3 3 MPRA repA fractions 6 7 2hpf ATCCACTG AGGTGCGT S3 L003 R1 001 MM 1.fastq.gz,0:151 1:151,A:3168466372;C:3269998328;G:3075956662;T:3009160932;N:619842,151,151,,,3168466372,3269998328,3075956662,3009160932,619842,SRX23160946,SRS20111108,SRA1775336,University of Basel|Biozentrum Basel,University of Basel,2,0.01351,7e-05,0.00028,0.0,0.99168,0.99977,0.43472,0.54545,151,151,T,T,mates < 9% mapping rate,illumina,novaseq_era,5prime,other,unknown,bulk,unknown,unknown,,Switzerland,2024-01-11,Cleavage,Embryo,Whole Organism,All anatomical structures
29247,SRR27489764,SRX23160945,SRS20111103,SRP483112,PRJNA1056276,five prime UTR MPRA during early zebrafish embryogenesis,PRJNA1056276,Other,The goal is to determine the contribution of zebrafish five prime UTR sequences to translation initiation. The five prime UTR MPRA reporter library was injected at the 1 cell stage and samples were collected during early stages of embryogenesis. Polysome profiling was performed to quantify ribosome occupancy of each five prime UTR reporter.,,,polysome fraction,HMW fraction 2hpf replica B,MPRA repB fractions 8 9 2hpf,,strain:TLAB|age:2 hpf|dev stage:64 cells|collection date:2022 05 16|geo loc name:Switzerland: Basel|sex:not applicable|tissue:whole embryo|biomaterial provider:Schier lab|collected by:Madalena M. Reimao Pinto|genotype:WT|growth protocol:E3 buffer standard conditions|sample type:100 embryos|sample number:20|replicate:replicate B|BioSampleModel:Model organism or animal,,,,,,,,,HMW fraction 2hpf replica B,Library 20,Library 20,Total RNA was extracted from polysome fractionated sample RT was performed with reporter specific primer UMI were introduced ath the five primeend and library was amplified to include adapters compatible with Illumina sequencing.,,,OTHER,TRANSCRIPTOMIC,RT-PCR,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP483112,,,BSSE_QGF_206655_HGWLYDSX3_3_MPRA_repB_fractions_8_9_2hpf_AACGTTCC_GGAGTACT_S20_L003_R1_001_MM_1.fastq.gz BSSE_QGF_206655_HGWLYDSX3_3_MPRA_repB_fractions_8_9_2hpf_AACGTTCC_GGAGTACT_S20_L003_R2_001_MM_1.fastq.gz,fastq fastq,12514444214.0,41438557.0,BSSE QGF 206655 HGWLYDSX3 3 MPRA repB fractions 8 9 2hpf AACGTTCC GGAGTACT S20 L003 R1 001 MM 1.fastq.gz,0:151 1:151,A:3174354240;C:3246812350;G:3082021359;T:3010633962;N:622303,151,151,,,3174354240,3246812350,3082021359,3010633962,622303,SRX23160945,SRS20111103,SRA1775336,University of Basel|Biozentrum Basel,University of Basel,2,0.01121,0.00016,0.00027,1e-05,0.99204,0.99953,0.43533,0.5,151,151,T,T,mates < 9% mapping rate,illumina,novaseq_era,5prime,other,unknown,bulk,unknown,unknown,,Switzerland,2024-01-11,Cleavage,Embryo,Whole Organism,All anatomical structures
29248,SRR27489765,SRX23160944,SRS20111102,SRP483112,PRJNA1056276,five prime UTR MPRA during early zebrafish embryogenesis,PRJNA1056276,Other,The goal is to determine the contribution of zebrafish five prime UTR sequences to translation initiation. The five prime UTR MPRA reporter library was injected at the 1 cell stage and samples were collected during early stages of embryogenesis. Polysome profiling was performed to quantify ribosome occupancy of each five prime UTR reporter.,,,polysome fraction,LMW fraction 2hpf replica B,MPRA repB fractions 6 7 2hpf,,strain:TLAB|age:2 hpf|dev stage:64 cells|collection date:2022 05 16|geo loc name:Switzerland: Basel|sex:not applicable|tissue:whole embryo|biomaterial provider:Schier lab|collected by:Madalena M. Reimao Pinto|genotype:WT|growth protocol:E3 buffer standard conditions|sample type:100 embryos|sample number:19|replicate:replicate B|BioSampleModel:Model organism or animal,,,,,,,,,LMW fraction 2hpf replica B,Library 19,Library 19,Total RNA was extracted from polysome fractionated sample RT was performed with reporter specific primer UMI were introduced ath the five primeend and library was amplified to include adapters compatible with Illumina sequencing.,,,OTHER,TRANSCRIPTOMIC,RT-PCR,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP483112,,,BSSE_QGF_206654_HGWLYDSX3_3_MPRA_repB_fractions_6_7_2hpf_GGTACCTT_AAGACGTC_S19_L003_R2_001_MM_1.fastq.gz BSSE_QGF_206654_HGWLYDSX3_3_MPRA_repB_fractions_6_7_2hpf_GGTACCTT_AAGACGTC_S19_L003_R1_001_MM_1.fastq.gz,fastq fastq,16535129670.0,54752085.0,BSSE QGF 206654 HGWLYDSX3 3 MPRA repB fractions 6 7 2hpf GGTACCTT AAGACGTC S19 L003 R1 001 MM 1.fastq.gz,0:151 1:151,A:4184643114;C:4312135767;G:4051628900;T:3985895468;N:826421,151,151,,,4184643114,4312135767,4051628900,3985895468,826421,SRX23160944,SRS20111102,SRA1775336,University of Basel|Biozentrum Basel,University of Basel,2,0.01416,0.00017,0.00031,1e-05,0.9917,0.99941,0.40732,0.6,151,151,T,T,mates < 9% mapping rate,illumina,novaseq_era,5prime,other,unknown,bulk,unknown,unknown,,Switzerland,2024-01-11,Cleavage,Embryo,Whole Organism,All anatomical structures
29249,SRR27489766,SRX23160943,SRS20111101,SRP483112,PRJNA1056276,five prime UTR MPRA during early zebrafish embryogenesis,PRJNA1056276,Other,The goal is to determine the contribution of zebrafish five prime UTR sequences to translation initiation. The five prime UTR MPRA reporter library was injected at the 1 cell stage and samples were collected during early stages of embryogenesis. Polysome profiling was performed to quantify ribosome occupancy of each five prime UTR reporter.,,,polysome fraction,80S fraction 2hpf replica B,MPRA repB fractions 4 5 2hpf,,strain:TLAB|age:2 hpf|dev stage:64 cells|collection date:2022 05 16|geo loc name:Switzerland: Basel|sex:not applicable|tissue:whole embryo|biomaterial provider:Schier lab|collected by:Madalena M. Reimao Pinto|genotype:WT|growth protocol:E3 buffer standard conditions|sample type:100 embryos|sample number:18|replicate:replicate B|BioSampleModel:Model organism or animal,,,,,,,,,80S fraction 2hpf replica B,Library 18,Library 18,Total RNA was extracted from polysome fractionated sample RT was performed with reporter