rowid,run.accession,experiment.accession,sample.accession,study.accession,bioproject,study.title,study.alias,study.type,study.abstract,study.attributes,study.PMIDs,sample.description,sample.title,sample.alias,sample.centername,sample.attributes,GEOsample.title,GEOsample.dataprocessing,GEOsample.source,GEOsample.treatmentprotocol,GEOsample.extractprotocol,GEOsample.growthprotocol,GEOsample.characteristics,GEOsample.accession,experiment.title,experiment.alias,experiment.library_name,experiment.design_description,experiment.library_construction_protocol,experiment.attributes,experiment.library_strategy,experiment.library_source,experiment.library_selection,experiment.library_layout,experiment.platform,experiment.instrument_model,experiment.spot_descriptor,experiment.study_ref,run.title,run.attributes,run.filename,run.semantic_name,run.total_bases,run.total_spots,run.alias,run.read_lengths,run.base_counts,run.r1_length,run.r2_length,run.r3_length,run.r4_length,run.Acount,run.Ccount,run.Gcount,run.Tcount,run.Ncount,run.experiment,run.pool_member,submission.accession,submission.srasource,submission.bioprojectsource,seqdetective.n_mates,seqdetective.mapping_rate.mate1,seqdetective.mapping_rate.mate2,seqdetective.nofeature_rate.mate1,seqdetective.nofeature_rate.mate2,seqdetective.sparsity.mate1,seqdetective.sparsity.mate2,seqdetective.pos_strand_rate.mate1,seqdetective.pos_strand_rate.mate2,seqdetective.readlen.mate1,seqdetective.readlen.mate2,seqdetective.judgement.mate1,seqdetective.judgement.mate2,seqdetective.judgement.reason,platform_family,instrument_generation,read_bias,selection_class,prep_kit,sc_or_bulk,tech_class,technology,tech_variant,submission.bioprojectsource.country,earliest_date,devstage_curation,devstage_curation_coarse,tissue_curation,tissue_curation_coarse 71,DRR032753,DRX029559,DRS049958,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 114 individuals,Dr 8cell 2,SAMD00028150,,sample name:Dr 8cell 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:8cell|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028150,DRX029559,Dr 8cell 2,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028150,,,,3708921900.0,37089219.0,DRR032753,0:100 1:0,A:985502141;C:874161613;G:869551685;T:979663686;N:42775,100,0,,,985502141,874161613,869551685,979663686,42775,DRX029559,DRS049958,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.93329,,0.02366,,0.78896,,0.47447,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Cleavage,Embryo,Whole Organism,All anatomical structures 72,DRR032752,DRX029558,DRS049957,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 96 individuals,Dr 8cell 1,SAMD00028149,,sample name:Dr 8cell 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:8cell|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028149,DRX029558,Dr 8cell 1,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028149,,,,3666991200.0,36669912.0,DRR032752,0:100 1:0,A:976118513;C:862559696;G:858017821;T:970254302;N:40868,100,0,,,976118513,862559696,858017821,970254302,40868,DRX029558,DRS049957,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.934,,0.02403,,0.78877,,0.46902,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Cleavage,Embryo,Whole Organism,All anatomical structures 86,DRR032738,DRX029544,DRS049943,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 100 individuals,Dr 32cell 2,SAMD00028135,,sample name:Dr 32cell 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:32cell|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028135,DRX029544,Dr 32cell 2,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028135,,,,3678713000.0,36787130.0,DRR032738,0:100 1:0,A:981005900;C:863203049;G:859660640;T:974807835;N:35576,100,0,,,981005900,863203049,859660640,974807835,35576,DRX029544,DRS049943,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.93302,,0.02468,,0.77441,,0.47485,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Cleavage,Embryo,Whole Organism,All anatomical structures 87,DRR032737,DRX029543,DRS049942,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 95 individuals,Dr 32cell 1,SAMD00028134,,sample name:Dr 32cell 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:32cell|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028134,DRX029543,Dr 32cell 1,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028134,,,,3870906500.0,38709065.0,DRR032737,0:100 1:0,A:1030407751;C:909948718;G:905608620;T:1024897443;N:43968,100,0,,,1030407751,909948718,905608620,1024897443,43968,DRX029543,DRS049942,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.93364,,0.02484,,0.77307,,0.47588,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Cleavage,Embryo,Whole Organism,All anatomical structures 90,DRR032734,DRX029540,DRS049939,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 107 individuals,Dr 2cell 2,SAMD00028131,,sample name:Dr 2cell 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:2cell|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028131,DRX029540,Dr 2cell 2,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028131,,,,3687517000.0,36875170.0,DRR032734,0:100 1:0,A:975272080;C:873518282;G:869743434;T:968941851;N:41353,100,0,,,975272080,873518282,869743434,968941851,41353,DRX029540,DRS049939,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.93204,,0.02088,,0.81639,,0.47553,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Cleavage,Embryo,Whole Organism,All anatomical structures 91,DRR032733,DRX029539,DRS049938,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 108 individuals,Dr 2cell 1,SAMD00028130,,sample name:Dr 2cell 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:2cell|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028130,DRX029539,Dr 2cell 1,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028130,,,,4156651100.0,41566511.0,DRR032733,0:100 1:0,A:1099943617;C:985498415;G:978884426;T:1092278665;N:45977,100,0,,,1099943617,985498415,978884426,1092278665,45977,DRX029539,DRS049938,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.93452,,0.02198,,0.81197,,0.47342,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Cleavage,Embryo,Whole Organism,All anatomical structures 3155,ERR1410225,ERX1481464,ERS1021813,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 pool12,SAMEA3714664,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714664|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:11Z|INSDC status:public|Submitter Id:e9237f50 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TTCAGCTC is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e9237f50 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#24,15565967,Illumina sequencing of library 15565967 constructed from sample accession ERS1021813 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TTCAGCTC.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#24.cram,cram,682856330.0,5252741.0,SC RUN 18730 4#24,0:55 1:75,A:168217714;C:139075008;G:141169282;T:234338870;N:55456,55,75,,,168217714,139075008,141169282,234338870,55456,ERX1481464,ERS1021813,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.22601,0.6266,0.06302,0.07433,0.95848,0.87767,0.77147,0.72121,55,75,B,B,mate1-mate2 similar by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures 3156,ERR1410224,ERX1481463,ERS1021812,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 pool11,SAMEA3714663,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714663|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:10Z|INSDC status:public|Submitter Id:e91834b0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TACTAGTC is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e91834b0 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#23,15565966,Illumina sequencing of library 15565966 constructed from sample accession ERS1021812 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TACTAGTC.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#23.cram,cram,784669730.0,6035921.0,SC RUN 18730 4#23,0:55 1:75,A:193369040;C:154930839;G:157589012;T:278718023;N:62816,55,75,,,193369040,154930839,157589012,278718023,62816,ERX1481463,ERS1021812,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.22113,0.66423,0.05856,0.07177,0.95899,0.86705,0.76036,0.71777,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures 3157,ERR1410223,ERX1481462,ERS1021811,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 pool10,SAMEA3714662,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714662|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:10Z|INSDC status:public|Submitter Id:e90c9bf0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TCAGATTC is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e90c9bf0 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#22,15565965,Illumina sequencing of library 15565965 constructed from sample accession ERS1021811 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TCAGATTC.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#22.cram,cram,1247901590.0,9599243.0,SC RUN 18730 4#22,0:55 1:75,A:314703461;C:244320464;G:241561095;T:447214667;N:101903,55,75,,,314703461,244320464,241561095,447214667,101903,ERX1481462,ERS1021811,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.20694,0.62963,0.04856,0.05487,0.95763,0.87026,0.7137,0.71273,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures 3158,ERR1410222,ERX1481461,ERS1021810,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 pool9,SAMEA3714661,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714661|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:09Z|INSDC status:public|Submitter Id:e8fe4410 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TATGCCAG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8fe4410 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#21,15565964,Illumina sequencing of library 15565964 constructed from sample accession ERS1021810 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TATGCCAG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#21.cram,cram,1160974880.0,8930576.0,SC RUN 18730 4#21,0:55 1:75,A:287583127;C:233701395;G:225242195;T:414354028;N:94135,55,75,,,287583127,233701395,225242195,414354028,94135,ERX1481461,ERS1021810,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.20242,0.60852,0.05828,0.06484,0.95568,0.87456,0.67452,0.38749,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures 3159,ERR1410221,ERX1481460,ERS1021809,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 pool8,SAMEA3714660,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714660|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:08Z|INSDC status:public|Submitter Id:e8f2d260 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TGGCTCAG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8f2d260 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#20,15565963,Illumina sequencing of library 15565963 constructed from sample accession ERS1021809 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TGGCTCAG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#20.cram,cram,1041644630.0,8012651.0,SC RUN 18730 4#20,0:55 1:75,A:250361997;C:216927117;G:209137594;T:365137042;N:80880,55,75,,,250361997,216927117,209137594,365137042,80880,ERX1481460,ERS1021809,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.23722,0.6381,0.05317,0.07562,0.95503,0.87671,0.75995,0.72353,55,75,B,B,mate1-mate2 similar by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures 3160,ERR1410220,ERX1481459,ERS1021808,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 pool7,SAMEA3714659,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714659|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:08Z|INSDC status:public|Submitter Id:e8e787c0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TCATTGAG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8e787c0 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#19,15565962,Illumina sequencing of library 15565962 constructed from sample accession ERS1021808 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TCATTGAG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#19.cram,cram,1002402180.0,7710786.0,SC RUN 18730 4#19,0:55 1:75,A:249654737;C:203437995;G:194586976;T:354640685;N:81787,55,75,,,249654737,203437995,194586976,354640685,81787,ERX1481459,ERS1021808,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.21081,0.61197,0.04352,0.05852,0.9529,0.86815,0.65385,0.64824,55,75,B,B,mate1-mate2 similar by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures 3161,ERR1410219,ERX1481458,ERS1021807,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 pool6,SAMEA3714658,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714658|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:07Z|INSDC status:public|Submitter Id:e8dc3d20 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TGTATGCG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8dc3d20 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#18,15565961,Illumina sequencing of library 15565961 constructed from sample accession ERS1021807 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TGTATGCG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#18.cram,cram,1001271050.0,7702085.0,SC RUN 18730 4#18,0:55 1:75,A:249131077;C:206043698;G:193568917;T:352446609;N:80749,55,75,,,249131077,206043698,193568917,352446609,80749,ERX1481458,ERS1021807,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.22004,0.6117,0.05313,0.0656,0.95095,0.8758,0.70135,0.69364,55,75,B,B,mate1-mate2 similar by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures 3162,ERR1410218,ERX1481457,ERS1021806,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 pool5,SAMEA3714657,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714657|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:06Z|INSDC status:public|Submitter Id:e8b183a0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TCCAGTCG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8b183a0 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#17,15565960,Illumina sequencing of library 15565960 constructed from sample accession ERS1021806 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TCCAGTCG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#17.cram,cram,1240938140.0,9545678.0,SC RUN 18730 4#17,0:55 1:75,A:302318036;C:249218633;G:246601321;T:442702025;N:98125,55,75,,,302318036,249218633,246601321,442702025,98125,ERX1481457,ERS1021806,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.23057,0.63523,0.05319,0.067,0.95213,0.86695,0.69753,0.68537,55,75,B,B,mate1-mate2 similar by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures 3163,ERR1410217,ERX1481456,ERS1021805,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 pool4,SAMEA3714656,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714656|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:06Z|INSDC status:public|Submitter Id:e8ab9030 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TAAGTTCG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8ab9030 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#16,15565959,Illumina sequencing of library 15565959 constructed from sample accession ERS1021805 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TAAGTTCG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#16.cram,cram,942829030.0,7252531.0,SC RUN 18730 4#16,0:55 1:75,A:225274547;C:196341691;G:188483755;T:332654028;N:75009,55,75,,,225274547,196341691,188483755,332654028,75009,ERX1481456,ERS1021805,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.21889,0.64365,0.04363,0.07265,0.95181,0.87478,0.70501,0.69162,55,75,B,B,mate1-mate2 similar by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures 3164,ERR1410216,ERX1481455,ERS1021804,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 pool3,SAMEA3714655,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714655|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:05Z|INSDC status:public|Submitter Id:e8a5eae0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TCAGGAGG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8a5eae0 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#15,15565958,Illumina sequencing of library 15565958 constructed from sample accession ERS1021804 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TCAGGAGG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#15.cram,cram,992671030.0,7635931.0,SC RUN 18730 4#15,0:55 1:75,A:241776762;C:210080049;G:195284057;T:345448849;N:81313,55,75,,,241776762,210080049,195284057,345448849,81313,ERX1481455,ERS1021804,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.21439,0.6195,0.04725,0.05379,0.95191,0.87606,0.67336,0.65016,55,75,B,B,mate1-mate2 similar by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures 3165,ERR1410215,ERX1481454,ERS1021803,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 pool2,SAMEA3714654,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714654|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:05Z|INSDC status:public|Submitter Id:e89cc320 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TCTCACGG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e89cc320 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#14,15565957,Illumina sequencing of library 15565957 constructed from sample accession ERS1021803 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TCTCACGG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#14.cram,cram,1234311910.0,9494707.0,SC RUN 18730 4#14,0:55 1:75,A:301439259;C:257228602;G:244500849;T:431043241;N:99959,55,75,,,301439259,257228602,244500849,431043241,99959,ERX1481454,ERS1021803,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.19348,0.62337,0.04021,0.05986,0.95574,0.87941,0.67064,0.69696,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures 3166,ERR1410214,ERX1481453,ERS1021802,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 pool1,SAMEA3714653,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714653|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:04Z|INSDC status:public|Submitter Id:e897ba10 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TACTTCGG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e897ba10 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#13,15565956,Illumina sequencing of library 15565956 constructed from sample accession ERS1021802 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TACTTCGG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#13.cram,cram,1039867140.0,7998978.0,SC RUN 18730 4#13,0:55 1:75,A:252384576;C:218519074;G:206578085;T:362298880;N:86525,55,75,,,252384576,218519074,206578085,362298880,86525,ERX1481453,ERS1021802,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.18713,0.60956,0.05049,0.0817,0.95556,0.87618,0.66594,0.68034,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures 3167,ERR1410213,ERX1481452,ERS1021801,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 12,SAMEA3714652,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714652|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:04Z|INSDC status:public|Submitter Id:e89262e0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TGAACTGG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e89262e0 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#12,15565955,Illumina sequencing of library 15565955 constructed from sample accession ERS1021801 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TGAACTGG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#12.cram,cram,1071792020.0,8244554.0,SC RUN 18730 4#12,0:55 1:75,A:266291261;C:216074486;G:207838804;T:381495628;N:91841,55,75,,,266291261,216074486,207838804,381495628,91841,ERX1481452,ERS1021801,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.19027,0.64477,0.0489,0.06997,0.95268,0.86371,0.66594,0.67162,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures 3168,ERR1410212,ERX1481451,ERS1021800,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 11,SAMEA3714651,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714651|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:03Z|INSDC status:public|Submitter Id:e88d59d0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TTGGTATG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e88d59d0 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#11,15565954,Illumina sequencing of library 15565954 constructed from sample accession ERS1021800 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TTGGTATG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#11.cram,cram,686164570.0,5278189.0,SC RUN 18730 4#11,0:55 1:75,A:165352345;C:146328635;G:134343947;T:240083817;N:55826,55,75,,,165352345,146328635,134343947,240083817,55826,ERX1481451,ERS1021800,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.22823,0.61844,0.08567,0.10696,0.95106,0.86797,0.62805,0.63179,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures 