rowid,run.accession,experiment.accession,sample.accession,study.accession,bioproject,study.title,study.alias,study.type,study.abstract,study.attributes,study.PMIDs,sample.description,sample.title,sample.alias,sample.centername,sample.attributes,GEOsample.title,GEOsample.dataprocessing,GEOsample.source,GEOsample.treatmentprotocol,GEOsample.extractprotocol,GEOsample.growthprotocol,GEOsample.characteristics,GEOsample.accession,experiment.title,experiment.alias,experiment.library_name,experiment.design_description,experiment.library_construction_protocol,experiment.attributes,experiment.library_strategy,experiment.library_source,experiment.library_selection,experiment.library_layout,experiment.platform,experiment.instrument_model,experiment.spot_descriptor,experiment.study_ref,run.title,run.attributes,run.filename,run.semantic_name,run.total_bases,run.total_spots,run.alias,run.read_lengths,run.base_counts,run.r1_length,run.r2_length,run.r3_length,run.r4_length,run.Acount,run.Ccount,run.Gcount,run.Tcount,run.Ncount,run.experiment,run.pool_member,submission.accession,submission.srasource,submission.bioprojectsource,seqdetective.n_mates,seqdetective.mapping_rate.mate1,seqdetective.mapping_rate.mate2,seqdetective.nofeature_rate.mate1,seqdetective.nofeature_rate.mate2,seqdetective.sparsity.mate1,seqdetective.sparsity.mate2,seqdetective.pos_strand_rate.mate1,seqdetective.pos_strand_rate.mate2,seqdetective.readlen.mate1,seqdetective.readlen.mate2,seqdetective.judgement.mate1,seqdetective.judgement.mate2,seqdetective.judgement.reason,platform_family,instrument_generation,read_bias,selection_class,prep_kit,sc_or_bulk,tech_class,technology,tech_variant,submission.bioprojectsource.country,earliest_date,devstage_curation,devstage_curation_coarse,tissue_curation,tissue_curation_coarse
3155,ERR1410225,ERX1481464,ERS1021813,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 pool12,SAMEA3714664,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714664|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:11Z|INSDC status:public|Submitter Id:e9237f50 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TTCAGCTC is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e9237f50 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#24,15565967,Illumina sequencing of library 15565967 constructed from sample accession ERS1021813 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TTCAGCTC.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#24.cram,cram,682856330.0,5252741.0,SC RUN 18730 4#24,0:55 1:75,A:168217714;C:139075008;G:141169282;T:234338870;N:55456,55,75,,,168217714,139075008,141169282,234338870,55456,ERX1481464,ERS1021813,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.22601,0.6266,0.06302,0.07433,0.95848,0.87767,0.77147,0.72121,55,75,B,B,mate1-mate2 similar by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3156,ERR1410224,ERX1481463,ERS1021812,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 pool11,SAMEA3714663,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714663|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:10Z|INSDC status:public|Submitter Id:e91834b0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TACTAGTC is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e91834b0 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#23,15565966,Illumina sequencing of library 15565966 constructed from sample accession ERS1021812 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TACTAGTC.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#23.cram,cram,784669730.0,6035921.0,SC RUN 18730 4#23,0:55 1:75,A:193369040;C:154930839;G:157589012;T:278718023;N:62816,55,75,,,193369040,154930839,157589012,278718023,62816,ERX1481463,ERS1021812,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.22113,0.66423,0.05856,0.07177,0.95899,0.86705,0.76036,0.71777,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3157,ERR1410223,ERX1481462,ERS1021811,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 pool10,SAMEA3714662,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714662|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:10Z|INSDC status:public|Submitter Id:e90c9bf0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TCAGATTC is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e90c9bf0 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#22,15565965,Illumina sequencing of library 15565965 constructed from sample accession ERS1021811 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TCAGATTC.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#22.cram,cram,1247901590.0,9599243.0,SC RUN 18730 4#22,0:55 1:75,A:314703461;C:244320464;G:241561095;T:447214667;N:101903,55,75,,,314703461,244320464,241561095,447214667,101903,ERX1481462,ERS1021811,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.20694,0.62963,0.04856,0.05487,0.95763,0.87026,0.7137,0.71273,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3158,ERR1410222,ERX1481461,ERS1021810,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 pool9,SAMEA3714661,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714661|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:09Z|INSDC status:public|Submitter Id:e8fe4410 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TATGCCAG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8fe4410 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#21,15565964,Illumina sequencing of library 15565964 constructed from sample accession ERS1021810 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TATGCCAG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#21.cram,cram,1160974880.0,8930576.0,SC RUN 18730 4#21,0:55 1:75,A:287583127;C:233701395;G:225242195;T:414354028;N:94135,55,75,,,287583127,233701395,225242195,414354028,94135,ERX1481461,ERS1021810,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.20242,0.60852,0.05828,0.06484,0.95568,0.87456,0.67452,0.38749,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3159,ERR1410221,ERX1481460,ERS1021809,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 pool8,SAMEA3714660,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714660|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:08Z|INSDC status:public|Submitter Id:e8f2d260 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TGGCTCAG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8f2d260 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#20,15565963,Illumina sequencing of library 15565963 constructed from sample accession ERS1021809 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TGGCTCAG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#20.cram,cram,1041644630.0,8012651.0,SC RUN 18730 4#20,0:55 1:75,A:250361997;C:216927117;G:209137594;T:365137042;N:80880,55,75,,,250361997,216927117,209137594,365137042,80880,ERX1481460,ERS1021809,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.23722,0.6381,0.05317,0.07562,0.95503,0.87671,0.75995,0.72353,55,75,B,B,mate1-mate2 similar by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3160,ERR1410220,ERX1481459,ERS1021808,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 pool7,SAMEA3714659,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714659|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:08Z|INSDC status:public|Submitter Id:e8e787c0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TCATTGAG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8e787c0 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#19,15565962,Illumina sequencing of library 15565962 constructed from sample accession ERS1021808 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TCATTGAG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#19.cram,cram,1002402180.0,7710786.0,SC RUN 18730 4#19,0:55 1:75,A:249654737;C:203437995;G:194586976;T:354640685;N:81787,55,75,,,249654737,203437995,194586976,354640685,81787,ERX1481459,ERS1021808,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.21081,0.61197,0.04352,0.05852,0.9529,0.86815,0.65385,0.64824,55,75,B,B,mate1-mate2 similar by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3161,ERR1410219,ERX1481458,ERS1021807,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 pool6,SAMEA3714658,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714658|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:07Z|INSDC status:public|Submitter Id:e8dc3d20 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TGTATGCG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8dc3d20 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#18,15565961,Illumina sequencing of library 15565961 constructed from sample accession ERS1021807 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TGTATGCG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#18.cram,cram,1001271050.0,7702085.0,SC RUN 18730 4#18,0:55 1:75,A:249131077;C:206043698;G:193568917;T:352446609;N:80749,55,75,,,249131077,206043698,193568917,352446609,80749,ERX1481458,ERS1021807,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.22004,0.6117,0.05313,0.0656,0.95095,0.8758,0.70135,0.69364,55,75,B,B,mate1-mate2 similar by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3162,ERR1410218,ERX1481457,ERS1021806,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 pool5,SAMEA3714657,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714657|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:06Z|INSDC status:public|Submitter Id:e8b183a0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TCCAGTCG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8b183a0 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#17,15565960,Illumina sequencing of library 15565960 constructed from sample accession ERS1021806 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TCCAGTCG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#17.cram,cram,1240938140.0,9545678.0,SC RUN 18730 4#17,0:55 1:75,A:302318036;C:249218633;G:246601321;T:442702025;N:98125,55,75,,,302318036,249218633,246601321,442702025,98125,ERX1481457,ERS1021806,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.23057,0.63523,0.05319,0.067,0.95213,0.86695,0.69753,0.68537,55,75,B,B,mate1-mate2 similar by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3163,ERR1410217,ERX1481456,ERS1021805,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 pool4,SAMEA3714656,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714656|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:06Z|INSDC status:public|Submitter Id:e8ab9030 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TAAGTTCG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8ab9030 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#16,15565959,Illumina sequencing of library 15565959 constructed from sample accession ERS1021805 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TAAGTTCG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#16.cram,cram,942829030.0,7252531.0,SC RUN 18730 4#16,0:55 1:75,A:225274547;C:196341691;G:188483755;T:332654028;N:75009,55,75,,,225274547,196341691,188483755,332654028,75009,ERX1481456,ERS1021805,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.21889,0.64365,0.04363,0.07265,0.95181,0.87478,0.70501,0.69162,55,75,B,B,mate1-mate2 similar by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3164,ERR1410216,ERX1481455,ERS1021804,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 pool3,SAMEA3714655,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714655|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:05Z|INSDC status:public|Submitter Id:e8a5eae0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TCAGGAGG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8a5eae0 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#15,15565958,Illumina sequencing of library 15565958 constructed from sample accession ERS1021804 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TCAGGAGG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#15.cram,cram,992671030.0,7635931.0,SC RUN 18730 4#15,0:55 1:75,A:241776762;C:210080049;G:195284057;T:345448849;N:81313,55,75,,,241776762,210080049,195284057,345448849,81313,ERX1481455,ERS1021804,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.21439,0.6195,0.04725,0.05379,0.95191,0.87606,0.67336,0.65016,55,75,B,B,mate1-mate2 similar by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3165,ERR1410215,ERX1481454,ERS1021803,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 pool2,SAMEA3714654,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714654|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:05Z|INSDC status:public|Submitter Id:e89cc320 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TCTCACGG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e89cc320 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#14,15565957,Illumina sequencing of library 15565957 constructed from sample accession ERS1021803 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TCTCACGG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#14.cram,cram,1234311910.0,9494707.0,SC RUN 18730 4#14,0:55 1:75,A:301439259;C:257228602;G:244500849;T:431043241;N:99959,55,75,,,301439259,257228602,244500849,431043241,99959,ERX1481454,ERS1021803,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.19348,0.62337,0.04021,0.05986,0.95574,0.87941,0.67064,0.69696,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3166,ERR1410214,ERX1481453,ERS1021802,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 pool1,SAMEA3714653,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714653|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:04Z|INSDC status:public|Submitter Id:e897ba10 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TACTTCGG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e897ba10 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#13,15565956,Illumina sequencing of library 15565956 constructed from sample accession ERS1021802 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TACTTCGG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#13.cram,cram,1039867140.0,7998978.0,SC RUN 18730 4#13,0:55 1:75,A:252384576;C:218519074;G:206578085;T:362298880;N:86525,55,75,,,252384576,218519074,206578085,362298880,86525,ERX1481453,ERS1021802,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.18713,0.60956,0.05049,0.0817,0.95556,0.87618,0.66594,0.68034,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3167,ERR1410213,ERX1481452,ERS1021801,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 12,SAMEA3714652,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714652|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:04Z|INSDC status:public|Submitter Id:e89262e0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TGAACTGG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e89262e0 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#12,15565955,Illumina sequencing of library 15565955 constructed from sample accession ERS1021801 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TGAACTGG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#12.cram,cram,1071792020.0,8244554.0,SC RUN 18730 4#12,0:55 1:75,A:266291261;C:216074486;G:207838804;T:381495628;N:91841,55,75,,,266291261,216074486,207838804,381495628,91841,ERX1481452,ERS1021801,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.19027,0.64477,0.0489,0.06997,0.95268,0.86371,0.66594,0.67162,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3168,ERR1410212,ERX1481451,ERS1021800,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 11,SAMEA3714651,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714651|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:03Z|INSDC status:public|Submitter Id:e88d59d0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TTGGTATG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e88d59d0 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#11,15565954,Illumina sequencing of library 15565954 constructed from sample accession ERS1021800 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TTGGTATG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#11.cram,cram,686164570.0,5278189.0,SC RUN 18730 4#11,0:55 1:75,A:165352345;C:146328635;G:134343947;T:240083817;N:55826,55,75,,,165352345,146328635,134343947,240083817,55826,ERX1481451,ERS1021800,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.22823,0.61844,0.08567,0.10696,0.95106,0.86797,0.62805,0.63179,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3169,ERR1410211,ERX1481450,ERS1021799,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 10,SAMEA3714650,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714650|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:03Z|INSDC status:public|Submitter Id:e88829b0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TAACGCTG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e88829b0 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#10,15565953,Illumina sequencing of library 15565953 constructed from sample accession ERS1021799 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TAACGCTG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#10.cram,cram,889043870.0,6838799.0,SC RUN 18730 4#10,0:55 1:75,A:223435089;C:179282347;G:171273337;T:314981588;N:71509,55,75,,,223435089,179282347,171273337,314981588,71509,ERX1481450,ERS1021799,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.19054,0.6472,0.0467,0.06495,0.953,0.86519,0.68221,0.68725,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3170,ERR1410210,ERX1481449,ERS1021798,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 9,SAMEA3714649,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714649|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:02Z|INSDC status:public|Submitter Id:e88320a0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TCGAAGTG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e88320a0 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#9,15565952,Illumina sequencing of library 15565952 constructed from sample accession ERS1021798 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TCGAAGTG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#9.cram,cram,987809940.0,7598538.0,SC RUN 18730 4#9,0:55 1:75,A:248484130;C:197140774;G:188385871;T:353715305;N:83860,55,75,,,248484130,197140774,188385871,353715305,83860,ERX1481449,ERS1021798,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.2215,0.62639,0.05009,0.06362,0.94959,0.86689,0.63702,0.63984,55,75,B,B,mate1-mate2 similar by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3171,ERR1410209,ERX1481448,ERS1021797,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 8,SAMEA3714648,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714648|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:02Z|INSDC status:public|Submitter Id:e87d5440 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TTCCATTG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e87d5440 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#8,15565951,Illumina sequencing of library 15565951 constructed from sample accession ERS1021797 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TTCCATTG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#8.cram,cram,991993340.0,7630718.0,SC RUN 18730 4#8,0:55 1:75,A:248601530;C:201637312;G:190701521;T:350971271;N:81706,55,75,,,248601530,201637312,190701521,350971271,81706,ERX1481448,ERS1021797,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.18071,0.60546,0.04372,0.05614,0.95556,0.87182,0.64904,0.68316,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3172,ERR1410208,ERX1481447,ERS1021796,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 7,SAMEA3714647,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714647|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:01Z|INSDC status:public|Submitter Id:e871e290 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TAGTCTTG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e871e290 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#7,15565950,Illumina sequencing of library 15565950 constructed from sample accession ERS1021796 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TAGTCTTG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#7.cram,cram,1355591770.0,10427629.0,SC RUN 18730 4#7,0:55 1:75,A:333761549;C:285155703;G:270975293;T:465589806;N:109419,55,75,,,333761549,285155703,270975293,465589806,109419,ERX1481447,ERS1021796,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.19403,0.63995,0.03449,0.07104,0.957,0.88641,0.73288,0.71598,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3173,ERR1410207,ERX1481446,ERS1021795,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 6,SAMEA3714646,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714646|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:01Z|INSDC status:public|Submitter Id:e86670e0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TGTGGTTG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e86670e0 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#6,15565949,Illumina sequencing of library 15565949 constructed from sample accession ERS1021795 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TGTGGTTG.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#6.cram,cram,1121411330.0,8626241.0,SC RUN 18730 4#6,0:55 1:75,A:275436070;C:245845272;G:219970219;T:380067436;N:92333,55,75,,,275436070,245845272,219970219,380067436,92333,ERX1481446,ERS1021795,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.185,0.59026,0.03934,0.06143,0.95268,0.88968,0.59393,0.69736,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3174,ERR1410206,ERX1481445,ERS1021794,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 5,SAMEA3714645,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714645|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:01Z|INSDC status:public|Submitter Id:e85b2640 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TCCTCAAT is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e85b2640 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#5,15565948,Illumina sequencing of library 15565948 constructed from sample accession ERS1021794 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TCCTCAAT.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#5.cram,cram,852544290.0,6558033.0,SC RUN 18730 4#5,0:55 1:75,A:202033234;C:177211087;G:169900063;T:303332405;N:67501,55,75,,,202033234,177211087,169900063,303332405,67501,ERX1481445,ERS1021794,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.21445,0.62891,0.0753,0.09655,0.95278,0.86929,0.61569,0.48656,55,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3175,ERR1410205,ERX1481444,ERS1021793,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 4,SAMEA3714644,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714644|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:00Z|INSDC status:public|Submitter Id:e84f8d80 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TACAGGAT is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e84f8d80 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#4,15565947,Illumina sequencing of library 15565947 constructed from sample accession ERS1021793 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TACAGGAT.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#4.cram,cram,989803880.0,7613876.0,SC RUN 18730 4#4,0:55 1:75,A:241562947;C:196888151;G:193862254;T:357404172;N:86356,55,75,,,241562947,196888151,193862254,357404172,86356,ERX1481444,ERS1021793,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.27131,0.63988,0.04128,0.04919,0.95923,0.88292,0.81011,0.7508,55,75,B,B,mate1-mate2 similar by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3176,ERR1410204,ERX1481443,ERS1021792,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 3,SAMEA3714643,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714643|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:00Z|INSDC status:public|Submitter Id:e8441bd0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TAGTGACT is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8441bd0 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#3,15565946,Illumina sequencing of library 15565946 constructed from sample accession ERS1021792 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TAGTGACT.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#3.cram,cram,1144202930.0,8801561.0,SC RUN 18730 4#3,0:55 1:75,A:278906912;C:230946498;G:229591661;T:404660425;N:97434,55,75,,,278906912,230946498,229591661,404660425,97434,ERX1481443,ERS1021792,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.24055,0.6437,0.04616,0.05861,0.9554,0.88221,0.30306,0.73916,55,75,B,B,mate1-mate2 similar by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3177,ERR1410203,ERX1481442,ERS1021791,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 2,SAMEA3714642,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714642|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:41:59Z|INSDC status:public|Submitter Id:e8385c00 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TTCCTGCT is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8385c00 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#2,15565945,Illumina sequencing of library 15565945 constructed from sample accession ERS1021791 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TTCCTGCT.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#2.cram,cram,1459339960.0,11225692.0,SC RUN 18730 4#2,0:55 1:75,A:361580033;C:294777861;G:295641568;T:507221717;N:118781,55,75,,,361580033,294777861,295641568,507221717,118781,ERX1481442,ERS1021791,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.25446,0.64481,0.04258,0.05864,0.95473,0.88562,0.32211,0.75437,55,75,B,B,mate1-mate2 similar by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3178,ERR1410202,ERX1481441,ERS1021790,ERP013756,PRJEB12296,Baseline expression from transcriptional profiling of zebrafish developmental stages 2,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 453,,,ZMP phenotype 128 1 1,SAMEA3714641,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714641|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:41:58Z|INSDC status:public|Submitter Id:e73ff240 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TGCGATCT is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e73ff240 a000 11e5 800b 68b59976a382|strain:mixed,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 18730 4#1,15565944,Illumina sequencing of library 15565944 constructed from sample accession ERS1021790 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TGCGATCT.,Transcriptome counting qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP013756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16,18730_4#1.cram,cram,869624210.0,6689417.0,SC RUN 18730 4#1,0:55 1:75,A:211816407;C:178380016;G:176641186;T:302714073;N:72528,55,75,,,211816407,178380016,176641186,302714073,72528,ERX1481441,ERS1021790,ERA620320,European Nucleotide Archive,Wellcome Sanger Institute,2,0.26789,0.63129,0.0568,0.09239,0.95978,0.88978,0.82999,0.78005,55,75,B,B,mate1-mate2 similar by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-12-16,Cleavage,Embryo,Whole Organism,All anatomical structures
3788,ERR1442900,ERX1513277,ERS1079219,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 F,SAMEA3892085,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892085|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:07Z|INSDC status:public|Submitter Id:744149e0 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:744149e0 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19912 2#70,16564972,Illumina sequencing of library 16564972 constructed from sample accession ERS1079219 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 2. This submission includes reads tagged with the sequence GATCTCTT.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19912_2#70.cram,cram,364410400.0,1822052.0,SC RUN 19912 2#70,0:100 1:100,A:96471898;C:85460940;G:85739185;T:96152266;N:586111,100,100,,,96471898,85460940,85739185,96152266,586111,ERX1513277,ERS1079219,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96377,0.96719,0.0976,0.09955,0.79667,0.79693,0.58832,0.58226,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures
3789,ERR1442899,ERX1513276,ERS1079218,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 E,SAMEA3892084,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892084|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74358a10 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74358a10 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19912 2#69,16564960,Illumina sequencing of library 16564960 constructed from sample accession ERS1079218 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 2. This submission includes reads tagged with the sequence GGTGAGTT.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19912_2#69.cram,cram,312144800.0,1560724.0,SC RUN 19912 2#69,0:100 1:100,A:82044388;C:74027006;G:73985684;T:81583681;N:504041,100,100,,,82044388,74027006,73985684,81583681,504041,ERX1513276,ERS1079218,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96275,0.9677,0.10631,0.10791,0.79496,0.79535,0.57643,0.57303,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures
3790,ERR1442898,ERX1513275,ERS1079217,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 D,SAMEA3892083,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892083|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74295510 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74295510 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19912 2#68,16564948,Illumina sequencing of library 16564948 constructed from sample accession ERS1079217 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 2. This submission includes reads tagged with the sequence TGCGTGAA.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19912_2#68.cram,cram,330453000.0,1652265.0,SC RUN 19912 2#68,0:100 1:100,A:87696659;C:77248972;G:77394239;T:87578108;N:535022,100,100,,,87696659,77248972,77394239,87578108,535022,ERX1513275,ERS1079217,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96171,0.96419,0.10779,0.11047,0.79902,0.80018,0.57383,0.56925,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures
3791,ERR1442897,ERX1513274,ERS1079216,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 C,SAMEA3892082,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892082|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:741d9540 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:741d9540 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19912 2#67,16564936,Illumina sequencing of library 16564936 constructed from sample accession ERS1079216 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 2. This submission includes reads tagged with the sequence TACCACCA.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19912_2#67.cram,cram,327261000.0,1636305.0,SC RUN 19912 2#67,0:100 1:100,A:87523901;C:75771535;G:75871608;T:87573282;N:520674,100,100,,,87523901,75771535,75871608,87573282,520674,ERX1513274,ERS1079216,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.95986,0.96354,0.1123,0.11468,0.80156,0.80229,0.58372,0.58338,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures
3792,ERR1442896,ERX1513273,ERS1079215,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 B,SAMEA3892081,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892081|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:05Z|INSDC status:public|Submitter Id:74118750 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74118750 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19912 2#66,16564924,Illumina sequencing of library 16564924 constructed from sample accession ERS1079215 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 2. This submission includes reads tagged with the sequence TGAAGCCA.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19912_2#66.cram,cram,328496600.0,1642483.0,SC RUN 19912 2#66,0:100 1:100,A:86841947;C:77278436;G:77262516;T:86589805;N:523896,100,100,,,86841947,77278436,77262516,86589805,523896,ERX1513273,ERS1079215,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96091,0.96535,0.1279,0.13047,0.79805,0.79857,0.58551,0.58209,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures
3878,ERR1442810,ERX1513187,ERS1079219,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 F,SAMEA3892085,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892085|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:07Z|INSDC status:public|Submitter Id:744149e0 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:744149e0 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19912 1#70,16564972,Illumina sequencing of library 16564972 constructed from sample accession ERS1079219 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 1. This submission includes reads tagged with the sequence GATCTCTT.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19912_1#70.cram,cram,364912600.0,1824563.0,SC RUN 19912 1#70,0:100 1:100,A:96642496;C:85588675;G:85883202;T:96301393;N:496834,100,100,,,96642496,85588675,85883202,96301393,496834,ERX1513187,ERS1079219,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96362,0.96689,0.09725,0.09882,0.79592,0.79703,0.59097,0.5784,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures
3879,ERR1442809,ERX1513186,ERS1079218,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 E,SAMEA3892084,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892084|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74358a10 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74358a10 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19912 1#69,16564960,Illumina sequencing of library 16564960 constructed from sample accession ERS1079218 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 1. This submission includes reads tagged with the sequence GGTGAGTT.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19912_1#69.cram,cram,312470400.0,1562352.0,SC RUN 19912 1#69,0:100 1:100,A:82160555;C:74100532;G:74069193;T:81696066;N:444054,100,100,,,82160555,74100532,74069193,81696066,444054,ERX1513186,ERS1079218,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96376,0.96859,0.10642,0.1079,0.79417,0.79474,0.5752,0.57,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures
3880,ERR1442808,ERX1513185,ERS1079217,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 D,SAMEA3892083,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892083|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74295510 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74295510 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19912 1#68,16564948,Illumina sequencing of library 16564948 constructed from sample accession ERS1079217 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 1. This submission includes reads tagged with the sequence TGCGTGAA.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19912_1#68.cram,cram,330554000.0,1652770.0,SC RUN 19912 1#68,0:100 1:100,A:87747224;C:77298685;G:77439701;T:87616982;N:451408,100,100,,,87747224,77298685,77439701,87616982,451408,ERX1513185,ERS1079217,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96163,0.96436,0.10875,0.1111,0.79928,0.79965,0.57561,0.5708,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures
3881,ERR1442807,ERX1513184,ERS1079216,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 C,SAMEA3892082,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892082|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:741d9540 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:741d9540 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19912 1#67,16564936,Illumina sequencing of library 16564936 constructed from sample accession ERS1079216 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 1. This submission includes reads tagged with the sequence TACCACCA.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19912_1#67.cram,cram,327019400.0,1635097.0,SC RUN 19912 1#67,0:100 1:100,A:87453957;C:75726607;G:75847551;T:87546870;N:444415,100,100,,,87453957,75726607,75847551,87546870,444415,ERX1513184,ERS1079216,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96147,0.9625,0.11258,0.11475,0.79825,0.79924,0.58372,0.56917,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures
3882,ERR1442806,ERX1513183,ERS1079215,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 B,SAMEA3892081,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892081|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:05Z|INSDC status:public|Submitter Id:74118750 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74118750 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19912 1#66,16564924,Illumina sequencing of library 16564924 constructed from sample accession ERS1079215 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 1. This submission includes reads tagged with the sequence TGAAGCCA.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19912_1#66.cram,cram,327613800.0,1638069.0,SC RUN 19912 1#66,0:100 1:100,A:86594522;C:77121933;G:77114321;T:86338082;N:444942,100,100,,,86594522,77121933,77114321,86338082,444942,ERX1513183,ERS1079215,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.9614,0.96527,0.12823,0.13043,0.79762,0.79922,0.58597,0.5851,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures
3968,ERR1442720,ERX1513097,ERS1079219,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 F,SAMEA3892085,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892085|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:07Z|INSDC status:public|Submitter Id:744149e0 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:744149e0 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19850 2#70,16564972,Illumina sequencing of library 16564972 constructed from sample accession ERS1079219 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 2. This submission includes reads tagged with the sequence GATCTCTT.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19850_2#70.cram,cram,371283800.0,1856419.0,SC RUN 19850 2#70,0:100 1:100,A:98443439;C:87187703;G:87417381;T:98100142;N:135135,100,100,,,98443439,87187703,87417381,98100142,135135,ERX1513097,ERS1079219,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96411,0.96451,0.09692,0.09902,0.79657,0.7964,0.58932,0.57779,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures
3969,ERR1442719,ERX1513096,ERS1079218,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 E,SAMEA3892084,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892084|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74358a10 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74358a10 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19850 2#69,16564960,Illumina sequencing of library 16564960 constructed from sample accession ERS1079218 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 2. This submission includes reads tagged with the sequence GGTGAGTT.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19850_2#69.cram,cram,318491400.0,1592457.0,SC RUN 19850 2#69,0:100 1:100,A:83845999;C:75642375;G:75561647;T:83330437;N:110942,100,100,,,83845999,75642375,75561647,83330437,110942,ERX1513096,ERS1079218,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96388,0.96834,0.10544,0.10741,0.79336,0.79417,0.57217,0.56939,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures
3970,ERR1442718,ERX1513095,ERS1079217,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 D,SAMEA3892083,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892083|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74295510 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74295510 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19850 2#68,16564948,Illumina sequencing of library 16564948 constructed from sample accession ERS1079217 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 2. This submission includes reads tagged with the sequence TGCGTGAA.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19850_2#68.cram,cram,335548800.0,1677744.0,SC RUN 19850 2#68,0:100 1:100,A:89188408;C:78543202;G:78653253;T:89044211;N:119726,100,100,,,89188408,78543202,78653253,89044211,119726,ERX1513095,ERS1079217,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96211,0.96612,0.10777,0.11055,0.79724,0.79876,0.57249,0.43044,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures
3971,ERR1442717,ERX1513094,ERS1079216,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 C,SAMEA3892082,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892082|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:741d9540 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:741d9540 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19850 2#67,16564936,Illumina sequencing of library 16564936 constructed from sample accession ERS1079216 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 2. This submission includes reads tagged with the sequence TACCACCA.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19850_2#67.cram,cram,331952200.0,1659761.0,SC RUN 19850 2#67,0:100 1:100,A:88872903;C:76957606;G:77065688;T:88935012;N:120991,100,100,,,88872903,76957606,77065688,88935012,120991,ERX1513094,ERS1079216,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96191,0.96393,0.11342,0.11468,0.799,0.79908,0.58219,0.58045,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures
3972,ERR1442716,ERX1513093,ERS1079215,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 B,SAMEA3892081,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892081|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:05Z|INSDC status:public|Submitter Id:74118750 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74118750 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19850 2#66,16564924,Illumina sequencing of library 16564924 constructed from sample accession ERS1079215 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 2. This submission includes reads tagged with the sequence TGAAGCCA.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19850_2#66.cram,cram,333024200.0,1665121.0,SC RUN 19850 2#66,0:100 1:100,A:88172616;C:78454066;G:78393792;T:87885914;N:117812,100,100,,,88172616,78454066,78393792,87885914,117812,ERX1513093,ERS1079215,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96249,0.96556,0.1289,0.13166,0.79945,0.79961,0.58336,0.58063,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures
4058,ERR1442630,ERX1513007,ERS1079219,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 F,SAMEA3892085,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892085|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:07Z|INSDC status:public|Submitter Id:744149e0 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:744149e0 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19850 1#70,16564972,Illumina sequencing of library 16564972 constructed from sample accession ERS1079219 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 1. This submission includes reads tagged with the sequence GATCTCTT.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19850_1#70.cram,cram,371578800.0,1857894.0,SC RUN 19850 1#70,0:100 1:100,A:98533022;C:87264222;G:87555118;T:98151909;N:74529,100,100,,,98533022,87264222,87555118,98151909,74529,ERX1513007,ERS1079219,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.9636,0.96761,0.09699,0.09916,0.79525,0.79553,0.58618,0.57988,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures
4059,ERR1442629,ERX1513006,ERS1079218,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 E,SAMEA3892084,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892084|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74358a10 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74358a10 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19850 1#69,16564960,Illumina sequencing of library 16564960 constructed from sample accession ERS1079218 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 1. This submission includes reads tagged with the sequence GGTGAGTT.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19850_1#69.cram,cram,318342200.0,1591711.0,SC RUN 19850 1#69,0:100 1:100,A:83801083;C:75621628;G:75578752;T:83271737;N:69000,100,100,,,83801083,75621628,75578752,83271737,69000,ERX1513006,ERS1079218,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96351,0.96877,0.10486,0.10713,0.79423,0.79444,0.57288,0.57375,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures
4060,ERR1442628,ERX1513005,ERS1079217,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 D,SAMEA3892083,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892083|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74295510 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74295510 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19850 1#68,16564948,Illumina sequencing of library 16564948 constructed from sample accession ERS1079217 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 1. This submission includes reads tagged with the sequence TGCGTGAA.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19850_1#68.cram,cram,334846000.0,1674230.0,SC RUN 19850 1#68,0:100 1:100,A:88989528;C:78413149;G:78541907;T:88833028;N:68388,100,100,,,88989528,78413149,78541907,88833028,68388,ERX1513005,ERS1079217,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96197,0.96681,0.10873,0.11111,0.79805,0.7992,0.57474,0.57198,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures
4061,ERR1442627,ERX1513004,ERS1079216,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 C,SAMEA3892082,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892082|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:741d9540 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:741d9540 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19850 1#67,16564936,Illumina sequencing of library 16564936 constructed from sample accession ERS1079216 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 1. This submission includes reads tagged with the sequence TACCACCA.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19850_1#67.cram,cram,332077800.0,1660389.0,SC RUN 19850 1#67,0:100 1:100,A:88958890;C:76946124;G:77079866;T:89022508;N:70412,100,100,,,88958890,76946124,77079866,89022508,70412,ERX1513004,ERS1079216,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96162,0.96369,0.11367,0.11586,0.7992,0.79855,0.58505,0.58088,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures
4062,ERR1442626,ERX1513003,ERS1079215,ERP014517,PRJEB12982,Baseline expression from transcriptional profiling of zebrafish developmental stages 3,Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130,Transcriptome Analysis,RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling,ArrayExpress:E ERAD 475,,,ZMP phenotype 128 B,SAMEA3892081,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892081|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:05Z|INSDC status:public|Submitter Id:74118750 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74118750 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 paired end sequencing,SC EXP 19850 1#66,16564924,Illumina sequencing of library 16564924 constructed from sample accession ERS1079215 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 1. This submission includes reads tagged with the sequence TGAAGCCA.,RNA seq dUTP eukaryotic,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP014517,Illumina HiSeq 2500 paired end sequencing,ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16,19850_1#66.cram,cram,332776400.0,1663882.0,SC RUN 19850 1#66,0:100 1:100,A:88108657;C:78400833;G:78371292;T:87823689;N:71929,100,100,,,88108657,78400833,78371292,87823689,71929,ERX1513003,ERS1079215,ERA648700,European Nucleotide Archive,Wellcome Sanger Institute,2,0.96154,0.96535,0.12909,0.13161,0.79815,0.79959,0.58756,0.58417,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2016-03-10,Cleavage,Embryo,Whole Organism,All anatomical structures
9296,ERR202508,ERX177193,ERS092407,ERP001280,PRJEB2925,maternal to Zygotic Transition,maternal_to_Zygotic_Transition-sc-2012-03-12T11:38:43Z-599,Transcriptome Analysis,During early stages of embryonic development the genome is transcriptionally inactive and cells are under the control of maternally provided mRNA and proteins. At a key point in development known as the maternal to zygotic transition MZT the genome becomes activated and the maternally provided mRNAs begin to degrade. We plan to map the mRNA profiles of genes during the maternal to zygotic transition by using solexa sequencing.,,,,,SAMEA1570569,SC,ArrayExpress DevelopmentalStage:2 cell|ArrayExpress Genotype:T/LF|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Phenotype:WT|ArrayExpress Sex:mixed|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2012 11 28T14:59:05Z|ENA LAST UPDATE:2018 03 08T15:36:29Z|External Id:SAMEA1570569|INSDC center name:SC|INSDC first public:2012 11 28T14:59:05Z|INSDC last update:2018 03 08T15:36:29Z|INSDC status:public|Submitter Id:2C TotRNA sc 2012 02 06T13:12:17Z 1121923|common name:zebrafish|sample description:RNA seq|sample name:2C TotRNA sc 2012 02 06T13:12:17Z 1121923|scientific name:Danio rerio|strain:T/LF,,,,,,,,,1,SC EXP 6683 2,2532385,Illumina sequencing of library 2532385 constructed from sample accession ERS092407 for study accession ERP001280.,Illumina cDNA protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP001280,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2012 11 28|ENA LAST UPDATE:2018 11 16,6683_2.bam,bam,11463941550.0,76426277.0,SC RUN 6683 2,0:75 1:75,A:2384324967;C:3291391074;G:3291238330;T:2457078635;N:39908544,75,75,,,2384324967,3291391074,3291238330,2457078635,39908544,ERX177193,ERS092407,ERA176708,SC,Wellcome Sanger Institute,2,0.96484,0.95918,0.35968,0.35526,0.88404,0.88485,0.84949,0.8524,75,75,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2012-11-28,Cleavage,Embryo,Whole Organism,All anatomical structures
9298,ERR202506,ERX177191,ERS092405,ERP001280,PRJEB2925,maternal to Zygotic Transition,maternal_to_Zygotic_Transition-sc-2012-03-12T11:38:43Z-599,Transcriptome Analysis,During early stages of embryonic development the genome is transcriptionally inactive and cells are under the control of maternally provided mRNA and proteins. At a key point in development known as the maternal to zygotic transition MZT the genome becomes activated and the maternally provided mRNAs begin to degrade. We plan to map the mRNA profiles of genes during the maternal to zygotic transition by using solexa sequencing.,,,,,SAMEA1570534,SC,ArrayExpress DevelopmentalStage:16 cell|ArrayExpress Genotype:T/LF|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Phenotype:WT|ArrayExpress Sex:mixed|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2012 11 28T14:59:05Z|ENA LAST UPDATE:2018 03 08T15:36:25Z|External Id:SAMEA1570534|INSDC center name:SC|INSDC first public:2012 11 28T14:59:05Z|INSDC last update:2018 03 08T15:36:25Z|INSDC status:public|Submitter Id:16C stan pro sc 2012 02 06T13:12:14Z 1121921|common name:zebrafish|sample description:RNA seq|sample name:16C stan pro sc 2012 02 06T13:12:14Z 1121921|scientific name:Danio rerio|strain:T/LF,,,,,,,,,1,SC EXP 6317 5,2532383,Illumina sequencing of library 2532383 constructed from sample accession ERS092405 for study accession ERP001280.,Illumina cDNA protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP001280,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2012 11 28|ENA LAST UPDATE:2018 11 16,6317_5.bam,bam,7092438300.0,47282922.0,SC RUN 6317 5,0:75 1:75,A:1947926886;C:1582039071;G:1595096528;T:1959471222;N:7904593,75,75,,,1947926886,1582039071,1595096528,1959471222,7904593,ERX177191,ERS092405,ERA176708,SC,Wellcome Sanger Institute,2,0.90801,0.90631,0.0426,0.04216,0.78486,0.78539,0.4795,0.47872,75,75,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2012-11-28,Cleavage,Embryo,Whole Organism,All anatomical structures
9301,ERR202503,ERX177188,ERS092094,ERP001280,PRJEB2925,maternal to Zygotic Transition,maternal_to_Zygotic_Transition-sc-2012-03-12T11:38:43Z-599,Transcriptome Analysis,During early stages of embryonic development the genome is transcriptionally inactive and cells are under the control of maternally provided mRNA and proteins. At a key point in development known as the maternal to zygotic transition MZT the genome becomes activated and the maternally provided mRNAs begin to degrade. We plan to map the mRNA profiles of genes during the maternal to zygotic transition by using solexa sequencing.,,,,,SAMEA1570566,SC,ArrayExpress DevelopmentalStage:64 cell|ArrayExpress Genotype:SAT/WIK|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Phenotype:WT|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2012 11 28T14:59:05Z|ENA LAST UPDATE:2018 03 08T15:36:31Z|External Id:SAMEA1570566|INSDC center name:SC|INSDC first public:2012 11 28T14:59:05Z|INSDC last update:2018 03 08T15:36:31Z|INSDC status:public|Submitter Id:SAT b sc 2012 02 06T13:05:45Z 998060|common name:zebrafish|sample description:RNA seq|sample name:SAT b sc 2012 02 06T13:05:45Z 998060|scientific name:Danio rerio|strain:SAT,,,,,,,,,1,SC EXP 5552 6,1476240,Illumina sequencing of library 1476240 constructed from sample accession ERS092094 for study accession ERP001280.,Illumina cDNA protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina Genome Analyzer II,,ERP001280,Illumina Genome Analyzer II paired end sequencing,ENA FIRST PUBLIC:2012 11 28|ENA LAST UPDATE:2018 11 16,5552_6.bam,bam,3031861428.0,28072791.0,SC RUN 5552 6,0:54 1:54,A:827548202;C:685397282;G:689217947;T:827560833;N:2137164,54,54,,,827548202,685397282,689217947,827560833,2137164,ERX177188,ERS092094,ERA176708,SC,Wellcome Sanger Institute,2,0.88709,0.8867,0.04219,0.04381,0.76836,0.76978,0.48688,0.48607,54,54,B,B,biological fallback assumption,illumina,early_illumina,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2012-11-28,Cleavage,Embryo,Whole Organism,All anatomical structures
9304,ERR202500,ERX177185,ERS092093,ERP001280,PRJEB2925,maternal to Zygotic Transition,maternal_to_Zygotic_Transition-sc-2012-03-12T11:38:43Z-599,Transcriptome Analysis,During early stages of embryonic development the genome is transcriptionally inactive and cells are under the control of maternally provided mRNA and proteins. At a key point in development known as the maternal to zygotic transition MZT the genome becomes activated and the maternally provided mRNAs begin to degrade. We plan to map the mRNA profiles of genes during the maternal to zygotic transition by using solexa sequencing.,,,,,SAMEA1570541,SC,ArrayExpress DevelopmentalStage:2 cell|ArrayExpress Genotype:SAT/WIK|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Phenotype:WT|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2012 11 28T14:59:05Z|ENA LAST UPDATE:2018 03 08T15:36:13Z|External Id:SAMEA1570541|INSDC center name:SC|INSDC first public:2012 11 28T14:59:05Z|INSDC last update:2018 03 08T15:36:13Z|INSDC status:public|Submitter Id:SAT a sc 2012 02 06T13:05:43Z 998059|common name:zebrafish|sample description:RNA seq|sample name:SAT a sc 2012 02 06T13:05:43Z 998059|scientific name:Danio rerio|strain:SAT,,,,,,,,,1,SC EXP 5540 7,1392795,Illumina sequencing of library 1392795 constructed from sample accession ERS092093 for study accession ERP001280.,Illumina cDNA protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina Genome Analyzer II,,ERP001280,Illumina Genome Analyzer II paired end sequencing,ENA FIRST PUBLIC:2012 11 28|ENA LAST UPDATE:2018 11 16,5540_7.bam,bam,4139896608.0,38332376.0,SC RUN 5540 7,0:54 1:54,A:1123995667;C:935834208;G:933659183;T:1138309303;N:8098247,54,54,,,1123995667,935834208,933659183,1138309303,8098247,ERX177185,ERS092093,ERA176708,SC,Wellcome Sanger Institute,2,0.89473,0.89261,0.0475,0.0496,0.80413,0.80551,0.49672,0.49064,54,54,B,B,biological fallback assumption,illumina,early_illumina,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2012-11-28,Cleavage,Embryo,Whole Organism,All anatomical structures