specific primer UMI were introduced ath the five primeend and library was amplified to include adapters compatible with Illumina sequencing.,,,OTHER,TRANSCRIPTOMIC,RT-PCR,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP483112,,,BSSE_QGF_206653_HGWLYDSX3_3_MPRA_repB_fractions_4_5_2hpf_GCACGGAC_GTCTCGCA_S18_L003_R1_001_MM_1.fastq.gz BSSE_QGF_206653_HGWLYDSX3_3_MPRA_repB_fractions_4_5_2hpf_GCACGGAC_GTCTCGCA_S18_L003_R2_001_MM_1.fastq.gz,fastq fastq,12692870042.0,42029371.0,BSSE QGF 206653 HGWLYDSX3 3 MPRA repB fractions 4 5 2hpf GCACGGAC GTCTCGCA S18 L003 R1 001 MM 1.fastq.gz,0:151 1:151,A:3179006274;C:3325152682;G:3173386021;T:3014687781;N:637284,151,151,,,3179006274,3325152682,3173386021,3014687781,637284,SRX23160943,SRS20111101,SRA1775336,University of Basel|Biozentrum Basel,University of Basel,2,0.01199,8e-05,0.0003,1e-05,0.99145,0.99979,0.40897,0.36363,151,151,T,T,mates < 9% mapping rate,illumina,novaseq_era,5prime,other,unknown,bulk,unknown,unknown,,Switzerland,2024-01-11,Cleavage,Embryo,Whole Organism,All anatomical structures
29250,SRR27489767,SRX23160942,SRS20111100,SRP483112,PRJNA1056276,five prime UTR MPRA during early zebrafish embryogenesis,PRJNA1056276,Other,The goal is to determine the contribution of zebrafish five prime UTR sequences to translation initiation. The five prime UTR MPRA reporter library was injected at the 1 cell stage and samples were collected during early stages of embryogenesis. Polysome profiling was performed to quantify ribosome occupancy of each five prime UTR reporter.,,,input sample,Total 2hpf replica B,MPRA repB input 2hpf,,strain:TLAB|age:2 hpf|dev stage:64 cells|collection date:2022 05 16|geo loc name:Switzerland: Basel|sex:not applicable|tissue:whole embryo|biomaterial provider:Schier lab|collected by:Madalena M. Reimao Pinto|genotype:WT|growth protocol:E3 buffer standard conditions|sample type:100 embryos|sample number:17|replicate:replicate B|BioSampleModel:Model organism or animal,,,,,,,,,Total 2hpf replica B,Library 17,Library 17,Total RNA was extracted from input sample RT was performed with reporter specific primer UMI were introduced ath the five primeend and library was amplified to include adapters compatible with Illumina sequencing.,,,OTHER,TRANSCRIPTOMIC,RT-PCR,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP483112,,,BSSE_QGF_206652_HGWLYDSX3_3_MPRA_repB_input_2hpf_ATGTAAGT_ACTCTATG_S17_L003_R1_001_MM_1.fastq.gz BSSE_QGF_206652_HGWLYDSX3_3_MPRA_repB_input_2hpf_ATGTAAGT_ACTCTATG_S17_L003_R2_001_MM_1.fastq.gz,fastq fastq,13169436008.0,43607404.0,BSSE QGF 206652 HGWLYDSX3 3 MPRA repB input 2hpf ATGTAAGT ACTCTATG S17 L003 R1 001 MM 1.fastq.gz,0:151 1:151,A:3341908647;C:3485072739;G:3171200836;T:3170595031;N:658755,151,151,,,3341908647,3485072739,3171200836,3170595031,658755,SRX23160942,SRS20111100,SRA1775336,University of Basel|Biozentrum Basel,University of Basel,2,0.01868,5e-05,0.0006,0.0,0.99038,0.99983,0.41955,0.125,151,151,T,T,mates < 9% mapping rate,illumina,novaseq_era,5prime,other,unknown,bulk,unknown,unknown,,Switzerland,2024-01-11,Cleavage,Embryo,Whole Organism,All anatomical structures
29257,SRR27489774,SRX23160935,SRS20111093,SRP483112,PRJNA1056276,five prime UTR MPRA during early zebrafish embryogenesis,PRJNA1056276,Other,The goal is to determine the contribution of zebrafish five prime UTR sequences to translation initiation. The five prime UTR MPRA reporter library was injected at the 1 cell stage and samples were collected during early stages of embryogenesis. Polysome profiling was performed to quantify ribosome occupancy of each five prime UTR reporter.,,,polysome fraction,80S fraction 2hpf replica A,MPRA repA fractions 4 5 2hpf,,strain:TLAB|age:2 hpf|dev stage:64 cells|collection date:2022 05 16|geo loc name:Switzerland: Basel|sex:not applicable|tissue:whole embryo|biomaterial provider:Schier lab|collected by:Madalena M. Reimao Pinto|genotype:WT|growth protocol:E3 buffer standard conditions|sample type:100 embryos|sample number:2|replicate:replicate A|BioSampleModel:Model organism or animal,,,,,,,,,80S fraction 2hpf replica A,Library 2,Library 2,Total RNA was extracted from polysome fractionated sample RT was performed with reporter specific primer UMI were introduced ath the five primeend and library was amplified to include adapters compatible with Illumina sequencing.,,,OTHER,TRANSCRIPTOMIC,RT-PCR,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP483112,,,BSSE_QGF_206637_HGWLYDSX3_3_MPRA_repA_fractions_4_5_2hpf_TTGGACTT_TATGAGTA_S2_L003_R1_001_MM_1.fastq.gz BSSE_QGF_206637_HGWLYDSX3_3_MPRA_repA_fractions_4_5_2hpf_TTGGACTT_TATGAGTA_S2_L003_R2_001_MM_1.fastq.gz,fastq fastq,16111078182.0,53347941.0,BSSE QGF 206637 HGWLYDSX3 3 MPRA repA fractions 4 5 2hpf TTGGACTT TATGAGTA S2 L003 R1 001 MM 1.fastq.gz,0:151 1:151,A:4069536779;C:4222816450;G:3957789955;T:3860129964;N:805034,151,151,,,4069536779,4222816450,3957789955,3860129964,805034,SRX23160935,SRS20111093,SRA1775336,University of Basel|Biozentrum Basel,University of Basel,2,0.01511,5e-05,0.00034,0.0,0.99135,0.99985,0.41564,0.42857,151,151,T,T,mates < 9% mapping rate,illumina,novaseq_era,5prime,other,unknown,bulk,unknown,unknown,,Switzerland,2024-01-11,Cleavage,Embryo,Whole Organism,All anatomical structures