3169,ERR1410211,ERX1481450,ERS1021799,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 10,SAMEA3714650,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714650|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:03Z|INSDC status:public|Submitter Id:e88829b0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TAACGCTG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e88829b0 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#10,15565953,Illumina sequencing of library 15565953 constructed from sample accession ERS1021799 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TAACGCTG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#10.cram,cram,889043870.0,6838799.0,SC RUN 18730 4#10,0:55 1:75,A:223435089;C:179282347;G:171273337;T:314981588;N:71509,55,75,,,223435089,179282347,171273337,314981588,71509,ERX1481450,ERS1021799,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.19054,0.6472,0.0467,0.06495,0.953,0.86519,0.68221,0.68725,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures 3170,ERR1410210,ERX1481449,ERS1021798,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 9,SAMEA3714649,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714649|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:02Z|INSDC status:public|Submitter Id:e88320a0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TCGAAGTG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e88320a0 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#9,15565952,Illumina sequencing of library 15565952 constructed from sample accession ERS1021798 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TCGAAGTG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#9.cram,cram,987809940.0,7598538.0,SC RUN 18730 4#9,0:55 1:75,A:248484130;C:197140774;G:188385871;T:353715305;N:83860,55,75,,,248484130,197140774,188385871,353715305,83860,ERX1481449,ERS1021798,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.2215,0.62639,0.05009,0.06362,0.94959,0.86689,0.63702,0.63984,55,75,B,B,mate1-mate2 similar by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures 3171,ERR1410209,ERX1481448,ERS1021797,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 8,SAMEA3714648,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714648|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:02Z|INSDC status:public|Submitter Id:e87d5440 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TTCCATTG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e87d5440 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#8,15565951,Illumina sequencing of library 15565951 constructed from sample accession ERS1021797 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TTCCATTG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#8.cram,cram,991993340.0,7630718.0,SC RUN 18730 4#8,0:55 1:75,A:248601530;C:201637312;G:190701521;T:350971271;N:81706,55,75,,,248601530,201637312,190701521,350971271,81706,ERX1481448,ERS1021797,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.18071,0.60546,0.04372,0.05614,0.95556,0.87182,0.64904,0.68316,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures 3172,ERR1410208,ERX1481447,ERS1021796,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 7,SAMEA3714647,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714647|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:01Z|INSDC status:public|Submitter Id:e871e290 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TAGTCTTG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e871e290 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#7,15565950,Illumina sequencing of library 15565950 constructed from sample accession ERS1021796 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TAGTCTTG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#7.cram,cram,1355591770.0,10427629.0,SC RUN 18730 4#7,0:55 1:75,A:333761549;C:285155703;G:270975293;T:465589806;N:109419,55,75,,,333761549,285155703,270975293,465589806,109419,ERX1481447,ERS1021796,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.19403,0.63995,0.03449,0.07104,0.957,0.88641,0.73288,0.71598,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures 3173,ERR1410207,ERX1481446,ERS1021795,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 6,SAMEA3714646,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714646|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:01Z|INSDC status:public|Submitter Id:e86670e0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TGTGGTTG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e86670e0 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#6,15565949,Illumina sequencing of library 15565949 constructed from sample accession ERS1021795 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TGTGGTTG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#6.cram,cram,1121411330.0,8626241.0,SC RUN 18730 4#6,0:55 1:75,A:275436070;C:245845272;G:219970219;T:380067436;N:92333,55,75,,,275436070,245845272,219970219,380067436,92333,ERX1481446,ERS1021795,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.185,0.59026,0.03934,0.06143,0.95268,0.88968,0.59393,0.69736,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures 3174,ERR1410206,ERX1481445,ERS1021794,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 5,SAMEA3714645,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714645|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:01Z|INSDC status:public|Submitter Id:e85b2640 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TCCTCAAT is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e85b2640 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#5,15565948,Illumina sequencing of library 15565948 constructed from sample accession ERS1021794 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TCCTCAAT.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#5.cram,cram,852544290.0,6558033.0,SC RUN 18730 4#5,0:55 1:75,A:202033234;C:177211087;G:169900063;T:303332405;N:67501,55,75,,,202033234,177211087,169900063,303332405,67501,ERX1481445,ERS1021794,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.21445,0.62891,0.0753,0.09655,0.95278,0.86929,0.61569,0.48656,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures 3175,ERR1410205,ERX1481444,ERS1021793,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 4,SAMEA3714644,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714644|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:00Z|INSDC status:public|Submitter Id:e84f8d80 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TACAGGAT is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e84f8d80 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#4,15565947,Illumina sequencing of library 15565947 constructed from sample accession ERS1021793 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TACAGGAT.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#4.cram,cram,989803880.0,7613876.0,SC RUN 18730 4#4,0:55 1:75,A:241562947;C:196888151;G:193862254;T:357404172;N:86356,55,75,,,241562947,196888151,193862254,357404172,86356,ERX1481444,ERS1021793,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.27131,0.63988,0.04128,0.04919,0.95923,0.88292,0.81011,0.7508,55,75,B,B,mate1-mate2 similar by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures 3176,ERR1410204,ERX1481443,ERS1021792,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 3,SAMEA3714643,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714643|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:00Z|INSDC status:public|Submitter Id:e8441bd0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TAGTGACT is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8441bd0 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#3,15565946,Illumina sequencing of library 15565946 constructed from sample accession ERS1021792 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TAGTGACT.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#3.cram,cram,1144202930.0,8801561.0,SC RUN 18730 4#3,0:55 1:75,A:278906912;C:230946498;G:229591661;T:404660425;N:97434,55,75,,,278906912,230946498,229591661,404660425,97434,ERX1481443,ERS1021792,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.24055,0.6437,0.04616,0.05861,0.9554,0.88221,0.30306,0.73916,55,75,B,B,mate1-mate2 similar by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures 3177,ERR1410203,ERX1481442,ERS1021791,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 2,SAMEA3714642,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714642|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:41:59Z|INSDC status:public|Submitter Id:e8385c00 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TTCCTGCT is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8385c00 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#2,15565945,Illumina sequencing of library 15565945 constructed from sample accession ERS1021791 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TTCCTGCT.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#2.cram,cram,1459339960.0,11225692.0,SC RUN 18730 4#2,0:55 1:75,A:361580033;C:294777861;G:295641568;T:507221717;N:118781,55,75,,,361580033,294777861,295641568,507221717,118781,ERX1481442,ERS1021791,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.25446,0.64481,0.04258,0.05864,0.95473,0.88562,0.32211,0.75437,55,75,B,B,mate1-mate2 similar by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures 3178,ERR1410202,ERX1481441,ERS1021790,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 1,SAMEA3714641,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714641|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:41:58Z|INSDC status:public|Submitter Id:e73ff240 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TGCGATCT is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e73ff240 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#1,15565944,Illumina sequencing of library 15565944 constructed from sample accession ERS1021790 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TGCGATCT.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#1.cram,cram,869624210.0,6689417.0,SC RUN 18730 4#1,0:55 1:75,A:211816407;C:178380016;G:176641186;T:302714073;N:72528,55,75,,,211816407,178380016,176641186,302714073,72528,ERX1481441,ERS1021790,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.26789,0.63129,0.0568,0.09239,0.95978,0.88978,0.82999,0.78005,55,75,B,B,mate1-mate2 similar by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures 3788,ERR1442900,ERX1513277,ERS1079219,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 F,SAMEA3892085,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892085|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:07Z|INSDC status:public|Submitter Id:744149e0 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:744149e0 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19912 2#70,16564972,Illumina sequencing of library 16564972 constructed from sample accession ERS1079219 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 2. This submission includes reads tagged with the sequence GATCTCTT.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19912_2#70.cram,cram,364410400.0,1822052.0,SC RUN 19912 2#70,0:100 1:100,A:96471898;C:85460940;G:85739185;T:96152266;N:586111,100,100,,,96471898,85460940,85739185,96152266,586111,ERX1513277,ERS1079219,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96377,0.96719,0.0976,0.09955,0.79667,0.79693,0.58832,0.58226,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures 3789,ERR1442899,ERX1513276,ERS1079218,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 E,SAMEA3892084,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892084|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74358a10 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74358a10 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19912 2#69,16564960,Illumina sequencing of library 16564960 constructed from sample accession ERS1079218 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 2. This submission includes reads tagged with the sequence GGTGAGTT.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19912_2#69.cram,cram,312144800.0,1560724.0,SC RUN 19912 2#69,0:100 1:100,A:82044388;C:74027006;G:73985684;T:81583681;N:504041,100,100,,,82044388,74027006,73985684,81583681,504041,ERX1513276,ERS1079218,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96275,0.9677,0.10631,0.10791,0.79496,0.79535,0.57643,0.57303,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures 3790,ERR1442898,ERX1513275,ERS1079217,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 D,SAMEA3892083,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892083|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74295510 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74295510 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19912 2#68,16564948,Illumina sequencing of library 16564948 constructed from sample accession ERS1079217 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 2. This submission includes reads tagged with the sequence TGCGTGAA.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19912_2#68.cram,cram,330453000.0,1652265.0,SC RUN 19912 2#68,0:100 1:100,A:87696659;C:77248972;G:77394239;T:87578108;N:535022,100,100,,,87696659,77248972,77394239,87578108,535022,ERX1513275,ERS1079217,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96171,0.96419,0.10779,0.11047,0.79902,0.80018,0.57383,0.56925,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures 3791,ERR1442897,ERX1513274,ERS1079216,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 C,SAMEA3892082,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892082|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:741d9540 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:741d9540 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19912 2#67,16564936,Illumina sequencing of library 16564936 constructed from sample accession ERS1079216 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 2. This submission includes reads tagged with the sequence TACCACCA.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19912_2#67.cram,cram,327261000.0,1636305.0,SC RUN 19912 2#67,0:100 1:100,A:87523901;C:75771535;G:75871608;T:87573282;N:520674,100,100,,,87523901,75771535,75871608,87573282,520674,ERX1513274,ERS1079216,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.95986,0.96354,0.1123,0.11468,0.80156,0.80229,0.58372,0.58338,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures 3792,ERR1442896,ERX1513273,ERS1079215,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 B,SAMEA3892081,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892081|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:05Z|INSDC status:public|Submitter Id:74118750 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74118750 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19912 2#66,16564924,Illumina sequencing of library 16564924 constructed from sample accession ERS1079215 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 2. This submission includes reads tagged with the sequence TGAAGCCA.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19912_2#66.cram,cram,328496600.0,1642483.0,SC RUN 19912 2#66,0:100 1:100,A:86841947;C:77278436;G:77262516;T:86589805;N:523896,100,100,,,86841947,77278436,77262516,86589805,523896,ERX1513273,ERS1079215,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96091,0.96535,0.1279,0.13047,0.79805,0.79857,0.58551,0.58209,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures 3878,ERR1442810,ERX1513187,ERS1079219,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 F,SAMEA3892085,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892085|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:07Z|INSDC status:public|Submitter Id:744149e0 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:744149e0 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19912 1#70,16564972,Illumina sequencing of library 16564972 constructed from sample accession ERS1079219 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 1. This submission includes reads tagged with the sequence GATCTCTT.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19912_1#70.cram,cram,364912600.0,1824563.0,SC RUN 19912 1#70,0:100 1:100,A:96642496;C:85588675;G:85883202;T:96301393;N:496834,100,100,,,96642496,85588675,85883202,96301393,496834,ERX1513187,ERS1079219,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96362,0.96689,0.09725,0.09882,0.79592,0.79703,0.59097,0.5784,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures 3879,ERR1442809,ERX1513186,ERS1079218,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 E,SAMEA3892084,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892084|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74358a10 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74358a10 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19912 1#69,16564960,Illumina sequencing of library 16564960 constructed from sample accession ERS1079218 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 1. This submission includes reads tagged with the sequence GGTGAGTT.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19912_1#69.cram,cram,312470400.0,1562352.0,SC RUN 19912 1#69,0:100 1:100,A:82160555;C:74100532;G:74069193;T:81696066;N:444054,100,100,,,82160555,74100532,74069193,81696066,444054,ERX1513186,ERS1079218,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96376,0.96859,0.10642,0.1079,0.79417,0.79474,0.5752,0.57,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures 3880,ERR1442808,ERX1513185,ERS1079217,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 D,SAMEA3892083,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892083|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74295510 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74295510 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19912 1#68,16564948,Illumina sequencing of library 16564948 constructed from sample accession ERS1079217 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 1. This submission includes reads tagged with the sequence TGCGTGAA.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19912_1#68.cram,cram,330554000.0,1652770.0,SC RUN 19912 1#68,0:100 1:100,A:87747224;C:77298685;G:77439701;T:87616982;N:451408,100,100,,,87747224,77298685,77439701,87616982,451408,ERX1513185,ERS1079217,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96163,0.96436,0.10875,0.1111,0.79928,0.79965,0.57561,0.5708,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures 3881,ERR1442807,ERX1513184,ERS1079216,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 C,SAMEA3892082,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892082|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:741d9540 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:741d9540 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19912 1#67,16564936,Illumina sequencing of library 16564936 constructed from sample accession ERS1079216 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 1. This submission includes reads tagged with the sequence TACCACCA.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19912_1#67.cram,cram,327019400.0,1635097.0,SC RUN 19912 1#67,0:100 1:100,A:87453957;C:75726607;G:75847551;T:87546870;N:444415,100,100,,,87453957,75726607,75847551,87546870,444415,ERX1513184,ERS1079216,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96147,0.9625,0.11258,0.11475,0.79825,0.79924,0.58372,0.56917,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures 3882,ERR1442806,ERX1513183,ERS1079215,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 B,SAMEA3892081,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892081|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:05Z|INSDC status:public|Submitter Id:74118750 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74118750 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19912 1#66,16564924,Illumina sequencing of library 16564924 constructed from sample accession ERS1079215 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 1. This submission includes reads tagged with the sequence TGAAGCCA.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19912_1#66.cram,cram,327613800.0,1638069.0,SC RUN 19912 1#66,0:100 1:100,A:86594522;C:77121933;G:77114321;T:86338082;N:444942,100,100,,,86594522,77121933,77114321,86338082,444942,ERX1513183,ERS1079215,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.9614,0.96527,0.12823,0.13043,0.79762,0.79922,0.58597,0.5851,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures 3968,ERR1442720,ERX1513097,ERS1079219,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 F,SAMEA3892085,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892085|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:07Z|INSDC status:public|Submitter Id:744149e0 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:744149e0 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19850 2#70,16564972,Illumina sequencing of library 16564972 constructed from sample accession ERS1079219 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 2. This submission includes reads tagged with the sequence GATCTCTT.