9308,ERR202496,ERX177181,ERS092089,ERP001280,PRJEB2925,maternal to Zygotic Transition,maternal_to_Zygotic_Transition-sc-2012-03-12T11:38:43Z-599,Transcriptome Analysis,During early stages of embryonic development the genome is transcriptionally inactive and cells are under the control of maternally provided mRNA and proteins. At a key point in development known as the maternal to zygotic transition MZT the genome becomes activated and the maternally provided mRNAs begin to degrade. We plan to map the mRNA profiles of genes during the maternal to zygotic transition by using solexa sequencing.,,,,,SAMEA1570537,SC,ArrayExpress DevelopmentalStage:64 cell|ArrayExpress Genotype:WIK/SAT|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Phenotype:WT|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2012 11 28T14:59:05Z|ENA LAST UPDATE:2018 03 08T15:36:15Z|External Id:SAMEA1570537|INSDC center name:SC|INSDC first public:2012 11 28T14:59:05Z|INSDC last update:2018 03 08T15:36:15Z|INSDC status:public|Submitter Id:WIK b sc 2012 02 06T13:05:39Z 998055|common name:zebrafish|sample description:RNA seq|sample name:WIK b sc 2012 02 06T13:05:39Z 998055|scientific name:Danio rerio|strain:WIK,,,,,,,,,1,SC EXP 5540 2,1392791,Illumina sequencing of library 1392791 constructed from sample accession ERS092089 for study accession ERP001280.,Illumina cDNA protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina Genome Analyzer II,,ERP001280,Illumina Genome Analyzer II paired end sequencing,ENA FIRST PUBLIC:2012 11 28|ENA LAST UPDATE:2018 11 16,5540_2.bam,bam,3934066536.0,36426542.0,SC RUN 5540 2,0:54 1:54,A:1089272408;C:875257818;G:871131618;T:1090449345;N:7955347,54,54,,,1089272408,875257818,871131618,1090449345,7955347,ERX177181,ERS092089,ERA176708,SC,Wellcome Sanger Institute,2,0.92002,0.92014,0.04875,0.05104,0.76061,0.76161,0.4821,0.48296,54,54,B,B,biological fallback assumption,illumina,early_illumina,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2012-11-28,Cleavage,Embryo,Whole Organism,All anatomical structures
9309,ERR202495,ERX177180,ERS092088,ERP001280,PRJEB2925,maternal to Zygotic Transition,maternal_to_Zygotic_Transition-sc-2012-03-12T11:38:43Z-599,Transcriptome Analysis,During early stages of embryonic development the genome is transcriptionally inactive and cells are under the control of maternally provided mRNA and proteins. At a key point in development known as the maternal to zygotic transition MZT the genome becomes activated and the maternally provided mRNAs begin to degrade. We plan to map the mRNA profiles of genes during the maternal to zygotic transition by using solexa sequencing.,,,,,SAMEA1570572,SC,ArrayExpress DevelopmentalStage:2 cell|ArrayExpress Genotype:WIK/SAT|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Phenotype:WT|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2012 11 28T14:59:05Z|ENA LAST UPDATE:2018 03 08T15:36:31Z|External Id:SAMEA1570572|INSDC center name:SC|INSDC first public:2012 11 28T14:59:05Z|INSDC last update:2018 03 08T15:36:31Z|INSDC status:public|Submitter Id:WIK a sc 2012 02 06T13:05:37Z 998054|common name:zebrafish|sample description:RNA seq|sample name:WIK a sc 2012 02 06T13:05:37Z 998054|scientific name:Danio rerio|strain:WIK,,,,,,,,,1,SC EXP 5540 1,1392790,Illumina sequencing of library 1392790 constructed from sample accession ERS092088 for study accession ERP001280.,Illumina cDNA protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina Genome Analyzer II,,ERP001280,Illumina Genome Analyzer II paired end sequencing,ENA FIRST PUBLIC:2012 11 28|ENA LAST UPDATE:2018 11 16,5540_1.bam,bam,4120158204.0,38149613.0,SC RUN 5540 1,0:54 1:54,A:1165514767;C:896704109;G:892695229;T:1156428740;N:8815359,54,54,,,1165514767,896704109,892695229,1156428740,8815359,ERX177180,ERS092088,ERA176708,SC,Wellcome Sanger Institute,2,0.9228,0.92241,0.05498,0.05795,0.79091,0.79235,0.50034,0.50151,54,54,B,B,biological fallback assumption,illumina,early_illumina,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2012-11-28,Cleavage,Embryo,Whole Organism,All anatomical structures
24550,ERR964668,ERX1041631,ERS792102,ERP011038,PRJEB9889,The Zebrafish transcriptome during early development,ena-STUDY-KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION-15-07-2015-15:13:51:747-22,Other,Zebrafish has emerged as a model organism to investigate vertebrate development and human genetic diseases. However currently zebrafish annotation is still ongoing and clearly not sufficed therefore providing opportunity for novel transcript finding. With the introduction of massive parallel sequencing whole transcriptome investigations became possible through assembling entire transcriptome from overlapped sequencing reads. In the study we were aiming to discover novel transcribed regions NTRs using data from RNA sequencing. We have developed an in house bioinformatics pipeline for NTR discovery. Using the pipeline we detected 165 putative NTRs which could involve in early zebrafish development and not annotated anywhere. Six randomly selected NTRs were successfully validated experimentally using RT PCR. These NTRs provided new candidates for zebrafish transcriptome studies and zebrafish genome annotation.,,,,KI BN JKE DRERIO RNASEQ,SAMEA3484817,KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION,ENA first public:2015 07 16|ENA last update:2015 07 15|External Id:SAMEA3484817|INSDC center alias:KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION|INSDC center name:KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION|INSDC first public:2015 07 16T15:54:30Z|INSDC last update:2015 07 15T15:02:15Z|INSDC status:public|Submitter Id:KI BN JKE DRERIO RNASEQ 2009 16cell|common name:zebrafish|dev stage:16 cell|sample name:KI BN JKE DRERIO RNASEQ 2009 16cell|strain:Tuebingen,,,,,,,,,AB SOLiD System 3.0 sequencing,ena EXPERIMENT KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION 15 07 2015 15:13:47:870 2,unspecified,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ABI_SOLID,AB SOLiD System 3.0,,ERP011038,AB SOLiD System 3.0 sequencing,ENA FIRST PUBLIC:2015 07 16|ENA LAST UPDATE:2018 11 16,KI-BN-JKE-DRERIO-RNASEQ-20090709-16cell_F3.csfasta.gz KI-BN-JKE-DRERIO-RNASEQ-20090709-16cell_F3_QV.qual.gz,SOLiD_native SOLiD_native,5278508300.0,105570166.0,ena RUN KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION 15 07 2015 15:13:47:871 2,0:50,0:1410981717;1:1203936808;2:1415708111;3:1223403795;.:24477869,50,,,,,,,,,ERX1041631,ERS792102,ERA458495,KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION|European Nucleotide Archive,KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION,1,0.71371,,0.09346,,0.91539,,0.73015,,50,,B,,usable mapping rate,legacy,early,full_length,random_priming,unknown,bulk,unknown,unknown,,Sweden,2015-07-15,Cleavage,Embryo,Undetermined,Embryo Imprecise
24553,ERR964672,ERX1041635,ERS792102,ERP011038,PRJEB9889,The Zebrafish transcriptome during early development,ena-STUDY-KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION-15-07-2015-15:13:51:747-22,Other,Zebrafish has emerged as a model organism to investigate vertebrate development and human genetic diseases. However currently zebrafish annotation is still ongoing and clearly not sufficed therefore providing opportunity for novel transcript finding. With the introduction of massive parallel sequencing whole transcriptome investigations became possible through assembling entire transcriptome from overlapped sequencing reads. In the study we were aiming to discover novel transcribed regions NTRs using data from RNA sequencing. We have developed an in house bioinformatics pipeline for NTR discovery. Using the pipeline we detected 165 putative NTRs which could involve in early zebrafish development and not annotated anywhere. Six randomly selected NTRs were successfully validated experimentally using RT PCR. These NTRs provided new candidates for zebrafish transcriptome studies and zebrafish genome annotation.,,,,KI BN JKE DRERIO RNASEQ,SAMEA3484817,KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION,ENA first public:2015 07 16|ENA last update:2015 07 15|External Id:SAMEA3484817|INSDC center alias:KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION|INSDC center name:KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION|INSDC first public:2015 07 16T15:54:30Z|INSDC last update:2015 07 15T15:02:15Z|INSDC status:public|Submitter Id:KI BN JKE DRERIO RNASEQ 2009 16cell|common name:zebrafish|dev stage:16 cell|sample name:KI BN JKE DRERIO RNASEQ 2009 16cell|strain:Tuebingen,,,,,,,,,AB SOLiD System 3.0 sequencing,ena EXPERIMENT KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION 15 07 2015 15:13:47:872 6,unspecified,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ABI_SOLID,AB SOLiD System 3.0,,ERP011038,AB SOLiD System 3.0 sequencing,ENA FIRST PUBLIC:2015 07 16|ENA LAST UPDATE:2018 11 16,KI-BN-JKE-DRERIO-RNASEQ-20091014-16cell_F3.csfasta.gz KI-BN-JKE-DRERIO-RNASEQ-20091014-16cell_F3_QV.qual.gz,SOLiD_native SOLiD_native,2719433200.0,54388664.0,ena RUN KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION 15 07 2015 15:13:47:872 6,0:50,0:699731678;1:628745158;2:754903505;3:633574679;.:2478180,50,,,,,,,,,ERX1041635,ERS792102,ERA458495,KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION|European Nucleotide Archive,KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION,1,0.73214,,0.09566,,0.90836,,0.74043,,50,,B,,usable mapping rate,legacy,early,full_length,random_priming,unknown,bulk,unknown,unknown,,Sweden,2015-07-15,Cleavage,Embryo,Undetermined,Embryo Imprecise
28935,SRR26845669,SRX22541151,SRS19550737,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 2hour wt 75mM s4u r2,GSM7903257,,tissue:Embryos at 2 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 2hour wt 75mM s4u r2,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 2 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:2 hpf of [AB TU]x[TL TLF],GSM7903257,GSM7903257: zebrafish 2hour wt 75mM s4u r2; Danio rerio; RNA Seq,GSM7903257 r1,GSM7903257,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s2h_2.fastq.gz,fastq,4440596805.0,43966305.0,GSM7903257 r1,0:101,A:1543708731;C:806593065;G:905733733;T:1182095254;N:2466022,101,,,,1543708731,806593065,905733733,1182095254,2466022,SRX22541151,SRS19550737,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.63778,,0.15677,,0.82676,,0.61166,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Cleavage,Embryo,Embryo Imprecise,All anatomical structures
28936,SRR26845670,SRX22541150,SRS19550735,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 2hour wt 75mM s4u r1,GSM7903256,,tissue:Embryos at 2 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 2hour wt 75mM s4u r1,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 2 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:2 hpf of [AB TU]x[TL TLF],GSM7903256,GSM7903256: zebrafish 2hour wt 75mM s4u r1; Danio rerio; RNA Seq,GSM7903256 r1,GSM7903256,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s2h_1.fastq.gz,fastq,4689849655.0,46434155.0,GSM7903256 r1,0:101,A:1611038201;C:846984275;G:953714532;T:1275424861;N:2687786,101,,,,1611038201,846984275,953714532,1275424861,2687786,SRX22541150,SRS19550735,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.67301,,0.15612,,0.82171,,0.63462,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Cleavage,Embryo,Embryo Imprecise,All anatomical structures
28937,SRR26845671,SRX22541149,SRS19550733,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 1hour wt 75mM s4u r3,GSM7903255,,tissue:Embryos at 1 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 1hour wt 75mM s4u r3,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 1 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:1 hpf of [AB TU]x[TL TLF],GSM7903255,GSM7903255: zebrafish 1hour wt 75mM s4u r3; Danio rerio; RNA Seq,GSM7903255 r1,GSM7903255,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s1h_3.fastq.gz,fastq,5540992108.0,54861308.0,GSM7903255 r1,0:101,A:1856189531;C:1011042624;G:1124613529;T:1546055477;N:3090947,101,,,,1856189531,1011042624,1124613529,1546055477,3090947,SRX22541149,SRS19550733,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.72187,,0.16436,,0.82416,,0.64431,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Cleavage,Embryo,Embryo Imprecise,All anatomical structures
28938,SRR26845672,SRX22541148,SRS19550734,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 1hour wt 75mM s4u r2,GSM7903254,,tissue:Embryos at 1 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 1hour wt 75mM s4u r2,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 1 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:1 hpf of [AB TU]x[TL TLF],GSM7903254,GSM7903254: zebrafish 1hour wt 75mM s4u r2; Danio rerio; RNA Seq,GSM7903254 r1,GSM7903254,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s1h_2.fastq.gz,fastq,4572239397.0,45269697.0,GSM7903254 r1,0:101,A:1530268631;C:831534079;G:915378596;T:1292534173;N:2523918,101,,,,1530268631,831534079,915378596,1292534173,2523918,SRX22541148,SRS19550734,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.72394,,0.15187,,0.81753,,0.63236,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Cleavage,Embryo,Embryo Imprecise,All anatomical structures
28939,SRR26845673,SRX22541147,SRS19550732,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 1hour wt 75mM s4u r1,GSM7903253,,tissue:Embryos at 1 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 1hour wt 75mM s4u r1,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 1 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:1 hpf of [AB TU]x[TL TLF],GSM7903253,GSM7903253: zebrafish 1hour wt 75mM s4u r1; Danio rerio; RNA Seq,GSM7903253 r1,GSM7903253,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s1h_1.fastq.gz,fastq,4271986597.0,42296897.0,GSM7903253 r1,0:101,A:1447221671;C:787487923;G:887526673;T:1147409594;N:2340736,101,,,,1447221671,787487923,887526673,1147409594,2340736,SRX22541147,SRS19550732,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.68805,,0.18469,,0.83175,,0.62945,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Cleavage,Embryo,Embryo Imprecise,All anatomical structures
30769,SRR28348935,SRX23954961,SRS20755382,SRP495323,PRJNA1088158,Protein profiling of zebrafish embryos unmasks regulatory layers during early embryogenesis.,GSE261646,Transcriptome Analysis,The maternal to zygotic transition is crucial in embryonic development marked by the degradation of maternally provided mRNAs and initiation of zygotic gene expression. However the changes occurring at the protein level during this transition remain unclear. Here we conducted protein profiling throughout zebrafish embryogenesis using quantitative mass spectrometry integrating transcriptomics and translatomics datasets. Our data shows that unlike RNA changes protein changes are less dynamic. Further increases in protein levels correlate with mRNA translation whereas declines in protein levels do not suggesting active protein degradation processes. Interestingly proteins from pure zygotic genes are present at fertilization challenging existing mRNA based gene classifications. As a proof of concept we utilized CRISPR Cas13d to target znf281b mRNA a gene whose protein significantly accumulates within the first two hpf demonstrating its crucial role in development. Consequently our protein profiling coupled with CRISPR Cas13d offers a new approach to unravel maternal mRNAs function during embryonic development. Overall design: Two biological replicate samples containing 50 zebrafish oocytes per stage were collected by pairing females in natural matings to ''purge'' mature eggs and used to establish an oogenesis time line. Fish were euthanized and ovaries harvested within 1–11 days post purging dpp. Stage I and II oocytes were collected at 1–2 dpp stage III oocytes germinal vesicle in central position at 4–7 dpp and stage IV oocytes germinal vesicle asymmetrically located at 8–10 dpp. Oocyte isolations were based on73 and conducted in isolation medium Leibovitz L 15 Sigma Aldrich #L5520 plus Collagenase I and II depending on the stages as follows. Stages I and II were isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130 and 3 mg/mL Collagenase II Gibco 17101015. Stage III was isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130. Stage IV was isolated by mechanical stripping with forceps and needle without xxx use of Collagenases. Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. Three biological replicate samples containing 20 dechorionated zebrafish embryos were snap frozen in TRIzol Invitrogen #15596026. Four time points of embryonic development were included: 1 cell stage 0 hpf hpf 2 hpf 4 hpf and 6 hpf. RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols.,,pubmed:39302832,,Zebrafish Embryo 2hpf rep3,GSM8147858,,source name:Whole embryo|tissue:Whole embryo|developmental stage:2hpf|genotype:AB TF and TLF|geo loc name:missing|collection date:missing,Zebrafish Embryo 2hpf rep3,Raw reads from zebrafish oocytes stages I IV and embryos 0 2 4 and 6 hpf were demultiplexed into FASTQ format allowing up to one mismatch using Illumina bcl convert 3.10.5. Reads were aligned to UCSC genome danRer11 with STAR aligner version 2.7.3a using Ensembl 106 gene models. Counts were converted to TPM values using RSEM version v1.3.0 and all subsequent analysis was done using TPM. Assembly: danRer11 Ensembl 106 gene models Supplementary files format and content: comma separated files with TPMs from all replicates,Whole embryo,,Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer’s protocols. 0 2 4 and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer’s protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0 2 4 and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer’s directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598 and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled quantified and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer’s instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina Cat. No. 20020598 and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized pooled and sequenced on a NextSeq 500 instrument Illumina as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.,,tissue:Whole embryo|developmental stage:2hpf|genotype:AB TF and TLF,GSM8147858,GSM8147858: Zebrafish Embryo 2hpf rep3; Danio rerio; RNA Seq,GSM8147858 r1,GSM8147858,1,Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. 0 2 4 and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0 2 4 and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer's directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598 and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled quantified and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer's instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina Cat. No. 20020598 and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized pooled and sequenced on a NextSeq 500 instrument Illumina as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP495323,,,s_2hpf_3.fastq,fastq,1748504032.0,23006632.0,GSM8147858 r1,0:76,A:420580006;C:434589498;G:408972977;T:484281127;N:80424,76,,,,420580006,434589498,408972977,484281127,80424,SRX23954961,SRS20755382,SRA1824599,"Computational Biology, Stowers Institute for Medical Research","Computational Biology, Stowers Institute for Medical Research",,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,trueseq,bulk,bulk,bulk,,United States,2024-03-14,Cleavage,Embryo,Whole Organism,All anatomical structures
30770,SRR28348936,SRX23954960,SRS20755381,SRP495323,PRJNA1088158,Protein profiling of zebrafish embryos unmasks regulatory layers during early embryogenesis.,GSE261646,Transcriptome Analysis,The maternal to zygotic transition is crucial in embryonic development marked by the degradation of maternally provided mRNAs and initiation of zygotic gene expression. However the changes occurring at the protein level during this transition remain unclear. Here we conducted protein profiling throughout zebrafish embryogenesis using quantitative mass spectrometry integrating transcriptomics and translatomics datasets. Our data shows that unlike RNA changes protein changes are less dynamic. Further increases in protein levels correlate with mRNA translation whereas declines in protein levels do not suggesting active protein degradation processes. Interestingly proteins from pure zygotic genes are present at fertilization challenging existing mRNA based gene classifications. As a proof of concept we utilized CRISPR Cas13d to target znf281b mRNA a gene whose protein significantly accumulates within the first two hpf demonstrating its crucial role in development. Consequently our protein profiling coupled with CRISPR Cas13d offers a new approach to unravel maternal mRNAs function during embryonic development. Overall design: Two biological replicate samples containing 50 zebrafish oocytes per stage were collected by pairing females in natural matings to ''purge'' mature eggs and used to establish an oogenesis time line. Fish were euthanized and ovaries harvested within 1–11 days post purging dpp. Stage I and II oocytes were collected at 1–2 dpp stage III oocytes germinal vesicle in central position at 4–7 dpp and stage IV oocytes germinal vesicle asymmetrically located at 8–10 dpp. Oocyte isolations were based on73 and conducted in isolation medium Leibovitz L 15 Sigma Aldrich #L5520 plus Collagenase I and II depending on the stages as follows. Stages I and II were isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130 and 3 mg/mL Collagenase II Gibco 17101015. Stage III was isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130. Stage IV was isolated by mechanical stripping with forceps and needle without xxx use of Collagenases. Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. Three biological replicate samples containing 20 dechorionated zebrafish embryos were snap frozen in TRIzol Invitrogen #15596026. Four time points of embryonic development were included: 1 cell stage 0 hpf hpf 2 hpf 4 hpf and 6 hpf. RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols.,,pubmed:39302832,,Zebrafish Embryo 2hpf rep2,GSM8147857,,source name:Whole embryo|tissue:Whole embryo|developmental stage:2hpf|genotype:AB TF and TLF|geo loc name:missing|collection date:missing,Zebrafish Embryo 2hpf rep2,Raw reads from zebrafish oocytes stages I IV and embryos 0 2 4 and 6 hpf were demultiplexed into FASTQ format allowing up to one mismatch using Illumina bcl convert 3.10.5. Reads were aligned to UCSC genome danRer11 with STAR aligner version 2.7.3a using Ensembl 106 gene models. Counts were converted to TPM values using RSEM version v1.3.0 and all subsequent analysis was done using TPM. Assembly: danRer11 Ensembl 106 gene models Supplementary files format and content: comma separated files with TPMs from all replicates,Whole embryo,,Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer’s protocols. 0 2 4 and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer’s protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0 2 4 and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer’s directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598 and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled quantified and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer’s instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina Cat. No. 20020598 and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized pooled and sequenced on a NextSeq 500 instrument Illumina as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.,,tissue:Whole embryo|developmental stage:2hpf|genotype:AB TF and TLF,GSM8147857,GSM8147857: Zebrafish Embryo 2hpf rep2; Danio rerio; RNA Seq,GSM8147857 r1,GSM8147857,1,Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. 0 2 4 and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0 2 4 and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer's directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598 and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled quantified and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer's instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina Cat. No. 20020598 and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized pooled and sequenced on a NextSeq 500 instrument Illumina as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP495323,,,s_2hpf_2.fastq,fastq,1578919456.0,20775256.0,GSM8147857 r1,0:76,A:380440230;C:393721925;G:368114931;T:436571104;N:71266,76,,,,380440230,393721925,368114931,436571104,71266,SRX23954960,SRS20755381,SRA1824599,"Computational Biology, Stowers Institute for Medical Research","Computational Biology, Stowers Institute for Medical Research",,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,trueseq,bulk,bulk,bulk,,United States,2024-03-14,Cleavage,Embryo,Whole Organism,All anatomical structures
30771,SRR28348937,SRX23954959,SRS20755380,SRP495323,PRJNA1088158,Protein profiling of zebrafish embryos unmasks regulatory layers during early embryogenesis.,GSE261646,Transcriptome Analysis,The maternal to zygotic transition is crucial in embryonic development marked by the degradation of maternally provided mRNAs and initiation of zygotic gene expression. However the changes occurring at the protein level during this transition remain unclear. Here we conducted protein profiling throughout zebrafish embryogenesis using quantitative mass spectrometry integrating transcriptomics and translatomics datasets. Our data shows that unlike RNA changes protein changes are less dynamic. Further increases in protein levels correlate with mRNA translation whereas declines in protein levels do not suggesting active protein degradation processes. Interestingly proteins from pure zygotic genes are present at fertilization challenging existing mRNA based gene classifications. As a proof of concept we utilized CRISPR Cas13d to target znf281b mRNA a gene whose protein significantly accumulates within the first two hpf demonstrating its crucial role in development. Consequently our protein profiling coupled with CRISPR Cas13d offers a new approach to unravel maternal mRNAs function during embryonic development. Overall design: Two biological replicate samples containing 50 zebrafish oocytes per stage were collected by pairing females in natural matings to ''purge'' mature eggs and used to establish an oogenesis time line. Fish were euthanized and ovaries harvested within 1–11 days post purging dpp. Stage I and II oocytes were collected at 1–2 dpp stage III oocytes germinal vesicle in central position at 4–7 dpp and stage IV oocytes germinal vesicle asymmetrically located at 8–10 dpp. Oocyte isolations were based on73 and conducted in isolation medium Leibovitz L 15 Sigma Aldrich #L5520 plus Collagenase I and II depending on the stages as follows. Stages I and II were isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130 and 3 mg/mL Collagenase II Gibco 17101015. Stage III was isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130. Stage IV was isolated by mechanical stripping with forceps and needle without xxx use of Collagenases. Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. Three biological replicate samples containing 20 dechorionated zebrafish embryos were snap frozen in TRIzol Invitrogen #15596026. Four time points of embryonic development were included: 1 cell stage 0 hpf hpf 2 hpf 4 hpf and 6 hpf. RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols.,,pubmed:39302832,,Zebrafish Embryo 2hpf rep1,GSM8147856,,source name:Whole embryo|tissue:Whole embryo|developmental stage:2hpf|genotype:AB TF and TLF|geo loc name:missing|collection date:missing,Zebrafish Embryo 2hpf rep1,Raw reads from zebrafish oocytes stages I IV and embryos 0 2 4 and 6 hpf were demultiplexed into FASTQ format allowing up to one mismatch using Illumina bcl convert 3.10.5. Reads were aligned to UCSC genome danRer11 with STAR aligner version 2.7.3a using Ensembl 106 gene models. Counts were converted to TPM values using RSEM version v1.3.0 and all subsequent analysis was done using TPM. Assembly: danRer11 Ensembl 106 gene models Supplementary files format and content: comma separated files with TPMs from all replicates,Whole embryo,,Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer’s protocols. 0 2 4 and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer’s protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0 2 4 and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer’s directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598 and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled quantified and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer’s instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina Cat. No. 20020598 and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized pooled and sequenced on a NextSeq 500 instrument Illumina as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.,,tissue:Whole embryo|developmental stage:2hpf|genotype:AB TF and TLF,GSM8147856,GSM8147856: Zebrafish Embryo 2hpf rep1; Danio rerio; RNA Seq,GSM8147856 r1,GSM8147856,1,Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. 0 2 4 and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0 2 4 and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer's directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598 and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled quantified and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer's instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina Cat. No. 20020598 and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized pooled and sequenced on a NextSeq 500 instrument Illumina as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP495323,,,s_2hpf_1.fastq,fastq,1730435412.0,22768887.0,GSM8147856 r1,0:76,A:420026952;C:428388301;G:403718608;T:478219805;N:81746,76,,,,420026952,428388301,403718608,478219805,81746,SRX23954959,SRS20755380,SRA1824599,"Computational Biology, Stowers Institute for Medical Research","Computational Biology, Stowers Institute for Medical Research",,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,trueseq,bulk,bulk,bulk,,United States,2024-03-14,Cleavage,Embryo,Whole Organism,All anatomical structures