29258,SRR27489775,SRX23160934,SRS20111092,SRP483112,PRJNA1056276,five prime UTR MPRA during early zebrafish embryogenesis,PRJNA1056276,Other,The goal is to determine the contribution of zebrafish five prime UTR sequences to translation initiation. The five prime UTR MPRA reporter library was injected at the 1 cell stage and samples were collected during early stages of embryogenesis. Polysome profiling was performed to quantify ribosome occupancy of each five prime UTR reporter.,,,input sample,Total 2hpf replica A,MPRA repA input 2hpf,,strain:TLAB|age:2 hpf|dev stage:64 cells|collection date:2022 05 16|geo loc name:Switzerland: Basel|sex:not applicable|tissue:whole embryo|biomaterial provider:Schier lab|collected by:Madalena M. Reimao Pinto|genotype:WT|growth protocol:E3 buffer standard conditions|sample type:100 embryos|sample number:1|replicate:replicate A|BioSampleModel:Model organism or animal,,,,,,,,,Total 2hpf replica A,Library 1,Library 1,Total RNA was extracted from input sample RT was performed with reporter specific primer UMI were introduced ath the five primeend and library was amplified to include adapters compatible with Illumina sequencing.,,,OTHER,TRANSCRIPTOMIC,RT-PCR,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP483112,,,BSSE_QGF_206636_HGWLYDSX3_3_MPRA_repA_input_2hpf_GGACTTGG_CGCAGACG_S1_L003_R1_001_MM_1.fastq.gz BSSE_QGF_206636_HGWLYDSX3_3_MPRA_repA_input_2hpf_GGACTTGG_CGCAGACG_S1_L003_R2_001_MM_1.fastq.gz,fastq fastq,9769305890.0,32348695.0,BSSE QGF 206636 HGWLYDSX3 3 MPRA repA input 2hpf GGACTTGG CGCAGACG S1 L003 R1 001 MM 1.fastq.gz,0:151 1:151,A:2477269774;C:2598109179;G:2338444856;T:2354997596;N:484485,151,151,,,2477269774,2598109179,2338444856,2354997596,484485,SRX23160934,SRS20111092,SRA1775336,University of Basel|Biozentrum Basel,University of Basel,2,0.0205,4e-05,0.00059,0.0,0.99013,0.99987,0.41957,0.33333,151,151,T,T,mates < 9% mapping rate,illumina,novaseq_era,5prime,other,unknown,bulk,unknown,unknown,,Switzerland,2024-01-11,Cleavage,Embryo,Whole Organism,All anatomical structures
29718,SRR27485663,SRX23156886,SRS20107307,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,4 cell R3,,strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:1 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|replicate:3|BioSampleModel:Model organism or animal,,,,,,,,,mRNA seq of zebrafish: embryo 1 hpf rep4,EV06010,EV06010,RNA was extracted with Trizol and processed with QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina Lexogen. 500 ng total RNA per sample. Single indexed QuantSeq libraries were QC checked on a Bioanalyzer 2100 Agilent using a High Sensitivity DNA Kit for correct insert size and quantified using Qubit dsDNA HS Assay Invitrogen. Pooled libraries were sequenced on a NextSeq500 instrument Illumina in 1x75bp single end sequencing mode,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV06010.R1.fastq.gz,fastq,620142356.0,8227837.0,EV06010.R1.fastq.gz,0:75.37,A:186029536;C:118842640;G:134072972;T:181171903;N:25305,75,,,,186029536,118842640,134072972,181171903,25305,SRX23156886,SRS20107307,SRA1783314,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,0.90656,,0.06918,,0.80192,,0.72472,,76,,B,,usable mapping rate,illumina,nextseq,3prime,poly_a,lexogen,bulk,unknown,unknown,,Austria,2024-01-11,Cleavage,Embryo,Whole Organism,All anatomical structures
29725,SRR27485670,SRX23156879,SRS20107300,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,4 cell R2,,strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:1 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|replicate:2|BioSampleModel:Model organism or animal,,,,,,,,,mRNA seq of zebrafish: embryo 1 hpf rep4,EV06003,EV06003,RNA was extracted with Trizol and processed with QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina Lexogen. 500 ng total RNA per sample. Single indexed QuantSeq libraries were QC checked on a Bioanalyzer 2100 Agilent using a High Sensitivity DNA Kit for correct insert size and quantified using Qubit dsDNA HS Assay Invitrogen. Pooled libraries were sequenced on a NextSeq500 instrument Illumina in 1x75bp single end sequencing mode,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV06003.R1.fastq.gz,fastq,706095550.0,9366364.0,EV06003.R1.fastq.gz,0:75.39,A:204324355;C:140058731;G:159377323;T:202282197;N:52944,75,,,,204324355,140058731,159377323,202282197,52944,SRX23156879,SRS20107300,SRA1783314,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,0.90788,,0.10297,,0.80168,,0.71073,,76,,B,,usable mapping rate,illumina,nextseq,3prime,poly_a,lexogen,bulk,unknown,unknown,,Austria,2024-01-11,Cleavage,Embryo,Whole Organism,All anatomical structures
29736,SRR27477296,SRX23148651,SRS20099370,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,4 cell R4,,strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:1 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|replicate:4|BioSampleModel:Model organism or animal,,,,,,,,,mRNA seq of zebrafish: embryo 1 hpf rep4,EV09003,EV09003,RNA was extracted with Trizol and processed with QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina Lexogen. 500 ng total RNA per sample. Single indexed QuantSeq libraries were QC checked on a Bioanalyzer 2100 Agilent using a High Sensitivity DNA Kit for correct insert size and quantified using Qubit dsDNA HS Assay Invitrogen. Pooled libraries were sequenced on a NextSeq500 instrument Illumina in 1x75bp single end sequencing mode,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV09003.R1.fastq.gz,fastq,438955973.0,5837128.0,EV09003.R1.fastq.gz,0:75.20,A:134628611;C:87460856;G:98199538;T:118638244;N:28724,75,,,,134628611,87460856,98199538,118638244,28724,SRX23148651,SRS20099370,SRA1782413,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,0.89029,,0.11994,,0.80833,,0.72581,,76,,B,,usable mapping rate,illumina,nextseq,3prime,poly_a,lexogen,bulk,unknown,unknown,,Austria,2024-01-10,Cleavage,Embryo,Whole Organism,All anatomical structures
29743,SRR27467676,SRX23139230,SRS20090273,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,4 cell DM R2,,strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:1 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:DM|BioSampleModel:Model organism or animal,,,,,,,,,tRAM seq of zebrafish: embryo 1 hpf DM rep2,EV04004,EV04004,RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.,,,OTHER,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV04004.R1.fastq.gz,fastq,895671560.0,6397654.0,EV04004.R1.fastq.gz,0:140,A:206443066;C:147067097;G:365386937;T:176734600;N:39860,140,,,,206443066,147067097,365386937,176734600,39860,SRX23139230,SRS20090273,SRA1781872,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,0.0,,0.0,,1.0,,,,140,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Austria,2024-01-09,Cleavage,Embryo,Whole Organism,All anatomical structures