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19850_2#70.cram,cram,371283800.0,1856419.0,SC RUN 19850 2#70,0:100 1:100,A:98443439;C:87187703;G:87417381;T:98100142;N:135135,100,100,,,98443439,87187703,87417381,98100142,135135,ERX1513097,ERS1079219,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96411,0.96451,0.09692,0.09902,0.79657,0.7964,0.58932,0.57779,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures 3969,ERR1442719,ERX1513096,ERS1079218,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 E,SAMEA3892084,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892084|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74358a10 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74358a10 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19850 2#69,16564960,Illumina sequencing of library 16564960 constructed from sample accession ERS1079218 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 2. This submission includes reads tagged with the sequence GGTGAGTT.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19850_2#69.cram,cram,318491400.0,1592457.0,SC RUN 19850 2#69,0:100 1:100,A:83845999;C:75642375;G:75561647;T:83330437;N:110942,100,100,,,83845999,75642375,75561647,83330437,110942,ERX1513096,ERS1079218,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96388,0.96834,0.10544,0.10741,0.79336,0.79417,0.57217,0.56939,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures 3970,ERR1442718,ERX1513095,ERS1079217,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 D,SAMEA3892083,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892083|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74295510 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74295510 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19850 2#68,16564948,Illumina sequencing of library 16564948 constructed from sample accession ERS1079217 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 2. This submission includes reads tagged with the sequence TGCGTGAA.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19850_2#68.cram,cram,335548800.0,1677744.0,SC RUN 19850 2#68,0:100 1:100,A:89188408;C:78543202;G:78653253;T:89044211;N:119726,100,100,,,89188408,78543202,78653253,89044211,119726,ERX1513095,ERS1079217,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96211,0.96612,0.10777,0.11055,0.79724,0.79876,0.57249,0.43044,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures 3971,ERR1442717,ERX1513094,ERS1079216,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 C,SAMEA3892082,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892082|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:741d9540 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:741d9540 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19850 2#67,16564936,Illumina sequencing of library 16564936 constructed from sample accession ERS1079216 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 2. This submission includes reads tagged with the sequence TACCACCA.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19850_2#67.cram,cram,331952200.0,1659761.0,SC RUN 19850 2#67,0:100 1:100,A:88872903;C:76957606;G:77065688;T:88935012;N:120991,100,100,,,88872903,76957606,77065688,88935012,120991,ERX1513094,ERS1079216,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96191,0.96393,0.11342,0.11468,0.799,0.79908,0.58219,0.58045,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures 3972,ERR1442716,ERX1513093,ERS1079215,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 B,SAMEA3892081,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892081|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:05Z|INSDC status:public|Submitter Id:74118750 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74118750 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19850 2#66,16564924,Illumina sequencing of library 16564924 constructed from sample accession ERS1079215 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 2. This submission includes reads tagged with the sequence TGAAGCCA.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19850_2#66.cram,cram,333024200.0,1665121.0,SC RUN 19850 2#66,0:100 1:100,A:88172616;C:78454066;G:78393792;T:87885914;N:117812,100,100,,,88172616,78454066,78393792,87885914,117812,ERX1513093,ERS1079215,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96249,0.96556,0.1289,0.13166,0.79945,0.79961,0.58336,0.58063,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures 4058,ERR1442630,ERX1513007,ERS1079219,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 F,SAMEA3892085,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892085|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:07Z|INSDC status:public|Submitter Id:744149e0 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:744149e0 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19850 1#70,16564972,Illumina sequencing of library 16564972 constructed from sample accession ERS1079219 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 1. This submission includes reads tagged with the sequence GATCTCTT.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19850_1#70.cram,cram,371578800.0,1857894.0,SC RUN 19850 1#70,0:100 1:100,A:98533022;C:87264222;G:87555118;T:98151909;N:74529,100,100,,,98533022,87264222,87555118,98151909,74529,ERX1513007,ERS1079219,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.9636,0.96761,0.09699,0.09916,0.79525,0.79553,0.58618,0.57988,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures 4059,ERR1442629,ERX1513006,ERS1079218,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 E,SAMEA3892084,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892084|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74358a10 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74358a10 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19850 1#69,16564960,Illumina sequencing of library 16564960 constructed from sample accession ERS1079218 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 1. This submission includes reads tagged with the sequence GGTGAGTT.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19850_1#69.cram,cram,318342200.0,1591711.0,SC RUN 19850 1#69,0:100 1:100,A:83801083;C:75621628;G:75578752;T:83271737;N:69000,100,100,,,83801083,75621628,75578752,83271737,69000,ERX1513006,ERS1079218,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96351,0.96877,0.10486,0.10713,0.79423,0.79444,0.57288,0.57375,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures 4060,ERR1442628,ERX1513005,ERS1079217,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 D,SAMEA3892083,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892083|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74295510 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74295510 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19850 1#68,16564948,Illumina sequencing of library 16564948 constructed from sample accession ERS1079217 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 1. This submission includes reads tagged with the sequence TGCGTGAA.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19850_1#68.cram,cram,334846000.0,1674230.0,SC RUN 19850 1#68,0:100 1:100,A:88989528;C:78413149;G:78541907;T:88833028;N:68388,100,100,,,88989528,78413149,78541907,88833028,68388,ERX1513005,ERS1079217,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96197,0.96681,0.10873,0.11111,0.79805,0.7992,0.57474,0.57198,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures 4061,ERR1442627,ERX1513004,ERS1079216,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 C,SAMEA3892082,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892082|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:741d9540 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:741d9540 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19850 1#67,16564936,Illumina sequencing of library 16564936 constructed from sample accession ERS1079216 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 1. This submission includes reads tagged with the sequence TACCACCA.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19850_1#67.cram,cram,332077800.0,1660389.0,SC RUN 19850 1#67,0:100 1:100,A:88958890;C:76946124;G:77079866;T:89022508;N:70412,100,100,,,88958890,76946124,77079866,89022508,70412,ERX1513004,ERS1079216,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96162,0.96369,0.11367,0.11586,0.7992,0.79855,0.58505,0.58088,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures 4062,ERR1442626,ERX1513003,ERS1079215,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 B,SAMEA3892081,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892081|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:05Z|INSDC status:public|Submitter Id:74118750 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74118750 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19850 1#66,16564924,Illumina sequencing of library 16564924 constructed from sample accession ERS1079215 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 1. This submission includes reads tagged with the sequence TGAAGCCA.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19850_1#66.cram,cram,332776400.0,1663882.0,SC RUN 19850 1#66,0:100 1:100,A:88108657;C:78400833;G:78371292;T:87823689;N:71929,100,100,,,88108657,78400833,78371292,87823689,71929,ERX1513003,ERS1079215,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96154,0.96535,0.12909,0.13161,0.79815,0.79959,0.58756,0.58417,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures 8090,ERR034125,ERX012651,ERS032266,ERP000635,PRJEB2512,The Zebrafish transcriptome during early development,KI-BN-JKE-DRERIO-RNASEQ-2011,Transcriptome Analysis,Background: Zebrafish Danio rerio is an important model for the study of early vertebrate development. The transition from fertilized egg to embryo is accompanied by a multitude of changes in gene expression and the transcriptional events that underlie these processes have not been fully characterized. In this study we use RNA Seq to characterize and compare the transcriptome of four early developmental stages in zebrafish on a global scale. Results: An average of 79M total reads were detected from the different stages. Out of the total number of reads 65% 73% reads were successfully mapped to the zebrafish genome and 36% 44% out of those were uniquely mapped. The total number of detected unique gene transcripts was 11187 of which 10096 of these were already present at 1 cell stage. The largest number of common transcripts was observed between 1 cell stage and 16 cell stage. An enrichment of gene transcripts with molecular functions of DNA binding protein folding and processing as well as metal ion binding was observed with progression of development. To confirm our RNA Seq results and to further investigate the developmental expression of specific genes the transcript levels of a subset of genes were analyzed using TaqMan® array micro fluidic card TLDA. Conclusion: Clustering analysis of the detected transcripts show a majority of gene transcripts being present at steady levels with a minority of the gene transcripts clustering as increasing or decreasing in expression during development. Developmental stages pre MBT were similar when comparing highly expressed genes whereas 50% epiboly stage differed from the earlier three stages in highly expressed genes number of uniquely expressed genes and enrichment of GO molecular functions.,,,RNA extracted from zebrafish embryo at 16 cell stage,zebrafish embryo 16 cell,SAMEA791631,"Department of Biosciences and Nutrition, Karolinska Institutet, Sweden",ENA first public:2011 06 09|ENA last update:2018 03 08|External Id:SAMEA791631|INSDC center alias:KI BN|INSDC center name:Department of Biosciences and Nutrition Karolinska Institutet Sweden|INSDC first public:2011 06 09T11:04:10Z|INSDC last update:2018 03 08T15:26:39Z|INSDC status:public|Submitter Id:KI BN JKE DRERIO RNASEQ 2011 16cell|common name:zebrafish|sample name:KI BN JKE DRERIO RNASEQ 2011 16cell|sex:mixed|strain:Tuebingen,,,,,,,,,Transcriptome profiling of early zebrafish development,KI BN JKE DRERIO RNASEQ 2011 16cell,JKE Drerio rna seq,Transcriptome profiling of 16 cell stage of zebrafish embryos.,Total RNA was extracted from approximately 150 embryos per developmental stage using Trireagent Sigma Aldrich. The total RNA was then processed further according to the Small RNA Expression Kit Applied Biosystems.,,RNA-Seq,TRANSCRIPTOMIC,RANDOM,SINGLE,ABI_SOLID,AB SOLiD System 3.0,500Application ReadForward1,ERP000635,AB SOLiD System 3.0 sequencing; Transcriptome profiling of early zebrafish development,ENA FIRST PUBLIC:2011 06 09|ENA LAST UPDATE:2018 11 16,KI-BN-JKE-DRERIO-RNASEQ-2011-16cell.csfasta.gz KI-BN-JKE-DRERIO-RNASEQ-2011-16cell_QV.qual.gz,SOLiD_native SOLiD_native,4256756500.0,85135130.0,KI BN JKE DRERIO RNASEQ 2011 16cell,0:50,,50,,,,,,,,,ERX012651,ERS032266,ERA029959,KI-BN|Department of Biosciences and Nutrition,"Department of Biosciences and Nutrition, Karolinska Institutet, Sweden",1,0.57946,,0.08115,,0.91896,,0.72164,,50,,B,,usable mapping rate,legacy,early,unknown,random_priming,unknown,bulk,unknown,unknown,,Sweden,2011-06-09,Cleavage,Embryo,Embryo Imprecise,All anatomical structures 9296,ERR202508,ERX177193,ERS092407,ERP001280,PRJEB2925,maternal to Zygotic Transition,maternal_to_Zygotic_Transition-sc-2012-03-12T11:38:43Z-599,Transcriptome Analysis,During early stages of embryonic development the genome is transcriptionally inactive and cells are under the control of maternally provided mRNA and proteins. At a key point in development known as the maternal to zygotic transition MZT the genome becomes activated and the maternally provided mRNAs begin to degrade. We plan to map the mRNA profiles of genes during the maternal to zygotic transition by using solexa sequencing.,,,,,SAMEA1570569,SC,ArrayExpress DevelopmentalStage:2 cell|ArrayExpress Genotype:T/LF|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Phenotype:WT|ArrayExpress Sex:mixed|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2012 11 28T14:59:05Z|ENA LAST UPDATE:2018 03 08T15:36:29Z|External Id:SAMEA1570569|INSDC center name:SC|INSDC first public:2012 11 28T14:59:05Z|INSDC last update:2018 03 08T15:36:29Z|INSDC status:public|Submitter Id:2C TotRNA sc 2012 02 06T13:12:17Z 1121923|common name:zebrafish|sample description:RNA seq|sample name:2C TotRNA sc 2012 02 06T13:12:17Z 1121923|scientific name:Danio rerio|strain:T/LF,,,,,,,,,1,SC EXP 6683 2,2532385,Illumina sequencing of library 2532385 constructed from sample accession ERS092407 for study accession ERP001280.,Illumina cDNA protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP001280,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2012 11 28|ENA LAST UPDATE:2018 11 16,6683_2.bam,bam,11463941550.0,76426277.0,SC RUN 6683 2,0:75 1:75,A:2384324967;C:3291391074;G:3291238330;T:2457078635;N:39908544,75,75,,,2384324967,3291391074,3291238330,2457078635,39908544,ERX177193,ERS092407,ERA176708,SC,Wellcome Sanger Institute,2,0.96484,0.95918,0.35968,0.35526,0.88404,0.88485,0.84949,0.8524,75,75,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2012-11-28,Cleavage,Embryo,Whole Organism,All anatomical structures 9298,ERR202506,ERX177191,ERS092405,ERP001280,PRJEB2925,maternal to Zygotic Transition,maternal_to_Zygotic_Transition-sc-2012-03-12T11:38:43Z-599,Transcriptome Analysis,During early stages of embryonic development the genome is transcriptionally inactive and cells are under the control of maternally provided mRNA and proteins. At a key point in development known as the maternal to zygotic transition MZT the genome becomes activated and the maternally provided mRNAs begin to degrade. We plan to map the mRNA profiles of genes during the maternal to zygotic transition by using solexa sequencing.,,,,,SAMEA1570534,SC,ArrayExpress DevelopmentalStage:16 cell|ArrayExpress Genotype:T/LF|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Phenotype:WT|ArrayExpress Sex:mixed|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2012 11 28T14:59:05Z|ENA LAST UPDATE:2018 03 08T15:36:25Z|External Id:SAMEA1570534|INSDC center name:SC|INSDC first public:2012 11 28T14:59:05Z|INSDC last update:2018 03 08T15:36:25Z|INSDC status:public|Submitter Id:16C stan pro sc 2012 02 06T13:12:14Z 1121921|common name:zebrafish|sample description:RNA seq|sample name:16C stan pro sc 2012 02 06T13:12:14Z 1121921|scientific name:Danio rerio|strain:T/LF,,,,,,,,,1,SC EXP 6317 5,2532383,Illumina sequencing of library 2532383 constructed from sample accession ERS092405 for study accession ERP001280.,Illumina cDNA protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP001280,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2012 11 28|ENA LAST UPDATE:2018 11 16,6317_5.bam,bam,7092438300.0,47282922.0,SC RUN 6317 5,0:75 1:75,A:1947926886;C:1582039071;G:1595096528;T:1959471222;N:7904593,75,75,,,1947926886,1582039071,1595096528,1959471222,7904593,ERX177191,ERS092405,ERA176708,SC,Wellcome Sanger Institute,2,0.90801,0.90631,0.0426,0.04216,0.78486,0.78539,0.4795,0.47872,75,75,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2012-11-28,Cleavage,Embryo,Whole Organism,All anatomical structures 9301,ERR202503,ERX177188,ERS092094,ERP001280,PRJEB2925,maternal to Zygotic Transition,maternal_to_Zygotic_Transition-sc-2012-03-12T11:38:43Z-599,Transcriptome Analysis,During early stages of embryonic development the genome is transcriptionally inactive and cells are under the control of maternally provided mRNA and proteins. At a key point in development known as the maternal to zygotic transition MZT the genome becomes activated and the maternally provided mRNAs begin to degrade. We plan to map the mRNA profiles of genes during the maternal to zygotic transition by using solexa sequencing.,,,,,SAMEA1570566,SC,ArrayExpress DevelopmentalStage:64 cell|ArrayExpress Genotype:SAT/WIK|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Phenotype:WT|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2012 11 28T14:59:05Z|ENA LAST UPDATE:2018 03 08T15:36:31Z|External Id:SAMEA1570566|INSDC center name:SC|INSDC first public:2012 11 28T14:59:05Z|INSDC last update:2018 03 08T15:36:31Z|INSDC status:public|Submitter Id:SAT b sc 2012 02 06T13:05:45Z 998060|common name:zebrafish|sample description:RNA seq|sample name:SAT b sc 2012 02 06T13:05:45Z 998060|scientific name:Danio rerio|strain:SAT,,,,,,,,,1,SC EXP 5552 6,1476240,Illumina sequencing of library 1476240 constructed from sample accession ERS092094 for study accession ERP001280.,Illumina cDNA protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina Genome Analyzer II,,ERP001280,Illumina Genome Analyzer II paired end sequencing,ENA FIRST PUBLIC:2012 11 28|ENA LAST UPDATE:2018 11 16,5552_6.bam,bam,3031861428.0,28072791.0,SC RUN 5552 6,0:54 1:54,A:827548202;C:685397282;G:689217947;T:827560833;N:2137164,54,54,,,827548202,685397282,689217947,827560833,2137164,ERX177188,ERS092094,ERA176708,SC,Wellcome Sanger Institute,2,0.88709,0.8867,0.04219,0.04381,0.76836,0.76978,0.48688,0.48607,54,54,B,B,biological fallback assumption,illumina,early_illumina,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2012-11-28,Cleavage,Embryo,Whole Organism,All anatomical structures 9304,ERR202500,ERX177185,ERS092093,ERP001280,PRJEB2925,maternal to Zygotic Transition,maternal_to_Zygotic_Transition-sc-2012-03-12T11:38:43Z-599,Transcriptome Analysis,During early stages of embryonic development the genome is transcriptionally inactive and cells are under the control of maternally provided mRNA and proteins. At a key point in development known as the maternal to zygotic transition MZT the genome becomes activated and the maternally provided mRNAs begin to degrade. We plan to map the mRNA profiles of genes during the maternal to zygotic transition by using solexa sequencing.,,,,,SAMEA1570541,SC,ArrayExpress DevelopmentalStage:2 cell|ArrayExpress Genotype:SAT/WIK|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Phenotype:WT|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2012 11 28T14:59:05Z|ENA LAST UPDATE:2018 03 08T15:36:13Z|External Id:SAMEA1570541|INSDC center name:SC|INSDC first public:2012 11 