31528,SRR28423881,SRX24027916,SRS20821688,SRP497294,PRJNA1090898,The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst169,GSE262247,Transcriptome Analysis,The innate immune system is triggered xxx post injury and its spatiotemporal dynamics are critical for successful regeneration. MyD88 is a key component of the innate immune response; however its role during regeneration remains unclear. Here we show that MyD88 controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration. Our data reveal a significant reduction in pro inflammatory neutrophil and macrophage populations as well as the expansion of a collagen rich endocardial population in cryoinjured myd88 / ventricles. Consistent with these findings we observed increased myofibroblasts fibrin abundance and scarring in myd88 / ventricles. Transcriptomic analyses of endocardial cells and immunostaining experiments reveal compromised PI3K/AKT pathway activation in the myd88 / endocardium. Moreover loss of MyD88 impairs cardiomyocyte proliferation and protrusive activity towards the injured area. Notably endothelial specific overexpression of myd88 reverses the neutrophil fibrotic and scarring phenotypes in cryoinjured myd88 / ventricles. Mechanistically we identify the endocardial derived chemokine gene cxcl18b as a transcriptional target of the MyD88 signaling axis and using loss and gain of function tools show that it controls neutrophil recruitment. Altogether these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis thereby emphasizing the strong impact of the innate immune response during tissue regeneration. Overall design: Live zebrafish ventricular cells were isolated at 24 hour post cryoinjury hpci from myd88+/+ and myd88 / ventricles by Fluorescence activated cell sorting FACS and analyzed using scRNAseq.,parent bioproject:PRJNA1090894,pubmed:39271818,,ventricular cells myd88 / 24 hpci,GSM8161054,,source name:cardiac ventricles|tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88 / |treatment:cardiac cryoinjury|geo loc name:missing|collection date:missing,ventricular cells myd88 / 24 hpci,Raw reads were aligned against the zebrafish genome DanRer11 and counted by StarSolo Dobin et al. doi: 10.1093/bioinformatics/bts635 followed by secondary analysis in Annotated Data Format. Preprocessed counts were further analyzed using Scanpy Wolf et al. doi: 10.1186/s13059 017 1382 0. Basic cell quality control was conducted by taking the number of detected genes and mitochondrial content into consideration. We removed 32 cells in total that did not express more than 300 genes or had a mitochondrial content greater than 10%. Furthermore we filtered 7823 genes if they were detected in less than 30 cells <0.01%. Raw counts per cell were normalized to the median count over all cells and transformed into log space to stabilize variance We initially reduced dimensionality of the dataset using PCA retaining 50 principal components. Subsequent steps like low dimensional UMAP embedding McInnes & Healy https://arxiv.org/abs/1802.03426 and cell clustering via community detection Traag et al. https://arxiv.org/abs/1810.08473 were based on the initial PCA. Final data visualization was done by CellxGene package DOI 10.5281/zenodo.3235020. Assembly: DanRer11 Supplementary files format and content: starsolo outputs,cardiac ventricles,cardiac cryoinjury 24 hours prior to heart extraction,Ventricular cells were isolated from a pool of 4 myd88+/+ and 4 myd88 / ventricles for the myd88+/+ and myd88 / sample respectively. Cell isolation was performed with the Pierce Primary Cardiomyocyte Isolation Kit Thermo Fisher Scientific following the manufacturer’s instructions and with the following modifications: Incubation was performed at 30°C for 20 min followed by resuspension in 1× Hanks’ balanced salt solution Gibco with 0.25% BSA. Suspended cells were sorted using FACSAriaIII sorter BD to exclude dead cells using DAPI Sigma. Library preparation was conducted according to the manufacturer indications Chromium Next GEM Single Cell 3’ GEM Library & Gel Bead Kit v3.1 16 rxns PN 1000121.,,tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88 / |treatment:cardiac cryoinjury,GSM8161054,GSM8161054: ventricular cells myd88 / 24 hpci; Danio rerio; RNA Seq,GSM8161054 r1,GSM8161054,1,Ventricular cells were isolated from a pool of 4 myd88+/+ and 4 myd88 / ventricles for the myd88+/+ and myd88 / sample respectively. Cell isolation was performed with the Pierce Primary Cardiomyocyte Isolation Kit Thermo Fisher Scientific following the manufacturer's instructions and with the following modifications: Incubation was performed at 30°C for 20 min followed by resuspension in 1× Hanks' balanced salt solution Gibco with 0.25% BSA. Suspended cells were sorted using FACSAriaIII sorter BD to exclude dead cells using DAPI Sigma. Library preparation was conducted according to the manufacturer indications Chromium Next GEM Single Cell three prime GEM Library & Gel Bead Kit v3.1 16 rxns PN 1000121.,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,PAIRED,ILLUMINA,NextSeq 2000,,SRP497294,,,Pinelopi_10x_Zebrafish_Mut_Lib_R1.fastq.gz Pinelopi_10x_Zebrafish_Mut_Lib_R2.fastq.gz,fastq fastq,31356990530.0,394538049.0,GSM8161054 r1,0:28 1:51.48,A:8573180857;C:6884590114;G:7520784498;T:8220228225;N:158206836,28,51,,,8573180857,6884590114,7520784498,8220228225,158206836,SRX24027916,SRS20821688,SRA1832827,MPI for heart and lung research,MPI for heart and lung research,,,,,,,,,,,,T,B,sc-like readlen,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,sc,single_cell_droplet,10x,,Germany,2024-03-22,Cleavage,Embryo,Heart,Cardiovascular System
31529,SRR28423882,SRX24027915,SRS20821687,SRP497294,PRJNA1090898,The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst169,GSE262247,Transcriptome Analysis,The innate immune system is triggered xxx post injury and its spatiotemporal dynamics are critical for successful regeneration. MyD88 is a key component of the innate immune response; however its role during regeneration remains unclear. Here we show that MyD88 controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration. Our data reveal a significant reduction in pro inflammatory neutrophil and macrophage populations as well as the expansion of a collagen rich endocardial population in cryoinjured myd88 / ventricles. Consistent with these findings we observed increased myofibroblasts fibrin abundance and scarring in myd88 / ventricles. Transcriptomic analyses of endocardial cells and immunostaining experiments reveal compromised PI3K/AKT pathway activation in the myd88 / endocardium. Moreover loss of MyD88 impairs cardiomyocyte proliferation and protrusive activity towards the injured area. Notably endothelial specific overexpression of myd88 reverses the neutrophil fibrotic and scarring phenotypes in cryoinjured myd88 / ventricles. Mechanistically we identify the endocardial derived chemokine gene cxcl18b as a transcriptional target of the MyD88 signaling axis and using loss and gain of function tools show that it controls neutrophil recruitment. Altogether these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis thereby emphasizing the strong impact of the innate immune response during tissue regeneration. Overall design: Live zebrafish ventricular cells were isolated at 24 hour post cryoinjury hpci from myd88+/+ and myd88 / ventricles by Fluorescence activated cell sorting FACS and analyzed using scRNAseq.,parent bioproject:PRJNA1090894,pubmed:39271818,,ventricular cells myd88+/+ 24 hpci,GSM8161053,,source name:cardiac ventricles|tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88+/+|treatment:cardiac cryoinjury|geo loc name:missing|collection date:missing,ventricular cells myd88+/+ 24 hpci,Raw reads were aligned against the zebrafish genome DanRer11 and counted by StarSolo Dobin et al. doi: 10.1093/bioinformatics/bts635 followed by secondary analysis in Annotated Data Format. Preprocessed counts were further analyzed using Scanpy Wolf et al. doi: 10.1186/s13059 017 1382 0. Basic cell quality control was conducted by taking the number of detected genes and mitochondrial content into consideration. We removed 32 cells in total that did not express more than 300 genes or had a mitochondrial content greater than 10%. Furthermore we filtered 7823 genes if they were detected in less than 30 cells <0.01%. Raw counts per cell were normalized to the median count over all cells and transformed into log space to stabilize variance We initially reduced dimensionality of the dataset using PCA retaining 50 principal components. Subsequent steps like low dimensional UMAP embedding McInnes & Healy https://arxiv.org/abs/1802.03426 and cell clustering via community detection Traag et al. https://arxiv.org/abs/1810.08473 were based on the initial PCA. Final data visualization was done by CellxGene package DOI 10.5281/zenodo.3235020. Assembly: DanRer11 Supplementary files format and content: starsolo outputs,cardiac ventricles,cardiac cryoinjury 24 hours prior to heart extraction,Ventricular cells were isolated from a pool of 4 myd88+/+ and 4 myd88 / ventricles for the myd88+/+ and myd88 / sample respectively. Cell isolation was performed with the Pierce Primary Cardiomyocyte Isolation Kit Thermo Fisher Scientific following the manufacturer’s instructions and with the following modifications: Incubation was performed at 30°C for 20 min followed by resuspension in 1× Hanks’ balanced salt solution Gibco with 0.25% BSA. Suspended cells were sorted using FACSAriaIII sorter BD to exclude dead cells using DAPI Sigma. Library preparation was conducted according to the manufacturer indications Chromium Next GEM Single Cell 3’ GEM Library & Gel Bead Kit v3.1 16 rxns PN 1000121.,,tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88+/+|treatment:cardiac cryoinjury,GSM8161053,GSM8161053: ventricular cells myd88+/+ 24 hpci; Danio rerio; RNA Seq,GSM8161053 r1,GSM8161053,1,Ventricular cells were isolated from a pool of 4 myd88+/+ and 4 myd88 / ventricles for the myd88+/+ and myd88 / sample respectively. Cell isolation was performed with the Pierce Primary Cardiomyocyte Isolation Kit Thermo Fisher Scientific following the manufacturer's instructions and with the following modifications: Incubation was performed at 30°C for 20 min followed by resuspension in 1× Hanks' balanced salt solution Gibco with 0.25% BSA. Suspended cells were sorted using FACSAriaIII sorter BD to exclude dead cells using DAPI Sigma. Library preparation was conducted according to the manufacturer indications Chromium Next GEM Single Cell three prime GEM Library & Gel Bead Kit v3.1 16 rxns PN 1000121.,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,PAIRED,ILLUMINA,NextSeq 2000,,SRP497294,,,Pinelopi_10x_Zebrafish_WT_Lib_R1.fastq.gz Pinelopi_10x_Zebrafish_WT_Lib_R2.fastq.gz,fastq fastq,40672259373.0,511650018.0,GSM8161053 r1,0:28 1:51.49,A:11079272327;C:8809520398;G:9307205642;T:11269370263;N:206890743,28,51,,,11079272327,8809520398,9307205642,11269370263,206890743,SRX24027915,SRS20821687,SRA1832827,MPI for heart and lung research,MPI for heart and lung research,,,,,,,,,,,,T,B,sc-like readlen,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,sc,single_cell_droplet,10x,,Germany,2024-03-22,Cleavage,Embryo,Heart,Cardiovascular System
34036,SRR31033345,SRX26418807,SRS22938440,SRP539223,PRJNA1174207,Rbm24 dictates mRNA recruitment for germ plasm assembly,GSE279756,Transcriptome Analysis,Ribonucleoprotein RNP granules are the most common membrane less biomolecular condensates. However the mechanisms underlying their assembly are largely unknown. The aggregation of germ plasm determines the fate of primordial germ cells PGCs and serves as a model for RNP granule assembly. Here we show that maternal RNA binding protein Rbm24a is the key factor governing specific sorting of mRNAs. Mechanistically Rbm24a complexes with Buc and interacts to dictate the specific grasp of germ plasm mRNAs into phase separated condensates. Germ plasm particles lacking Rbm24a and mRNAs fail to undergo kinesin dependent transport towards the cleavage furrows where small granules fuse into large aggregates. Therefore the loss of maternal Rbm24a causes a complete degradation of germ plasm and the disappearance of PGCs. These findings demonstrate that Rbm24a functions as a nucleating organizer of the germ plasm highlighting an emerging mechanism for RNA binding proteins in reading and recruiting RNA components into the phase separated protein scaffold. Overall design: To examine the global transcriptome alterations following the loss of maternal Rbm24a we conducted bulk RNA seq analysis on Mrbm24a and their sibling embyos at 4 cell sphere stage and 24 hpf.,,,,Zebrafish Riboseq M 4cell 5,GSM8579730,,source name:whole embryo|tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:Mrbm24a|geo loc name:missing|collection date:missing,Zebrafish Riboseq M 4cell 5,Each library was amplified by a 11 cycle PCR and 150 bp paired end sequencing was subjected to Illumina HiSeq 2000 to obtain the raw data. Assembly: GRCz10 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text file includes FPKM values for each Sample,whole embryo,,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions.,Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C,tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:Mrbm24a,GSM8579730,GSM8579730: Zebrafish Riboseq M 4cell 5; Danio rerio; RNA Seq,GSM8579730 r1,GSM8579730,1,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,SRP539223,,,M-4cell-5_L1_1.fq.gz M-4cell-5_L1_2.fq.gz,fastq fastq,5643278100.0,18810927.0,GSM8579730 r1,0:150 1:150,A:1555401034;C:1268722567;G:1323837426;T:1495279385;N:37688,150,150,,,1555401034,1268722567,1323837426,1495279385,37688,SRX26418807,SRS22938440,SRA1993092,Shandong university,Shandong university,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,unknown,bulk,bulk,bulk,,China,2024-10-17,Cleavage,Embryo,Whole Organism,All anatomical structures
34037,SRR31033351,SRX26418806,SRS22938443,SRP539223,PRJNA1174207,Rbm24 dictates mRNA recruitment for germ plasm assembly,GSE279756,Transcriptome Analysis,Ribonucleoprotein RNP granules are the most common membrane less biomolecular condensates. However the mechanisms underlying their assembly are largely unknown. The aggregation of germ plasm determines the fate of primordial germ cells PGCs and serves as a model for RNP granule assembly. Here we show that maternal RNA binding protein Rbm24a is the key factor governing specific sorting of mRNAs. Mechanistically Rbm24a complexes with Buc and interacts to dictate the specific grasp of germ plasm mRNAs into phase separated condensates. Germ plasm particles lacking Rbm24a and mRNAs fail to undergo kinesin dependent transport towards the cleavage furrows where small granules fuse into large aggregates. Therefore the loss of maternal Rbm24a causes a complete degradation of germ plasm and the disappearance of PGCs. These findings demonstrate that Rbm24a functions as a nucleating organizer of the germ plasm highlighting an emerging mechanism for RNA binding proteins in reading and recruiting RNA components into the phase separated protein scaffold. Overall design: To examine the global transcriptome alterations following the loss of maternal Rbm24a we conducted bulk RNA seq analysis on Mrbm24a and their sibling embyos at 4 cell sphere stage and 24 hpf.,,,,Zebrafish Riboseq M 4cell 4,GSM8579729,,source name:whole embryo|tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:Mrbm24a|geo loc name:missing|collection date:missing,Zebrafish Riboseq M 4cell 4,Each library was amplified by a 11 cycle PCR and 150 bp paired end sequencing was subjected to Illumina HiSeq 2000 to obtain the raw data. Assembly: GRCz10 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text file includes FPKM values for each Sample,whole embryo,,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions.,Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C,tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:Mrbm24a,GSM8579729,GSM8579729: Zebrafish Riboseq M 4cell 4; Danio rerio; RNA Seq,GSM8579729 r1,GSM8579729,1,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,SRP539223,,,M-4cell-4_L1_1.fq.gz M-4cell-4_L1_2.fq.gz,fastq fastq,6607232100.0,22024107.0,GSM8579729 r1,0:150 1:150,A:1825603885;C:1480833466;G:1538474482;T:1762276005;N:44262,150,150,,,1825603885,1480833466,1538474482,1762276005,44262,SRX26418806,SRS22938443,SRA1993092,Shandong university,Shandong university,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,unknown,bulk,bulk,bulk,,China,2024-10-17,Cleavage,Embryo,Whole Organism,All anatomical structures
34038,SRR31033346,SRX26418805,SRS22938438,SRP539223,PRJNA1174207,Rbm24 dictates mRNA recruitment for germ plasm assembly,GSE279756,Transcriptome Analysis,Ribonucleoprotein RNP granules are the most common membrane less biomolecular condensates. However the mechanisms underlying their assembly are largely unknown. The aggregation of germ plasm determines the fate of primordial germ cells PGCs and serves as a model for RNP granule assembly. Here we show that maternal RNA binding protein Rbm24a is the key factor governing specific sorting of mRNAs. Mechanistically Rbm24a complexes with Buc and interacts to dictate the specific grasp of germ plasm mRNAs into phase separated condensates. Germ plasm particles lacking Rbm24a and mRNAs fail to undergo kinesin dependent transport towards the cleavage furrows where small granules fuse into large aggregates. Therefore the loss of maternal Rbm24a causes a complete degradation of germ plasm and the disappearance of PGCs. These findings demonstrate that Rbm24a functions as a nucleating organizer of the germ plasm highlighting an emerging mechanism for RNA binding proteins in reading and recruiting RNA components into the phase separated protein scaffold. Overall design: To examine the global transcriptome alterations following the loss of maternal Rbm24a we conducted bulk RNA seq analysis on Mrbm24a and their sibling embyos at 4 cell sphere stage and 24 hpf.,,,,Zebrafish Riboseq M 4cell 3,GSM8579728,,source name:whole embryo|tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:Mrbm24a|geo loc name:missing|collection date:missing,Zebrafish Riboseq M 4cell 3,Each library was amplified by a 11 cycle PCR and 150 bp paired end sequencing was subjected to Illumina HiSeq 2000 to obtain the raw data. Assembly: GRCz10 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text file includes FPKM values for each Sample,whole embryo,,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions.,Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C,tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:Mrbm24a,GSM8579728,GSM8579728: Zebrafish Riboseq M 4cell 3; Danio rerio; RNA Seq,GSM8579728 r1,GSM8579728,1,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,SRP539223,,,M-4cell-3_L1_1.fq.gz M-4cell-3_L1_2.fq.gz,fastq fastq,7948794900.0,26495983.0,GSM8579728 r1,0:150 1:150,A:2183592013;C:1794605656;G:1863773539;T:2106770087;N:53605,150,150,,,2183592013,1794605656,1863773539,2106770087,53605,SRX26418805,SRS22938438,SRA1993092,Shandong university,Shandong university,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,unknown,bulk,bulk,bulk,,China,2024-10-17,Cleavage,Embryo,Whole Organism,All anatomical structures
34039,SRR31033350,SRX26418804,SRS22938441,SRP539223,PRJNA1174207,Rbm24 dictates mRNA recruitment for germ plasm assembly,GSE279756,Transcriptome Analysis,Ribonucleoprotein RNP granules are the most common membrane less biomolecular condensates. However the mechanisms underlying their assembly are largely unknown. The aggregation of germ plasm determines the fate of primordial germ cells PGCs and serves as a model for RNP granule assembly. Here we show that maternal RNA binding protein Rbm24a is the key factor governing specific sorting of mRNAs. Mechanistically Rbm24a complexes with Buc and interacts to dictate the specific grasp of germ plasm mRNAs into phase separated condensates. Germ plasm particles lacking Rbm24a and mRNAs fail to undergo kinesin dependent transport towards the cleavage furrows where small granules fuse into large aggregates. Therefore the loss of maternal Rbm24a causes a complete degradation of germ plasm and the disappearance of PGCs. These findings demonstrate that Rbm24a functions as a nucleating organizer of the germ plasm highlighting an emerging mechanism for RNA binding proteins in reading and recruiting RNA components into the phase separated protein scaffold. Overall design: To examine the global transcriptome alterations following the loss of maternal Rbm24a we conducted bulk RNA seq analysis on Mrbm24a and their sibling embyos at 4 cell sphere stage and 24 hpf.,,,,Zebrafish Riboseq M 4cell 2,GSM8579727,,source name:whole embryo|tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:Mrbm24a|geo loc name:missing|collection date:missing,Zebrafish Riboseq M 4cell 2,Each library was amplified by a 11 cycle PCR and 150 bp paired end sequencing was subjected to Illumina HiSeq 2000 to obtain the raw data. Assembly: GRCz10 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text file includes FPKM values for each Sample,whole embryo,,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions.,Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C,tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:Mrbm24a,GSM8579727,GSM8579727: Zebrafish Riboseq M 4cell 2; Danio rerio; RNA Seq,GSM8579727 r1,GSM8579727,1,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,SRP539223,,,M-4cell-2_L1_1.fq.gz M-4cell-2_L1_2.fq.gz,fastq fastq,7036510200.0,23455034.0,GSM8579727 r1,0:150 1:150,A:1830698676;C:1686461802;G:1754202163;T:1765099649;N:47910,150,150,,,1830698676,1686461802,1754202163,1765099649,47910,SRX26418804,SRS22938441,SRA1993092,Shandong university,Shandong university,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,unknown,bulk,bulk,bulk,,China,2024-10-17,Cleavage,Embryo,Whole Organism,All anatomical structures
34047,SRR31033355,SRX26418796,SRS22938428,SRP539223,PRJNA1174207,Rbm24 dictates mRNA recruitment for germ plasm assembly,GSE279756,Transcriptome Analysis,Ribonucleoprotein RNP granules are the most common membrane less biomolecular condensates. However the mechanisms underlying their assembly are largely unknown. The aggregation of germ plasm determines the fate of primordial germ cells PGCs and serves as a model for RNP granule assembly. Here we show that maternal RNA binding protein Rbm24a is the key factor governing specific sorting of mRNAs. Mechanistically Rbm24a complexes with Buc and interacts to dictate the specific grasp of germ plasm mRNAs into phase separated condensates. Germ plasm particles lacking Rbm24a and mRNAs fail to undergo kinesin dependent transport towards the cleavage furrows where small granules fuse into large aggregates. Therefore the loss of maternal Rbm24a causes a complete degradation of germ plasm and the disappearance of PGCs. These findings demonstrate that Rbm24a functions as a nucleating organizer of the germ plasm highlighting an emerging mechanism for RNA binding proteins in reading and recruiting RNA components into the phase separated protein scaffold. Overall design: To examine the global transcriptome alterations following the loss of maternal Rbm24a we conducted bulk RNA seq analysis on Mrbm24a and their sibling embyos at 4 cell sphere stage and 24 hpf.,,,,Zebrafish RNAseq Sibling 4cell 4,GSM8579719,,source name:whole embryo|tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:wild type|geo loc name:missing|collection date:missing,Zebrafish RNAseq Sibling 4cell 4,Each library was amplified by a 11 cycle PCR and 150 bp paired end sequencing was subjected to Illumina HiSeq 2000 to obtain the raw data. Assembly: GRCz10 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text file includes FPKM values for each Sample,whole embryo,,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions.,Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C,tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:wild type,GSM8579719,GSM8579719: Zebrafish RNAseq Sibling 4cell 4; Danio rerio; RNA Seq,GSM8579719 r1,GSM8579719,1,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,SRP539223,,,Sibling-4cell-4_L1_1.fq.gz Sibling-4cell-4_L1_2.fq.gz,fastq fastq,7424662500.0,24748875.0,GSM8579719 r1,0:150 1:150,A:2045351766;C:1671617139;G:1731338149;T:1976305596;N:49850,150,150,,,2045351766,1671617139,1731338149,1976305596,49850,SRX26418796,SRS22938428,SRA1993092,Shandong university,Shandong university,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,unknown,bulk,bulk,bulk,,China,2024-10-17,Cleavage,Embryo,Whole Organism,All anatomical structures
34048,SRR31033358,SRX26418795,SRS22938431,SRP539223,PRJNA1174207,Rbm24 dictates mRNA recruitment for germ plasm assembly,GSE279756,Transcriptome Analysis,Ribonucleoprotein RNP granules are the most common membrane less biomolecular condensates. However the mechanisms underlying their assembly are largely unknown. The aggregation of germ plasm determines the fate of primordial germ cells PGCs and serves as a model for RNP granule assembly. Here we show that maternal RNA binding protein Rbm24a is the key factor governing specific sorting of mRNAs. Mechanistically Rbm24a complexes with Buc and interacts to dictate the specific grasp of germ plasm mRNAs into phase separated condensates. Germ plasm particles lacking Rbm24a and mRNAs fail to undergo kinesin dependent transport towards the cleavage furrows where small granules fuse into large aggregates. Therefore the loss of maternal Rbm24a causes a complete degradation of germ plasm and the disappearance of PGCs. These findings demonstrate that Rbm24a functions as a nucleating organizer of the germ plasm highlighting an emerging mechanism for RNA binding proteins in reading and recruiting RNA components into the phase separated protein scaffold. Overall design: To examine the global transcriptome alterations following the loss of maternal Rbm24a we conducted bulk RNA seq analysis on Mrbm24a and their sibling embyos at 4 cell sphere stage and 24 hpf.,,,,Zebrafish RNAseq Sibling 4cell 2,GSM8579718,,source name:whole embryo|tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:wild type|geo loc name:missing|collection date:missing,Zebrafish RNAseq Sibling 4cell 2,Each library was amplified by a 11 cycle PCR and 150 bp paired end sequencing was subjected to Illumina HiSeq 2000 to obtain the raw data. Assembly: GRCz10 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text file includes FPKM values for each Sample,whole embryo,,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions.,Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C,tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:wild type,GSM8579718,GSM8579718: Zebrafish RNAseq Sibling 4cell 2; Danio rerio; RNA Seq,GSM8579718 r1,GSM8579718,1,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,SRP539223,,,Sibling-4cell-2_L1_1.fq.gz Sibling-4cell-2_L1_2.fq.gz,fastq fastq,6484454400.0,21614848.0,GSM8579718 r1,0:150 1:150,A:1701212104;C:1544478776;G:1597991536;T:1640728663;N:43321,150,150,,,1701212104,1544478776,1597991536,1640728663,43321,SRX26418795,SRS22938431,SRA1993092,Shandong university,Shandong university,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,unknown,bulk,bulk,bulk,,China,2024-10-17,Cleavage,Embryo,Whole Organism,All anatomical structures