29744,SRR27467677,SRX23139229,SRS20090274,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,4 cell mock R2,,strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:1 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:mock|BioSampleModel:Model organism or animal,,,,,,,,,tRAM seq of zebrafish: embryo 1 hpf mock rep2,EV04003,EV04003,RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.,,,OTHER,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV04003.R1.fastq.gz,fastq,664112120.0,4743658.0,EV04003.R1.fastq.gz,0:140,A:163711695;C:142612940;G:211194350;T:146562626;N:30509,140,,,,163711695,142612940,211194350,146562626,30509,SRX23139229,SRS20090274,SRA1781872,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,2e-05,,0.0,,0.99997,,1.0,,140,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Austria,2024-01-09,Cleavage,Embryo,Whole Organism,All anatomical structures
29758,SRR27437478,SRX23109819,SRS20064573,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,4 cell BS R3,,strain:TLAB fish|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|dev stage:1 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:BS|BioSampleModel:Model organism or animal,,,,,,,,,tRAM seq of zebrafish: embryo 1 hpf BS rep3,EV07006,EV07006,RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.,,,OTHER,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV07006.R1.fastq.gz,fastq,2584527680.0,18460912.0,EV07006.R1.fastq.gz,0:140,A:685107500;C:367766834;G:717359848;T:814224206;N:69292,140,,,,685107500,367766834,717359848,814224206,69292,SRX23109819,SRS20064573,SRA1780298,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,2e-05,,1e-05,,1.0,,,,140,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Austria,2024-01-06,Cleavage,Embryo,Whole Organism,All anatomical structures
29759,SRR27437479,SRX23109818,SRS20064571,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,4 cell DM R3,,strain:TLAB fish|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|dev stage:1 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:DM|BioSampleModel:Model organism or animal,,,,,,,,,tRAM seq of zebrafish: embryo 1 hpf DM rep3,EV07005,EV07005,RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.,,,OTHER,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV07005.R1.fastq.gz,fastq,713829480.0,5098782.0,EV07005.R1.fastq.gz,0:140,A:183575304;C:168886779;G:213156258;T:148191838;N:19301,140,,,,183575304,168886779,213156258,148191838,19301,SRX23109818,SRS20064571,SRA1780298,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,5e-05,,0.0,,0.99989,,1.0,,140,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Austria,2024-01-06,Cleavage,Embryo,Whole Organism,All anatomical structures
29760,SRR27437480,SRX23109817,SRS20064572,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,4 cell mock R3,,strain:TLAB fish|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|dev stage:1 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:mock|BioSampleModel:Model organism or animal,,,,,,,,,tRAM seq of zebrafish: embryo 1 hpf mock rep3,EV07004,EV07004,RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.,,,OTHER,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV07004.R1.fastq.gz,fastq,517336680.0,3695262.0,EV07004.R1.fastq.gz,0:140,A:136783049;C:131207858;G:139873280;T:109458276;N:14217,140,,,,136783049,131207858,139873280,109458276,14217,SRX23109817,SRS20064572,SRA1780298,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,7e-05,,0.0,,0.99981,,0.7,,140,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Austria,2024-01-06,Cleavage,Embryo,Whole Organism,All anatomical structures
29779,SRR27435864,SRX23108232,SRS20063068,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,4 cell BS R4,,strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:1 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:BS|BioSampleModel:Model organism or animal,,,,,,,,,tRAM seq of zebrafish: embryo 1 hpf BS rep4,EV08009,EV08009,RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.,,,OTHER,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV08009.R1.fastq.gz,fastq,756964460.0,5406889.0,EV08009.R1.fastq.gz,0:140,A:191381054;C:111783194;G:185694475;T:268052883;N:52854,140,,,,191381054,111783194,185694475,268052883,52854,SRX23108232,SRS20063068,SRA1780265,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,1e-05,,0.0,,0.99997,,1.0,,140,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Austria,2024-01-05,Cleavage,Embryo,Whole Organism,All anatomical structures
29780,SRR27435865,SRX23108231,SRS20063069,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,4 cell DM R4,,strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:1 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:DM|BioSampleModel:Model organism or animal,,,,,,,,,tRAM seq of zebrafish: embryo 1 hpf DM rep4,EV08008,EV08008,RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.,,,OTHER,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV08008.R1.fastq.gz,fastq,751794680.0,5369962.0,EV08008.R1.fastq.gz,0:140,A:194845808;C:197389162;G:194749636;T:164756481;N:53593,140,,,,194845808,197389162,194749636,164756481,53593,SRX23108231,SRS20063069,SRA1780265,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,0.00124,,0.00029,,0.99853,,0.77083,,140,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Austria,2024-01-05,Cleavage,Embryo,Whole Organism,All anatomical structures