28T14:59:05Z|INSDC last update:2018 03 08T15:36:13Z|INSDC status:public|Submitter Id:SAT a sc 2012 02 06T13:05:43Z 998059|common name:zebrafish|sample description:RNA seq|sample name:SAT a sc 2012 02 06T13:05:43Z 998059|scientific name:Danio rerio|strain:SAT,,,,,,,,,1,SC EXP 5540 7,1392795,Illumina sequencing of library 1392795 constructed from sample accession ERS092093 for study accession ERP001280.,Illumina cDNA protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina Genome Analyzer II,,ERP001280,Illumina Genome Analyzer II paired end sequencing,ENA FIRST PUBLIC:2012 11 28|ENA LAST UPDATE:2018 11 16,5540_7.bam,bam,4139896608.0,38332376.0,SC RUN 5540 7,0:54 1:54,A:1123995667;C:935834208;G:933659183;T:1138309303;N:8098247,54,54,,,1123995667,935834208,933659183,1138309303,8098247,ERX177185,ERS092093,ERA176708,SC,Wellcome Sanger Institute,2,0.89473,0.89261,0.0475,0.0496,0.80413,0.80551,0.49672,0.49064,54,54,B,B,biological fallback assumption,illumina,early_illumina,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2012-11-28,Cleavage,Embryo,Whole Organism,All anatomical structures 9308,ERR202496,ERX177181,ERS092089,ERP001280,PRJEB2925,maternal to Zygotic Transition,maternal_to_Zygotic_Transition-sc-2012-03-12T11:38:43Z-599,Transcriptome Analysis,During early stages of embryonic development the genome is transcriptionally inactive and cells are under the control of maternally provided mRNA and proteins. At a key point in development known as the maternal to zygotic transition MZT the genome becomes activated and the maternally provided mRNAs begin to degrade. We plan to map the mRNA profiles of genes during the maternal to zygotic transition by using solexa sequencing.,,,,,SAMEA1570537,SC,ArrayExpress DevelopmentalStage:64 cell|ArrayExpress Genotype:WIK/SAT|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Phenotype:WT|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2012 11 28T14:59:05Z|ENA LAST UPDATE:2018 03 08T15:36:15Z|External Id:SAMEA1570537|INSDC center name:SC|INSDC first public:2012 11 28T14:59:05Z|INSDC last update:2018 03 08T15:36:15Z|INSDC status:public|Submitter Id:WIK b sc 2012 02 06T13:05:39Z 998055|common name:zebrafish|sample description:RNA seq|sample name:WIK b sc 2012 02 06T13:05:39Z 998055|scientific name:Danio rerio|strain:WIK,,,,,,,,,1,SC EXP 5540 2,1392791,Illumina sequencing of library 1392791 constructed from sample accession ERS092089 for study accession ERP001280.,Illumina cDNA protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina Genome Analyzer II,,ERP001280,Illumina Genome Analyzer II paired end sequencing,ENA FIRST PUBLIC:2012 11 28|ENA LAST UPDATE:2018 11 16,5540_2.bam,bam,3934066536.0,36426542.0,SC RUN 5540 2,0:54 1:54,A:1089272408;C:875257818;G:871131618;T:1090449345;N:7955347,54,54,,,1089272408,875257818,871131618,1090449345,7955347,ERX177181,ERS092089,ERA176708,SC,Wellcome Sanger Institute,2,0.92002,0.92014,0.04875,0.05104,0.76061,0.76161,0.4821,0.48296,54,54,B,B,biological fallback assumption,illumina,early_illumina,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2012-11-28,Cleavage,Embryo,Whole Organism,All anatomical structures 9309,ERR202495,ERX177180,ERS092088,ERP001280,PRJEB2925,maternal to Zygotic Transition,maternal_to_Zygotic_Transition-sc-2012-03-12T11:38:43Z-599,Transcriptome Analysis,During early stages of embryonic development the genome is transcriptionally inactive and cells are under the control of maternally provided mRNA and proteins. At a key point in development known as the maternal to zygotic transition MZT the genome becomes activated and the maternally provided mRNAs begin to degrade. We plan to map the mRNA profiles of genes during the maternal to zygotic transition by using solexa sequencing.,,,,,SAMEA1570572,SC,ArrayExpress DevelopmentalStage:2 cell|ArrayExpress Genotype:WIK/SAT|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Phenotype:WT|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2012 11 28T14:59:05Z|ENA LAST UPDATE:2018 03 08T15:36:31Z|External Id:SAMEA1570572|INSDC center name:SC|INSDC first public:2012 11 28T14:59:05Z|INSDC last update:2018 03 08T15:36:31Z|INSDC status:public|Submitter Id:WIK a sc 2012 02 06T13:05:37Z 998054|common name:zebrafish|sample description:RNA seq|sample name:WIK a sc 2012 02 06T13:05:37Z 998054|scientific name:Danio rerio|strain:WIK,,,,,,,,,1,SC EXP 5540 1,1392790,Illumina sequencing of library 1392790 constructed from sample accession ERS092088 for study accession ERP001280.,Illumina cDNA protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina Genome Analyzer II,,ERP001280,Illumina Genome Analyzer II paired end sequencing,ENA FIRST PUBLIC:2012 11 28|ENA LAST UPDATE:2018 11 16,5540_1.bam,bam,4120158204.0,38149613.0,SC RUN 5540 1,0:54 1:54,A:1165514767;C:896704109;G:892695229;T:1156428740;N:8815359,54,54,,,1165514767,896704109,892695229,1156428740,8815359,ERX177180,ERS092088,ERA176708,SC,Wellcome Sanger Institute,2,0.9228,0.92241,0.05498,0.05795,0.79091,0.79235,0.50034,0.50151,54,54,B,B,biological fallback assumption,illumina,early_illumina,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2012-11-28,Cleavage,Embryo,Whole Organism,All anatomical structures 9726,ERR3841993,ERX3854555,ERS3555998,ERP116106,PRJEB33323,Deconstructing the individual steps of vertebrate translation initiation,ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422,Other,In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate.,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03,,,64 cell 2,SAMEA5752539,Computational Biology Unit,ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752539|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:2|common name:zebrafish|dev stage:64 cell|sample name:2|scientific name:Danio rerio,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT Computational Biology Unit 27 01 2020 16:24:36:406 3,64 cell 3,OTHER,RNA Seq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 500,,ERP116106,NextSeq 500 sequencing,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2020 02 14,,,1579307816.0,20780366.0,ena RUN Computational Biology Unit 27 01 2020 16:24:36:406 3,0:76,A:589876602;C:380048242;G:392473318;T:216893826;N:15828,76,,,,589876602,380048242,392473318,216893826,15828,ERX3854555,ERS3555998,ERA2359305,Computational Biology Unit|European Nucleotide Archive,Computational Biology Unit,1,0.15411,,0.04564,,0.97883,,0.55376,,76,,B,,usable mapping rate,illumina,nextseq,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2019-07-03,Cleavage,Embryo,Undetermined,Embryo Imprecise 9727,ERR3841992,ERX3854554,ERS3556003,ERP116106,PRJEB33323,Deconstructing the individual steps of vertebrate translation initiation,ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422,Other,In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate.,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03,,,64 cell 4Ei 10,SAMEA5752544,Computational Biology Unit,ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752544|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:7|common name:zebrafish|dev stage:64 cell|sample name:7|scientific name:Danio rerio,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT Computational Biology Unit 27 01 2020 16:24:36:406 2,64 cell 4Ei,OTHER,RNA Seq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 500,,ERP116106,NextSeq 500 sequencing,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2020 02 14,,,1213585480.0,15968230.0,ena RUN Computational Biology Unit 27 01 2020 16:24:36:406 2,0:76,A:548456563;C:244465528;G:271963808;T:148687764;N:11817,76,,,,548456563,244465528,271963808,148687764,11817,ERX3854554,ERS3556003,ERA2359305,Computational Biology Unit|European Nucleotide Archive,Computational Biology Unit,1,0.21973,,0.10926,,0.97419,,0.44348,,76,,B,,usable mapping rate,illumina,nextseq,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2019-07-03,Cleavage,Embryo,Undetermined,Embryo Imprecise 9728,ERR3841991,ERX3854553,ERS3555997,ERP116106,PRJEB33323,Deconstructing the individual steps of vertebrate translation initiation,ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422,Other,In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate.,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03,,,64 cell 1,SAMEA5752538,Computational Biology Unit,ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752538|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:1|common name:zebrafish|dev stage:64 cell|sample name:1|scientific name:Danio rerio,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT Computational Biology Unit 27 01 2020 16:24:36:405 1,64 cell 1,OTHER,RNA Seq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 500,,ERP116106,NextSeq 500 sequencing,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2020 02 14,,,1494930944.0,19670144.0,ena RUN Computational Biology Unit 27 01 2020 16:24:36:406 1,0:76,A:543017836;C:366974203;G:367027373;T:217896401;N:15131,76,,,,543017836,366974203,367027373,217896401,15131,ERX3854553,ERS3555997,ERA2359305,Computational Biology Unit|European Nucleotide Archive,Computational Biology Unit,1,0.2544,,0.08957,,0.96568,,0.55681,,76,,B,,usable mapping rate,illumina,nextseq,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2019-07-03,Cleavage,Embryo,Undetermined,Embryo Imprecise 9919,ERR5167510,ERX4972431,ERS5593364,ERP122761,PRJEB39265,RNA dynamics during zebrafish development,ena-STUDY-CENTER FOR GENOMIC REGULATION (CRG)-06-07-2020-15:41:43:771-1183,Other,RNA dynamics during early zebrafish development,ENA FIRST PUBLIC:2022 07 05|ENA LAST UPDATE:2022 07 05,,,cDNA WT 2hpf rep1,JD T20 PDPN191089,,ENA FIRST PUBLIC:2022 07 05T12:06:34Z|organism:Danio rerio|ENA LAST UPDATE:2022 07 05T12:06:34Z|scientific name:Danio rerio|common name:zebrafish|ENA FIRST PUBLIC:2022 07 05|ENA LAST UPDATE:2022 07 05,,,,,,,,,PromethION sequencing,ena EXPERIMENT CENTER FOR GENOMIC REGULATION CRG 21 01 2021 22:16:50:154 1,unspecified,1,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,OXFORD_NANOPORE,PromethION,,ERP122761,PromethION sequencing,ENA FIRST PUBLIC:2022 07 05|ENA LAST UPDATE:2022 07 05,,,,,ena RUN CENTER FOR GENOMIC REGULATION CRG 21 01 2021 22:16:50:154 1,,,,,,,,,,,,ERX4972431,,ERA3319053,CENTER FOR GENOMIC REGULATION (CRG)|European Nucleotide Archive,CENTER FOR GENOMIC REGULATION (CRG),,,,,,,,,,,,,,,ont,ont,unknown,poly_a,unknown,bulk,unknown,unknown,,Spain,2022-07-05,Cleavage,Embryo,Undetermined,Embryo Imprecise 24550,ERR964668,ERX1041631,ERS792102,ERP011038,PRJEB9889,The Zebrafish transcriptome during early development,ena-STUDY-KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION-15-07-2015-15:13:51:747-22,Other,Zebrafish has emerged as a model organism to investigate vertebrate development and human genetic diseases. However currently zebrafish annotation is still ongoing and clearly not sufficed therefore providing opportunity for novel transcript finding. With the introduction of massive parallel sequencing whole transcriptome investigations became possible through assembling entire transcriptome from overlapped sequencing reads. In the study we were aiming to discover novel transcribed regions NTRs using data from RNA sequencing. We have developed an in house bioinformatics pipeline for NTR discovery. Using the pipeline we detected 165 putative NTRs which could involve in early zebrafish development and not annotated anywhere. Six randomly selected NTRs were successfully validated experimentally using RT PCR. These NTRs provided new candidates for zebrafish transcriptome studies and zebrafish genome annotation.,,,,KI BN JKE DRERIO RNASEQ,SAMEA3484817,KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION,ENA first public:2015 07 16|ENA last update:2015 07 15|External Id:SAMEA3484817|INSDC center alias:KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION|INSDC center name:KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION|INSDC first public:2015 07 16T15:54:30Z|INSDC last update:2015 07 15T15:02:15Z|INSDC status:public|Submitter Id:KI BN JKE DRERIO RNASEQ 2009 16cell|common name:zebrafish|dev stage:16 cell|sample name:KI BN JKE DRERIO RNASEQ 2009 16cell|strain:Tuebingen,,,,,,,,,AB SOLiD System 3.0 sequencing,ena EXPERIMENT KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION 15 07 2015 15:13:47:870 2,unspecified,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ABI_SOLID,AB SOLiD System 3.0,,ERP011038,AB SOLiD System 3.0 sequencing,ENA FIRST PUBLIC:2015 07 16|ENA LAST UPDATE:2018 11 16,KI-BN-JKE-DRERIO-RNASEQ-20090709-16cell_F3.csfasta.gz KI-BN-JKE-DRERIO-RNASEQ-20090709-16cell_F3_QV.qual.gz,SOLiD_native SOLiD_native,5278508300.0,105570166.0,ena RUN KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION 15 07 2015 15:13:47:871 2,0:50,0:1410981717;1:1203936808;2:1415708111;3:1223403795;.:24477869,50,,,,,,,,,ERX1041631,ERS792102,ERA458495,KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION|European Nucleotide Archive,KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION,1,0.71371,,0.09346,,0.91539,,0.73015,,50,,B,,usable mapping rate,legacy,early,full_length,random_priming,unknown,bulk,unknown,unknown,,Sweden,2015-07-15,Cleavage,Embryo,Undetermined,Embryo Imprecise 24553,ERR964672,ERX1041635,ERS792102,ERP011038,PRJEB9889,The Zebrafish transcriptome during early development,ena-STUDY-KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION-15-07-2015-15:13:51:747-22,Other,Zebrafish has emerged as a model organism to investigate vertebrate development and human genetic diseases. However currently zebrafish annotation is still ongoing and clearly not sufficed therefore providing opportunity for novel transcript finding. With the introduction of massive parallel sequencing whole transcriptome investigations became possible through assembling entire transcriptome from overlapped sequencing reads. In the study we were aiming to discover novel transcribed regions NTRs using data from RNA sequencing. We have developed an in house bioinformatics pipeline for NTR discovery. Using the pipeline we detected 165 putative NTRs which could involve in early zebrafish development and not annotated anywhere. Six randomly selected NTRs were successfully validated experimentally using RT PCR. These NTRs provided new candidates for zebrafish transcriptome studies and zebrafish genome annotation.,,,,KI BN JKE DRERIO RNASEQ,SAMEA3484817,KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION,ENA first public:2015 07 16|ENA last update:2015 07 15|External Id:SAMEA3484817|INSDC center alias:KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION|INSDC center name:KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION|INSDC first public:2015 07 16T15:54:30Z|INSDC last update:2015 07 15T15:02:15Z|INSDC status:public|Submitter Id:KI BN JKE DRERIO RNASEQ 2009 16cell|common name:zebrafish|dev stage:16 cell|sample name:KI BN JKE DRERIO RNASEQ 2009 16cell|strain:Tuebingen,,,,,,,,,AB SOLiD System 3.0 sequencing,ena EXPERIMENT KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION 15 07 2015 15:13:47:872 6,unspecified,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ABI_SOLID,AB SOLiD System 3.0,,ERP011038,AB SOLiD System 3.0 sequencing,ENA FIRST PUBLIC:2015 07 16|ENA LAST UPDATE:2018 11 16,KI-BN-JKE-DRERIO-RNASEQ-20091014-16cell_F3.csfasta.gz KI-BN-JKE-DRERIO-RNASEQ-20091014-16cell_F3_QV.qual.gz,SOLiD_native SOLiD_native,2719433200.0,54388664.0,ena RUN KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION 15 07 2015 15:13:47:872 6,0:50,0:699731678;1:628745158;2:754903505;3:633574679;.:2478180,50,,,,,,,,,ERX1041635,ERS792102,ERA458495,KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION|European Nucleotide Archive,KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION,1,0.73214,,0.09566,,0.90836,,0.74043,,50,,B,,usable mapping rate,legacy,early,full_length,random_priming,unknown,bulk,unknown,unknown,,Sweden,2015-07-15,Cleavage,Embryo,Undetermined,Embryo Imprecise 28560,SRR26395034,SRX22100899,SRS19166025,SRP466518,PRJNA1028258,Zygotic activation of transposable elements during zebrafish early embryogenesis,PRJNA1028258,Other,Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age.,,pubmed:40246845,,,64 cell RNA seq rep8,,strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 64 8|BioSampleModel:Model organism or animal,,,,,,,,,Illumina RNA seq of zebrafish: 64 cell replicate8,DR 035,DR 035,mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage.,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,HiSeq X Ten,,SRP466518,,,C64-8_1.fq.gz C64-8_2.fq.gz,fastq fastq,13755975120.0,50948056.0,C64 8 1.fq.gz,0:135 1:135,A:3658420874;C:3226727105;G:3239474262;T:3628930832;N:2422047,135,135,,,3658420874,3226727105,3239474262,3628930832,2422047,SRX22100899,SRS19166025,SRA1731898,University of Michigan|Computational Medicine and Bioinformatics,University of Michigan,2,0.92463,0.92386,0.0253,0.02389,0.77441,0.77851,0.48196,0.47927,135,135,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,United States,2023-10-16,Cleavage,Embryo,Embryo Imprecise,All anatomical structures 28561,SRR26395035,SRX22100898,SRS19166024,SRP466518,PRJNA1028258,Zygotic activation of transposable elements during zebrafish early embryogenesis,PRJNA1028258,Other,Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age.,,pubmed:40246845,,,64 cell RNA seq rep7,,strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 64 7|BioSampleModel:Model organism or animal,,,,,,,,,Illumina RNA seq of zebrafish: 64 cell replicate7,DR 034,DR 034,mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage.,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,HiSeq X Ten,,SRP466518,,,C64-7_1.fq.gz C64-7_2.fq.gz,fastq fastq,14250954780.0,52781314.0,C64 7 1.fq.gz,0:135 1:135,A:3810945650;C:3320623800;G:3339892194;T:3776960886;N:2532250,135,135,,,3810945650,3320623800,3339892194,3776960886,2532250,SRX22100898,SRS19166024,SRA1731898,University of Michigan|Computational Medicine and Bioinformatics,University of Michigan,2,0.93734,0.93685,0.02705,0.02576,0.77553,0.7791,0.47481,0.47745,135,135,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,United States,2023-10-16,Cleavage,Embryo,Embryo Imprecise,All anatomical structures 28562,SRR26395036,SRX22100897,SRS19166023,SRP466518,PRJNA1028258,Zygotic activation of transposable elements during zebrafish early embryogenesis,PRJNA1028258,Other,Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age.,,pubmed:40246845,,,64 cell RNA seq rep6,,strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 64 6|BioSampleModel:Model organism or animal,,,,,,,,,Illumina RNA seq of zebrafish: 64 cell replicate6,DR 033,DR 033,mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage.,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,HiSeq X Ten,,SRP466518,,,C64-6_1.fq.gz C64-6_2.fq.gz,fastq fastq,14251193190.0,52782197.0,C64 6 1.fq.gz,0:135 1:135,A:3801408063;C:3332053069;G:3345233238;T:3769986735;N:2512085,135,135,,,3801408063,3332053069,3345233238,3769986735,2512085,SRX22100897,SRS19166023,SRA1731898,University of Michigan|Computational Medicine and Bioinformatics,University of Michigan,2,0.94348,0.94342,0.02571,0.02414,0.77112,0.77492,0.48218,0.4777,135,135,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,United States,2023-10-16,Cleavage,Embryo,Embryo Imprecise,All anatomical structures 28563,SRR26395037,SRX22100896,SRS19166022,SRP466518,PRJNA1028258,Zygotic activation of transposable elements during zebrafish early embryogenesis,PRJNA1028258,Other,Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age.,,pubmed:40246845,,,64 cell RNA seq rep5,,strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 64 5|BioSampleModel:Model organism or animal,,,,,,,,,Illumina RNA seq of zebrafish: 64 cell replicate5,DR 032,DR 032,mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage.,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,HiSeq X Ten,,SRP466518,,,C64-5_1.fq.gz C64-5_2.fq.gz,fastq fastq,15142948650.0,56084995.0,C64 5 1.fq.gz,0:135 1:135,A:4031434744;C:3549307228;G:3562636129;T:3996868396;N:2702153,135,135,,,4031434744,3549307228,3562636129,3996868396,2702153,SRX22100896,SRS19166022,SRA1731898,University of Michigan|Computational Medicine and Bioinformatics,University of Michigan,2,0.93753,0.93663,0.02519,0.024,0.77301,0.77674,0.47421,0.46951,135,135,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,United States,2023-10-16,Cleavage,Embryo,Embryo Imprecise,All anatomical structures 28564,SRR26395038,SRX22100895,SRS19166021,SRP466518,PRJNA1028258,Zygotic activation of transposable elements during zebrafish early embryogenesis,PRJNA1028258,Other,Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age.,,pubmed:40246845,,,64 cell RNA seq rep4,,strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 