34049,SRR31033356,SRX26418794,SRS22938430,SRP539223,PRJNA1174207,Rbm24 dictates mRNA recruitment for germ plasm assembly,GSE279756,Transcriptome Analysis,Ribonucleoprotein RNP granules are the most common membrane less biomolecular condensates. However the mechanisms underlying their assembly are largely unknown. The aggregation of germ plasm determines the fate of primordial germ cells PGCs and serves as a model for RNP granule assembly. Here we show that maternal RNA binding protein Rbm24a is the key factor governing specific sorting of mRNAs. Mechanistically Rbm24a complexes with Buc and interacts to dictate the specific grasp of germ plasm mRNAs into phase separated condensates. Germ plasm particles lacking Rbm24a and mRNAs fail to undergo kinesin dependent transport towards the cleavage furrows where small granules fuse into large aggregates. Therefore the loss of maternal Rbm24a causes a complete degradation of germ plasm and the disappearance of PGCs. These findings demonstrate that Rbm24a functions as a nucleating organizer of the germ plasm highlighting an emerging mechanism for RNA binding proteins in reading and recruiting RNA components into the phase separated protein scaffold. Overall design: To examine the global transcriptome alterations following the loss of maternal Rbm24a we conducted bulk RNA seq analysis on Mrbm24a and their sibling embyos at 4 cell sphere stage and 24 hpf.,,,,Zebrafish RNAseq Sibling 4cell 1,GSM8579717,,source name:whole embryo|tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:wild type|geo loc name:missing|collection date:missing,Zebrafish RNAseq Sibling 4cell 1,Each library was amplified by a 11 cycle PCR and 150 bp paired end sequencing was subjected to Illumina HiSeq 2000 to obtain the raw data. Assembly: GRCz10 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text file includes FPKM values for each Sample,whole embryo,,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions.,Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C,tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:wild type,GSM8579717,GSM8579717: Zebrafish RNAseq Sibling 4cell 1; Danio rerio; RNA Seq,GSM8579717 r1,GSM8579717,1,Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,SRP539223,,,Sibling-4cell-1_L1_1.fq.gz Sibling-4cell-1_L1_2.fq.gz,fastq fastq,8126999700.0,27089999.0,GSM8579717 r1,0:150 1:150,A:2195769442;C:1872416059;G:1934390760;T:2124367874;N:55565,150,150,,,2195769442,1872416059,1934390760,2124367874,55565,SRX26418794,SRS22938430,SRA1993092,Shandong university,Shandong university,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,unknown,bulk,bulk,bulk,,China,2024-10-17,Cleavage,Embryo,Whole Organism,All anatomical structures
36258,SRR062659,SRX025027,SRS085806,SRP003165,PRJNA127881,High throughput sequencing of mRNA from oocyte 1 cell 16/32 cells 128/256 cells 3.5hpf and 5.3hpf zebrafish embryos Wild type; AB line,GSE22830,Transcriptome Analysis,mRNA seq based approach to determine the transcriptome dynamics during early development To study the mechanisms regulating this developmental event in zebrafish we applied RNA deep sequencing technology and generated comprehensive transcriptome profiles of 6 developmental stages from oocyte to early gastrulation. We determined the expression levels of maternal and zygotic transcripts and clustered them based on expression pattern. We identified a large number of novel transcribed regions in un annotated regions of the genome as well as splice variants with an estimated frequency of 40 75% during early zebrafish embryogenesis. Our data constitute a useful resource for developmental studies gene discovery and genome annotation. Overall design: RNA was extracted from pooled embryos of desired stages and one RNA seq library was generated for each sample. Totally 6 stages were selected: Maternal 1cell 16/32 cells 128/256 cells 3.5hpf and 5.3hpf,,pubmed:21555364;pubmed:24586560;pubmed:23676078,,16/32 cells,GSM564429,,tissue:developing embryos|background:AB; wild type|developmental stage:mixure of 16/32 cell embryos,16/32 cells,ABI pipeline BioScope v1.0.1 Data analysis: The SOLiD generated RNA Seq reads was in 50bp length and an initial filtering process was taken to remove any non desirable contamination sequences such as rRNA tRNA and repeats etc. A seed and extension mapping approach was developed to map the 50bp reads into reference genome zv7 and also into the respective zv7 refGene annotation separately. During mapping of the reads to the refGene annotation a splice junction database fasta file is generated to which the reads are mapped to. This database contains known and putative junction sequences created by taking 46bp from the joining ends of adjacent and non adjacent exons for each gene and putting them together simulating the genomic sequences of known and putative junctions respectively. The first 25bp of the 50bp read was used as the seed for alignment for each read. When an alignment cannot be found using these 25bp seed the seed window is shifted and the next 25bp seed is taken from the 21st to the 45th base of the read. An extension step follows when the seed is able to map and a score generated for each extended base to determine best alignment. A merging step is performed on the genome mapping and splice junction mapping to determine a set of alignments for each read from which a unique alignment is found based on the score generated for these alignments. Mapping parameters: Mapping was done using Applied Biosystems’ SOLiD BioScope alignment for whole transcriptome analysis pipeline. Two mismatches were allowed in the 25bp color space seed sequence with extension alignment performed to find the full mapping location. A score is computed for each mapping location and any location that scored <22 were filtered. Generation of gff and bedgraph files: GFF files were produced by parsing the output BAM format and extracted for unique alignments with score >22. The bedgraph files are then produced with the resulting gff file.,developing embryos,Embryos were frozen at the desired developmental stages and RNAs was extracted for sequencing.,mRNA seq was performed by Mission Biotech Taiwan. SOLiD sequencing libraries were prepared using the Whole Transcriptome Library Preparation for SOLiD™ Sequencing kit ABI according to manufacturer’s instructions. About 200 280 µg of total RNAs were used as starting materials which were subjected to polyA selection using Applied Biosystems PolyA Purist Kit AM1916 fragmentation and library construction using distinct adapters for each library SOLiD Barcoding. From each library equal volumes were pooled together and sequenced in SOLiD3 ABI platform generating 50bp tags.,Zebrafish embryos AB background collected just post fertilization were reared and harvested at desired time points. Unfertilized oocytes were collected by squeezing the abdomen of spawning females. Harvested embryos were snap frozen in liquid nitrogen and stored in −80°C. Total RNA was extracted from whole embryos using Trizol Invitrogen according to manufacturer’s instructions. RNA concentrations were determined using NanoDrop 2000 Thermo Scientific. Integrity of RNA samples were determined using Agilent RNA 6000 Nano chip and size separated using Agilent 2100 Bioanalyzer. Total RNA obtained per 100 embryos at each developmental stage was calculated for data normalization purposes.,background:AB; wild type|developmental stage:mixure of 16/32 cell embryos,GSM564429,GSM564429: 16/32 cells,GSM564429: 16/32 cells,GSM564429: 16/32 cells,1,,GEO Accession:GSM564429,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ABI_SOLID,AB SOLiD System 3.0,0Application ReadForward1,SRP003165,,,,,1792238300.0,35844766.0,GSM564429 1,0:50,,50,,,,,,,,,SRX025027,SRS085806,SRA022850,GEO,"Computational and Systems Biology, Genome Institute of Singapore",1,0.6993,,0.04019,,0.83763,,0.50284,,50,,B,,usable mapping rate,legacy,early,full_length,poly_a,unknown,bulk,unknown,unknown,,Singapore,2010-07-08,Cleavage,Embryo,Embryo Imprecise,All anatomical structures
36297,SRR393000,SRX113357,SRS284301,SRP010040,PRJNA150397,Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay,GSE34743,Transcriptome Analysis,MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos,,pubmed:22422859,,Ribosome protected fragments Wild type 2hpf 2,GSM854439,,source name:Whole embryo wild type|sample type:ribosome protected fragments|tissue:whole embryo|genotype:wild type|development stage:2hpf,Ribosome protected fragments Wild type 2hpf 2,Ribo Wt 2 B.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence,Whole embryo wild type,,Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PCR was carried out with an initial 30s denaturation at 98degC followed by 4 cycles of 30s denaturation at 98degC and 15s extension at 72degC followed by 10 15 cycles of 10s denaturation at 98degC 30s annealing at 50degC and 15s extension at 72degC. Reactions were separated on a non denaturing 8% polyacrylamide TBE gel and correct sized DNA fragments were sequenced using Illumina HiSeq2000. In parallel RNA input from 20 embryos was extracted using Trizol then polyA selected using biotinylated oligodT40 at room temperature and eluted. Samples were then alkaline fragmented for 20min at 95degC using 2 mM EDTA; 10 mM Na2CO3; 90 mM NaHCO3 pH 9.3; then neutralized with 560ul of ice cold NaOAc 300mM pH 5.5 and RNA precipitated with isopropanol. Small RNA sequencing libraries were constructed as above selecting for fragments in the 30 50 nt range.,,sample type:ribosome protected fragments|tissue:whole embryo|genotype:wild type|developmental stage:2hpf,GSM854439,GSM854439: Ribosome protected fragments Wild type 2hpf 2; Danio rerio; RNA Seq,GSM854439 1,GSM854439: Ribosome protected fragments Wild type 2hpf 2,1,,GEO Accession:GSM854439,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina Genome Analyzer II,720Application ReadForward1,SRP010040,,,Ribo_Wt_2_B1.fq,fastq,217015848.0,3014109.0,GSM854439 r1,0:72,A:73500339;C:46583724;G:47804114;T:49117423;N:10248,72,,,,73500339,46583724,47804114,49117423,10248,SRX113357,SRS284301,SRA048903,GEO,"Giraldez Lab, Genetics, Yale University",1,2e-05,,0.0,,0.99997,,1.0,,72,,T,,under 1.2% mapping rate,illumina,early_illumina,unknown,poly_a,unknown,bulk,unknown,unknown,,United States,2011-12-27,Cleavage,Embryo,Whole Organism,All anatomical structures
36298,SRR393001,SRX113357,SRS284301,SRP010040,PRJNA150397,Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay,GSE34743,Transcriptome Analysis,MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos,,pubmed:22422859,,Ribosome protected fragments Wild type 2hpf 2,GSM854439,,source name:Whole embryo wild type|sample type:ribosome protected fragments|tissue:whole embryo|genotype:wild type|development stage:2hpf,Ribosome protected fragments Wild type 2hpf 2,Ribo Wt 2 B.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence,Whole embryo wild type,,Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PCR was carried out with an initial 30s denaturation at 98degC followed by 4 cycles of 30s denaturation at 98degC and 15s extension at 72degC followed by 10 15 cycles of 10s denaturation at 98degC 30s annealing at 50degC and 15s extension at 72degC. Reactions were separated on a non denaturing 8% polyacrylamide TBE gel and correct sized DNA fragments were sequenced using Illumina HiSeq2000. In parallel RNA input from 20 embryos was extracted using Trizol then polyA selected using biotinylated oligodT40 at room temperature and eluted. Samples were then alkaline fragmented for 20min at 95degC using 2 mM EDTA; 10 mM Na2CO3; 90 mM NaHCO3 pH 9.3; then neutralized with 560ul of ice cold NaOAc 300mM pH 5.5 and RNA precipitated with isopropanol. Small RNA sequencing libraries were constructed as above selecting for fragments in the 30 50 nt range.,,sample type:ribosome protected fragments|tissue:whole embryo|genotype:wild type|developmental stage:2hpf,GSM854439,GSM854439: Ribosome protected fragments Wild type 2hpf 2; Danio rerio; RNA Seq,GSM854439 1,GSM854439: Ribosome protected fragments Wild type 2hpf 2,1,,GEO Accession:GSM854439,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina Genome Analyzer II,720Application ReadForward1,SRP010040,,instrument model:Illumina HiSeq 2000,Ribo_Wt_2_B2.fq,fastq,976804848.0,13566734.0,GSM854439 r2,0:72,A:312362919;C:205660950;G:237663406;T:221097191;N:20382,72,,,,312362919,205660950,237663406,221097191,20382,SRX113357,SRS284301,SRA048903,GEO,"Giraldez Lab, Genetics, Yale University",1,0.0,,0.0,,1.0,,,,72,,T,,under 1.2% mapping rate,illumina,early_illumina,unknown,poly_a,unknown,bulk,unknown,unknown,,United States,2011-12-27,Cleavage,Embryo,Whole Organism,All anatomical structures
36299,SRR392998,SRX113356,SRS284300,SRP010040,PRJNA150397,Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay,GSE34743,Transcriptome Analysis,MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos,,pubmed:22422859,,Ribosome protected fragments Wild type 2hpf,GSM854438,,source name:Whole embryo wild type|sample type:ribosome protected fragments|tissue:whole embryo|genotype:wild type|development stage:2hpf,Ribosome protected fragments Wild type 2hpf,Ribo Wt 2 A.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence,Whole embryo wild type,,Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PCR was carried out with an initial 30s denaturation at 98degC followed by 4 cycles of 30s denaturation at 98degC and 15s extension at 72degC followed by 10 15 cycles of 10s denaturation at 98degC 30s annealing at 50degC and 15s extension at 72degC. Reactions were separated on a non denaturing 8% polyacrylamide TBE gel and correct sized DNA fragments were sequenced using Illumina HiSeq2000. In parallel RNA input from 20 embryos was extracted using Trizol then polyA selected using biotinylated oligodT40 at room temperature and eluted. Samples were then alkaline fragmented for 20min at 95degC using 2 mM EDTA; 10 mM Na2CO3; 90 mM NaHCO3 pH 9.3; then neutralized with 560ul of ice cold NaOAc 300mM pH 5.5 and RNA precipitated with isopropanol. Small RNA sequencing libraries were constructed as above selecting for fragments in the 30 50 nt range.,,sample type:ribosome protected fragments|tissue:whole embryo|genotype:wild type|developmental stage:2hpf,GSM854438,GSM854438: Ribosome protected fragments Wild type 2hpf; Danio rerio; RNA Seq,GSM854438 1,GSM854438: Ribosome protected fragments Wild type 2hpf,1,,GEO Accession:GSM854438,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina Genome Analyzer II,720Application ReadForward1,SRP010040,,,Ribo_Wt_2_A1.fq,fastq,284876712.0,3956621.0,GSM854438 r1,0:72,A:88022040;C:68867093;G:63794882;T:64180749;N:11948,72,,,,88022040,68867093,63794882,64180749,11948,SRX113356,SRS284300,SRA048903,GEO,"Giraldez Lab, Genetics, Yale University",1,0.00011,,7e-05,,0.99995,,0.0,,72,,T,,under 1.2% mapping rate,illumina,early_illumina,unknown,poly_a,unknown,bulk,unknown,unknown,,United States,2011-12-27,Cleavage,Embryo,Whole Organism,All anatomical structures
36300,SRR392999,SRX113356,SRS284300,SRP010040,PRJNA150397,Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay,GSE34743,Transcriptome Analysis,MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos,,pubmed:22422859,,Ribosome protected fragments Wild type 2hpf,GSM854438,,source name:Whole embryo wild type|sample type:ribosome protected fragments|tissue:whole embryo|genotype:wild type|development stage:2hpf,Ribosome protected fragments Wild type 2hpf,Ribo Wt 2 A.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence,Whole embryo wild type,,Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PCR was carried out with an initial 30s denaturation at 98degC followed by 4 cycles of 30s denaturation at 98degC and 15s extension at 72degC followed by 10 15 cycles of 10s denaturation at 98degC 30s annealing at 50degC and 15s extension at 72degC. Reactions were separated on a non denaturing 8% polyacrylamide TBE gel and correct sized DNA fragments were sequenced using Illumina HiSeq2000. In parallel RNA input from 20 embryos was extracted using Trizol then polyA selected using biotinylated oligodT40 at room temperature and eluted. Samples were then alkaline fragmented for 20min at 95degC using 2 mM EDTA; 10 mM Na2CO3; 90 mM NaHCO3 pH 9.3; then neutralized with 560ul of ice cold NaOAc 300mM pH 5.5 and RNA precipitated with isopropanol. Small RNA sequencing libraries were constructed as above selecting for fragments in the 30 50 nt range.,,sample type:ribosome protected fragments|tissue:whole embryo|genotype:wild type|developmental stage:2hpf,GSM854438,GSM854438: Ribosome protected fragments Wild type 2hpf; Danio rerio; RNA Seq,GSM854438 1,GSM854438: Ribosome protected fragments Wild type 2hpf,1,,GEO Accession:GSM854438,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina Genome Analyzer II,720Application ReadForward1,SRP010040,,instrument model:Illumina HiSeq 2000,Ribo_Wt_2_A2.fq,fastq,1197987552.0,16638716.0,GSM854438 r2,0:72,A:346631182;C:288138913;G:296030268;T:267150788;N:36401,72,,,,346631182,288138913,296030268,267150788,36401,SRX113356,SRS284300,SRA048903,GEO,"Giraldez Lab, Genetics, Yale University",1,3e-05,,0.0,,0.99997,,0.0,,72,,T,,under 1.2% mapping rate,illumina,early_illumina,unknown,poly_a,unknown,bulk,unknown,unknown,,United States,2011-12-27,Cleavage,Embryo,Whole Organism,All anatomical structures
36309,SRR392988,SRX113351,SRS284295,SRP010040,PRJNA150397,Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay,GSE34743,Transcriptome Analysis,MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos,,pubmed:22422859,,Ribosome protected fragments MZdicer 2hpf 2,GSM854433,,source name:Whole embryo MZdicer|sample type:ribosome protected fragments|tissue:whole embryo|genotype:MZdicer mutant|development stage:2hpf,Ribosome protected fragments MZdicer 2hpf 2,Ribo Dicer 2 B.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence,Whole embryo MZdicer,,Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PCR was carried out with an initial 30s denaturation at 98degC followed by 4 cycles of 30s denaturation at 98degC and 15s extension at 72degC followed by 10 15 cycles of 10s denaturation at 98degC 30s annealing at 50degC and 15s extension at 72degC. Reactions were separated on a non denaturing 8% polyacrylamide TBE gel and correct sized DNA fragments were sequenced using Illumina HiSeq2000. In parallel RNA input from 20 embryos was extracted using Trizol then polyA selected using biotinylated oligodT40 at room temperature and eluted. Samples were then alkaline fragmented for 20min at 95degC using 2 mM EDTA; 10 mM Na2CO3; 90 mM NaHCO3 pH 9.3; then neutralized with 560ul of ice cold NaOAc 300mM pH 5.5 and RNA precipitated with isopropanol. Small RNA sequencing libraries were constructed as above selecting for fragments in the 30 50 nt range.,,sample type:ribosome protected fragments|tissue:whole embryo|genotype:MZdicer mutant|developmental stage:2hpf,GSM854433,GSM854433: Ribosome protected fragments MZdicer 2hpf 2; Danio rerio; RNA Seq,GSM854433 1,GSM854433: Ribosome protected fragments MZdicer 2hpf 2,1,,GEO Accession:GSM854433,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina Genome Analyzer II,720Application ReadForward1,SRP010040,,,Ribo_Dicer_2_B1.fq,fastq,72956952.0,1013291.0,GSM854433 r1,0:72,A:22006501;C:17986138;G:16833834;T:16127785;N:2694,72,,,,22006501,17986138,16833834,16127785,2694,SRX113351,SRS284295,SRA048903,GEO,"Giraldez Lab, Genetics, Yale University",1,0.00131,,0.00114,,0.99991,,0.88888,,72,,T,,under 1.2% mapping rate,illumina,early_illumina,unknown,poly_a,unknown,bulk,unknown,unknown,,United States,2011-12-27,Cleavage,Embryo,Whole Organism,All anatomical structures
36310,SRR392989,SRX113351,SRS284295,SRP010040,PRJNA150397,Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay,GSE34743,Transcriptome Analysis,MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos,,pubmed:22422859,,Ribosome protected fragments MZdicer 2hpf 2,GSM854433,,source name:Whole embryo MZdicer|sample type:ribosome protected fragments|tissue:whole embryo|genotype:MZdicer mutant|development stage:2hpf,Ribosome protected fragments MZdicer 2hpf 2,Ribo Dicer 2 B.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence,Whole embryo MZdicer,,Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PCR was carried out with an initial 30s denaturation at 98degC followed by 4 cycles of 30s denaturation at 98degC and 15s extension at 72degC followed by 10 15 cycles of 10s denaturation at 98degC 30s annealing at 50degC and 15s extension at 72degC. Reactions were separated on a non denaturing 8% polyacrylamide TBE gel and correct sized DNA fragments were sequenced using Illumina HiSeq2000. In parallel RNA input from 20 embryos was extracted using Trizol then polyA selected using biotinylated oligodT40 at room temperature and eluted. Samples were then alkaline fragmented for 20min at 95degC using 2 mM EDTA; 10 mM Na2CO3; 90 mM NaHCO3 pH 9.3; then neutralized with 560ul of ice cold NaOAc 300mM pH 5.5 and RNA precipitated with isopropanol. Small RNA sequencing libraries were constructed as above selecting for fragments in the 30 50 nt range.,,sample type:ribosome protected fragments|tissue:whole embryo|genotype:MZdicer mutant|developmental stage:2hpf,GSM854433,GSM854433: Ribosome protected fragments MZdicer 2hpf 2; Danio rerio; RNA Seq,GSM854433 1,GSM854433: Ribosome protected fragments MZdicer 2hpf 2,1,,GEO Accession:GSM854433,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina Genome Analyzer II,720Application ReadForward1,SRP010040,,instrument model:Illumina HiSeq 2000,Ribo_Dicer_2_B2.fq,fastq,454127328.0,6307324.0,GSM854433 r2,0:72,A:124676855;C:112665084;G:119208313;T:97572172;N:4904,72,,,,124676855,112665084,119208313,97572172,4904,SRX113351,SRS284295,SRA048903,GEO,"Giraldez Lab, Genetics, Yale University",1,0.0,,0.0,,1.0,,,,72,,T,,under 1.2% mapping rate,illumina,early_illumina,unknown,poly_a,unknown,bulk,unknown,unknown,,United States,2011-12-27,Cleavage,Embryo,Whole Organism,All anatomical structures
36311,SRR392986,SRX113350,SRS284294,SRP010040,PRJNA150397,Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay,GSE34743,Transcriptome Analysis,MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos,,pubmed:22422859,,Ribosome protected fragments MZdicer 2hpf,GSM854432,,source name:Whole embryo MZdicer|sample type:ribosome protected fragments|tissue:whole embryo|genotype:MZdicer mutant|development stage:2hpf,Ribosome protected fragments MZdicer 2hpf,Ribo Dicer 2 A.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence,Whole embryo MZdicer,,Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PCR was carried out with an initial 30s denaturation at 98degC followed by 4 cycles of 30s denaturation at 98degC and 15s extension at 72degC followed by 10 15 cycles of 10s denaturation at 98degC 30s annealing at 50degC and 15s extension at 72degC. Reactions were separated on a non denaturing 8% polyacrylamide TBE gel and correct sized DNA fragments were sequenced using Illumina HiSeq2000. In parallel RNA input from 20 embryos was extracted using Trizol then polyA selected using biotinylated oligodT40 at room temperature and eluted. Samples were then alkaline fragmented for 20min at 95degC using 2 mM EDTA; 10 mM Na2CO3; 90 mM NaHCO3 pH 9.3; then neutralized with 560ul of ice cold NaOAc 300mM pH 5.5 and RNA precipitated with isopropanol. Small RNA sequencing libraries were constructed as above selecting for fragments in the 30 50 nt range.,,sample type:ribosome protected fragments|tissue:whole embryo|genotype:MZdicer mutant|developmental stage:2hpf,GSM854432,GSM854432: Ribosome protected fragments MZdicer 2hpf; Danio rerio; RNA Seq,GSM854432 1,GSM854432: Ribosome protected fragments MZdicer 2hpf,1,,GEO Accession:GSM854432,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina Genome Analyzer II,720Application ReadForward1,SRP010040,,,Ribo_Dicer_2_A1.fq,fastq,216257400.0,3003575.0,GSM854432 r1,0:72,A:66784432;C:51526758;G:47615177;T:50321714;N:9319,72,,,,66784432,51526758,47615177,50321714,9319,SRX113350,SRS284294,SRA048903,GEO,"Giraldez Lab, Genetics, Yale University",1,6e-05,,1e-05,,0.99995,,1.0,,72,,T,,under 1.2% mapping rate,illumina,early_illumina,unknown,poly_a,unknown,bulk,unknown,unknown,,United States,2011-12-27,Cleavage,Embryo,Whole Organism,All anatomical structures
36312,SRR392987,SRX113350,SRS284294,SRP010040,PRJNA150397,Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay,GSE34743,Transcriptome Analysis,MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos,,pubmed:22422859,,Ribosome protected fragments MZdicer 2hpf,GSM854432,,source name:Whole embryo MZdicer|sample type:ribosome protected fragments|tissue:whole embryo|genotype:MZdicer mutant|development stage:2hpf,Ribosome protected fragments MZdicer 2hpf,Ribo Dicer 2 A.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence,Whole embryo MZdicer,,Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PCR was carried out with an initial 30s denaturation at 98degC followed by 4 cycles of 30s denaturation at 98degC and 15s extension at 72degC followed by 10 15 cycles of 10s denaturation at 98degC 30s annealing at 50degC and 15s extension at 72degC. Reactions were separated on a non denaturing 8% polyacrylamide TBE gel and correct sized DNA fragments were sequenced using Illumina HiSeq2000. In parallel RNA input from 20 embryos was extracted using Trizol then polyA selected using biotinylated oligodT40 at room temperature and eluted. Samples were then alkaline fragmented for 20min at 95degC using 2 mM EDTA; 10 mM Na2CO3; 90 mM NaHCO3 pH 9.3; then neutralized with 560ul of ice cold NaOAc 300mM pH 5.5 and RNA precipitated with isopropanol. Small RNA sequencing libraries were constructed as above selecting for fragments in the 30 50 nt range.,,sample type:ribosome protected fragments|tissue:whole embryo|genotype:MZdicer mutant|developmental stage:2hpf,GSM854432,GSM854432: Ribosome protected fragments MZdicer 2hpf; Danio rerio; RNA Seq,GSM854432 1,GSM854432: Ribosome protected fragments MZdicer 2hpf,1,,GEO Accession:GSM854432,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina Genome Analyzer II,720Application ReadForward1,SRP010040,,instrument model:Illumina HiSeq 2000,Ribo_Dicer_2_A2.fq,fastq,953861544.0,13248077.0,GSM854432 r2,0:72,A:256595558;C:242054835;G:238026249;T:217176275;N:8627,72,,,,256595558,242054835,238026249,217176275,8627,SRX113350,SRS284294,SRA048903,GEO,"Giraldez Lab, Genetics, Yale University",1,9e-05,,3e-05,,0.99993,,1.0,,72,,T,,under 1.2% mapping rate,illumina,early_illumina,unknown,poly_a,unknown,bulk,unknown,unknown,,United States,2011-12-27,Cleavage,Embryo,Whole Organism,All anatomical structures