29781,SRR27435866,SRX23108230,SRS20063066,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,4 cell mock R4,,strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:1 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:mock|BioSampleModel:Model organism or animal,,,,,,,,,tRAM seq of zebrafish: embryo 1 hpf mock rep4,EV08007,EV08007,RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.,,,OTHER,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV08007.R1.fastq.gz,fastq,761961760.0,5442584.0,EV08007.R1.fastq.gz,0:140,A:194053323;C:191169414;G:194452160;T:182234253;N:52610,140,,,,194053323,191169414,194452160,182234253,52610,SRX23108230,SRS20063066,SRA1780265,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,0.00242,,0.00062,,0.99803,,0.81818,,140,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Austria,2024-01-05,Cleavage,Embryo,Whole Organism,All anatomical structures
30769,SRR28348935,SRX23954961,SRS20755382,SRP495323,PRJNA1088158,Protein profiling of zebrafish embryos unmasks regulatory layers during early embryogenesis.,GSE261646,Transcriptome Analysis,The maternal to zygotic transition is crucial in embryonic development marked by the degradation of maternally provided mRNAs and initiation of zygotic gene expression. However the changes occurring at the protein level during this transition remain unclear. Here we conducted protein profiling throughout zebrafish embryogenesis using quantitative mass spectrometry integrating transcriptomics and translatomics datasets. Our data shows that unlike RNA changes protein changes are less dynamic. Further increases in protein levels correlate with mRNA translation whereas declines in protein levels do not suggesting active protein degradation processes. Interestingly proteins from pure zygotic genes are present at fertilization challenging existing mRNA based gene classifications. As a proof of concept we utilized CRISPR Cas13d to target znf281b mRNA a gene whose protein significantly accumulates within the first two hpf demonstrating its crucial role in development. Consequently our protein profiling coupled with CRISPR Cas13d offers a new approach to unravel maternal mRNAs function during embryonic development. Overall design: Two biological replicate samples containing 50 zebrafish oocytes per stage were collected by pairing females in natural matings to ''purge'' mature eggs and used to establish an oogenesis time line. Fish were euthanized and ovaries harvested within 1–11 days post purging dpp. Stage I and II oocytes were collected at 1–2 dpp stage III oocytes germinal vesicle in central position at 4–7 dpp and stage IV oocytes germinal vesicle asymmetrically located at 8–10 dpp. Oocyte isolations were based on73 and conducted in isolation medium Leibovitz L 15 Sigma Aldrich #L5520 plus Collagenase I and II depending on the stages as follows. Stages I and II were isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130 and 3 mg/mL Collagenase II Gibco 17101015. Stage III was isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130. Stage IV was isolated by mechanical stripping with forceps and needle without xxx use of Collagenases. Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. Three biological replicate samples containing 20 dechorionated zebrafish embryos were snap frozen in TRIzol Invitrogen #15596026. Four time points of embryonic development were included: 1 cell stage 0 hpf hpf 2 hpf 4 hpf and 6 hpf. RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols.,,pubmed:39302832,,Zebrafish Embryo 2hpf rep3,GSM8147858,,source name:Whole embryo|tissue:Whole embryo|developmental stage:2hpf|genotype:AB TF and TLF|geo loc name:missing|collection date:missing,Zebrafish Embryo 2hpf rep3,Raw reads from zebrafish oocytes stages I IV and embryos 0 2 4 and 6 hpf were demultiplexed into FASTQ format allowing up to one mismatch using Illumina bcl convert 3.10.5. Reads were aligned to UCSC genome danRer11 with STAR aligner version 2.7.3a using Ensembl 106 gene models. Counts were converted to TPM values using RSEM version v1.3.0 and all subsequent analysis was done using TPM. Assembly: danRer11 Ensembl 106 gene models Supplementary files format and content: comma separated files with TPMs from all replicates,Whole embryo,,Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer’s protocols. 0 2 4 and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer’s protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0 2 4 and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer’s directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598 and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled quantified and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer’s instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina Cat. No. 20020598 and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized pooled and sequenced on a NextSeq 500 instrument Illumina as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.,,tissue:Whole embryo|developmental stage:2hpf|genotype:AB TF and TLF,GSM8147858,GSM8147858: Zebrafish Embryo 2hpf rep3; Danio rerio; RNA Seq,GSM8147858 r1,GSM8147858,1,Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. 0 2 4 and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0 2 4 and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer's directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598 and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled quantified and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer's instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina Cat. No. 20020598 and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized pooled and sequenced on a NextSeq 500 instrument Illumina as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP495323,,,s_2hpf_3.fastq,fastq,1748504032.0,23006632.0,GSM8147858 r1,0:76,A:420580006;C:434589498;G:408972977;T:484281127;N:80424,76,,,,420580006,434589498,408972977,484281127,80424,SRX23954961,SRS20755382,SRA1824599,"Computational Biology, Stowers Institute for Medical Research","Computational Biology, Stowers Institute for Medical Research",,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,trueseq,bulk,bulk,bulk,,United States,2024-03-14,Cleavage,Embryo,Whole Organism,All anatomical structures