64 4|BioSampleModel:Model organism or animal,,,,,,,,,Illumina RNA seq of zebrafish: 64 cell replicate4,DR 031,DR 031,mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage.,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,HiSeq X Ten,,SRP466518,,,C64-4_1.fq.gz C64-4_2.fq.gz,fastq fastq,14488466220.0,53660986.0,C64 4 1.fq.gz,0:135 1:135,A:3863267905;C:3389148218;G:3402037749;T:3831469669;N:2542679,135,135,,,3863267905,3389148218,3402037749,3831469669,2542679,SRX22100895,SRS19166021,SRA1731898,University of Michigan|Computational Medicine and Bioinformatics,University of Michigan,2,0.93879,0.93825,0.02613,0.02437,0.77212,0.77577,0.47796,0.47196,135,135,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,United States,2023-10-16,Cleavage,Embryo,Embryo Imprecise,All anatomical structures 28566,SRR26395040,SRX22100893,SRS19166019,SRP466518,PRJNA1028258,Zygotic activation of transposable elements during zebrafish early embryogenesis,PRJNA1028258,Other,Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age.,,pubmed:40246845,,,64 cell RNA seq rep3,,strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 64 3|BioSampleModel:Model organism or animal,,,,,,,,,Illumina RNA seq of zebrafish: 64 cell replicate3,DR 030,DR 030,mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage.,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,HiSeq X Ten,,SRP466518,,,C64-3_1.fq.gz C64-3_2.fq.gz,fastq fastq,16017940620.0,59325706.0,C64 3 1.fq.gz,0:135 1:135,A:4273558549;C:3744205640;G:3760255830;T:4237074764;N:2845837,135,135,,,4273558549,3744205640,3760255830,4237074764,2845837,SRX22100893,SRS19166019,SRA1731898,University of Michigan|Computational Medicine and Bioinformatics,University of Michigan,2,0.93688,0.9383,0.02702,0.02595,0.77433,0.7767,0.47319,0.47413,135,135,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,United States,2023-10-16,Cleavage,Embryo,Embryo Imprecise,All anatomical structures 28567,SRR26395041,SRX22100892,SRS19166018,SRP466518,PRJNA1028258,Zygotic activation of transposable elements during zebrafish early embryogenesis,PRJNA1028258,Other,Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age.,,pubmed:40246845,,,64 cell RNA seq rep2,,strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 64 2|BioSampleModel:Model organism or animal,,,,,,,,,Illumina RNA seq of zebrafish: 64 cell replicate2,DR 029,DR 029,mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage.,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,HiSeq X Ten,,SRP466518,,,C64-2_1.fq.gz C64-2_2.fq.gz,fastq fastq,16732836630.0,61973469.0,C64 2 1.fq.gz,0:135 1:135,A:4451249064;C:3924735460;G:3940154978;T:4413679398;N:3017730,135,135,,,4451249064,3924735460,3940154978,4413679398,3017730,SRX22100892,SRS19166018,SRA1731898,University of Michigan|Computational Medicine and Bioinformatics,University of Michigan,2,0.94302,0.94257,0.02459,0.02333,0.77248,0.77479,0.47902,0.47678,135,135,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,United States,2023-10-16,Cleavage,Embryo,Embryo Imprecise,All anatomical structures 28568,SRR26395042,SRX22100891,SRS19166017,SRP466518,PRJNA1028258,Zygotic activation of transposable elements during zebrafish early embryogenesis,PRJNA1028258,Other,Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age.,,pubmed:40246845,,,64 cell RNA seq rep1,,strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 64 1|BioSampleModel:Model organism or animal,,,,,,,,,Illumina RNA seq of zebrafish: 64 cell replicate1,DR 028,DR 028,mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage.,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,HiSeq X Ten,,SRP466518,,,C64-1_1.fq.gz C64-1_2.fq.gz,fastq fastq,16459047450.0,60959435.0,C64 1 1.fq.gz,0:135 1:135,A:4391773658;C:3847087464;G:3866793612;T:4350489494;N:2903222,135,135,,,4391773658,3847087464,3866793612,4350489494,2903222,SRX22100891,SRS19166017,SRA1731898,University of Michigan|Computational Medicine and Bioinformatics,University of Michigan,2,0.94676,0.94707,0.02568,0.0244,0.77236,0.77593,0.48374,0.47691,135,135,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,United States,2023-10-16,Cleavage,Embryo,Embryo Imprecise,All anatomical structures 28576,SRR26395050,SRX22100883,SRS19166009,SRP466518,PRJNA1028258,Zygotic activation of transposable elements during zebrafish early embryogenesis,PRJNA1028258,Other,Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age.,,pubmed:40246845,,,64 cell Iso seq,,strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:LR 3|BioSampleModel:Model organism or animal,,,,,,,,,PacBio Iso seq of zebrafish: 64 cell,DR 003,DR 003,Total RNA was isolated from each developmental stages of zebrafish embryos using TRIzolTM Reagent Invitrogen. RNA purity and concentration were assessed with the NanoPhotometer spectrophotometer IMPLEN CA USA and the Qubit RNA Assay Kit in the Qubit 3.0 Fluorometer Life Technologies CA USA. The RNA integrity number RIN was determined using the RNA Nano 6000 Assay Kit and Agilent Bioanalyzer 2100 system Agilent Technologies CA USA. RNA samples with a RIN 8 were used to synthesize cDNA with SMARTerPCR cDNA Synthesis Kit Takara Bio USA Inc. Mountain View CA USA. PCR amplification was performed using a KAPA HiFi PCR Kit Kapa Biosystems Wilmington MA USA with the optimized number of cycles. Size selection of PCR products cDNA for each sample was applied using the BluePippin System: <3 kb and >3 kb. Subsequently two cDNA libraries <3 kb >3 kb were prepared using a SMRTbell Template Prep Kit 1.0 Pacific Biosciences Menlo Park CA USA and sequenced on the PacBio sequel II platform.,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,PACBIO_SMRT,Sequel,,SRP466518,,,cell64_1.ccs.fq.gz cell64_2.ccs.fq.gz,fastq fastq,2829660788.0,1238867.0,cell64 1.ccs.fq.gz,0:2284.07,A:765802910;C:646754322;G:668768985;T:748334571;N:0,2284,,,,765802910,646754322,668768985,748334571,0,SRX22100883,SRS19166009,SRA1731898,University of Michigan|Computational Medicine and Bioinformatics,University of Michigan,1,0.37504,,0.00108,,0.91149,,0.48939,,1913,,T,,long read,pacbio,pacbio_modern,full_length,poly_a,unknown,bulk,unknown,unknown,,United States,2023-10-16,Cleavage,Embryo,Embryo Imprecise,All anatomical structures 28935,SRR26845669,SRX22541151,SRS19550737,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 2hour wt 75mM s4u r2,GSM7903257,,tissue:Embryos at 2 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 2hour wt 75mM s4u r2,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 2 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:2 hpf of [AB TU]x[TL TLF],GSM7903257,GSM7903257: zebrafish 2hour wt 75mM s4u r2; Danio rerio; RNA Seq,GSM7903257 r1,GSM7903257,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s2h_2.fastq.gz,fastq,4440596805.0,43966305.0,GSM7903257 r1,0:101,A:1543708731;C:806593065;G:905733733;T:1182095254;N:2466022,101,,,,1543708731,806593065,905733733,1182095254,2466022,SRX22541151,SRS19550737,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.63778,,0.15677,,0.82676,,0.61166,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Cleavage,Embryo,Embryo Imprecise,All anatomical structures 28936,SRR26845670,SRX22541150,SRS19550735,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 2hour wt 75mM s4u r1,GSM7903256,,tissue:Embryos at 2 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 2hour wt 75mM s4u r1,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 2 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:2 hpf of [AB TU]x[TL TLF],GSM7903256,GSM7903256: zebrafish 2hour wt 75mM s4u r1; Danio rerio; RNA Seq,GSM7903256 r1,GSM7903256,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s2h_1.fastq.gz,fastq,4689849655.0,46434155.0,GSM7903256 r1,0:101,A:1611038201;C:846984275;G:953714532;T:1275424861;N:2687786,101,,,,1611038201,846984275,953714532,1275424861,2687786,SRX22541150,SRS19550735,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.67301,,0.15612,,0.82171,,0.63462,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Cleavage,Embryo,Embryo Imprecise,All anatomical structures 28937,SRR26845671,SRX22541149,SRS19550733,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 1hour wt 75mM s4u r3,GSM7903255,,tissue:Embryos at 1 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 1hour wt 75mM s4u r3,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 1 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:1 hpf of [AB TU]x[TL TLF],GSM7903255,GSM7903255: zebrafish 1hour wt 75mM s4u r3; Danio rerio; RNA Seq,GSM7903255 r1,GSM7903255,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s1h_3.fastq.gz,fastq,5540992108.0,54861308.0,GSM7903255 r1,0:101,A:1856189531;C:1011042624;G:1124613529;T:1546055477;N:3090947,101,,,,1856189531,1011042624,1124613529,1546055477,3090947,SRX22541149,SRS19550733,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.72187,,0.16436,,0.82416,,0.64431,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Cleavage,Embryo,Embryo Imprecise,All anatomical structures 28938,SRR26845672,SRX22541148,SRS19550734,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 1hour wt 75mM s4u r2,GSM7903254,,tissue:Embryos at 1 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 1hour wt 75mM s4u r2,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 1 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:1 hpf of [AB TU]x[TL TLF],GSM7903254,GSM7903254: zebrafish 1hour wt 75mM s4u r2; Danio rerio; RNA Seq,GSM7903254 r1,GSM7903254,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s1h_2.fastq.gz,fastq,4572239397.0,45269697.0,GSM7903254 r1,0:101,A:1530268631;C:831534079;G:915378596;T:1292534173;N:2523918,101,,,,1530268631,831534079,915378596,1292534173,2523918,SRX22541148,SRS19550734,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.72394,,0.15187,,0.81753,,0.63236,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Cleavage,Embryo,Embryo Imprecise,All anatomical structures 28939,SRR26845673,SRX22541147,SRS19550732,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 1hour wt 75mM s4u r1,GSM7903253,,tissue:Embryos at 1 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 1hour wt 75mM s4u r1,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 1 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:1 hpf of [AB TU]x[TL TLF],GSM7903253,GSM7903253: zebrafish 1hour wt 75mM s4u r1; Danio rerio; RNA Seq,GSM7903253 r1,GSM7903253,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s1h_1.fastq.gz,fastq,4271986597.0,42296897.0,GSM7903253 r1,0:101,A:1447221671;C:787487923;G:887526673;T:1147409594;N:2340736,101,,,,1447221671,787487923,887526673,1147409594,2340736,SRX22541147,SRS19550732,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.68805,,0.18469,,0.83175,,0.62945,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Cleavage,Embryo,Embryo Imprecise,All anatomical structures 29718,SRR27485663,SRX23156886,SRS20107307,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,4 cell R3,,strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:1 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|replicate:3|BioSampleModel:Model organism or animal,,,,,,,,,mRNA seq of zebrafish: embryo 1 hpf rep4,EV06010,EV06010,RNA was extracted with Trizol and processed with QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina Lexogen. 500 ng total RNA per sample. Single indexed QuantSeq libraries were QC checked on a Bioanalyzer 2100 Agilent using a High Sensitivity DNA Kit for correct insert size and quantified using Qubit dsDNA HS Assay Invitrogen. Pooled libraries were sequenced on a NextSeq500 instrument Illumina in 1x75bp single end sequencing mode,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV06010.R1.fastq.gz,fastq,620142356.0,8227837.0,EV06010.R1.fastq.gz,0:75.37,A:186029536;C:118842640;G:134072972;T:181171903;N:25305,75,,,,186029536,118842640,134072972,181171903,25305,SRX23156886,SRS20107307,SRA1783314,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,0.90656,,0.06918,,0.80192,,0.72472,,76,,B,,usable mapping rate,illumina,nextseq,3prime,poly_a,lexogen,bulk,unknown,unknown,,Austria,2024-01-11,Cleavage,Embryo,Whole Organism,All anatomical structures 29725,SRR27485670,SRX23156879,SRS20107300,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,4 cell R2,,strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:1 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|replicate:2|BioSampleModel:Model organism or animal,,,,,,,,,mRNA seq of zebrafish: embryo 1 hpf rep4,EV06003,EV06003,RNA was extracted with Trizol and processed with QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina Lexogen. 500 ng total RNA per sample. Single indexed QuantSeq libraries were QC checked on a Bioanalyzer 2100 Agilent using a High Sensitivity DNA Kit for correct insert size and quantified using Qubit dsDNA HS Assay Invitrogen. Pooled libraries were sequenced on a NextSeq500 instrument Illumina in 1x75bp single end sequencing mode,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV06003.R1.fastq.gz,fastq,706095550.0,9366364.0,EV06003.R1.fastq.gz,0:75.39,A:204324355;C:140058731;G:159377323;T:202282197;N:52944,75,,,,204324355,140058731,159377323,202282197,52944,SRX23156879,SRS20107300,SRA1783314,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,0.90788,,0.10297,,0.80168,,0.71073,,76,,B,,usable mapping rate,illumina,nextseq,3prime,poly_a,lexogen,bulk,unknown,unknown,,Austria,2024-01-11,Cleavage,Embryo,Whole Organism,All anatomical structures 29736,SRR27477296,SRX23148651,SRS20099370,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,4 cell R4,,strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:1 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|replicate:4|BioSampleModel:Model organism or animal,,,,,,,,,mRNA seq of zebrafish: embryo 1 hpf rep4,EV09003,EV09003,RNA was extracted with Trizol and processed with QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina Lexogen. 500 ng total RNA per sample. Single indexed QuantSeq libraries were QC checked on a Bioanalyzer 2100 Agilent using a High Sensitivity DNA Kit for correct insert size and quantified using Qubit dsDNA HS Assay Invitrogen. Pooled libraries were sequenced on a NextSeq500 instrument Illumina in 1x75bp single end sequencing mode,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV09003.R1.fastq.gz,fastq,438955973.0,5837128.0,EV09003.R1.fastq.gz,0:75.20,A:134628611;C:87460856;G:98199538;T:118638244;N:28724,75,,,,134628611,87460856,98199538,118638244,28724,SRX23148651,SRS20099370,SRA1782413,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,0.89029,,0.11994,,0.80833,,0.72581,,76,,B,,usable mapping rate,illumina,nextseq,3prime,poly_a,lexogen,bulk,unknown,unknown,,Austria,2024-01-10,Cleavage,Embryo,Whole Organism,All anatomical structures 30769,SRR28348935,SRX23954961,SRS20755382,SRP495323,PRJNA1088158,Protein profiling of zebrafish embryos unmasks regulatory layers during early embryogenesis.,GSE261646,Transcriptome Analysis,The maternal to zygotic transition is crucial in embryonic development marked by the degradation of maternally provided mRNAs and initiation of zygotic gene expression. However the changes occurring at the protein level during this transition remain unclear. Here we conducted protein profiling throughout zebrafish embryogenesis using quantitative mass spectrometry integrating transcriptomics and translatomics datasets. Our data shows that unlike RNA changes protein changes are less dynamic. Further increases in protein levels correlate with mRNA translation whereas declines in protein levels do not suggesting active protein degradation processes. Interestingly proteins from pure zygotic genes are present at fertilization challenging existing mRNA based gene classifications. As a proof of concept we utilized CRISPR Cas13d to target znf281b mRNA a gene whose protein significantly accumulates within the first two hpf demonstrating its crucial role in development. Consequently our protein profiling coupled with CRISPR Cas13d offers a new approach to unravel maternal mRNAs function during embryonic development. Overall design: Two biological replicate samples containing 50 zebrafish oocytes per stage were collected by pairing females in natural matings to ''purge'' mature eggs and used to establish an oogenesis time line. Fish were euthanized and ovaries harvested within 1–11 days post purging dpp. Stage I and II oocytes were collected at 1–2 dpp stage III oocytes germinal vesicle in central position at 4–7 dpp and stage IV oocytes germinal vesicle asymmetrically located at 8–10 dpp. Oocyte isolations were based on73 and conducted in isolation medium Leibovitz L 15 Sigma Aldrich #L5520 plus Collagenase I and II depending on the stages as follows. Stages I and II were isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130 and 3 mg/mL Collagenase II Gibco 17101015. Stage III was isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130. Stage IV was isolated by mechanical stripping with forceps and needle without xxx use of Collagenases. Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. Three biological replicate samples containing 20 dechorionated zebrafish embryos were snap frozen in TRIzol Invitrogen #15596026. Four time points of embryonic development were included: 1 cell stage 0 hpf hpf 2 hpf 4 hpf and 6 hpf. RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols.,,pubmed:39302832,,Zebrafish Embryo 2hpf rep3,GSM8147858,,source name:Whole embryo|tissue:Whole embryo|developmental stage:2hpf|genotype:AB TF and TLF|geo loc name:missing|collection date:missing,Zebrafish Embryo 2hpf rep3,Raw reads from zebrafish oocytes stages I IV and embryos 0 2 4 and 6 hpf were demultiplexed into FASTQ format allowing up to one mismatch using Illumina bcl convert 3.10.5. Reads were aligned to UCSC genome danRer11 with STAR aligner version 2.7.3a using Ensembl 106 gene models. Counts were converted to TPM values using RSEM version v1.3.0 and all subsequent analysis was done using TPM. Assembly: danRer11 Ensembl 106 gene models Supplementary files format and content: comma separated files with TPMs from all replicates,Whole embryo,,Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer’s protocols. 0 2 4 and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer’s protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0 2 4 and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer’s directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598 and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled quantified and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer’s instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina Cat. No. 20020598 and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized pooled and sequenced on a NextSeq 500 instrument Illumina as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.,,tissue:Whole embryo|developmental stage:2hpf|genotype:AB TF and TLF,GSM8147858,GSM8147858: Zebrafish Embryo 2hpf rep3; Danio rerio; RNA Seq,GSM8147858 r1,GSM8147858,1,Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. 