36321,SRR392976,SRX113345,SRS284289,SRP010040,PRJNA150397,Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay,GSE34743,Transcriptome Analysis,MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos,,pubmed:22422859,,Input mRNA Seq Wild type 2hpf 2,GSM854427,,source name:Whole embryo wild type|sample type:input mRNA|tissue:whole embryo|genotype:wild type|development stage:2hpf|genetic background:TUAB,Input mRNA Seq Wild type 2hpf 2,Input Wt 2 B.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence,Whole embryo wild type,,Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PCR was carried out with an initial 30s denaturation at 98degC followed by 4 cycles of 30s denaturation at 98degC and 15s extension at 72degC followed by 10 15 cycles of 10s denaturation at 98degC 30s annealing at 50degC and 15s extension at 72degC. Reactions were separated on a non denaturing 8% polyacrylamide TBE gel and correct sized DNA fragments were sequenced using Illumina HiSeq2000. In parallel RNA input from 20 embryos was extracted using Trizol then polyA selected using biotinylated oligodT40 at room temperature and eluted. Samples were then alkaline fragmented for 20min at 95degC using 2 mM EDTA; 10 mM Na2CO3; 90 mM NaHCO3 pH 9.3; then neutralized with 560ul of ice cold NaOAc 300mM pH 5.5 and RNA precipitated with isopropanol. Small RNA sequencing libraries were constructed as above selecting for fragments in the 30 50 nt range.,,sample type:input mRNA|tissue:whole embryo|genotype:wild type|developmental stage:2hpf|genetic background:TUAB,GSM854427,GSM854427: Input mRNA Seq Wild type 2hpf 2; Danio rerio; RNA Seq,GSM854427 1,GSM854427: Input mRNA Seq Wild type 2hpf 2,1,,GEO Accession:GSM854427,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina Genome Analyzer II,720Application ReadForward1,SRP010040,,,Input_Wt_2_B1.fq,fastq,395024832.0,5486456.0,GSM854427 r1,0:72,A:142810926;C:92574191;G:71835480;T:87787309;N:16926,72,,,,142810926,92574191,71835480,87787309,16926,SRX113345,SRS284289,SRA048903,GEO,"Giraldez Lab, Genetics, Yale University",1,0.0,,0.0,,1.0,,,,72,,T,,under 1.2% mapping rate,illumina,early_illumina,unknown,poly_a,unknown,bulk,unknown,unknown,,United States,2011-12-27,Cleavage,Embryo,Whole Organism,All anatomical structures
36322,SRR392977,SRX113345,SRS284289,SRP010040,PRJNA150397,Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay,GSE34743,Transcriptome Analysis,MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos,,pubmed:22422859,,Input mRNA Seq Wild type 2hpf 2,GSM854427,,source name:Whole embryo wild type|sample type:input mRNA|tissue:whole embryo|genotype:wild type|development stage:2hpf|genetic background:TUAB,Input mRNA Seq Wild type 2hpf 2,Input Wt 2 B.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence,Whole embryo wild type,,Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PCR was carried out with an initial 30s denaturation at 98degC followed by 4 cycles of 30s denaturation at 98degC and 15s extension at 72degC followed by 10 15 cycles of 10s denaturation at 98degC 30s annealing at 50degC and 15s extension at 72degC. Reactions were separated on a non denaturing 8% polyacrylamide TBE gel and correct sized DNA fragments were sequenced using Illumina HiSeq2000. In parallel RNA input from 20 embryos was extracted using Trizol then polyA selected using biotinylated oligodT40 at room temperature and eluted. Samples were then alkaline fragmented for 20min at 95degC using 2 mM EDTA; 10 mM Na2CO3; 90 mM NaHCO3 pH 9.3; then neutralized with 560ul of ice cold NaOAc 300mM pH 5.5 and RNA precipitated with isopropanol. Small RNA sequencing libraries were constructed as above selecting for fragments in the 30 50 nt range.,,sample type:input mRNA|tissue:whole embryo|genotype:wild type|developmental stage:2hpf|genetic background:TUAB,GSM854427,GSM854427: Input mRNA Seq Wild type 2hpf 2; Danio rerio; RNA Seq,GSM854427 1,GSM854427: Input mRNA Seq Wild type 2hpf 2,1,,GEO Accession:GSM854427,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina Genome Analyzer II,720Application ReadForward1,SRP010040,,instrument model:Illumina HiSeq 2000,Input_Wt_2_B2.fq,fastq,1778028768.0,24694844.0,GSM854427 r2,0:72,A:599303071;C:388710416;G:399829888;T:390165838;N:19555,72,,,,599303071,388710416,399829888,390165838,19555,SRX113345,SRS284289,SRA048903,GEO,"Giraldez Lab, Genetics, Yale University",1,0.0,,0.0,,1.0,,,,72,,T,,under 1.2% mapping rate,illumina,early_illumina,unknown,poly_a,unknown,bulk,unknown,unknown,,United States,2011-12-27,Cleavage,Embryo,Whole Organism,All anatomical structures
36323,SRR392974,SRX113344,SRS284288,SRP010040,PRJNA150397,Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay,GSE34743,Transcriptome Analysis,MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos,,pubmed:22422859,,Input mRNA Seq Wild type 2hpf,GSM854426,,source name:Whole embryo wild type|sample type:input mRNA|tissue:whole embryo|genotype:wild type|development stage:2hpf|genetic background:TUAB,Input mRNA Seq Wild type 2hpf,Input Wt 2 A.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence,Whole embryo wild type,,Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PCR was carried out with an initial 30s denaturation at 98degC followed by 4 cycles of 30s denaturation at 98degC and 15s extension at 72degC followed by 10 15 cycles of 10s denaturation at 98degC 30s annealing at 50degC and 15s extension at 72degC. Reactions were separated on a non denaturing 8% polyacrylamide TBE gel and correct sized DNA fragments were sequenced using Illumina HiSeq2000. In parallel RNA input from 20 embryos was extracted using Trizol then polyA selected using biotinylated oligodT40 at room temperature and eluted. Samples were then alkaline fragmented for 20min at 95degC using 2 mM EDTA; 10 mM Na2CO3; 90 mM NaHCO3 pH 9.3; then neutralized with 560ul of ice cold NaOAc 300mM pH 5.5 and RNA precipitated with isopropanol. Small RNA sequencing libraries were constructed as above selecting for fragments in the 30 50 nt range.,,sample type:input mRNA|tissue:whole embryo|genotype:wild type|developmental stage:2hpf|genetic background:TUAB,GSM854426,GSM854426: Input mRNA Seq Wild type 2hpf; Danio rerio; RNA Seq,GSM854426 1,GSM854426: Input mRNA Seq Wild type 2hpf,1,,GEO Accession:GSM854426,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina Genome Analyzer II,720Application ReadForward1,SRP010040,,,Input_Wt_2_A1.fq,fastq,315124632.0,4376731.0,GSM854426 r1,0:72,A:116463238;C:74027349;G:54200798;T:70419115;N:14132,72,,,,116463238,74027349,54200798,70419115,14132,SRX113344,SRS284288,SRA048903,GEO,"Giraldez Lab, Genetics, Yale University",1,0.0,,0.0,,1.0,,,,72,,T,,under 1.2% mapping rate,illumina,early_illumina,unknown,poly_a,unknown,bulk,unknown,unknown,,United States,2011-12-27,Cleavage,Embryo,Whole Organism,All anatomical structures
36324,SRR392975,SRX113344,SRS284288,SRP010040,PRJNA150397,Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay,GSE34743,Transcriptome Analysis,MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos,,pubmed:22422859,,Input mRNA Seq Wild type 2hpf,GSM854426,,source name:Whole embryo wild type|sample type:input mRNA|tissue:whole embryo|genotype:wild type|development stage:2hpf|genetic background:TUAB,Input mRNA Seq Wild type 2hpf,Input Wt 2 A.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence,Whole embryo wild type,,Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PCR was carried out with an initial 30s denaturation at 98degC followed by 4 cycles of 30s denaturation at 98degC and 15s extension at 72degC followed by 10 15 cycles of 10s denaturation at 98degC 30s annealing at 50degC and 15s extension at 72degC. Reactions were separated on a non denaturing 8% polyacrylamide TBE gel and correct sized DNA fragments were sequenced using Illumina HiSeq2000. In parallel RNA input from 20 embryos was extracted using Trizol then polyA selected using biotinylated oligodT40 at room temperature and eluted. Samples were then alkaline fragmented for 20min at 95degC using 2 mM EDTA; 10 mM Na2CO3; 90 mM NaHCO3 pH 9.3; then neutralized with 560ul of ice cold NaOAc 300mM pH 5.5 and RNA precipitated with isopropanol. Small RNA sequencing libraries were constructed as above selecting for fragments in the 30 50 nt range.,,sample type:input mRNA|tissue:whole embryo|genotype:wild type|developmental stage:2hpf|genetic background:TUAB,GSM854426,GSM854426: Input mRNA Seq Wild type 2hpf; Danio rerio; RNA Seq,GSM854426 1,GSM854426: Input mRNA Seq Wild type 2hpf,1,,GEO Accession:GSM854426,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina Genome Analyzer II,720Application ReadForward1,SRP010040,,instrument model:Illumina HiSeq 2000,Input_Wt_2_A2.fq,fastq,1366683048.0,18981709.0,GSM854426 r2,0:72,A:475749702;C:303155361;G:282027500;T:305707196;N:43289,72,,,,475749702,303155361,282027500,305707196,43289,SRX113344,SRS284288,SRA048903,GEO,"Giraldez Lab, Genetics, Yale University",1,0.0,,0.0,,1.0,,,,72,,T,,under 1.2% mapping rate,illumina,early_illumina,unknown,poly_a,unknown,bulk,unknown,unknown,,United States,2011-12-27,Cleavage,Embryo,Whole Organism,All anatomical structures
36331,SRR392966,SRX113340,SRS284284,SRP010040,PRJNA150397,Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay,GSE34743,Transcriptome Analysis,MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos,,pubmed:22422859,,Input mRNA Seq MZdicer 2hpf,GSM854422,,source name:Whole embryo MZdicer|sample type:input mRNA|tissue:whole embryo|genotype:MZdicer mutant|development stage:2hpf|genetic background:TUAB,Input mRNA Seq MZdicer 2hpf,Input Dicer 2 A.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence,Whole embryo MZdicer,,Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PCR was carried out with an initial 30s denaturation at 98degC followed by 4 cycles of 30s denaturation at 98degC and 15s extension at 72degC followed by 10 15 cycles of 10s denaturation at 98degC 30s annealing at 50degC and 15s extension at 72degC. Reactions were separated on a non denaturing 8% polyacrylamide TBE gel and correct sized DNA fragments were sequenced using Illumina HiSeq2000. In parallel RNA input from 20 embryos was extracted using Trizol then polyA selected using biotinylated oligodT40 at room temperature and eluted. Samples were then alkaline fragmented for 20min at 95degC using 2 mM EDTA; 10 mM Na2CO3; 90 mM NaHCO3 pH 9.3; then neutralized with 560ul of ice cold NaOAc 300mM pH 5.5 and RNA precipitated with isopropanol. Small RNA sequencing libraries were constructed as above selecting for fragments in the 30 50 nt range.,,sample type:input mRNA|tissue:whole embryo|genotype:MZdicer mutant|developmental stage:2hpf|genetic background:TUAB,GSM854422,GSM854422: Input mRNA Seq MZdicer 2hpf; Danio rerio; RNA Seq,GSM854422 1,GSM854422: Input mRNA Seq MZdicer 2hpf,1,,GEO Accession:GSM854422,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina Genome Analyzer II,720Application ReadForward1,SRP010040,,,Input_Dicer_2_A1.fq,fastq,197997408.0,2749964.0,GSM854422 r1,0:72,A:73258529;C:47205089;G:34750581;T:42774230;N:8979,72,,,,73258529,47205089,34750581,42774230,8979,SRX113340,SRS284284,SRA048903,GEO,"Giraldez Lab, Genetics, Yale University",1,0.0,,0.0,,1.0,,,,72,,T,,under 1.2% mapping rate,illumina,early_illumina,unknown,poly_a,unknown,bulk,unknown,unknown,,United States,2011-12-27,Cleavage,Embryo,Whole Organism,All anatomical structures
36332,SRR392967,SRX113340,SRS284284,SRP010040,PRJNA150397,Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay,GSE34743,Transcriptome Analysis,MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos,,pubmed:22422859,,Input mRNA Seq MZdicer 2hpf,GSM854422,,source name:Whole embryo MZdicer|sample type:input mRNA|tissue:whole embryo|genotype:MZdicer mutant|development stage:2hpf|genetic background:TUAB,Input mRNA Seq MZdicer 2hpf,Input Dicer 2 A.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence,Whole embryo MZdicer,,Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PCR was carried out with an initial 30s denaturation at 98degC followed by 4 cycles of 30s denaturation at 98degC and 15s extension at 72degC followed by 10 15 cycles of 10s denaturation at 98degC 30s annealing at 50degC and 15s extension at 72degC. Reactions were separated on a non denaturing 8% polyacrylamide TBE gel and correct sized DNA fragments were sequenced using Illumina HiSeq2000. In parallel RNA input from 20 embryos was extracted using Trizol then polyA selected using biotinylated oligodT40 at room temperature and eluted. Samples were then alkaline fragmented for 20min at 95degC using 2 mM EDTA; 10 mM Na2CO3; 90 mM NaHCO3 pH 9.3; then neutralized with 560ul of ice cold NaOAc 300mM pH 5.5 and RNA precipitated with isopropanol. Small RNA sequencing libraries were constructed as above selecting for fragments in the 30 50 nt range.,,sample type:input mRNA|tissue:whole embryo|genotype:MZdicer mutant|developmental stage:2hpf|genetic background:TUAB,GSM854422,GSM854422: Input mRNA Seq MZdicer 2hpf; Danio rerio; RNA Seq,GSM854422 1,GSM854422: Input mRNA Seq MZdicer 2hpf,1,,GEO Accession:GSM854422,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina Genome Analyzer II,720Application ReadForward1,SRP010040,,instrument model:Illumina HiSeq 2000,Input_Dicer_2_A2.fq,fastq,821282832.0,11406706.0,GSM854422 r2,0:72,A:289320106;C:176199303;G:179059045;T:176687758;N:16620,72,,,,289320106,176199303,179059045,176687758,16620,SRX113340,SRS284284,SRA048903,GEO,"Giraldez Lab, Genetics, Yale University",1,0.0,,0.0,,1.0,,,,72,,T,,under 1.2% mapping rate,illumina,early_illumina,unknown,poly_a,unknown,bulk,unknown,unknown,,United States,2011-12-27,Cleavage,Embryo,Whole Organism,All anatomical structures
36355,SRR372788,SRX107384,SRS280824,SRP009426,PRJNA154389,Comprehensive identification of long non coding RNAs expressed during zebrafish embryogenesis [RNA seq],GSE32898,Transcriptome Analysis,Long non coding RNAs lncRNAs comprise a diverse class of transcripts that structurally resemble mRNAs but do not encode proteins. Recent genome wide studies in human and mouse have annotated lncRNAs expressed in cell lines and adult tissues but a systematic analysis of lncRNAs expressed during vertebrate embryogenesis has been elusive. To identify lncRNAs with potential functions in vertebrate embryogenesis we performed a time series of RNA Seq experiments at eight stages during early zebrafish development. We reconstructed 56 535 high confidence transcripts in 28 912 loci recovering the vast majority of expressed RefSeq transcripts while identifying thousands of novel isoforms and expressed loci. We defined a stringent set of 1 133 non coding multi exonic transcripts expressed during embryogenesis. These include long intergenic ncRNAs lincRNAs intronic overlapping lncRNAs exonic antisense overlapping lncRNAs and precursors for small RNAs sRNAs. Zebrafish lncRNAs share many of the characteristics of their mammalian counterparts: relatively short length low exon number low expression and conservation levels comparable to introns. Subsets of lncRNAs carry chromatin signatures characteristic of genes with developmental functions. The temporal expression profile of lncRNAs revealed two novel properties: lncRNAs are expressed in narrower time windows than protein coding genes and are specifically enriched in early stage embryos. In addition several lncRNAs show tissue specific expression and distinct subcellular localization patterns. Integrative computational analyses associated individual lncRNAs with specific pathways and functions ranging from cell cycle regulation to morphogenesis. Our study provides the first comprehensive identification of lncRNAs in a vertebrate embryo and forms the foundation for future genetic genomic and evolutionary studies. Overall design: RNA Seq for 8 zebrafish developmental stages 2 lanes for each stage 3 for shield.,parent bioproject:PRJNA146503,pubmed:22110045;pubmed:23698349,,2 4cell 2,GSM831504,,source name:2 4cell RNA Seq|tissue:embryo|development stage:embryogenesis: 2 4 cell stage|stdev for insert size:1301.769583,2 4cell 2,Th summary result files of he developmental transcriptome of all samples are available as supplementary information with the paper.,2 4cell RNA Seq,,Total RNA was isolated using the standard Trizol Invitrogen protocol. Two rounds of PolyA+ RNA purification were performed for each sample using the PolyAPuristTM MAG kit Ambion. The quality of the RNA and lack of contaminating ribosomal RNA were confirmed using the Agilent 2100 Bioanalyzer. Strand specific libraries for 76 bp paired end sequencing were prepared according to a modified UTP method Parkhomchuk et al. 2009 as detailed in Levin et al. 2010.,Zebrafish embryos were dechorionated at the 1 cell stage followed by incubation at 28C.,tissue:embryo|developmental stage:embryogenesis: 2 4 cell stage|average insert size fragment length:673.36217|stdev for insert size:1301.769583,GSM831504,GSM831504: 2 4cell 2,GSM831504: 2 4cell 2,GSM831504: 2 4cell 2,1,,GEO Accession:GSM831504,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,1520Application ReadForward11Application ReadReverse77,SRP009426,,,,,9256767320.0,60899785.0,GSM831504 1,0:76 1:76,A:2412461359;C:2170215834;G:2234888308;T:2438303823;N:897996,76,76,,,2412461359,2170215834,2234888308,2438303823,897996,SRX107384,SRS280824,SRA048184,GEO,"Sandelin, Dep. of Biology, University of Copenhagen",2,0.93703,0.94416,0.03525,0.03149,0.80129,0.79188,0.49723,0.49656,76,76,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Denmark,2011-11-11,Cleavage,Embryo,Embryo Imprecise,All anatomical structures
36356,SRR372787,SRX107383,SRS280823,SRP009426,PRJNA154389,Comprehensive identification of long non coding RNAs expressed during zebrafish embryogenesis [RNA seq],GSE32898,Transcriptome Analysis,Long non coding RNAs lncRNAs comprise a diverse class of transcripts that structurally resemble mRNAs but do not encode proteins. Recent genome wide studies in human and mouse have annotated lncRNAs expressed in cell lines and adult tissues but a systematic analysis of lncRNAs expressed during vertebrate embryogenesis has been elusive. To identify lncRNAs with potential functions in vertebrate embryogenesis we performed a time series of RNA Seq experiments at eight stages during early zebrafish development. We reconstructed 56 535 high confidence transcripts in 28 912 loci recovering the vast majority of expressed RefSeq transcripts while identifying thousands of novel isoforms and expressed loci. We defined a stringent set of 1 133 non coding multi exonic transcripts expressed during embryogenesis. These include long intergenic ncRNAs lincRNAs intronic overlapping lncRNAs exonic antisense overlapping lncRNAs and precursors for small RNAs sRNAs. Zebrafish lncRNAs share many of the characteristics of their mammalian counterparts: relatively short length low exon number low expression and conservation levels comparable to introns. Subsets of lncRNAs carry chromatin signatures characteristic of genes with developmental functions. The temporal expression profile of lncRNAs revealed two novel properties: lncRNAs are expressed in narrower time windows than protein coding genes and are specifically enriched in early stage embryos. In addition several lncRNAs show tissue specific expression and distinct subcellular localization patterns. Integrative computational analyses associated individual lncRNAs with specific pathways and functions ranging from cell cycle regulation to morphogenesis. Our study provides the first comprehensive identification of lncRNAs in a vertebrate embryo and forms the foundation for future genetic genomic and evolutionary studies. Overall design: RNA Seq for 8 zebrafish developmental stages 2 lanes for each stage 3 for shield.,parent bioproject:PRJNA146503,pubmed:22110045;pubmed:23698349,,2 4cell 1,GSM831503,,source name:2 4cell RNA Seq|tissue:embryo|developmental stage:embryogenesis: 2 4 cell stage|stdev for insert size:1336.039246,2 4cell 1,Th summary result files of he developmental transcriptome of all samples are available as supplementary information with the paper.,2 4cell RNA Seq,,Total RNA was isolated using the standard Trizol Invitrogen protocol. Two rounds of PolyA+ RNA purification were performed for each sample using the PolyAPuristTM MAG kit Ambion. The quality of the RNA and lack of contaminating ribosomal RNA were confirmed using the Agilent 2100 Bioanalyzer. Strand specific libraries for 76 bp paired end sequencing were prepared according to a modified UTP method Parkhomchuk et al. 2009 as detailed in Levin et al. 2010.,Zebrafish embryos were dechorionated at the 1 cell stage followed by incubation at 28C.,tissue:embryo|developmental stage:embryogenesis: 2 4 cell stage|average insert size fragment length:710.502832|stdev for insert size:1336.039246,GSM831503,GSM831503: 2 4cell 1,GSM831503: 2 4cell 1,GSM831503: 2 4cell 1,1,,GEO Accession:GSM831503,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,1520Application ReadForward11Application ReadReverse77,SRP009426,,,,,6454083552.0,42461076.0,GSM831503 1,0:76 1:76,A:1659789336;C:1511027834;G:1564153032;T:1683582419;N:35530931,76,76,,,1659789336,1511027834,1564153032,1683582419,35530931,SRX107383,SRS280823,SRA048184,GEO,"Sandelin, Dep. of Biology, University of Copenhagen",2,0.82115,0.94097,0.02927,0.02775,0.84362,0.79864,0.49872,0.49708,76,76,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Denmark,2011-11-11,Cleavage,Embryo,Embryo Imprecise,All anatomical structures
36358,SRR489491,SRX143568,SRS310289,SRP012376,PRJNA160143,Extensive alternative polyadenylation during zebrafish development,GSE37453,Transcriptome Analysis,The post transcriptional fate of messenger RNAs mRNAs is largely dictated by their three prime' untranslated regions three prime'UTRs which are defined by cleavage and polyadenylation CPA of pre mRNAs. We used polyA position profiling by sequencing 3P Seq to map polyA sites at eight developmental stages and tissues in the zebrafish. Analysis of over 60 million 3P Seq reads substantially increased and improved existing three prime'UTR annotations resulting in confidently identified three prime'UTRs for more than 78.79% of the annotated protein coding genes in zebrafish. Most zebrafish genes undergo alternative CPA with more than a thousand genes using different dominant three prime'UTRs at different stages. three prime'UTRs tend to be shortest in the ovaries and longest in the brain. Isoforms with some of the shortest three prime'UTRs are highly expressed in the ovary yet absent in the maternally contributed RNAs of the embryo perhaps because their three prime'UTRs are too short to accommodate a uridine rich motif required for stability of the maternal mRNA. At two hpf thousands of unique polyA sites appear at locations lacking a typical polyadenylation signal which suggests a wave of widespread cytoplasmic polyadenylation of mRNA degradation intermediates. Our insights into the identities formation and evolution of zebrafish three prime'UTRs provide a resource for studying gene regulation during vertebrate development. Overall design: 3P Seq was used to map the three prime' ends of protein coding genes in the zebrafish genome,,pubmed:22722342,,3P PE Seq PreMZT,GSM919974,,source name:whole embryo at 1.5 hpf 2 hpf type|tissue:whole embryo|development stage:1.5 hpf 2 hpf,3P PE Seq PreMZT,For 3P Seq: Reads were reverse complemented and aligned to the D. rerio genome Zv9/danRer7 using Bowtie. Reads that aligned to up to four genomic locus and had one or more mismatches at their three prime end within a terminal adenylate run were carried forward as 3P tags. Reads mapping to the same locus with the same number of terminal adenylates were consolidated in the processed data file. The BED file is as in Jan et al. GSE24924 For 3P PE Seq: In each read pair read #1 captured the three prime end of the polyA tail in the antisense orientation and read #2 captured a portion of the three prime region of the transcript and occasionally the beginning of the polyA tail in the sense orientation. Read #2 began with an adapter of 26 bases. Reads with more than 10 mismatches to the adapter were discarded and the first 26 bases were removed before further processing. A read pair was considered informative only if read #1 began with Ts and read #2 contained 2–39 terminal As. post leading Ts and terminal As were removed from reads #1 and #2 respectively they were mapped to the genome using Bowtie allowing for up to two mismatches and requiring a unique mapping position in the zebrafish genome. The length of the tail encoded in read #2 was defined as the maximum number of trailing As allowing for up to one mismatch. Only cases in which this number was larger than the number of As encoded in the genome at the predicted cleavage position by at least 2 bases were carried forward. Cleavage and polyadenylation position was defined as the last non A base in read #2. The length of the polyA tail at that position was estimated using the corresponding read #1 and defined as the maximal i for which >90% of the bases in the first i bases of read #1 were Ts. This criterion was used to allow for some sequencing errors expected when sequencing long homopolymers. Genome build: danRer7 Supplementary files format and content: The .bed files contain the positions where 3P Seq reads were mapped and the name of each track is the number of reads mapping to that position. Supplementary files format and content: The bigWig .bw files contain a summary of the number of reads whose three prime ends mapped to each position in the genome. Supplementary files format and content: For the paired end sequencing for mapping polyA tail lengths the text files contain the following columns : chromosome position strand number of polyA length reads followed by the individual measurements lower bounds on polyA tail length,whole embryo at 1.5 hpf 2 hpf,Anesthetized decorioneted embryos were washed three times in PBS 137 mM NaCl 2.7 mM KCl 1.5 mM KH2PO4 8 mM Na2HP04 pH 7.4 and suspended in PBS containing 1% freshly added formaldehyde. Embryos were transferred to a dounce homogenizer dounced several times and incubated at room temperature for 15 min. Formaldehyde was quenched by adding 1/20 volume 2.5 M glycine. Cells were pelleted at 400 x g for 5 min. The supernatant was removed and pellets were rinsed twice with PBS flash frozen in liquid nitrogen and stored at 80C.,3P PE Seq: To selectively capture polyadenylated ends for paired end sequencing 2.5 µg of total RNA from 2–2.2 or 6 hpf zebrafish embryos was splint ligated to a three prime biotinylated adapter p AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGACACATAC biotin IDT in the presence of bridge oligo TTCCGATCTTTTTTTTT IDT using T4 Rnl2 NEB in an overnight reaction at 18°C. Following partial digestion with RNase T1 Ambion 115–750 nt RNAs were isolated from a denaturing polyacrylamide gel and ligation products were captured on streptavidin M 280 Dynabeads Invitrogen. RNAs were phosphorylated at the five prime end on beads using PNK NEB and subsequently ligated to an adapter C3.spacer GTTCAGAGTTCTAcaguccgacgauc uppercase DNA; lowercase RNA; IDT using T4 Rnl1 NEB in an overnight reaction at room temperature. Complementary DNA was synthesized on beads using SuperScript II Invitrogen primed with AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACG IDT liberated from the beads by base hydrolysis size selected 155–790 nt on a denaturing polyacrylamide gel and amplified by PCR for 15 cycles. 180–750 nt products were isolated from a formamide gel and amplified for four additional cycles using primers that contain the Illumina paired end sequencing primer binding sites. post a final formamide gel purification and size selection 220–800 nt 80x80 paired end sequencing was performed on the Illumina Hi Seq platform.,Zebrafish embryos or adults grown under standard condition,genotype/variation:wild type|tissue:whole embryo|developmental stage:1.5 hpf 2 hpf,GSM919974,GSM919974: 3P PE Seq PreMZT; Danio rerio; RNA Seq,GSM919974 2,GSM919974: 3P PE Seq PreMZT,1,,GEO Accession:GSM919974,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,1600Application ReadForward11Application ReadReverse81,SRP012376,,,PolyALengths_PreMZT_read2.fastq PolyALengths_PreMZT_read1.fastq,fastq fastq,35175463040.0,219846644.0,GSM919974 r1,0:80 1:80,A:6774783678;C:5489443100;G:6337298045;T:13536245767;N:3037692450,80,80,,,6774783678,5489443100,6337298045,13536245767,3037692450,SRX143568,SRS310289,SRA051955,GEO,Whitehead Institute for Biomedical Research,2,0.87245,0.00013,0.4503,5e-05,0.98912,0.99993,0.92784,1.0,80,80,B,T,mate2 technical by mapping diff,illumina,hiseq_era,5prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United States,2012-04-20,Cleavage,Embryo,Whole Organism,All anatomical structures