30770,SRR28348936,SRX23954960,SRS20755381,SRP495323,PRJNA1088158,Protein profiling of zebrafish embryos unmasks regulatory layers during early embryogenesis.,GSE261646,Transcriptome Analysis,The maternal to zygotic transition is crucial in embryonic development marked by the degradation of maternally provided mRNAs and initiation of zygotic gene expression. However the changes occurring at the protein level during this transition remain unclear. Here we conducted protein profiling throughout zebrafish embryogenesis using quantitative mass spectrometry integrating transcriptomics and translatomics datasets. Our data shows that unlike RNA changes protein changes are less dynamic. Further increases in protein levels correlate with mRNA translation whereas declines in protein levels do not suggesting active protein degradation processes. Interestingly proteins from pure zygotic genes are present at fertilization challenging existing mRNA based gene classifications. As a proof of concept we utilized CRISPR Cas13d to target znf281b mRNA a gene whose protein significantly accumulates within the first two hpf demonstrating its crucial role in development. Consequently our protein profiling coupled with CRISPR Cas13d offers a new approach to unravel maternal mRNAs function during embryonic development. Overall design: Two biological replicate samples containing 50 zebrafish oocytes per stage were collected by pairing females in natural matings to ''purge'' mature eggs and used to establish an oogenesis time line. Fish were euthanized and ovaries harvested within 1–11 days post purging dpp. Stage I and II oocytes were collected at 1–2 dpp stage III oocytes germinal vesicle in central position at 4–7 dpp and stage IV oocytes germinal vesicle asymmetrically located at 8–10 dpp. Oocyte isolations were based on73 and conducted in isolation medium Leibovitz L 15 Sigma Aldrich #L5520 plus Collagenase I and II depending on the stages as follows. Stages I and II were isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130 and 3 mg/mL Collagenase II Gibco 17101015. Stage III was isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130. Stage IV was isolated by mechanical stripping with forceps and needle without xxx use of Collagenases. Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. Three biological replicate samples containing 20 dechorionated zebrafish embryos were snap frozen in TRIzol Invitrogen #15596026. Four time points of embryonic development were included: 1 cell stage 0 hpf hpf 2 hpf 4 hpf and 6 hpf. RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols.,,pubmed:39302832,,Zebrafish Embryo 2hpf rep2,GSM8147857,,source name:Whole embryo|tissue:Whole embryo|developmental stage:2hpf|genotype:AB TF and TLF|geo loc name:missing|collection date:missing,Zebrafish Embryo 2hpf rep2,Raw reads from zebrafish oocytes stages I IV and embryos 0 2 4 and 6 hpf were demultiplexed into FASTQ format allowing up to one mismatch using Illumina bcl convert 3.10.5. Reads were aligned to UCSC genome danRer11 with STAR aligner version 2.7.3a using Ensembl 106 gene models. Counts were converted to TPM values using RSEM version v1.3.0 and all subsequent analysis was done using TPM. Assembly: danRer11 Ensembl 106 gene models Supplementary files format and content: comma separated files with TPMs from all replicates,Whole embryo,,Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer’s protocols. 0 2 4 and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer’s protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0 2 4 and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer’s directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598 and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled quantified and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer’s instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina Cat. No. 20020598 and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized pooled and sequenced on a NextSeq 500 instrument Illumina as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.,,tissue:Whole embryo|developmental stage:2hpf|genotype:AB TF and TLF,GSM8147857,GSM8147857: Zebrafish Embryo 2hpf rep2; Danio rerio; RNA Seq,GSM8147857 r1,GSM8147857,1,Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. 0 2 4 and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0 2 4 and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer's directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598 and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled quantified and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer's instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina Cat. No. 20020598 and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized pooled and sequenced on a NextSeq 500 instrument Illumina as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP495323,,,s_2hpf_2.fastq,fastq,1578919456.0,20775256.0,GSM8147857 r1,0:76,A:380440230;C:393721925;G:368114931;T:436571104;N:71266,76,,,,380440230,393721925,368114931,436571104,71266,SRX23954960,SRS20755381,SRA1824599,"Computational Biology, Stowers Institute for Medical Research","Computational Biology, Stowers Institute for Medical Research",,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,trueseq,bulk,bulk,bulk,,United States,2024-03-14,Cleavage,Embryo,Whole Organism,All anatomical structures