0 2 4 and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0 2 4 and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer's directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598 and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled quantified and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer's instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina Cat. No. 20020598 and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized pooled and sequenced on a NextSeq 500 instrument Illumina as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP495323,,,s_2hpf_3.fastq,fastq,1748504032.0,23006632.0,GSM8147858 r1,0:76,A:420580006;C:434589498;G:408972977;T:484281127;N:80424,76,,,,420580006,434589498,408972977,484281127,80424,SRX23954961,SRS20755382,SRA1824599,"Computational Biology, Stowers Institute for Medical Research","Computational Biology, Stowers Institute for Medical Research",,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,trueseq,bulk,bulk,bulk,,United States,2024-03-14,Cleavage,Embryo,Whole Organism,All anatomical structures 30770,SRR28348936,SRX23954960,SRS20755381,SRP495323,PRJNA1088158,Protein profiling of zebrafish embryos unmasks regulatory layers during early embryogenesis.,GSE261646,Transcriptome Analysis,The maternal to zygotic transition is crucial in embryonic development marked by the degradation of maternally provided mRNAs and initiation of zygotic gene expression. However the changes occurring at the protein level during this transition remain unclear. Here we conducted protein profiling throughout zebrafish embryogenesis using quantitative mass spectrometry integrating transcriptomics and translatomics datasets. Our data shows that unlike RNA changes protein changes are less dynamic. Further increases in protein levels correlate with mRNA translation whereas declines in protein levels do not suggesting active protein degradation processes. Interestingly proteins from pure zygotic genes are present at fertilization challenging existing mRNA based gene classifications. As a proof of concept we utilized CRISPR Cas13d to target znf281b mRNA a gene whose protein significantly accumulates within the first two hpf demonstrating its crucial role in development. Consequently our protein profiling coupled with CRISPR Cas13d offers a new approach to unravel maternal mRNAs function during embryonic development. Overall design: Two biological replicate samples containing 50 zebrafish oocytes per stage were collected by pairing females in natural matings to ''purge'' mature eggs and used to establish an oogenesis time line. Fish were euthanized and ovaries harvested within 1–11 days post purging dpp. Stage I and II oocytes were collected at 1–2 dpp stage III oocytes germinal vesicle in central position at 4–7 dpp and stage IV oocytes germinal vesicle asymmetrically located at 8–10 dpp. Oocyte isolations were based on73 and conducted in isolation medium Leibovitz L 15 Sigma Aldrich #L5520 plus Collagenase I and II depending on the stages as follows. Stages I and II were isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130 and 3 mg/mL Collagenase II Gibco 17101015. Stage III was isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130. Stage IV was isolated by mechanical stripping with forceps and needle without xxx use of Collagenases. Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. Three biological replicate samples containing 20 dechorionated zebrafish embryos were snap frozen in TRIzol Invitrogen #15596026. Four time points of embryonic development were included: 1 cell stage 0 hpf hpf 2 hpf 4 hpf and 6 hpf. RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols.,,pubmed:39302832,,Zebrafish Embryo 2hpf rep2,GSM8147857,,source name:Whole embryo|tissue:Whole embryo|developmental stage:2hpf|genotype:AB TF and TLF|geo loc name:missing|collection date:missing,Zebrafish Embryo 2hpf rep2,Raw reads from zebrafish oocytes stages I IV and embryos 0 2 4 and 6 hpf were demultiplexed into FASTQ format allowing up to one mismatch using Illumina bcl convert 3.10.5. Reads were aligned to UCSC genome danRer11 with STAR aligner version 2.7.3a using Ensembl 106 gene models. Counts were converted to TPM values using RSEM version v1.3.0 and all subsequent analysis was done using TPM. Assembly: danRer11 Ensembl 106 gene models Supplementary files format and content: comma separated files with TPMs from all replicates,Whole embryo,,Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer’s protocols. 0 2 4 and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer’s protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0 2 4 and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer’s directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598 and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled quantified and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer’s instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina Cat. No. 20020598 and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized pooled and sequenced on a NextSeq 500 instrument Illumina as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.,,tissue:Whole embryo|developmental stage:2hpf|genotype:AB TF and TLF,GSM8147857,GSM8147857: Zebrafish Embryo 2hpf rep2; Danio rerio; RNA Seq,GSM8147857 r1,GSM8147857,1,Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. 0 2 4 and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0 2 4 and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer's directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598 and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled quantified and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer's instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina Cat. No. 20020598 and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized pooled and sequenced on a NextSeq 500 instrument Illumina as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP495323,,,s_2hpf_2.fastq,fastq,1578919456.0,20775256.0,GSM8147857 r1,0:76,A:380440230;C:393721925;G:368114931;T:436571104;N:71266,76,,,,380440230,393721925,368114931,436571104,71266,SRX23954960,SRS20755381,SRA1824599,"Computational Biology, Stowers Institute for Medical Research","Computational Biology, Stowers Institute for Medical Research",,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,trueseq,bulk,bulk,bulk,,United States,2024-03-14,Cleavage,Embryo,Whole Organism,All anatomical structures 30771,SRR28348937,SRX23954959,SRS20755380,SRP495323,PRJNA1088158,Protein profiling of zebrafish embryos unmasks regulatory layers during early embryogenesis.,GSE261646,Transcriptome Analysis,The maternal to zygotic transition is crucial in embryonic development marked by the degradation of maternally provided mRNAs and initiation of zygotic gene expression. However the changes occurring at the protein level during this transition remain unclear. Here we conducted protein profiling throughout zebrafish embryogenesis using quantitative mass spectrometry integrating transcriptomics and translatomics datasets. Our data shows that unlike RNA changes protein changes are less dynamic. Further increases in protein levels correlate with mRNA translation whereas declines in protein levels do not suggesting active protein degradation processes. Interestingly proteins from pure zygotic genes are present at fertilization challenging existing mRNA based gene classifications. As a proof of concept we utilized CRISPR Cas13d to target znf281b mRNA a gene whose protein significantly accumulates within the first two hpf demonstrating its crucial role in development. Consequently our protein profiling coupled with CRISPR Cas13d offers a new approach to unravel maternal mRNAs function during embryonic development. Overall design: Two biological replicate samples containing 50 zebrafish oocytes per stage were collected by pairing females in natural matings to ''purge'' mature eggs and used to establish an oogenesis time line. Fish were euthanized and ovaries harvested within 1–11 days post purging dpp. Stage I and II oocytes were collected at 1–2 dpp stage III oocytes germinal vesicle in central position at 4–7 dpp and stage IV oocytes germinal vesicle asymmetrically located at 8–10 dpp. Oocyte isolations were based on73 and conducted in isolation medium Leibovitz L 15 Sigma Aldrich #L5520 plus Collagenase I and II depending on the stages as follows. Stages I and II were isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130 and 3 mg/mL Collagenase II Gibco 17101015. Stage III was isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130. Stage IV was isolated by mechanical stripping with forceps and needle without xxx use of Collagenases. Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. Three biological replicate samples containing 20 dechorionated zebrafish embryos were snap frozen in TRIzol Invitrogen #15596026. Four time points of embryonic development were included: 1 cell stage 0 hpf hpf 2 hpf 4 hpf and 6 hpf. RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols.,,pubmed:39302832,,Zebrafish Embryo 2hpf rep1,GSM8147856,,source name:Whole embryo|tissue:Whole embryo|developmental stage:2hpf|genotype:AB TF and TLF|geo loc name:missing|collection date:missing,Zebrafish Embryo 2hpf rep1,Raw reads from zebrafish oocytes stages I IV and embryos 0 2 4 and 6 hpf were demultiplexed into FASTQ format allowing up to one mismatch using Illumina bcl convert 3.10.5. Reads were aligned to UCSC genome danRer11 with STAR aligner version 2.7.3a using Ensembl 106 gene models. Counts were converted to TPM values using RSEM version v1.3.0 and all subsequent analysis was done using TPM. Assembly: danRer11 Ensembl 106 gene models Supplementary files format and content: comma separated files with TPMs from all replicates,Whole embryo,,Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer’s protocols. 0 2 4 and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer’s protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0 2 4 and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer’s directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598 and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled quantified and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer’s instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina Cat. No. 20020598 and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized pooled and sequenced on a NextSeq 500 instrument Illumina as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.,,tissue:Whole embryo|developmental stage:2hpf|genotype:AB TF and TLF,GSM8147856,GSM8147856: Zebrafish Embryo 2hpf rep1; Danio rerio; RNA Seq,GSM8147856 r1,GSM8147856,1,Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. 0 2 4 and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0 2 4 and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer's directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598 and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled quantified and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer's instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina Cat. No. 20020598 and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized pooled and sequenced on a NextSeq 500 instrument Illumina as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP495323,,,s_2hpf_1.fastq,fastq,1730435412.0,22768887.0,GSM8147856 r1,0:76,A:420026952;C:428388301;G:403718608;T:478219805;N:81746,76,,,,420026952,428388301,403718608,478219805,81746,SRX23954959,SRS20755380,SRA1824599,"Computational Biology, Stowers Institute for Medical Research","Computational Biology, Stowers Institute for Medical Research",,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,trueseq,bulk,bulk,bulk,,United States,2024-03-14,Cleavage,Embryo,Whole Organism,All anatomical structures 31528,SRR28423881,SRX24027916,SRS20821688,SRP497294,PRJNA1090898,The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst169,GSE262247,Transcriptome Analysis,The innate immune system is triggered xxx post injury and its spatiotemporal dynamics are critical for successful regeneration. MyD88 is a key component of the innate immune response; however its role during regeneration remains unclear. Here we show that MyD88 controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration. Our data reveal a significant reduction in pro inflammatory neutrophil and macrophage populations as well as the expansion of a collagen rich endocardial population in cryoinjured myd88 / ventricles. Consistent with these findings we observed increased myofibroblasts fibrin abundance and scarring in myd88 / ventricles. Transcriptomic analyses of endocardial cells and immunostaining experiments reveal compromised PI3K/AKT pathway activation in the myd88 / endocardium. Moreover loss of MyD88 impairs cardiomyocyte proliferation and protrusive activity towards the injured area. Notably endothelial specific overexpression of myd88 reverses the neutrophil fibrotic and scarring phenotypes in cryoinjured myd88 / ventricles. Mechanistically we identify the endocardial derived chemokine gene cxcl18b as a transcriptional target of the MyD88 signaling axis and using loss and gain of function tools show that it controls neutrophil recruitment. Altogether these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis thereby emphasizing the strong impact of the innate immune response during tissue regeneration. Overall design: Live zebrafish ventricular cells were isolated at 24 hour post cryoinjury hpci from myd88+/+ and myd88 / ventricles by Fluorescence activated cell sorting FACS and analyzed using scRNAseq.,parent bioproject:PRJNA1090894,pubmed:39271818,,ventricular cells myd88 / 24 hpci,GSM8161054,,source name:cardiac ventricles|tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88 / |treatment:cardiac cryoinjury|geo loc name:missing|collection date:missing,ventricular cells myd88 / 24 hpci,Raw reads were aligned against the zebrafish genome DanRer11 and counted by StarSolo Dobin et al. doi: 10.1093/bioinformatics/bts635 followed by secondary analysis in Annotated Data Format. Preprocessed counts were further analyzed using Scanpy Wolf et al. doi: 10.1186/s13059 017 1382 0. Basic cell quality control was conducted by taking the number of detected genes and mitochondrial content into consideration. We removed 32 cells in total that did not express more than 300 genes or had a mitochondrial content greater than 10%. Furthermore we filtered 7823 genes if they were detected in less than 30 cells <0.01%. Raw counts per cell were normalized to the median count over all cells and transformed into log space to stabilize variance We initially reduced dimensionality of the dataset using PCA retaining 50 principal components. Subsequent steps like low dimensional UMAP embedding McInnes & Healy https://arxiv.org/abs/1802.03426 and cell clustering via community detection Traag et al. https://arxiv.org/abs/1810.08473 were based on the initial PCA. Final data visualization was done by CellxGene package DOI 10.5281/zenodo.3235020. Assembly: DanRer11 Supplementary files format and content: starsolo outputs,cardiac ventricles,cardiac cryoinjury 24 hours prior to heart extraction,Ventricular cells were isolated from a pool of 4 myd88+/+ and 4 myd88 / ventricles for the myd88+/+ and myd88 / sample respectively. Cell isolation was performed with the Pierce Primary Cardiomyocyte Isolation Kit Thermo Fisher Scientific following the manufacturer’s instructions and with the following modifications: Incubation was performed at 30°C for 20 min followed by resuspension in 1× Hanks’ balanced salt solution Gibco with 0.25% BSA. Suspended cells were sorted using FACSAriaIII sorter BD to exclude dead cells using DAPI Sigma. Library preparation was conducted according to the manufacturer indications Chromium Next GEM Single Cell 3’ GEM Library & Gel Bead Kit v3.1 16 rxns PN 1000121.,,tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88 / |treatment:cardiac cryoinjury,GSM8161054,GSM8161054: ventricular cells myd88 / 24 hpci; Danio rerio; RNA Seq,GSM8161054 r1,GSM8161054,1,Ventricular cells were isolated from a pool of 4 myd88+/+ and 4 myd88 / ventricles for the myd88+/+ and myd88 / sample respectively. Cell isolation was performed with the Pierce Primary Cardiomyocyte Isolation Kit Thermo Fisher Scientific following the manufacturer's instructions and with the following modifications: Incubation was performed at 30°C for 20 min followed by resuspension in 1× Hanks' balanced salt solution Gibco with 0.25% BSA. Suspended cells were sorted using FACSAriaIII sorter BD to exclude dead cells using DAPI Sigma. Library preparation was conducted according to the manufacturer indications Chromium Next GEM Single Cell three prime GEM Library & Gel Bead Kit v3.1 16 rxns PN 1000121.,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,PAIRED,ILLUMINA,NextSeq 2000,,SRP497294,,,Pinelopi_10x_Zebrafish_Mut_Lib_R1.fastq.gz Pinelopi_10x_Zebrafish_Mut_Lib_R2.fastq.gz,fastq fastq,31356990530.0,394538049.0,GSM8161054 r1,0:28 1:51.48,A:8573180857;C:6884590114;G:7520784498;T:8220228225;N:158206836,28,51,,,8573180857,6884590114,7520784498,8220228225,158206836,SRX24027916,SRS20821688,SRA1832827,MPI for heart and lung research,MPI for heart and lung research,,,,,,,,,,,,T,B,sc-like readlen,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,sc,single_cell_droplet,10x,,Germany,2024-03-22,Cleavage,Embryo,Heart,Cardiovascular System 31529,SRR28423882,SRX24027915,SRS20821687,SRP497294,PRJNA1090898,The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst169,GSE262247,Transcriptome Analysis,The innate immune system is triggered xxx post injury and its spatiotemporal dynamics are critical for successful regeneration. MyD88 is a key component of the innate immune response; however its role during regeneration remains unclear. Here we show that MyD88 controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration. Our data reveal a significant reduction in pro inflammatory neutrophil and macrophage populations as well as the expansion of a collagen rich endocardial population in cryoinjured myd88 / ventricles. Consistent with these findings we observed increased myofibroblasts fibrin abundance and scarring in myd88 / ventricles. Transcriptomic analyses of endocardial cells and immunostaining experiments reveal compromised PI3K/AKT pathway activation in the myd88 / endocardium. Moreover loss of MyD88 impairs cardiomyocyte proliferation and protrusive activity towards the injured area. Notably endothelial specific overexpression of myd88 reverses the neutrophil fibrotic and scarring phenotypes in cryoinjured myd88 / ventricles. Mechanistically we identify the endocardial derived chemokine gene cxcl18b as a transcriptional target of the MyD88 signaling axis and using loss and gain of function tools show that it controls neutrophil recruitment. Altogether these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis thereby emphasizing the strong impact of the innate immune response during tissue regeneration. Overall design: Live zebrafish ventricular cells were isolated at 24 hour post cryoinjury hpci from myd88+/+ and myd88 / ventricles by Fluorescence activated cell sorting FACS and analyzed using scRNAseq.,parent bioproject:PRJNA1090894,pubmed:39271818,,ventricular cells myd88+/+ 24 hpci,GSM8161053,,source name:cardiac ventricles|tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88+/+|treatment:cardiac cryoinjury|geo loc name:missing|collection date:missing,ventricular cells myd88+/+ 24 hpci,Raw reads were aligned against the zebrafish genome DanRer11 and counted by StarSolo Dobin et al. doi: 10.1093/bioinformatics/bts635 followed by secondary analysis in Annotated Data Format. Preprocessed counts were further analyzed using Scanpy Wolf et al. doi: 10.1186/s13059 017 1382 0. Basic cell quality control was conducted by taking the number of detected genes and mitochondrial content into consideration. We removed 32 cells in total that did not express more than 300 genes or had a mitochondrial content greater than 10%. Furthermore we filtered 7823 genes if they were detected in less than 30 cells <0.01%. Raw counts per cell were normalized to the median count over all cells and transformed into log space to stabilize variance We initially reduced dimensionality of the dataset using PCA retaining 50 principal components. Subsequent steps like low dimensional UMAP embedding McInnes & Healy https://arxiv.org/abs/1802.03426 and cell clustering via community detection Traag et al. https://arxiv.org/abs/1810.08473 were based on the initial PCA. Final data visualization was done by CellxGene package DOI 10.5281/zenodo.3235020. Assembly: DanRer11 Supplementary files format and content: starsolo outputs,cardiac ventricles,cardiac cryoinjury 24 hours prior to heart extraction,Ventricular cells were isolated from a pool of 4 myd88+/+ and 4 myd88 / ventricles for the myd88+/+ and myd88 / sample respectively. Cell isolation was performed with the Pierce Primary Cardiomyocyte Isolation Kit Thermo Fisher Scientific following the manufacturer’s instructions and with the following modifications: Incubation was performed at 30°C for 20 min followed by resuspension in 1× Hanks’ balanced salt solution Gibco with 0.25% BSA. Suspended cells were sorted using FACSAriaIII sorter BD to exclude dead cells using DAPI Sigma. Library preparation was conducted according to the manufacturer indications Chromium Next GEM Single Cell 3’ GEM Library & Gel Bead Kit v3.1 16 rxns PN 1000121.,,tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88+/+|treatment:cardiac cryoinjury,GSM8161053,GSM8161053: ventricular cells myd88+/+ 24 hpci; Danio rerio; RNA Seq,GSM8161053 r1,GSM8161053,1,Ventricular cells were isolated from a pool of 4 myd88+/+ and 4 myd88 / ventricles for the myd88+/+ and myd88 / sample respectively. Cell isolation was performed with the Pierce Primary Cardiomyocyte Isolation Kit Thermo Fisher Scientific following the manufacturer's instructions and with the following modifications: Incubation was performed at 30°C for 20 min followed by resuspension in 1× Hanks' balanced salt solution Gibco with 0.25% BSA. Suspended cells were sorted using FACSAriaIII sorter BD to exclude dead cells using DAPI