36365,SRR489484,SRX143561,SRS310282,SRP012376,PRJNA160143,Extensive alternative polyadenylation during zebrafish development,GSE37453,Transcriptome Analysis,The post transcriptional fate of messenger RNAs mRNAs is largely dictated by their three prime' untranslated regions three prime'UTRs which are defined by cleavage and polyadenylation CPA of pre mRNAs. We used polyA position profiling by sequencing 3P Seq to map polyA sites at eight developmental stages and tissues in the zebrafish. Analysis of over 60 million 3P Seq reads substantially increased and improved existing three prime'UTR annotations resulting in confidently identified three prime'UTRs for more than 78.79% of the annotated protein coding genes in zebrafish. Most zebrafish genes undergo alternative CPA with more than a thousand genes using different dominant three prime'UTRs at different stages. three prime'UTRs tend to be shortest in the ovaries and longest in the brain. Isoforms with some of the shortest three prime'UTRs are highly expressed in the ovary yet absent in the maternally contributed RNAs of the embryo perhaps because their three prime'UTRs are too short to accommodate a uridine rich motif required for stability of the maternal mRNA. At two hpf thousands of unique polyA sites appear at locations lacking a typical polyadenylation signal which suggests a wave of widespread cytoplasmic polyadenylation of mRNA degradation intermediates. Our insights into the identities formation and evolution of zebrafish three prime'UTRs provide a resource for studying gene regulation during vertebrate development. Overall design: 3P Seq was used to map the three prime' ends of protein coding genes in the zebrafish genome,,pubmed:22722342,,3P Seq PreMZT 3,GSM919967,,source name:whole embryo at 1.5 hpf 2 hpf type|tissue:whole embryo|development stage:1.5 hpf 2 hpf,3P Seq PreMZT 3,For 3P Seq: Reads were reverse complemented and aligned to the D. rerio genome Zv9/danRer7 using Bowtie. Reads that aligned to up to four genomic locus and had one or more mismatches at their three prime end within a terminal adenylate run were carried forward as 3P tags. Reads mapping to the same locus with the same number of terminal adenylates were consolidated in the processed data file. The BED file is as in Jan et al. GSE24924 For 3P PE Seq: In each read pair read #1 captured the three prime end of the polyA tail in the antisense orientation and read #2 captured a portion of the three prime region of the transcript and occasionally the beginning of the polyA tail in the sense orientation. Read #2 began with an adapter of 26 bases. Reads with more than 10 mismatches to the adapter were discarded and the first 26 bases were removed before further processing. A read pair was considered informative only if read #1 began with Ts and read #2 contained 2–39 terminal As. post leading Ts and terminal As were removed from reads #1 and #2 respectively they were mapped to the genome using Bowtie allowing for up to two mismatches and requiring a unique mapping position in the zebrafish genome. The length of the tail encoded in read #2 was defined as the maximum number of trailing As allowing for up to one mismatch. Only cases in which this number was larger than the number of As encoded in the genome at the predicted cleavage position by at least 2 bases were carried forward. Cleavage and polyadenylation position was defined as the last non A base in read #2. The length of the polyA tail at that position was estimated using the corresponding read #1 and defined as the maximal i for which >90% of the bases in the first i bases of read #1 were Ts. This criterion was used to allow for some sequencing errors expected when sequencing long homopolymers. Genome build: danRer7 Supplementary files format and content: The .bed files contain the positions where 3P Seq reads were mapped and the name of each track is the number of reads mapping to that position. Supplementary files format and content: The bigWig .bw files contain a summary of the number of reads whose three prime ends mapped to each position in the genome. Supplementary files format and content: For the paired end sequencing for mapping polyA tail lengths the text files contain the following columns : chromosome position strand number of polyA length reads followed by the individual measurements lower bounds on polyA tail length,whole embryo at 1.5 hpf 2 hpf,Anesthetized decorioneted embryos were washed three times in PBS 137 mM NaCl 2.7 mM KCl 1.5 mM KH2PO4 8 mM Na2HP04 pH 7.4 and suspended in PBS containing 1% freshly added formaldehyde. Embryos were transferred to a dounce homogenizer dounced several times and incubated at room temperature for 15 min. Formaldehyde was quenched by adding 1/20 volume 2.5 M glycine. Cells were pelleted at 400 x g for 5 min. The supernatant was removed and pellets were rinsed twice with PBS flash frozen in liquid nitrogen and stored at 80C.,3P Seq; see http://web.wi.mit.edu/bartel/pub/protocols.html,Zebrafish embryos or adults grown under standard condition,genotype/variation:wild type|tissue:whole embryo|developmental stage:1.5 hpf 2 hpf,GSM919967,GSM919967: 3P Seq PreMZT 3; Danio rerio; RNA Seq,GSM919967 1,GSM919967: 3P Seq PreMZT 3,1,,GEO Accession:GSM919967,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,400Application ReadForward1,SRP012376,,,3P_Seq_PreMZT_3.fastq,fastq,2568831200.0,64220780.0,GSM919967 r1,0:40,A:928593325;C:457629269;G:462667409;T:719889166;N:52031,40,,,,928593325,457629269,462667409,719889166,52031,SRX143561,SRS310282,SRA051955,GEO,Whitehead Institute for Biomedical Research,1,0.71138,,0.10487,,0.79904,,0.51337,,40,,B,,usable mapping rate,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United States,2012-04-20,Cleavage,Embryo,Whole Organism,All anatomical structures
36366,SRR489483,SRX143560,SRS310281,SRP012376,PRJNA160143,Extensive alternative polyadenylation during zebrafish development,GSE37453,Transcriptome Analysis,The post transcriptional fate of messenger RNAs mRNAs is largely dictated by their three prime' untranslated regions three prime'UTRs which are defined by cleavage and polyadenylation CPA of pre mRNAs. We used polyA position profiling by sequencing 3P Seq to map polyA sites at eight developmental stages and tissues in the zebrafish. Analysis of over 60 million 3P Seq reads substantially increased and improved existing three prime'UTR annotations resulting in confidently identified three prime'UTRs for more than 78.79% of the annotated protein coding genes in zebrafish. Most zebrafish genes undergo alternative CPA with more than a thousand genes using different dominant three prime'UTRs at different stages. three prime'UTRs tend to be shortest in the ovaries and longest in the brain. Isoforms with some of the shortest three prime'UTRs are highly expressed in the ovary yet absent in the maternally contributed RNAs of the embryo perhaps because their three prime'UTRs are too short to accommodate a uridine rich motif required for stability of the maternal mRNA. At two hpf thousands of unique polyA sites appear at locations lacking a typical polyadenylation signal which suggests a wave of widespread cytoplasmic polyadenylation of mRNA degradation intermediates. Our insights into the identities formation and evolution of zebrafish three prime'UTRs provide a resource for studying gene regulation during vertebrate development. Overall design: 3P Seq was used to map the three prime' ends of protein coding genes in the zebrafish genome,,pubmed:22722342,,3P Seq PreMZT 2,GSM919966,,source name:whole embryo at 1.5 hpf 2 hpf type|tissue:whole embryo|development stage:1.5 hpf 2 hpf,3P Seq PreMZT 2,For 3P Seq: Reads were reverse complemented and aligned to the D. rerio genome Zv9/danRer7 using Bowtie. Reads that aligned to up to four genomic locus and had one or more mismatches at their three prime end within a terminal adenylate run were carried forward as 3P tags. Reads mapping to the same locus with the same number of terminal adenylates were consolidated in the processed data file. The BED file is as in Jan et al. GSE24924 For 3P PE Seq: In each read pair read #1 captured the three prime end of the polyA tail in the antisense orientation and read #2 captured a portion of the three prime region of the transcript and occasionally the beginning of the polyA tail in the sense orientation. Read #2 began with an adapter of 26 bases. Reads with more than 10 mismatches to the adapter were discarded and the first 26 bases were removed before further processing. A read pair was considered informative only if read #1 began with Ts and read #2 contained 2–39 terminal As. post leading Ts and terminal As were removed from reads #1 and #2 respectively they were mapped to the genome using Bowtie allowing for up to two mismatches and requiring a unique mapping position in the zebrafish genome. The length of the tail encoded in read #2 was defined as the maximum number of trailing As allowing for up to one mismatch. Only cases in which this number was larger than the number of As encoded in the genome at the predicted cleavage position by at least 2 bases were carried forward. Cleavage and polyadenylation position was defined as the last non A base in read #2. The length of the polyA tail at that position was estimated using the corresponding read #1 and defined as the maximal i for which >90% of the bases in the first i bases of read #1 were Ts. This criterion was used to allow for some sequencing errors expected when sequencing long homopolymers. Genome build: danRer7 Supplementary files format and content: The .bed files contain the positions where 3P Seq reads were mapped and the name of each track is the number of reads mapping to that position. Supplementary files format and content: The bigWig .bw files contain a summary of the number of reads whose three prime ends mapped to each position in the genome. Supplementary files format and content: For the paired end sequencing for mapping polyA tail lengths the text files contain the following columns : chromosome position strand number of polyA length reads followed by the individual measurements lower bounds on polyA tail length,whole embryo at 1.5 hpf 2 hpf,Anesthetized decorioneted embryos were washed three times in PBS 137 mM NaCl 2.7 mM KCl 1.5 mM KH2PO4 8 mM Na2HP04 pH 7.4 and suspended in PBS containing 1% freshly added formaldehyde. Embryos were transferred to a dounce homogenizer dounced several times and incubated at room temperature for 15 min. Formaldehyde was quenched by adding 1/20 volume 2.5 M glycine. Cells were pelleted at 400 x g for 5 min. The supernatant was removed and pellets were rinsed twice with PBS flash frozen in liquid nitrogen and stored at 80C.,3P Seq; see http://web.wi.mit.edu/bartel/pub/protocols.html,Zebrafish embryos or adults grown under standard condition,genotype/variation:wild type|tissue:whole embryo|developmental stage:1.5 hpf 2 hpf,GSM919966,GSM919966: 3P Seq PreMZT 2; Danio rerio; RNA Seq,GSM919966 1,GSM919966: 3P Seq PreMZT 2,1,,GEO Accession:GSM919966,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina Genome Analyzer II,360Application ReadForward1,SRP012376,,,3P_Seq_PreMZT_2.fastq,fastq,706103748.0,19613993.0,GSM919966 r1,0:36,A:259247584;C:125282714;G:127103688;T:194451978;N:17784,36,,,,259247584,125282714,127103688,194451978,17784,SRX143560,SRS310281,SRA051955,GEO,Whitehead Institute for Biomedical Research,1,0.54759,,0.0884,,0.81371,,0.51819,,36,,B,,usable mapping rate,illumina,early_illumina,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United States,2012-04-20,Cleavage,Embryo,Whole Organism,All anatomical structures
36367,SRR489482,SRX143559,SRS310280,SRP012376,PRJNA160143,Extensive alternative polyadenylation during zebrafish development,GSE37453,Transcriptome Analysis,The post transcriptional fate of messenger RNAs mRNAs is largely dictated by their three prime' untranslated regions three prime'UTRs which are defined by cleavage and polyadenylation CPA of pre mRNAs. We used polyA position profiling by sequencing 3P Seq to map polyA sites at eight developmental stages and tissues in the zebrafish. Analysis of over 60 million 3P Seq reads substantially increased and improved existing three prime'UTR annotations resulting in confidently identified three prime'UTRs for more than 78.79% of the annotated protein coding genes in zebrafish. Most zebrafish genes undergo alternative CPA with more than a thousand genes using different dominant three prime'UTRs at different stages. three prime'UTRs tend to be shortest in the ovaries and longest in the brain. Isoforms with some of the shortest three prime'UTRs are highly expressed in the ovary yet absent in the maternally contributed RNAs of the embryo perhaps because their three prime'UTRs are too short to accommodate a uridine rich motif required for stability of the maternal mRNA. At two hpf thousands of unique polyA sites appear at locations lacking a typical polyadenylation signal which suggests a wave of widespread cytoplasmic polyadenylation of mRNA degradation intermediates. Our insights into the identities formation and evolution of zebrafish three prime'UTRs provide a resource for studying gene regulation during vertebrate development. Overall design: 3P Seq was used to map the three prime' ends of protein coding genes in the zebrafish genome,,pubmed:22722342,,3P Seq PreMZT,GSM919965,,source name:whole embryo at 1.5 hpf 2 hpf type|tissue:whole embryo|development stage:1.5 hpf 2 hpf,3P Seq PreMZT,For 3P Seq: Reads were reverse complemented and aligned to the D. rerio genome Zv9/danRer7 using Bowtie. Reads that aligned to up to four genomic locus and had one or more mismatches at their three prime end within a terminal adenylate run were carried forward as 3P tags. Reads mapping to the same locus with the same number of terminal adenylates were consolidated in the processed data file. The BED file is as in Jan et al. GSE24924 For 3P PE Seq: In each read pair read #1 captured the three prime end of the polyA tail in the antisense orientation and read #2 captured a portion of the three prime region of the transcript and occasionally the beginning of the polyA tail in the sense orientation. Read #2 began with an adapter of 26 bases. Reads with more than 10 mismatches to the adapter were discarded and the first 26 bases were removed before further processing. A read pair was considered informative only if read #1 began with Ts and read #2 contained 2–39 terminal As. post leading Ts and terminal As were removed from reads #1 and #2 respectively they were mapped to the genome using Bowtie allowing for up to two mismatches and requiring a unique mapping position in the zebrafish genome. The length of the tail encoded in read #2 was defined as the maximum number of trailing As allowing for up to one mismatch. Only cases in which this number was larger than the number of As encoded in the genome at the predicted cleavage position by at least 2 bases were carried forward. Cleavage and polyadenylation position was defined as the last non A base in read #2. The length of the polyA tail at that position was estimated using the corresponding read #1 and defined as the maximal i for which >90% of the bases in the first i bases of read #1 were Ts. This criterion was used to allow for some sequencing errors expected when sequencing long homopolymers. Genome build: danRer7 Supplementary files format and content: The .bed files contain the positions where 3P Seq reads were mapped and the name of each track is the number of reads mapping to that position. Supplementary files format and content: The bigWig .bw files contain a summary of the number of reads whose three prime ends mapped to each position in the genome. Supplementary files format and content: For the paired end sequencing for mapping polyA tail lengths the text files contain the following columns : chromosome position strand number of polyA length reads followed by the individual measurements lower bounds on polyA tail length,whole embryo at 1.5 hpf 2 hpf,Anesthetized decorioneted embryos were washed three times in PBS 137 mM NaCl 2.7 mM KCl 1.5 mM KH2PO4 8 mM Na2HP04 pH 7.4 and suspended in PBS containing 1% freshly added formaldehyde. Embryos were transferred to a dounce homogenizer dounced several times and incubated at room temperature for 15 min. Formaldehyde was quenched by adding 1/20 volume 2.5 M glycine. Cells were pelleted at 400 x g for 5 min. The supernatant was removed and pellets were rinsed twice with PBS flash frozen in liquid nitrogen and stored at 80C.,3P Seq; see http://web.wi.mit.edu/bartel/pub/protocols.html,Zebrafish embryos or adults grown under standard condition,genotype/variation:wild type|tissue:whole embryo|developmental stage:1.5 hpf 2 hpf,GSM919965,GSM919965: 3P Seq PreMZT; Danio rerio; RNA Seq,GSM919965 1,GSM919965: 3P Seq PreMZT,1,,GEO Accession:GSM919965,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina Genome Analyzer II,360Application ReadForward1,SRP012376,,,3P_Seq_PreMZT.fastq,fastq,612082764.0,17002299.0,GSM919965 r1,0:36,A:226644687;C:107265813;G:109073433;T:168922136;N:176695,36,,,,226644687,107265813,109073433,168922136,176695,SRX143559,SRS310280,SRA051955,GEO,Whitehead Institute for Biomedical Research,1,0.56415,,0.09075,,0.8114,,0.50672,,36,,B,,usable mapping rate,illumina,early_illumina,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United States,2012-04-20,Cleavage,Embryo,Whole Organism,All anatomical structures
36694,SRR801679,SRX258160,SRS406291,SRP020469,PRJNA195909,RNA sequencing project for zebrafish embryo and larva development,GSE45706,Transcriptome Analysis,Zebrafish is an important model system for the study of vertebrate embryonic development and adaptive immunese response. recent yrs have seen great advancement in the understanding of the regulatory mechanisms during zebrafish embryogenesis and immune processes yet large gaps still remain in the functional pathways critical for each developmental stage especially for the late embryonic development. We sequenced the polyA extracted mRNA from 9 stages covering 7 major developmental periods of zebrafish. Whole genome gene expression pattern were analyzed to reveal unknown pathways or factors with implicated roles during each stage of vertebrate development. Overall design: Analysis of total mRNA by highthroughput sequencing in 9 stages covering 7 periods during the embryonic and larval development of zebrafish,,pubmed:23700457;pubmed:26891128,source: Zebrafish embryos at the 64 cell stage,GSM1112155: 64 cell 2 hpf,GSM1112155,,strain:AB|developmental stage:64 cell 2 hpf|tissue:embryo,64 cell 2 hpf,Primary processing by SOLiD 3.0 online software The short SOLiD reads were aligned against the zebrafish genome build Zv9 using the software package Bioscope v1.2 obtained from Life Techlogies. Reads per kilobase of transcript per million mapped reads RPKM were calculated using an in house developed perl script which is available upon request. Genome build: Zv9 Supplementary files format and content: tab delimited text files including RPKM values for gene models from the genome annotation release Ensembl 62 of the Zv9 assembly,Zebrafish embryos at the 64 cell stage,Liquid nitrogen rapid cooling methods were used for zebrafish embryos and larvae euthanasia.,Total RNA was extracted from each stage of about 2000 embryos or larvae using Trizol Invitrogen Carlsbad CA USA methods according to the manufacturer’s instruction. RNA quality was evaluated by gel electrophoresis and the concentration was measured with NanoDrop 2000 Thermo Scientific,Waltham MA USA.The aliquots were stored at 80 oC. A protocol/kit available from Life Technologies with minor modifications was used to construct mRNA seq libraries. First the total RNA was estimated on an Agilent 2100 Bioanalyzer Agilent Technologies Waldbronn Germany. Second The ribosomal RNA removal steps were replaced by two rounds of polyA purification with the first round using the PolyATtract® mRNA Isolation Systems Promega Madison WI USA and the second round using the PolyAPurist™ Kit Ambion Austin TX USA. About 0.8 μg of mRNA was fragmented with 10min at 37 oC RNase III treatment. The fragmented mRNA were ligated with adaptor Mix A subsequently used for reverse transcription. The first strand cDNA were separated using 6% TBE Urea Gel Invitrogen Carlsbad CA USA and 100–200 nt fraction was recovered. The fractionated cDNA were subjected to 11 15 cycles of PCR amplification with the PCR products purified to yield the SOLiD Fragment Library ready for emulsion PCR. Emulsion PCR was performed using 600 pg of the library. All experiments were performed on full sequencing slides.,Zebrafish embryos and larvae were collected and maintained at approximately 28.5°C and were staged according to their morphological features and hours h or days dpf as described previously Kimmel et al. 1995,strain:AB|developmental stage:64 cell 2 hpf|tissue:embryo,GSM1112155,GSM1112155: 64 cell 2 hpf; Danio rerio; RNA Seq,GSM1112155 1,,1,,GEO Accession:GSM1112155,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ABI_SOLID,AB SOLiD System 3.0,,SRP020469,,,D_rerio_64cell_F3.csfasta.bz2 D_rerio_64cell_F3_QV.qual.bz2,SOLiD_native SOLiD_native,11793112050.0,235862241.0,GSM1112155 r1,0:50,0:2729453191;1:3189868180;2:3325229431;3:2482063391;.:66497857,50,,,,,,,,,SRX258160,SRS406291,SRA072427,GEO,Shanghai Chenshan Botanical Garden,1,0.56575,,0.01697,,0.8538,,0.48681,,50,,B,,usable mapping rate,legacy,early,unknown,poly_a,unknown,bulk,unknown,unknown,,China,2013-04-02,Cleavage,Embryo,Embryo Imprecise,All anatomical structures
36989,SRR870747,SRX288478,SRS431105,SRP023492,PRJNA206070,Nanog SoxB1 and Pou5f1/Oct4 regulate widespread zygotic gene activation during the maternal to zygotic transition,GSE47558,Other,Upon fertilization maternal factors direct development in a transcriptionally silent embryo. At the maternal to zygotic transition MZT a universal step in animal development unknown maternal factors trigger zygotic genome activation ZGA. In zebrafish ZGA is required for gastrulation and clearance of maternal mRNAs which is achieved in part by the conserved microRNA miR 430. However the precise factors that activate the zygotic program remain largely unknown. Here we show that Nanog Pou5f1 and SoxB1 are required for genome activation in zebrafish. We identified several hundred genes directly activated by maternal factors thus constituting the first wave of zygotic transcription in zebrafish. Ribosome profiling in the pre MZT embryo revealed that nanog sox19b and pou5f1 are the most highly translated transcription factor mRNAs. Combined loss of function for Nanog SoxB1 and Pou5f1 resulted in developmental arrest prior to gastrulation and a failure to activate >75% of zygotic genes. Furthermore we found that Nanog binds the miR 430 locus and together with Pou5f1 and SoxB1 initiate miR 430 expression and activity. Our results demonstrate that maternal Nanog Pou5f1 and SoxB1 are required to initiate the zygotic developmental program and in turn trigger the clearance of the maternal program by activating miR 430 expression. Overall design: Wild type and loss of function total mRNA sequencing of embryonic transcriptomes pre and post MZT; ribosome profiling pre MZT,,pubmed:24056933,,WT 2hpf Total mRNA,GSM1152440,,source name:WT 2hpf Total mRNA|tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA,WT 2hpf Total mRNA,Base calling was performed using CASAVA 1.8.2. For mRNA Seq raw reads were initially filtered by aligning permissively to a ribosomal DNA index and discarded using Bowtie v0.12.9 with switches seedlen 25 n 3 k 1 y e 10000. Unaligned reads were then aligned strand specific to the zebrafish Zv9 UCSC danRer7 genome sequence using Tophat v2.0.7 with default parameters. RPKMs for gene exons are calculated based on joined Ensembl r70 and RefSeq annotations for uniquely aligning reads. Metagenes with names in the form GeneX.GeneY are constructed for reads that do not align uniquely to either gene separately but align to both genes and nowhere else in the genome. The microRNA miR 430 polycistronic precursor is also listed as a meta gene called ‘mir 430 hairpin’. RPKMs for gene introns total RNA samples only are similarly calculated normalizing against the non repetitive sum length of a gene’s introns and the total number of aligned exonic reads in the sample. For Ribosome Profiling reads were trimmed of 3’ adapter sequence and reads in the trimmed length range 28 29nts were retained for ribosome protected fragments >=18nts for input mRNA. Reads were aligned as above retaining only uniquely aligned reads to the sense CDS sequences of protein coding genes. Note: traces of exogenous RNA corresponding to a nanog antisense probe and ntla sense and antisense were detected largely outside the expected size range; these reads were discarded. Gene counts for uniquely aligning reads to CDS regions are listed with respect to RefSeq transcript annotations. Genome build: Ensembl Zv9 / UCSC danRer7 Supplementary files format and content: RPKM tables for exons and introns for mRNA Seq; and RPKM tables for CDS regions for ribosome profiling generated as described above.,WT 2hpf Total mRNA,Treated embryos were injected at 1 cell stage for all treatements except cycloheximide which was applied by bathing 32 cell embryos and incubating at xxxdegreesC.,For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012.,,tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA,GSM1152440,GSM1152440: WT 2hpf Total mRNA; Danio rerio; RNA Seq,GSM1152440,,1,For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012.,GEO Accession:GSM1152440,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP023492,,,W2.run1_f0.fastq.gz,fastq,203106276.0,2672451.0,GSM1152440 r1,0:76,A:39556313;C:62215497;G:57574227;T:43753218;N:7021,76,,,,39556313,62215497,57574227,43753218,7021,SRX288478,SRS431105,SRA082637,GEO,"Giraldez Lab, Genetics, Yale University",1,0.89932,,0.14283,,0.79537,,0.6949,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,rrna_depletion,ribozero,bulk,unknown,unknown,,United States,2013-05-31,Cleavage,Embryo,Whole Organism,All anatomical structures