30771,SRR28348937,SRX23954959,SRS20755380,SRP495323,PRJNA1088158,Protein profiling of zebrafish embryos unmasks regulatory layers during early embryogenesis.,GSE261646,Transcriptome Analysis,The maternal to zygotic transition is crucial in embryonic development marked by the degradation of maternally provided mRNAs and initiation of zygotic gene expression. However the changes occurring at the protein level during this transition remain unclear. Here we conducted protein profiling throughout zebrafish embryogenesis using quantitative mass spectrometry integrating transcriptomics and translatomics datasets. Our data shows that unlike RNA changes protein changes are less dynamic. Further increases in protein levels correlate with mRNA translation whereas declines in protein levels do not suggesting active protein degradation processes. Interestingly proteins from pure zygotic genes are present at fertilization challenging existing mRNA based gene classifications. As a proof of concept we utilized CRISPR Cas13d to target znf281b mRNA a gene whose protein significantly accumulates within the first two hpf demonstrating its crucial role in development. Consequently our protein profiling coupled with CRISPR Cas13d offers a new approach to unravel maternal mRNAs function during embryonic development. Overall design: Two biological replicate samples containing 50 zebrafish oocytes per stage were collected by pairing females in natural matings to ''purge'' mature eggs and used to establish an oogenesis time line. Fish were euthanized and ovaries harvested within 1–11 days post purging dpp. Stage I and II oocytes were collected at 1–2 dpp stage III oocytes germinal vesicle in central position at 4–7 dpp and stage IV oocytes germinal vesicle asymmetrically located at 8–10 dpp. Oocyte isolations were based on73 and conducted in isolation medium Leibovitz L 15 Sigma Aldrich #L5520 plus Collagenase I and II depending on the stages as follows. Stages I and II were isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130 and 3 mg/mL Collagenase II Gibco 17101015. Stage III was isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130. Stage IV was isolated by mechanical stripping with forceps and needle without xxx use of Collagenases. Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. Three biological replicate samples containing 20 dechorionated zebrafish embryos were snap frozen in TRIzol Invitrogen #15596026. Four time points of embryonic development were included: 1 cell stage 0 hpf hpf 2 hpf 4 hpf and 6 hpf. RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols.,,pubmed:39302832,,Zebrafish Embryo 2hpf rep1,GSM8147856,,source name:Whole embryo|tissue:Whole embryo|developmental stage:2hpf|genotype:AB TF and TLF|geo loc name:missing|collection date:missing,Zebrafish Embryo 2hpf rep1,Raw reads from zebrafish oocytes stages I IV and embryos 0 2 4 and 6 hpf were demultiplexed into FASTQ format allowing up to one mismatch using Illumina bcl convert 3.10.5. Reads were aligned to UCSC genome danRer11 with STAR aligner version 2.7.3a using Ensembl 106 gene models. Counts were converted to TPM values using RSEM version v1.3.0 and all subsequent analysis was done using TPM. Assembly: danRer11 Ensembl 106 gene models Supplementary files format and content: comma separated files with TPMs from all replicates,Whole embryo,,Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer’s protocols. 0 2 4 and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer’s protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0 2 4 and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer’s directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598 and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled quantified and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer’s instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina Cat. No. 20020598 and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized pooled and sequenced on a NextSeq 500 instrument Illumina as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.,,tissue:Whole embryo|developmental stage:2hpf|genotype:AB TF and TLF,GSM8147856,GSM8147856: Zebrafish Embryo 2hpf rep1; Danio rerio; RNA Seq,GSM8147856 r1,GSM8147856,1,Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. 0 2 4 and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0 2 4 and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer's directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598 and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled quantified and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer's instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina Cat. No. 20020598 and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized pooled and sequenced on a NextSeq 500 instrument Illumina as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP495323,,,s_2hpf_1.fastq,fastq,1730435412.0,22768887.0,GSM8147856 r1,0:76,A:420026952;C:428388301;G:403718608;T:478219805;N:81746,76,,,,420026952,428388301,403718608,478219805,81746,SRX23954959,SRS20755380,SRA1824599,"Computational Biology, Stowers Institute for Medical Research","Computational Biology, Stowers Institute for Medical Research",,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,trueseq,bulk,bulk,bulk,,United States,2024-03-14,Cleavage,Embryo,Whole Organism,All anatomical structures