Sigma. Library preparation was conducted according to the manufacturer indications Chromium Next GEM Single Cell three prime GEM Library & Gel Bead Kit v3.1 16 rxns PN 1000121.,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,PAIRED,ILLUMINA,NextSeq 2000,,SRP497294,,,Pinelopi_10x_Zebrafish_WT_Lib_R1.fastq.gz Pinelopi_10x_Zebrafish_WT_Lib_R2.fastq.gz,fastq fastq,40672259373.0,511650018.0,GSM8161053 r1,0:28 1:51.49,A:11079272327;C:8809520398;G:9307205642;T:11269370263;N:206890743,28,51,,,11079272327,8809520398,9307205642,11269370263,206890743,SRX24027915,SRS20821687,SRA1832827,MPI for heart and lung research,MPI for heart and lung research,,,,,,,,,,,,T,B,sc-like readlen,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,sc,single_cell_droplet,10x,,Germany,2024-03-22,Cleavage,Embryo,Heart,Cardiovascular System 34036,SRR31033345,SRX26418807,SRS22938440,SRP539223,PRJNA1174207,Rbm24 dictates mRNA recruitment for germ plasm assembly,GSE279756,Transcriptome Analysis,Ribonucleoprotein RNP granules are the most common membrane less biomolecular condensates. However the mechanisms underlying their assembly are largely unknown. The aggregation of germ plasm determines the fate of primordial germ cells PGCs and serves as a model for RNP granule assembly. Here we show that maternal RNA binding protein Rbm24a is the key factor governing specific sorting of mRNAs. Mechanistically Rbm24a complexes with Buc and interacts to dictate the specific grasp of germ plasm mRNAs into phase separated condensates. Germ plasm particles lacking Rbm24a and mRNAs fail to undergo kinesin dependent transport towards the cleavage furrows where small granules fuse into large aggregates. Therefore the loss of maternal Rbm24a causes a complete degradation of germ plasm and the disappearance of PGCs. These findings demonstrate that Rbm24a functions as a nucleating organizer of the germ plasm highlighting an emerging mechanism for RNA binding proteins in reading and recruiting RNA components into the phase separated protein scaffold. Overall design: To examine the global transcriptome alterations following the loss of maternal Rbm24a we conducted bulk RNA seq analysis on Mrbm24a and their sibling embyos at 4 cell sphere stage and 24 hpf.,,,,Zebrafish Riboseq M 4cell 5,GSM8579730,,source name:whole embryo|tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:Mrbm24a|geo loc name:missing|collection date:missing,Zebrafish Riboseq M 4cell 5,Each library was amplified by a 11 cycle PCR and 150 bp paired end sequencing was subjected to Illumina HiSeq 2000 to obtain the raw data. Assembly: GRCz10 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text file includes FPKM values for each Sample,whole embryo,,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions.,Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C,tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:Mrbm24a,GSM8579730,GSM8579730: Zebrafish Riboseq M 4cell 5; Danio rerio; RNA Seq,GSM8579730 r1,GSM8579730,1,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,SRP539223,,,M-4cell-5_L1_1.fq.gz M-4cell-5_L1_2.fq.gz,fastq fastq,5643278100.0,18810927.0,GSM8579730 r1,0:150 1:150,A:1555401034;C:1268722567;G:1323837426;T:1495279385;N:37688,150,150,,,1555401034,1268722567,1323837426,1495279385,37688,SRX26418807,SRS22938440,SRA1993092,Shandong university,Shandong university,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,unknown,bulk,bulk,bulk,,China,2024-10-17,Cleavage,Embryo,Whole Organism,All anatomical structures 34037,SRR31033351,SRX26418806,SRS22938443,SRP539223,PRJNA1174207,Rbm24 dictates mRNA recruitment for germ plasm assembly,GSE279756,Transcriptome Analysis,Ribonucleoprotein RNP granules are the most common membrane less biomolecular condensates. However the mechanisms underlying their assembly are largely unknown. The aggregation of germ plasm determines the fate of primordial germ cells PGCs and serves as a model for RNP granule assembly. Here we show that maternal RNA binding protein Rbm24a is the key factor governing specific sorting of mRNAs. Mechanistically Rbm24a complexes with Buc and interacts to dictate the specific grasp of germ plasm mRNAs into phase separated condensates. Germ plasm particles lacking Rbm24a and mRNAs fail to undergo kinesin dependent transport towards the cleavage furrows where small granules fuse into large aggregates. Therefore the loss of maternal Rbm24a causes a complete degradation of germ plasm and the disappearance of PGCs. These findings demonstrate that Rbm24a functions as a nucleating organizer of the germ plasm highlighting an emerging mechanism for RNA binding proteins in reading and recruiting RNA components into the phase separated protein scaffold. Overall design: To examine the global transcriptome alterations following the loss of maternal Rbm24a we conducted bulk RNA seq analysis on Mrbm24a and their sibling embyos at 4 cell sphere stage and 24 hpf.,,,,Zebrafish Riboseq M 4cell 4,GSM8579729,,source name:whole embryo|tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:Mrbm24a|geo loc name:missing|collection date:missing,Zebrafish Riboseq M 4cell 4,Each library was amplified by a 11 cycle PCR and 150 bp paired end sequencing was subjected to Illumina HiSeq 2000 to obtain the raw data. Assembly: GRCz10 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text file includes FPKM values for each Sample,whole embryo,,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions.,Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C,tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:Mrbm24a,GSM8579729,GSM8579729: Zebrafish Riboseq M 4cell 4; Danio rerio; RNA Seq,GSM8579729 r1,GSM8579729,1,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,SRP539223,,,M-4cell-4_L1_1.fq.gz M-4cell-4_L1_2.fq.gz,fastq fastq,6607232100.0,22024107.0,GSM8579729 r1,0:150 1:150,A:1825603885;C:1480833466;G:1538474482;T:1762276005;N:44262,150,150,,,1825603885,1480833466,1538474482,1762276005,44262,SRX26418806,SRS22938443,SRA1993092,Shandong university,Shandong university,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,unknown,bulk,bulk,bulk,,China,2024-10-17,Cleavage,Embryo,Whole Organism,All anatomical structures 34038,SRR31033346,SRX26418805,SRS22938438,SRP539223,PRJNA1174207,Rbm24 dictates mRNA recruitment for germ plasm assembly,GSE279756,Transcriptome Analysis,Ribonucleoprotein RNP granules are the most common membrane less biomolecular condensates. However the mechanisms underlying their assembly are largely unknown. The aggregation of germ plasm determines the fate of primordial germ cells PGCs and serves as a model for RNP granule assembly. Here we show that maternal RNA binding protein Rbm24a is the key factor governing specific sorting of mRNAs. Mechanistically Rbm24a complexes with Buc and interacts to dictate the specific grasp of germ plasm mRNAs into phase separated condensates. Germ plasm particles lacking Rbm24a and mRNAs fail to undergo kinesin dependent transport towards the cleavage furrows where small granules fuse into large aggregates. Therefore the loss of maternal Rbm24a causes a complete degradation of germ plasm and the disappearance of PGCs. These findings demonstrate that Rbm24a functions as a nucleating organizer of the germ plasm highlighting an emerging mechanism for RNA binding proteins in reading and recruiting RNA components into the phase separated protein scaffold. Overall design: To examine the global transcriptome alterations following the loss of maternal Rbm24a we conducted bulk RNA seq analysis on Mrbm24a and their sibling embyos at 4 cell sphere stage and 24 hpf.,,,,Zebrafish Riboseq M 4cell 3,GSM8579728,,source name:whole embryo|tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:Mrbm24a|geo loc name:missing|collection date:missing,Zebrafish Riboseq M 4cell 3,Each library was amplified by a 11 cycle PCR and 150 bp paired end sequencing was subjected to Illumina HiSeq 2000 to obtain the raw data. Assembly: GRCz10 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text file includes FPKM values for each Sample,whole embryo,,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions.,Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C,tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:Mrbm24a,GSM8579728,GSM8579728: Zebrafish Riboseq M 4cell 3; Danio rerio; RNA Seq,GSM8579728 r1,GSM8579728,1,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,SRP539223,,,M-4cell-3_L1_1.fq.gz M-4cell-3_L1_2.fq.gz,fastq fastq,7948794900.0,26495983.0,GSM8579728 r1,0:150 1:150,A:2183592013;C:1794605656;G:1863773539;T:2106770087;N:53605,150,150,,,2183592013,1794605656,1863773539,2106770087,53605,SRX26418805,SRS22938438,SRA1993092,Shandong university,Shandong university,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,unknown,bulk,bulk,bulk,,China,2024-10-17,Cleavage,Embryo,Whole Organism,All anatomical structures 34039,SRR31033350,SRX26418804,SRS22938441,SRP539223,PRJNA1174207,Rbm24 dictates mRNA recruitment for germ plasm assembly,GSE279756,Transcriptome Analysis,Ribonucleoprotein RNP granules are the most common membrane less biomolecular condensates. However the mechanisms underlying their assembly are largely unknown. The aggregation of germ plasm determines the fate of primordial germ cells PGCs and serves as a model for RNP granule assembly. Here we show that maternal RNA binding protein Rbm24a is the key factor governing specific sorting of mRNAs. Mechanistically Rbm24a complexes with Buc and interacts to dictate the specific grasp of germ plasm mRNAs into phase separated condensates. Germ plasm particles lacking Rbm24a and mRNAs fail to undergo kinesin dependent transport towards the cleavage furrows where small granules fuse into large aggregates. Therefore the loss of maternal Rbm24a causes a complete degradation of germ plasm and the disappearance of PGCs. These findings demonstrate that Rbm24a functions as a nucleating organizer of the germ plasm highlighting an emerging mechanism for RNA binding proteins in reading and recruiting RNA components into the phase separated protein scaffold. Overall design: To examine the global transcriptome alterations following the loss of maternal Rbm24a we conducted bulk RNA seq analysis on Mrbm24a and their sibling embyos at 4 cell sphere stage and 24 hpf.,,,,Zebrafish Riboseq M 4cell 2,GSM8579727,,source name:whole embryo|tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:Mrbm24a|geo loc name:missing|collection date:missing,Zebrafish Riboseq M 4cell 2,Each library was amplified by a 11 cycle PCR and 150 bp paired end sequencing was subjected to Illumina HiSeq 2000 to obtain the raw data. Assembly: GRCz10 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text file includes FPKM values for each Sample,whole embryo,,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions.,Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C,tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:Mrbm24a,GSM8579727,GSM8579727: Zebrafish Riboseq M 4cell 2; Danio rerio; RNA Seq,GSM8579727 r1,GSM8579727,1,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,SRP539223,,,M-4cell-2_L1_1.fq.gz M-4cell-2_L1_2.fq.gz,fastq fastq,7036510200.0,23455034.0,GSM8579727 r1,0:150 1:150,A:1830698676;C:1686461802;G:1754202163;T:1765099649;N:47910,150,150,,,1830698676,1686461802,1754202163,1765099649,47910,SRX26418804,SRS22938441,SRA1993092,Shandong university,Shandong university,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,unknown,bulk,bulk,bulk,,China,2024-10-17,Cleavage,Embryo,Whole Organism,All anatomical structures 34047,SRR31033355,SRX26418796,SRS22938428,SRP539223,PRJNA1174207,Rbm24 dictates mRNA recruitment for germ plasm assembly,GSE279756,Transcriptome Analysis,Ribonucleoprotein RNP granules are the most common membrane less biomolecular condensates. However the mechanisms underlying their assembly are largely unknown. The aggregation of germ plasm determines the fate of primordial germ cells PGCs and serves as a model for RNP granule assembly. Here we show that maternal RNA binding protein Rbm24a is the key factor governing specific sorting of mRNAs. Mechanistically Rbm24a complexes with Buc and interacts to dictate the specific grasp of germ plasm mRNAs into phase separated condensates. Germ plasm particles lacking Rbm24a and mRNAs fail to undergo kinesin dependent transport towards the cleavage furrows where small granules fuse into large aggregates. Therefore the loss of maternal Rbm24a causes a complete degradation of germ plasm and the disappearance of PGCs. These findings demonstrate that Rbm24a functions as a nucleating organizer of the germ plasm highlighting an emerging mechanism for RNA binding proteins in reading and recruiting RNA components into the phase separated protein scaffold. Overall design: To examine the global transcriptome alterations following the loss of maternal Rbm24a we conducted bulk RNA seq analysis on Mrbm24a and their sibling embyos at 4 cell sphere stage and 24 hpf.,,,,Zebrafish RNAseq Sibling 4cell 4,GSM8579719,,source name:whole embryo|tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:wild type|geo loc name:missing|collection date:missing,Zebrafish RNAseq Sibling 4cell 4,Each library was amplified by a 11 cycle PCR and 150 bp paired end sequencing was subjected to Illumina HiSeq 2000 to obtain the raw data. Assembly: GRCz10 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text file includes FPKM values for each Sample,whole embryo,,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions.,Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C,tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:wild type,GSM8579719,GSM8579719: Zebrafish RNAseq Sibling 4cell 4; Danio rerio; RNA Seq,GSM8579719 r1,GSM8579719,1,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,SRP539223,,,Sibling-4cell-4_L1_1.fq.gz Sibling-4cell-4_L1_2.fq.gz,fastq fastq,7424662500.0,24748875.0,GSM8579719 r1,0:150 1:150,A:2045351766;C:1671617139;G:1731338149;T:1976305596;N:49850,150,150,,,2045351766,1671617139,1731338149,1976305596,49850,SRX26418796,SRS22938428,SRA1993092,Shandong university,Shandong university,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,unknown,bulk,bulk,bulk,,China,2024-10-17,Cleavage,Embryo,Whole Organism,All anatomical structures 34048,SRR31033358,SRX26418795,SRS22938431,SRP539223,PRJNA1174207,Rbm24 dictates mRNA recruitment for germ plasm assembly,GSE279756,Transcriptome Analysis,Ribonucleoprotein RNP granules are the most common membrane less biomolecular condensates. However the mechanisms underlying their assembly are largely unknown. The aggregation of germ plasm determines the fate of primordial germ cells PGCs and serves as a model for RNP granule assembly. Here we show that maternal RNA binding protein Rbm24a is the key factor governing specific sorting of mRNAs. Mechanistically Rbm24a complexes with Buc and interacts to dictate the specific grasp of germ plasm mRNAs into phase separated condensates. Germ plasm particles lacking Rbm24a and mRNAs fail to undergo kinesin dependent transport towards the cleavage furrows where small granules fuse into large aggregates. Therefore the loss of maternal Rbm24a causes a complete degradation of germ plasm and the disappearance of PGCs. These findings demonstrate that Rbm24a functions as a nucleating organizer of the germ plasm highlighting an emerging mechanism for RNA binding proteins in reading and recruiting RNA components into the phase separated protein scaffold. Overall design: To examine the global transcriptome alterations following the loss of maternal Rbm24a we conducted bulk RNA seq analysis on Mrbm24a and their sibling embyos at 4 cell sphere stage and 24 hpf.,,,,Zebrafish RNAseq Sibling 4cell 2,GSM8579718,,source name:whole embryo|tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:wild type|geo loc name:missing|collection date:missing,Zebrafish RNAseq Sibling 4cell 2,Each library was amplified by a 11 cycle PCR and 150 bp paired end sequencing was subjected to Illumina HiSeq 2000 to obtain the raw data. Assembly: GRCz10 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text file includes FPKM values for each Sample,whole embryo,,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions.,Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C,tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:wild type,GSM8579718,GSM8579718: Zebrafish RNAseq Sibling 4cell 2; Danio rerio; RNA Seq,GSM8579718 r1,GSM8579718,1,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,SRP539223,,,Sibling-4cell-2_L1_1.fq.gz Sibling-4cell-2_L1_2.fq.gz,fastq fastq,6484454400.0,21614848.0,GSM8579718 r1,0:150 1:150,A:1701212104;C:1544478776;G:1597991536;T:1640728663;N:43321,150,150,,,1701212104,1544478776,1597991536,1640728663,43321,SRX26418795,SRS22938431,SRA1993092,Shandong university,Shandong university,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,unknown,bulk,bulk,bulk,,China,2024-10-17,Cleavage,Embryo,Whole Organism,All anatomical structures 34049,SRR31033356,SRX26418794,SRS22938430,SRP539223,PRJNA1174207,Rbm24 dictates mRNA recruitment for germ plasm assembly,GSE279756,Transcriptome Analysis,Ribonucleoprotein RNP granules are the most common membrane less biomolecular condensates. However the mechanisms underlying their assembly are largely unknown. The aggregation of germ plasm determines the fate of primordial germ cells PGCs and serves as a model for RNP granule assembly. Here we show that maternal RNA binding protein Rbm24a is the key factor governing specific sorting of mRNAs. Mechanistically Rbm24a complexes with Buc and interacts to dictate the specific grasp of germ plasm mRNAs into phase separated condensates. Germ plasm particles lacking Rbm24a and mRNAs fail to undergo kinesin dependent transport towards the cleavage furrows where small granules fuse into large aggregates. Therefore the loss of maternal Rbm24a causes a complete degradation of germ plasm and the disappearance of PGCs. These findings demonstrate that Rbm24a functions as a nucleating organizer of the germ plasm highlighting an emerging mechanism for RNA binding proteins in reading and recruiting RNA components into the phase separated protein scaffold. Overall design: To examine the global transcriptome alterations following the loss of maternal Rbm24a we conducted bulk RNA seq analysis on Mrbm24a and their sibling embyos at 4 cell sphere stage and 24 hpf.,,,,Zebrafish RNAseq Sibling 4cell 1,GSM8579717,,source name:whole embryo|tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:wild type|geo loc name:missing|collection date:missing,Zebrafish RNAseq Sibling 4cell 1,Each library was amplified by a 11 cycle PCR and 150 bp paired end sequencing was subjected to Illumina HiSeq 2000 to obtain the raw data. Assembly: GRCz10 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text file includes FPKM values for each Sample,whole embryo,,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions.,Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C,tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:wild type,GSM8579717,GSM8579717: Zebrafish RNAseq Sibling 4cell 1; Danio rerio; RNA Seq,GSM8579717 r1,GSM8579717,1,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,SRP539223,,,Sibling-4cell-1_L1_1.fq.gz Sibling-4cell-1_L1_2.fq.gz,fastq fastq,8126999700.0,27089999.0,GSM8579717 r1,0:150 1:150,A:2195769442;C:1872416059;G:1934390760;T:2124367874;N:55565,150,150,,,2195769442,1872416059,1934390760,2124367874,55565,SRX26418794,SRS22938430,SRA1993092,Shandong university,Shandong university,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,unknown,bulk,bulk,bulk,,China,2024-10-17,Cleavage,Embryo,Whole Organism,All anatomical structures 36258,SRR062659,SRX025027,SRS085806,SRP003165,PRJNA127881,High throughput sequencing of mRNA from oocyte 1 cell 16/32 cells 128/256 cells 3.5hpf and 5.3hpf zebrafish embryos Wild type; AB line,GSE22830,Transcriptome Analysis,mRNA seq based approach to determine the transcriptome dynamics during early development To study the mechanisms regulating this developmental event in zebrafish we applied RNA deep sequencing technology and generated comprehensive transcriptome profiles of 6 developmental stages from oocyte to early gastrulation. We determined the expression levels of maternal and zygotic transcripts and clustered them based on expression pattern. We identified a large number of novel transcribed regions in un annotated regions of the genome as well as splice variants with an estimated frequency of 40 75% during early zebrafish embryogenesis. Our data constitute a useful resource for developmental studies gene discovery and genome annotation. Overall design: RNA was extracted from pooled embryos of desired stages and one RNA seq library was generated for each sample. Totally 6 stages were selected: Maternal 1cell 16/32 cells 128/256 cells 3.5hpf and 5.3hpf,,pubmed:21555364;pubmed:24586560;pubmed:23676078,,16/32 cells,GSM564429,,tissue:developing embryos|background:AB; wild type|developmental stage:mixure of 16/32 cell embryos,16/32 cells,ABI pipeline BioScope v1.0.1 Data analysis: The SOLiD generated RNA Seq reads was in 50bp length and an initial filtering process was taken to remove any non desirable contamination sequences such as rRNA tRNA and repeats etc. A seed and extension mapping approach was developed to map the 50bp reads into reference genome zv7 and also into the respective zv7 refGene annotation separately. During mapping of the reads to the refGene annotation a splice junction database fasta file is generated to which the reads are mapped to. This database contains known and putative junction sequences created by taking 46bp from the joining ends of adjacent and non adjacent exons for each gene and putting them together simulating the genomic sequences of known and putative junctions respectively. The first 25bp of the 50bp read was used as the seed for alignment for each read. When an alignment cannot be found using these 25bp seed the seed window is shifted and the next 25bp seed is taken from the 21st to the 45th base of the read. An extension step follows when the seed is able to map and a score generated for each extended base to determine best alignment. A merging step is performed on the genome mapping and splice junction mapping to determine a set of alignments for each read from which a unique alignment is found based on the score generated for these alignments. Mapping parameters:  Mapping was done using Applied Biosystems’ SOLiD BioScope alignment for whole transcriptome analysis pipeline.  