32033,SRR28976522,SRX24505963,SRS21254128,SRP506702,PRJNA1109723,rbm24a is an organizer component of germ plasm to determine germ cell fate,GSE267086,Other,The formation of germ cells is a critical issue for the continuation of species. A large group of animals follow a preformation strategy to generate their primordial germ cells PGCs. They produce a set of localized maternal mRNAs and proteins to form phase separated germ plasm that functions as the PGC determinants but the mechanisms underlying the assembly of germ plasm is poorly understood. This study identifies Rbm24a as an enssential localized germ plasm protein component that controls the formation of large and functional germ plasm granules. Rbm24a is complexed with Buc and interacts with germ plasm mRNAs which determines the specific grasp of germ plasm mRNAs into the phase separated aggregates. Rbm24a absent granules fail to undergo kinesin dependent transport towards the cleavage furrows where small particles fuse into large ones. The loss of maternal rbm24a causes the complete degradation of germ plasm components and the disappearance of PGCs resulting in totally sterile animals. Our work establishes that Rbm24 is a critical nucleating organizer component of germ plasm highlighting an emerging common mechanism to read and recruit RNA component into phase separated condensates. Overall design: To elucidate the comprehensive RNA binding landscape of Rbm24a in zebrafish we employed RIP seq analysis on both rbm24a GFP knock in and wild type zebrafish.,,,,Zebrafish RIP seq Rbm24a Knock in IP,GSM8259538,,source name:whole embryo|tissue:whole embryo|developmental stage:4 cell stage|cell type:embryonic cell|genotype:Rbm24a Knock in|antibody:GFP|geo loc name:missing|collection date:missing,Zebrafish RIP seq Rbm24a Knock in IP,Each library was amplified by a 15 cycle PCR and 150 bp paired end sequencing was subjected to Illumina Nova seq 6000 to obtain the raw data. Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: Bigwig file for each Sample,whole embryo,,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA and RIP IP RNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina Nova seq 6000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions.,Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C,tissue:whole embryo|developmental stage:4 cell stage|cell type:embryonic cell|genotype:Rbm24a Knock in|antibody:GFP,GSM8259538,GSM8259538: Zebrafish RIP seq Rbm24a Knock in IP; Danio rerio; RIP Seq,GSM8259538 r1,GSM8259538,1,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA and RIP IP RNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina Nova seq 6000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions.,,RIP-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP506702,,,RIP_KI_IP_R2.fq.gz RIP_KI_IP_R1.fq.gz,fastq fastq,6457893104.0,21383752.0,GSM8259538 r1,0:151 1:151,A:975588225;C:2019180290;G:2469634919;T:992947702;N:541968,151,151,,,975588225,2019180290,2469634919,992947702,541968,SRX24505963,SRS21254128,SRA1863578,"Ang Li, College of Life Sciences, shandong university","Ang Li, College of Life Sciences, shandong university",2,0.90304,0.86018,0.20083,0.20471,0.96382,0.96743,0.96102,0.98876,151,151,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,unknown,bulk,bulk,bulk,,China,2024-05-09,Cleavage,Embryo,Whole Organism,All anatomical structures
32034,SRR28976523,SRX24505962,SRS21254127,SRP506702,PRJNA1109723,rbm24a is an organizer component of germ plasm to determine germ cell fate,GSE267086,Other,The formation of germ cells is a critical issue for the continuation of species. A large group of animals follow a preformation strategy to generate their primordial germ cells PGCs. They produce a set of localized maternal mRNAs and proteins to form phase separated germ plasm that functions as the PGC determinants but the mechanisms underlying the assembly of germ plasm is poorly understood. This study identifies Rbm24a as an enssential localized germ plasm protein component that controls the formation of large and functional germ plasm granules. Rbm24a is complexed with Buc and interacts with germ plasm mRNAs which determines the specific grasp of germ plasm mRNAs into the phase separated aggregates. Rbm24a absent granules fail to undergo kinesin dependent transport towards the cleavage furrows where small particles fuse into large ones. The loss of maternal rbm24a causes the complete degradation of germ plasm components and the disappearance of PGCs resulting in totally sterile animals. Our work establishes that Rbm24 is a critical nucleating organizer component of germ plasm highlighting an emerging common mechanism to read and recruit RNA component into phase separated condensates. Overall design: To elucidate the comprehensive RNA binding landscape of Rbm24a in zebrafish we employed RIP seq analysis on both rbm24a GFP knock in and wild type zebrafish.,,,,Zebrafish RIP seq wild type IP,GSM8259537,,source name:whole embryo|tissue:whole embryo|developmental stage:4 cell stage|cell type:embryonic cell|genotype:wild type|antibody:GFP|geo loc name:missing|collection date:missing,Zebrafish RIP seq wild type IP,Each library was amplified by a 15 cycle PCR and 150 bp paired end sequencing was subjected to Illumina Nova seq 6000 to obtain the raw data. Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: Bigwig file for each Sample,whole embryo,,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA and RIP IP RNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina Nova seq 6000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions.,Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C,tissue:whole embryo|developmental stage:4 cell stage|cell type:embryonic cell|genotype:wild type|antibody:GFP,GSM8259537,GSM8259537: Zebrafish RIP seq wild type IP; Danio rerio; RIP Seq,GSM8259537 r1,GSM8259537,1,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA and RIP IP RNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina Nova seq 6000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions.,,RIP-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP506702,,,RIP_WT_IP_R2.fq.gz RIP_WT_IP_R1.fq.gz,fastq fastq,4501412680.0,14905340.0,GSM8259537 r1,0:151 1:151,A:651609366;C:1285679784;G:1901211768;T:662533141;N:378621,151,151,,,651609366,1285679784,1901211768,662533141,378621,SRX24505962,SRS21254127,SRA1863578,"Ang Li, College of Life Sciences, shandong university","Ang Li, College of Life Sciences, shandong university",2,0.96426,0.81361,0.26579,0.2253,0.97784,0.97806,0.8699,0.93379,151,151,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,unknown,bulk,bulk,bulk,,China,2024-05-09,Cleavage,Embryo,Whole Organism,All anatomical structures