Two mismatches were allowed in the 25bp color space seed sequence with extension alignment performed to find the full mapping location.  A score is computed for each mapping location and any location that scored <22 were filtered. Generation of gff and bedgraph files: GFF files were produced by parsing the output BAM format and extracted for unique alignments with score >22. The bedgraph files are then produced with the resulting gff file.,developing embryos,Embryos were frozen at the desired developmental stages and RNAs was extracted for sequencing.,mRNA seq was performed by Mission Biotech Taiwan. SOLiD sequencing libraries were prepared using the Whole Transcriptome Library Preparation for SOLiD™ Sequencing kit ABI according to manufacturer’s instructions. About 200 280 µg of total RNAs were used as starting materials which were subjected to polyA selection using Applied Biosystems PolyA Purist Kit AM1916 fragmentation and library construction using distinct adapters for each library SOLiD Barcoding. From each library equal volumes were pooled together and sequenced in SOLiD3 ABI platform generating 50bp tags.,Zebrafish embryos AB background collected just post fertilization were reared and harvested at desired time points. Unfertilized oocytes were collected by squeezing the abdomen of spawning females. Harvested embryos were snap frozen in liquid nitrogen and stored in −80°C. Total RNA was extracted from whole embryos using Trizol Invitrogen according to manufacturer’s instructions. RNA concentrations were determined using NanoDrop 2000 Thermo Scientific. Integrity of RNA samples were determined using Agilent RNA 6000 Nano chip and size separated using Agilent 2100 Bioanalyzer. Total RNA obtained per 100 embryos at each developmental stage was calculated for data normalization purposes.,background:AB; wild type|developmental stage:mixure of 16/32 cell embryos,GSM564429,GSM564429: 16/32 cells,GSM564429: 16/32 cells,GSM564429: 16/32 cells,1,,GEO Accession:GSM564429,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ABI_SOLID,AB SOLiD System 3.0,0Application ReadForward1,SRP003165,,,,,1792238300.0,35844766.0,GSM564429 1,0:50,,50,,,,,,,,,SRX025027,SRS085806,SRA022850,GEO,"Computational and Systems Biology, Genome Institute of Singapore",1,0.6993,,0.04019,,0.83763,,0.50284,,50,,B,,usable mapping rate,legacy,early,full_length,poly_a,unknown,bulk,unknown,unknown,,Singapore,2010-07-08,Cleavage,Embryo,Embryo Imprecise,All anatomical structures 36297,SRR393000,SRX113357,SRS284301,SRP010040,PRJNA150397,Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay,GSE34743,Transcriptome Analysis,MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos,,pubmed:22422859,,Ribosome protected fragments Wild type 2hpf 2,GSM854439,,source name:Whole embryo wild type|sample type:ribosome protected fragments|tissue:whole embryo|genotype:wild type|development stage:2hpf,Ribosome protected fragments Wild type 2hpf 2,Ribo Wt 2 B.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence,Whole embryo wild type,,Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PCR was carried out with an initial 30s denaturation at 98degC followed by 4 cycles of 30s denaturation at 98degC and 15s extension at 72degC followed by 10 15 cycles of 10s denaturation at 98degC 30s annealing at 50degC and 15s extension at 72degC. Reactions were separated on a non denaturing 8% polyacrylamide TBE gel and correct sized DNA fragments were sequenced using Illumina HiSeq2000. In parallel RNA input from 20 embryos was extracted using Trizol then polyA selected using biotinylated oligodT40 at room temperature and eluted. Samples were then alkaline fragmented for 20min at 95degC using 2 mM EDTA; 10 mM Na2CO3; 90 mM NaHCO3 pH 9.3; then neutralized with 560ul of ice cold NaOAc 300mM pH 5.5 and RNA precipitated with isopropanol. Small RNA sequencing libraries were constructed as above selecting for fragments in the 30 50 nt range.,,sample type:ribosome protected fragments|tissue:whole embryo|genotype:wild type|developmental stage:2hpf,GSM854439,GSM854439: Ribosome protected fragments Wild type 2hpf 2; Danio rerio; RNA Seq,GSM854439 1,GSM854439: Ribosome protected fragments Wild type 2hpf 2,1,,GEO Accession:GSM854439,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina Genome Analyzer II,720Application ReadForward1,SRP010040,,,Ribo_Wt_2_B1.fq,fastq,217015848.0,3014109.0,GSM854439 r1,0:72,A:73500339;C:46583724;G:47804114;T:49117423;N:10248,72,,,,73500339,46583724,47804114,49117423,10248,SRX113357,SRS284301,SRA048903,GEO,"Giraldez Lab, Genetics, Yale University",1,2e-05,,0.0,,0.99997,,1.0,,72,,T,,under 1.2% mapping rate,illumina,early_illumina,unknown,poly_a,unknown,bulk,unknown,unknown,,United States,2011-12-27,Cleavage,Embryo,Whole Organism,All anatomical structures 36298,SRR393001,SRX113357,SRS284301,SRP010040,PRJNA150397,Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay,GSE34743,Transcriptome Analysis,MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos,,pubmed:22422859,,Ribosome protected fragments Wild type 2hpf 2,GSM854439,,source name:Whole embryo wild type|sample type:ribosome protected fragments|tissue:whole embryo|genotype:wild type|development stage:2hpf,Ribosome protected fragments Wild type 2hpf 2,Ribo Wt 2 B.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence,Whole embryo wild type,,Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PCR was carried out with an initial 30s denaturation at 98degC followed by 4 cycles of 30s denaturation at 98degC and 15s extension at 72degC followed by 10 15 cycles of 10s denaturation at 98degC 30s annealing at 50degC and 15s extension at 72degC. Reactions were separated on a non denaturing 8% polyacrylamide TBE gel and correct sized DNA fragments were sequenced using Illumina HiSeq2000. In parallel RNA input from 20 embryos was extracted using Trizol then polyA selected using biotinylated oligodT40 at room temperature and eluted. Samples were then alkaline fragmented for 20min at 95degC using 2 mM EDTA; 10 mM Na2CO3; 90 mM NaHCO3 pH 9.3; then neutralized with 560ul of ice cold NaOAc 300mM pH 5.5 and RNA precipitated with isopropanol. Small RNA sequencing libraries were constructed as above selecting for fragments in the 30 50 nt range.,,sample type:ribosome protected fragments|tissue:whole embryo|genotype:wild type|developmental stage:2hpf,GSM854439,GSM854439: Ribosome protected fragments Wild type 2hpf 2; Danio rerio; RNA Seq,GSM854439 1,GSM854439: Ribosome protected fragments Wild type 2hpf 2,1,,GEO Accession:GSM854439,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina Genome Analyzer II,720Application ReadForward1,SRP010040,,instrument model:Illumina HiSeq 2000,Ribo_Wt_2_B2.fq,fastq,976804848.0,13566734.0,GSM854439 r2,0:72,A:312362919;C:205660950;G:237663406;T:221097191;N:20382,72,,,,312362919,205660950,237663406,221097191,20382,SRX113357,SRS284301,SRA048903,GEO,"Giraldez Lab, Genetics, Yale University",1,0.0,,0.0,,1.0,,,,72,,T,,under 1.2% mapping rate,illumina,early_illumina,unknown,poly_a,unknown,bulk,unknown,unknown,,United States,2011-12-27,Cleavage,Embryo,Whole Organism,All anatomical structures 36299,SRR392998,SRX113356,SRS284300,SRP010040,PRJNA150397,Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay,GSE34743,Transcriptome Analysis,MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos,,pubmed:22422859,,Ribosome protected fragments Wild type 2hpf,GSM854438,,source name:Whole embryo wild type|sample type:ribosome protected fragments|tissue:whole embryo|genotype:wild type|development stage:2hpf,Ribosome protected fragments Wild type 2hpf,Ribo Wt 2 A.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence,Whole embryo wild type,,Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PCR was carried out with an initial 30s denaturation at 98degC followed by 4 cycles of 30s denaturation at 98degC and 15s extension at 72degC followed by 10 15 cycles of 10s denaturation at 98degC 30s annealing at 50degC and 15s extension at 72degC. Reactions were separated on a non denaturing 8% polyacrylamide TBE gel and correct sized DNA fragments were sequenced using Illumina HiSeq2000. In parallel RNA input from 20 embryos was extracted using Trizol then polyA selected using biotinylated oligodT40 at room temperature and eluted. Samples were then alkaline fragmented for 20min at 95degC using 2 mM EDTA; 10 mM Na2CO3; 90 mM NaHCO3 pH 9.3; then neutralized with 560ul of ice cold NaOAc 300mM pH 5.5 and RNA precipitated with isopropanol. Small RNA sequencing libraries were constructed as above selecting for fragments in the 30 50 nt range.,,sample type:ribosome protected fragments|tissue:whole embryo|genotype:wild type|developmental stage:2hpf,GSM854438,GSM854438: Ribosome protected fragments Wild type 2hpf; Danio rerio; RNA Seq,GSM854438 1,GSM854438: Ribosome protected fragments Wild type 2hpf,1,,GEO Accession:GSM854438,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina Genome Analyzer II,720Application ReadForward1,SRP010040,,,Ribo_Wt_2_A1.fq,fastq,284876712.0,3956621.0,GSM854438 r1,0:72,A:88022040;C:68867093;G:63794882;T:64180749;N:11948,72,,,,88022040,68867093,63794882,64180749,11948,SRX113356,SRS284300,SRA048903,GEO,"Giraldez Lab, Genetics, Yale University",1,0.00011,,7e-05,,0.99995,,0.0,,72,,T,,under 1.2% mapping rate,illumina,early_illumina,unknown,poly_a,unknown,bulk,unknown,unknown,,United States,2011-12-27,Cleavage,Embryo,Whole Organism,All anatomical structures 36300,SRR392999,SRX113356,SRS284300,SRP010040,PRJNA150397,Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay,GSE34743,Transcriptome Analysis,MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos,,pubmed:22422859,,Ribosome protected fragments Wild type 2hpf,GSM854438,,source name:Whole embryo wild type|sample type:ribosome protected fragments|tissue:whole embryo|genotype:wild type|development stage:2hpf,Ribosome protected fragments Wild type 2hpf,Ribo Wt 2 A.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence,Whole embryo wild type,,Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PCR was carried out with an initial 30s denaturation at 98degC followed by 4 cycles of 30s denaturation at 98degC and 15s extension at 72degC followed by 10 15 cycles of 10s denaturation at 98degC 30s annealing at 50degC and 15s extension at 72degC. Reactions were separated on a non denaturing 8% polyacrylamide TBE gel and correct sized DNA fragments were sequenced using Illumina HiSeq2000. In parallel RNA input from 20 embryos was extracted using Trizol then polyA selected using biotinylated oligodT40 at room temperature and eluted. Samples were then alkaline fragmented for 20min at 95degC using 2 mM EDTA; 10 mM Na2CO3; 90 mM NaHCO3 pH 9.3; then neutralized with 560ul of ice cold NaOAc 300mM pH 5.5 and RNA precipitated with isopropanol. Small RNA sequencing libraries were constructed as above selecting for fragments in the 30 50 nt range.,,sample type:ribosome protected fragments|tissue:whole embryo|genotype:wild type|developmental stage:2hpf,GSM854438,GSM854438: Ribosome protected fragments Wild type 2hpf; Danio rerio; RNA Seq,GSM854438 1,GSM854438: Ribosome protected fragments Wild type 2hpf,1,,GEO Accession:GSM854438,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina Genome Analyzer II,720Application ReadForward1,SRP010040,,instrument model:Illumina HiSeq 2000,Ribo_Wt_2_A2.fq,fastq,1197987552.0,16638716.0,GSM854438 r2,0:72,A:346631182;C:288138913;G:296030268;T:267150788;N:36401,72,,,,346631182,288138913,296030268,267150788,36401,SRX113356,SRS284300,SRA048903,GEO,"Giraldez Lab, Genetics, Yale University",1,3e-05,,0.0,,0.99997,,0.0,,72,,T,,under 1.2% mapping rate,illumina,early_illumina,unknown,poly_a,unknown,bulk,unknown,unknown,,United States,2011-12-27,Cleavage,Embryo,Whole Organism,All anatomical structures 36309,SRR392988,SRX113351,SRS284295,SRP010040,PRJNA150397,Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay,GSE34743,Transcriptome Analysis,MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos,,pubmed:22422859,,Ribosome protected fragments MZdicer 2hpf 2,GSM854433,,source name:Whole embryo MZdicer|sample type:ribosome protected fragments|tissue:whole embryo|genotype:MZdicer mutant|development stage:2hpf,Ribosome protected fragments MZdicer 2hpf 2,Ribo Dicer 2 B.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence,Whole embryo MZdicer,,Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PCR was carried out with an initial 30s denaturation at 98degC followed by 4 cycles of 30s denaturation at 98degC and 15s extension at 72degC followed by 10 15 cycles of 10s denaturation at 98degC 30s annealing at 50degC and 15s extension at 72degC. Reactions were separated on a non denaturing 8% polyacrylamide TBE gel and correct sized DNA fragments were sequenced using Illumina HiSeq2000. In parallel RNA input from 20 embryos was extracted using Trizol then polyA selected using biotinylated oligodT40 at room temperature and eluted. Samples were then alkaline fragmented for 20min at 95degC using 2 mM EDTA; 10 mM Na2CO3; 90 mM NaHCO3 pH 9.3; then neutralized with 560ul of ice cold NaOAc 300mM pH 5.5 and RNA precipitated with isopropanol. Small RNA sequencing libraries were constructed as above selecting for fragments in the 30 50 nt range.,,sample type:ribosome protected fragments|tissue:whole embryo|genotype:MZdicer mutant|developmental stage:2hpf,GSM854433,GSM854433: Ribosome protected fragments MZdicer 2hpf 2; Danio rerio; RNA Seq,GSM854433 1,GSM854433: Ribosome protected fragments MZdicer 2hpf 2,1,,GEO Accession:GSM854433,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina Genome Analyzer II,720Application ReadForward1,SRP010040,,,Ribo_Dicer_2_B1.fq,fastq,72956952.0,1013291.0,GSM854433 r1,0:72,A:22006501;C:17986138;G:16833834;T:16127785;N:2694,72,,,,22006501,17986138,16833834,16127785,2694,SRX113351,SRS284295,SRA048903,GEO,"Giraldez Lab, Genetics, Yale University",1,0.00131,,0.00114,,0.99991,,0.88888,,72,,T,,under 1.2% mapping rate,illumina,early_illumina,unknown,poly_a,unknown,bulk,unknown,unknown,,United States,2011-12-27,Cleavage,Embryo,Whole Organism,All anatomical structures 36310,SRR392989,SRX113351,SRS284295,SRP010040,PRJNA150397,Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay,GSE34743,Transcriptome Analysis,MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos,,pubmed:22422859,,Ribosome protected fragments MZdicer 2hpf 2,GSM854433,,source name:Whole embryo MZdicer|sample type:ribosome protected fragments|tissue:whole embryo|genotype:MZdicer mutant|development stage:2hpf,Ribosome protected fragments MZdicer 2hpf 2,Ribo Dicer 2 B.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence,Whole embryo MZdicer,,Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PCR was carried out with an initial 30s denaturation at 98degC followed by 4 cycles of 30s denaturation at 98degC and 15s extension at 72degC followed by 10 15 cycles of 10s denaturation at 98degC 30s annealing at 50degC and 15s extension at 72degC. Reactions were separated on a non denaturing 8% polyacrylamide TBE gel and correct sized DNA fragments were sequenced using Illumina HiSeq2000. In parallel RNA input from 20 embryos was extracted using Trizol then polyA selected using biotinylated oligodT40 at room temperature and eluted. Samples were then alkaline fragmented for 20min at 95degC using 2 mM EDTA; 10 mM Na2CO3; 90 mM NaHCO3 pH 9.3; then neutralized with 560ul of ice cold NaOAc 300mM pH 5.5 and RNA precipitated with isopropanol. Small RNA sequencing libraries were constructed as above selecting for fragments in the 30 50 nt range.,,sample type:ribosome protected fragments|tissue:whole embryo|genotype:MZdicer mutant|developmental stage:2hpf,GSM854433,GSM854433: Ribosome protected fragments MZdicer 2hpf 2; Danio rerio; RNA Seq,GSM854433 1,GSM854433: Ribosome protected fragments MZdicer 2hpf 2,1,,GEO Accession:GSM854433,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina Genome Analyzer II,720Application ReadForward1,SRP010040,,instrument model:Illumina HiSeq 2000,Ribo_Dicer_2_B2.fq,fastq,454127328.0,6307324.0,GSM854433 r2,0:72,A:124676855;C:112665084;G:119208313;T:97572172;N:4904,72,,,,124676855,112665084,119208313,97572172,4904,SRX113351,SRS284295,SRA048903,GEO,"Giraldez Lab, Genetics, Yale University",1,0.0,,0.0,,1.0,,,,72,,T,,under 1.2% mapping rate,illumina,early_illumina,unknown,poly_a,unknown,bulk,unknown,unknown,,United States,2011-12-27,Cleavage,Embryo,Whole Organism,All anatomical structures 36311,SRR392986,SRX113350,SRS284294,SRP010040,PRJNA150397,Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay,GSE34743,Transcriptome Analysis,MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos,,pubmed:22422859,,Ribosome protected fragments MZdicer 2hpf,GSM854432,,source name:Whole embryo MZdicer|sample type:ribosome protected fragments|tissue:whole embryo|genotype:MZdicer mutant|development stage:2hpf,Ribosome protected fragments MZdicer 2hpf,Ribo Dicer 2 A.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence,Whole embryo MZdicer,,Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PCR was carried out with an initial 30s denaturation at 98degC followed by 4 cycles of 30s denaturation at 98degC and 15s extension at 72degC followed by 10 15 cycles of 10s denaturation at 98degC 30s annealing at 50degC and 15s extension at 72degC. Reactions were separated on a non denaturing 8% polyacrylamide TBE gel and correct sized DNA fragments were sequenced using Illumina HiSeq2000. In parallel RNA input from 20 embryos was extracted using Trizol then polyA selected using biotinylated oligodT40 at room temperature and eluted. Samples were then alkaline fragmented for 20min at 95degC using 2 mM EDTA; 10 mM Na2CO3; 90 mM NaHCO3 pH 9.3; then neutralized with 560ul of ice cold NaOAc 300mM pH 5.5 and RNA precipitated with isopropanol. Small RNA sequencing libraries were constructed as above selecting for fragments in the 30 50 nt range.,,sample type:ribosome protected fragments|tissue:whole embryo|genotype:MZdicer mutant|developmental stage:2hpf,GSM854432,GSM854432: Ribosome protected fragments MZdicer 2hpf; Danio rerio; RNA Seq,GSM854432 1,GSM854432: Ribosome protected fragments MZdicer 2hpf,1,,GEO Accession:GSM854432,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina Genome Analyzer II,720Application ReadForward1,SRP010040,,,Ribo_Dicer_2_A1.fq,fastq,216257400.0,3003575.0,GSM854432 r1,0:72,A:66784432;C:51526758;G:47615177;T:50321714;N:9319,72,,,,66784432,51526758,47615177,50321714,9319,SRX113350,SRS284294,SRA048903,GEO,"Giraldez Lab, Genetics, Yale University",1,6e-05,,1e-05,,0.99995,,1.0,,72,,T,,under 1.2% mapping rate,illumina,early_illumina,unknown,poly_a,unknown,bulk,unknown,unknown,,United States,2011-12-27,Cleavage,Embryo,Whole Organism,All anatomical structures