36990,SRR870748,SRX288478,SRS431105,SRP023492,PRJNA206070,Nanog SoxB1 and Pou5f1/Oct4 regulate widespread zygotic gene activation during the maternal to zygotic transition,GSE47558,Other,Upon fertilization maternal factors direct development in a transcriptionally silent embryo. At the maternal to zygotic transition MZT a universal step in animal development unknown maternal factors trigger zygotic genome activation ZGA. In zebrafish ZGA is required for gastrulation and clearance of maternal mRNAs which is achieved in part by the conserved microRNA miR 430. However the precise factors that activate the zygotic program remain largely unknown. Here we show that Nanog Pou5f1 and SoxB1 are required for genome activation in zebrafish. We identified several hundred genes directly activated by maternal factors thus constituting the first wave of zygotic transcription in zebrafish. Ribosome profiling in the pre MZT embryo revealed that nanog sox19b and pou5f1 are the most highly translated transcription factor mRNAs. Combined loss of function for Nanog SoxB1 and Pou5f1 resulted in developmental arrest prior to gastrulation and a failure to activate >75% of zygotic genes. Furthermore we found that Nanog binds the miR 430 locus and together with Pou5f1 and SoxB1 initiate miR 430 expression and activity. Our results demonstrate that maternal Nanog Pou5f1 and SoxB1 are required to initiate the zygotic developmental program and in turn trigger the clearance of the maternal program by activating miR 430 expression. Overall design: Wild type and loss of function total mRNA sequencing of embryonic transcriptomes pre and post MZT; ribosome profiling pre MZT,,pubmed:24056933,,WT 2hpf Total mRNA,GSM1152440,,source name:WT 2hpf Total mRNA|tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA,WT 2hpf Total mRNA,Base calling was performed using CASAVA 1.8.2. For mRNA Seq raw reads were initially filtered by aligning permissively to a ribosomal DNA index and discarded using Bowtie v0.12.9 with switches seedlen 25 n 3 k 1 y e 10000. Unaligned reads were then aligned strand specific to the zebrafish Zv9 UCSC danRer7 genome sequence using Tophat v2.0.7 with default parameters. RPKMs for gene exons are calculated based on joined Ensembl r70 and RefSeq annotations for uniquely aligning reads. Metagenes with names in the form GeneX.GeneY are constructed for reads that do not align uniquely to either gene separately but align to both genes and nowhere else in the genome. The microRNA miR 430 polycistronic precursor is also listed as a meta gene called ‘mir 430 hairpin’. RPKMs for gene introns total RNA samples only are similarly calculated normalizing against the non repetitive sum length of a gene’s introns and the total number of aligned exonic reads in the sample. For Ribosome Profiling reads were trimmed of 3’ adapter sequence and reads in the trimmed length range 28 29nts were retained for ribosome protected fragments >=18nts for input mRNA. Reads were aligned as above retaining only uniquely aligned reads to the sense CDS sequences of protein coding genes. Note: traces of exogenous RNA corresponding to a nanog antisense probe and ntla sense and antisense were detected largely outside the expected size range; these reads were discarded. Gene counts for uniquely aligning reads to CDS regions are listed with respect to RefSeq transcript annotations. Genome build: Ensembl Zv9 / UCSC danRer7 Supplementary files format and content: RPKM tables for exons and introns for mRNA Seq; and RPKM tables for CDS regions for ribosome profiling generated as described above.,WT 2hpf Total mRNA,Treated embryos were injected at 1 cell stage for all treatements except cycloheximide which was applied by bathing 32 cell embryos and incubating at xxxdegreesC.,For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012.,,tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA,GSM1152440,GSM1152440: WT 2hpf Total mRNA; Danio rerio; RNA Seq,GSM1152440,,1,For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012.,GEO Accession:GSM1152440,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP023492,,,W2.run1_f1.fastq.gz,fastq,304000000.0,4000000.0,GSM1152440 r2,0:76,A:59049134;C:93274080;G:86287062;T:65360620;N:29104,76,,,,59049134,93274080,86287062,65360620,29104,SRX288478,SRS431105,SRA082637,GEO,"Giraldez Lab, Genetics, Yale University",1,0.89775,,0.14047,,0.79492,,0.72145,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,rrna_depletion,ribozero,bulk,unknown,unknown,,United States,2013-05-31,Cleavage,Embryo,Whole Organism,All anatomical structures
36991,SRR870749,SRX288478,SRS431105,SRP023492,PRJNA206070,Nanog SoxB1 and Pou5f1/Oct4 regulate widespread zygotic gene activation during the maternal to zygotic transition,GSE47558,Other,Upon fertilization maternal factors direct development in a transcriptionally silent embryo. At the maternal to zygotic transition MZT a universal step in animal development unknown maternal factors trigger zygotic genome activation ZGA. In zebrafish ZGA is required for gastrulation and clearance of maternal mRNAs which is achieved in part by the conserved microRNA miR 430. However the precise factors that activate the zygotic program remain largely unknown. Here we show that Nanog Pou5f1 and SoxB1 are required for genome activation in zebrafish. We identified several hundred genes directly activated by maternal factors thus constituting the first wave of zygotic transcription in zebrafish. Ribosome profiling in the pre MZT embryo revealed that nanog sox19b and pou5f1 are the most highly translated transcription factor mRNAs. Combined loss of function for Nanog SoxB1 and Pou5f1 resulted in developmental arrest prior to gastrulation and a failure to activate >75% of zygotic genes. Furthermore we found that Nanog binds the miR 430 locus and together with Pou5f1 and SoxB1 initiate miR 430 expression and activity. Our results demonstrate that maternal Nanog Pou5f1 and SoxB1 are required to initiate the zygotic developmental program and in turn trigger the clearance of the maternal program by activating miR 430 expression. Overall design: Wild type and loss of function total mRNA sequencing of embryonic transcriptomes pre and post MZT; ribosome profiling pre MZT,,pubmed:24056933,,WT 2hpf Total mRNA,GSM1152440,,source name:WT 2hpf Total mRNA|tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA,WT 2hpf Total mRNA,Base calling was performed using CASAVA 1.8.2. For mRNA Seq raw reads were initially filtered by aligning permissively to a ribosomal DNA index and discarded using Bowtie v0.12.9 with switches seedlen 25 n 3 k 1 y e 10000. Unaligned reads were then aligned strand specific to the zebrafish Zv9 UCSC danRer7 genome sequence using Tophat v2.0.7 with default parameters. RPKMs for gene exons are calculated based on joined Ensembl r70 and RefSeq annotations for uniquely aligning reads. Metagenes with names in the form GeneX.GeneY are constructed for reads that do not align uniquely to either gene separately but align to both genes and nowhere else in the genome. The microRNA miR 430 polycistronic precursor is also listed as a meta gene called ‘mir 430 hairpin’. RPKMs for gene introns total RNA samples only are similarly calculated normalizing against the non repetitive sum length of a gene’s introns and the total number of aligned exonic reads in the sample. For Ribosome Profiling reads were trimmed of 3’ adapter sequence and reads in the trimmed length range 28 29nts were retained for ribosome protected fragments >=18nts for input mRNA. Reads were aligned as above retaining only uniquely aligned reads to the sense CDS sequences of protein coding genes. Note: traces of exogenous RNA corresponding to a nanog antisense probe and ntla sense and antisense were detected largely outside the expected size range; these reads were discarded. Gene counts for uniquely aligning reads to CDS regions are listed with respect to RefSeq transcript annotations. Genome build: Ensembl Zv9 / UCSC danRer7 Supplementary files format and content: RPKM tables for exons and introns for mRNA Seq; and RPKM tables for CDS regions for ribosome profiling generated as described above.,WT 2hpf Total mRNA,Treated embryos were injected at 1 cell stage for all treatements except cycloheximide which was applied by bathing 32 cell embryos and incubating at xxxdegreesC.,For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012.,,tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA,GSM1152440,GSM1152440: WT 2hpf Total mRNA; Danio rerio; RNA Seq,GSM1152440,,1,For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012.,GEO Accession:GSM1152440,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP023492,,,W2.run2_f0.fastq.gz,fastq,198979248.0,2618148.0,GSM1152440 r3,0:76,A:38850253;C:60847024;G:56292278;T:42982425;N:7268,76,,,,38850253,60847024,56292278,42982425,7268,SRX288478,SRS431105,SRA082637,GEO,"Giraldez Lab, Genetics, Yale University",1,0.90135,,0.14238,,0.79525,,0.72238,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,rrna_depletion,ribozero,bulk,unknown,unknown,,United States,2013-05-31,Cleavage,Embryo,Whole Organism,All anatomical structures
36992,SRR870750,SRX288478,SRS431105,SRP023492,PRJNA206070,Nanog SoxB1 and Pou5f1/Oct4 regulate widespread zygotic gene activation during the maternal to zygotic transition,GSE47558,Other,Upon fertilization maternal factors direct development in a transcriptionally silent embryo. At the maternal to zygotic transition MZT a universal step in animal development unknown maternal factors trigger zygotic genome activation ZGA. In zebrafish ZGA is required for gastrulation and clearance of maternal mRNAs which is achieved in part by the conserved microRNA miR 430. However the precise factors that activate the zygotic program remain largely unknown. Here we show that Nanog Pou5f1 and SoxB1 are required for genome activation in zebrafish. We identified several hundred genes directly activated by maternal factors thus constituting the first wave of zygotic transcription in zebrafish. Ribosome profiling in the pre MZT embryo revealed that nanog sox19b and pou5f1 are the most highly translated transcription factor mRNAs. Combined loss of function for Nanog SoxB1 and Pou5f1 resulted in developmental arrest prior to gastrulation and a failure to activate >75% of zygotic genes. Furthermore we found that Nanog binds the miR 430 locus and together with Pou5f1 and SoxB1 initiate miR 430 expression and activity. Our results demonstrate that maternal Nanog Pou5f1 and SoxB1 are required to initiate the zygotic developmental program and in turn trigger the clearance of the maternal program by activating miR 430 expression. Overall design: Wild type and loss of function total mRNA sequencing of embryonic transcriptomes pre and post MZT; ribosome profiling pre MZT,,pubmed:24056933,,WT 2hpf Total mRNA,GSM1152440,,source name:WT 2hpf Total mRNA|tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA,WT 2hpf Total mRNA,Base calling was performed using CASAVA 1.8.2. For mRNA Seq raw reads were initially filtered by aligning permissively to a ribosomal DNA index and discarded using Bowtie v0.12.9 with switches seedlen 25 n 3 k 1 y e 10000. Unaligned reads were then aligned strand specific to the zebrafish Zv9 UCSC danRer7 genome sequence using Tophat v2.0.7 with default parameters. RPKMs for gene exons are calculated based on joined Ensembl r70 and RefSeq annotations for uniquely aligning reads. Metagenes with names in the form GeneX.GeneY are constructed for reads that do not align uniquely to either gene separately but align to both genes and nowhere else in the genome. The microRNA miR 430 polycistronic precursor is also listed as a meta gene called ‘mir 430 hairpin’. RPKMs for gene introns total RNA samples only are similarly calculated normalizing against the non repetitive sum length of a gene’s introns and the total number of aligned exonic reads in the sample. For Ribosome Profiling reads were trimmed of 3’ adapter sequence and reads in the trimmed length range 28 29nts were retained for ribosome protected fragments >=18nts for input mRNA. Reads were aligned as above retaining only uniquely aligned reads to the sense CDS sequences of protein coding genes. Note: traces of exogenous RNA corresponding to a nanog antisense probe and ntla sense and antisense were detected largely outside the expected size range; these reads were discarded. Gene counts for uniquely aligning reads to CDS regions are listed with respect to RefSeq transcript annotations. Genome build: Ensembl Zv9 / UCSC danRer7 Supplementary files format and content: RPKM tables for exons and introns for mRNA Seq; and RPKM tables for CDS regions for ribosome profiling generated as described above.,WT 2hpf Total mRNA,Treated embryos were injected at 1 cell stage for all treatements except cycloheximide which was applied by bathing 32 cell embryos and incubating at xxxdegreesC.,For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012.,,tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA,GSM1152440,GSM1152440: WT 2hpf Total mRNA; Danio rerio; RNA Seq,GSM1152440,,1,For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012.,GEO Accession:GSM1152440,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP023492,,,W2.run2_f1.fastq.gz,fastq,304000000.0,4000000.0,GSM1152440 r4,0:76,A:59259860;C:93069912;G:86074433;T:65573954;N:21841,76,,,,59259860,93069912,86074433,65573954,21841,SRX288478,SRS431105,SRA082637,GEO,"Giraldez Lab, Genetics, Yale University",1,0.90021,,0.14063,,0.79531,,0.69776,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,rrna_depletion,ribozero,bulk,unknown,unknown,,United States,2013-05-31,Cleavage,Embryo,Whole Organism,All anatomical structures
37234,SRR1146564,SRX451693,SRS544829,SRP033369,PRJNA230112,PolyA tail profiling reveals an embryonic switch in translational control,GSE52809,Other,PolyA tails enhance the stability and translation of most eukaryotic messenger RNAs but difficulties in globally measuring polyA tail lengths have impeded greater understanding of polyA tail function. Here we describe polyA tail length profiling by sequencing PAL seq and apply it to measure tail lengths of millions of individual RNAs isolated from yeasts cell lines Arabidopsis thaliana leaves mouse liver and zebrafish and frog embryos. PolyA tail lengths were conserved between orthologous mRNAs with mRNAs encoding ribosomal proteins and other 'housekeeping' proteins tending to have shorter tails. As expected tail lengths were coupled to translational efficiencies in early zebrafish and frog embryos. However this strong coupling diminished at gastrulation and was absent in non embryonic samples indicating a rapid developmental switch in the nature of translational control. This switch complements an earlier switch to zygotic transcriptional control and explains why the predominant effect of microRNA mediated deadenylation concurrently shifts from translational repression to mRNA destabilization. Overall design: 64 samples from a variety of species,,pubmed:24476825,,Dre 155 2hpf PAL,GSM1316816,,tissue:zebrafish embryo|strain:AB|developmental stage:2 hpf,Dre 155 2hpf PAL,Raw read files were stripped of adaptor and mapped to the appropriate species' genome and/or transcriptome. RNA seq and ribosome profiling reads mapping within the coding sequence of an annotated gene excluding the first 50 nucleotides of the coding sequence were assigned to that gene and used to calculate its RPKM value. PolyA tail length measurements were generated using PAL seq tags that mapped within the three prime UTR of an annotated gene. Genome build: Human: hg18; Mouse: mm9; Zebrafish: danRer7; Drosophila: dm3; Arabidopsis: tair10; S. cerevisiae: sacCer3; S. pombe: Spombe1; Xenopus: Unigene Supplementary files format and content: One set of processed data files contains abundance and polyA tail length measurements for each gene. Another set contains raw fluorescence intensities for each base for each cycle of sequencing by synthesis and streptavidin flow in for each sequencing cluster. Another set contains normalized streptavidin fluorescence intensities for each sequencing cluster.,zebrafish embryo,RNA seq: Cytoplasmically enriched RNA was extracted polyA selected randomly fragmented by partial alkaline hydrolysis and then size selected RNA fragments were used for library preparation. Ribosome profiling: Cell extracts were processed as described in Subtelny et al. 2014 GSE52809. PAL seq: Polyadenylated ends in total RNA were ligated to a biotinylated adaptor then partially digested with RNase T1. The resulting fragments were size selected 104 750 nt captured on streptavidin beads and used for library preparation.,Libraries were constructed exactly as described in Subtelny et al. 2014 GSE52809,Each sample was grown or maintained in accordance with standard protocols.,strain:AB|developmental stage:2 hpf,GSM1316816,GSM1316816: Dre 155 2hpf PAL; Danio rerio; RNA Seq,GSM1316816,,1,Libraries were constructed exactly as described in Subtelny et al. 2014 GSE52809,GEO Accession:GSM1316816,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina Genome Analyzer II,,SRP033369,,,Dre_155_2hpf_PAL_sequences.txt.gz,fastq,359788448.0,8775328.0,GSM1316816 r1,0:41,A:85325483;C:54760617;G:79441969;T:135974691;N:4285688,41,,,,85325483,54760617,79441969,135974691,4285688,SRX451693,SRS544829,SRA114402,GEO,"Bartel, Biology, Whitehead Institute for Biomedical Research",1,0.55281,,0.12799,,0.85399,,0.57589,,41,,B,,usable mapping rate,illumina,early_illumina,3prime,small_rna,unknown,bulk,unknown,unknown,,United States,2014-01-29,Cleavage,Embryo,Embryo Imprecise,All anatomical structures
37235,SRR1146563,SRX451692,SRS544828,SRP033369,PRJNA230112,PolyA tail profiling reveals an embryonic switch in translational control,GSE52809,Other,PolyA tails enhance the stability and translation of most eukaryotic messenger RNAs but difficulties in globally measuring polyA tail lengths have impeded greater understanding of polyA tail function. Here we describe polyA tail length profiling by sequencing PAL seq and apply it to measure tail lengths of millions of individual RNAs isolated from yeasts cell lines Arabidopsis thaliana leaves mouse liver and zebrafish and frog embryos. PolyA tail lengths were conserved between orthologous mRNAs with mRNAs encoding ribosomal proteins and other 'housekeeping' proteins tending to have shorter tails. As expected tail lengths were coupled to translational efficiencies in early zebrafish and frog embryos. However this strong coupling diminished at gastrulation and was absent in non embryonic samples indicating a rapid developmental switch in the nature of translational control. This switch complements an earlier switch to zygotic transcriptional control and explains why the predominant effect of microRNA mediated deadenylation concurrently shifts from translational repression to mRNA destabilization. Overall design: 64 samples from a variety of species,,pubmed:24476825,,Dre 132 2hpf PAL,GSM1316815,,tissue:zebrafish embryo|strain:AB|developmental stage:2 hpf,Dre 132 2hpf PAL,Raw read files were stripped of adaptor and mapped to the appropriate species' genome and/or transcriptome. RNA seq and ribosome profiling reads mapping within the coding sequence of an annotated gene excluding the first 50 nucleotides of the coding sequence were assigned to that gene and used to calculate its RPKM value. PolyA tail length measurements were generated using PAL seq tags that mapped within the three prime UTR of an annotated gene. Genome build: Human: hg18; Mouse: mm9; Zebrafish: danRer7; Drosophila: dm3; Arabidopsis: tair10; S. cerevisiae: sacCer3; S. pombe: Spombe1; Xenopus: Unigene Supplementary files format and content: One set of processed data files contains abundance and polyA tail length measurements for each gene. Another set contains raw fluorescence intensities for each base for each cycle of sequencing by synthesis and streptavidin flow in for each sequencing cluster. Another set contains normalized streptavidin fluorescence intensities for each sequencing cluster.,zebrafish embryo,RNA seq: Cytoplasmically enriched RNA was extracted polyA selected randomly fragmented by partial alkaline hydrolysis and then size selected RNA fragments were used for library preparation. Ribosome profiling: Cell extracts were processed as described in Subtelny et al. 2014 GSE52809. PAL seq: Polyadenylated ends in total RNA were ligated to a biotinylated adaptor then partially digested with RNase T1. The resulting fragments were size selected 104 750 nt captured on streptavidin beads and used for library preparation.,Libraries were constructed exactly as described in Subtelny et al. 2014 GSE52809,Each sample was grown or maintained in accordance with standard protocols.,strain:AB|developmental stage:2 hpf,GSM1316815,GSM1316815: Dre 132 2hpf PAL; Danio rerio; RNA Seq,GSM1316815,,1,Libraries were constructed exactly as described in Subtelny et al. 2014 GSE52809,GEO Accession:GSM1316815,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina Genome Analyzer II,,SRP033369,,,Dre_132_2hpf_PAL_sequences.txt.gz,fastq,381247110.0,9298710.0,GSM1316815 r1,0:41,A:89344310;C:58798497;G:80235521;T:148523775;N:4345007,41,,,,89344310,58798497,80235521,148523775,4345007,SRX451692,SRS544828,SRA114402,GEO,"Bartel, Biology, Whitehead Institute for Biomedical Research",1,0.56455,,0.12077,,0.86628,,0.56964,,41,,B,,usable mapping rate,illumina,early_illumina,3prime,small_rna,unknown,bulk,unknown,unknown,,United States,2014-01-29,Cleavage,Embryo,Embryo Imprecise,All anatomical structures
37236,SRR1146562,SRX451691,SRS544827,SRP033369,PRJNA230112,PolyA tail profiling reveals an embryonic switch in translational control,GSE52809,Other,PolyA tails enhance the stability and translation of most eukaryotic messenger RNAs but difficulties in globally measuring polyA tail lengths have impeded greater understanding of polyA tail function. Here we describe polyA tail length profiling by sequencing PAL seq and apply it to measure tail lengths of millions of individual RNAs isolated from yeasts cell lines Arabidopsis thaliana leaves mouse liver and zebrafish and frog embryos. PolyA tail lengths were conserved between orthologous mRNAs with mRNAs encoding ribosomal proteins and other 'housekeeping' proteins tending to have shorter tails. As expected tail lengths were coupled to translational efficiencies in early zebrafish and frog embryos. However this strong coupling diminished at gastrulation and was absent in non embryonic samples indicating a rapid developmental switch in the nature of translational control. This switch complements an earlier switch to zygotic transcriptional control and explains why the predominant effect of microRNA mediated deadenylation concurrently shifts from translational repression to mRNA destabilization. Overall design: 64 samples from a variety of species,,pubmed:24476825,,Dre mock 2hpf PAL,GSM1316814,,tissue:zebrafish embryo|strain:AB|developmental stage:2 hpf,Dre mock 2hpf PAL,Raw read files were stripped of adaptor and mapped to the appropriate species' genome and/or transcriptome. RNA seq and ribosome profiling reads mapping within the coding sequence of an annotated gene excluding the first 50 nucleotides of the coding sequence were assigned to that gene and used to calculate its RPKM value. PolyA tail length measurements were generated using PAL seq tags that mapped within the three prime UTR of an annotated gene. Genome build: Human: hg18; Mouse: mm9; Zebrafish: danRer7; Drosophila: dm3; Arabidopsis: tair10; S. cerevisiae: sacCer3; S. pombe: Spombe1; Xenopus: Unigene Supplementary files format and content: One set of processed data files contains abundance and polyA tail length measurements for each gene. Another set contains raw fluorescence intensities for each base for each cycle of sequencing by synthesis and streptavidin flow in for each sequencing cluster. Another set contains normalized streptavidin fluorescence intensities for each sequencing cluster.,zebrafish embryo,RNA seq: Cytoplasmically enriched RNA was extracted polyA selected randomly fragmented by partial alkaline hydrolysis and then size selected RNA fragments were used for library preparation. Ribosome profiling: Cell extracts were processed as described in Subtelny et al. 2014 GSE52809. PAL seq: Polyadenylated ends in total RNA were ligated to a biotinylated adaptor then partially digested with RNase T1. The resulting fragments were size selected 104 750 nt captured on streptavidin beads and used for library preparation.,Libraries were constructed exactly as described in Subtelny et al. 2014 GSE52809,Each sample was grown or maintained in accordance with standard protocols.,strain:AB|developmental stage:2 hpf,GSM1316814,GSM1316814: Dre mock 2hpf PAL; Danio rerio; RNA Seq,GSM1316814,,1,Libraries were constructed exactly as described in Subtelny et al. 2014 GSE52809,GEO Accession:GSM1316814,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina Genome Analyzer II,,SRP033369,,,Dre_mock_2hpf_PAL_sequences.txt.gz,fastq,377647351.0,9210911.0,GSM1316814 r1,0:41,A:87549066;C:56716380;G:81391312;T:147721892;N:4268701,41,,,,87549066,56716380,81391312,147721892,4268701,SRX451691,SRS544827,SRA114402,GEO,"Bartel, Biology, Whitehead Institute for Biomedical Research",1,0.55884,,0.12609,,0.85731,,0.55373,,41,,B,,usable mapping rate,illumina,early_illumina,3prime,small_rna,unknown,bulk,unknown,unknown,,United States,2014-01-29,Cleavage,Embryo,Embryo Imprecise,All anatomical structures
37243,SRR1039875,SRX384685,SRS508883,SRP033369,PRJNA230112,PolyA tail profiling reveals an embryonic switch in translational control,GSE52809,Other,PolyA tails enhance the stability and translation of most eukaryotic messenger RNAs but difficulties in globally measuring polyA tail lengths have impeded greater understanding of polyA tail function. Here we describe polyA tail length profiling by sequencing PAL seq and apply it to measure tail lengths of millions of individual RNAs isolated from yeasts cell lines Arabidopsis thaliana leaves mouse liver and zebrafish and frog embryos. PolyA tail lengths were conserved between orthologous mRNAs with mRNAs encoding ribosomal proteins and other 'housekeeping' proteins tending to have shorter tails. As expected tail lengths were coupled to translational efficiencies in early zebrafish and frog embryos. However this strong coupling diminished at gastrulation and was absent in non embryonic samples indicating a rapid developmental switch in the nature of translational control. This switch complements an earlier switch to zygotic transcriptional control and explains why the predominant effect of microRNA mediated deadenylation concurrently shifts from translational repression to mRNA destabilization. Overall design: 64 samples from a variety of species,,pubmed:24476825,,Dre 155 2hpf RPF,GSM1276556,,tissue:zebrafish embryo|strain:AB|developmental stage:2 hpf,Dre 155 2hpf RPF,Raw read files were stripped of adaptor and mapped to the appropriate species' genome and/or transcriptome. RNA seq and ribosome profiling reads mapping within the coding sequence of an annotated gene excluding the first 50 nucleotides of the coding sequence were assigned to that gene and used to calculate its RPKM value. PolyA tail length measurements were generated using PAL seq tags that mapped within the three prime UTR of an annotated gene. Genome build: Human: hg18; Mouse: mm9; Zebrafish: danRer7; Drosophila: dm3; Arabidopsis: tair10; S. cerevisiae: sacCer3; S. pombe: Spombe1; Xenopus: Unigene Supplementary files format and content: One set of processed data files contains abundance and polyA tail length measurements for each gene. Another set contains raw fluorescence intensities for each base for each cycle of sequencing by synthesis and streptavidin flow in for each sequencing cluster. Another set contains normalized streptavidin fluorescence intensities for each sequencing cluster.,zebrafish embryo,RNA seq: Cytoplasmically enriched RNA was extracted polyA selected randomly fragmented by partial alkaline hydrolysis and then size selected RNA fragments were used for library preparation. Ribosome profiling: Cell extracts were processed as described in Subtelny et al. 2014 GSE52809. PAL seq: Polyadenylated ends in total RNA were ligated to a biotinylated adaptor then partially digested with RNase T1. The resulting fragments were size selected 104 750 nt captured on streptavidin beads and used for library preparation.,Libraries were constructed exactly as described in Subtelny et al. 2014 GSE52809,Each sample was grown or maintained in accordance with standard protocols.,strain:AB|developmental stage:2 hpf,GSM1276556,GSM1276556: Dre 155 2hpf RPF; Danio rerio; RNA Seq,GSM1276556,,1,Libraries were constructed exactly as described in Guo et al. 2010 GSE22004 RNA seq,GEO Accession:GSM1276556,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP033369,,,Dre_155_2hpf_RPF_GCCAAT-s_2_1_sequence.txt,fastq,1183731400.0,29593285.0,GSM1276556 r1,0:40,A:294292314;C:281794141;G:332579260;T:274773786;N:291899,40,,,,294292314,281794141,332579260,274773786,291899,SRX384685,SRS508883,SRA114402,GEO,"Bartel, Biology, Whitehead Institute for Biomedical Research",1,0.04234,,0.00777,,0.94795,,0.7945,,40,,B,,usable mapping rate,illumina,hiseq_era,3prime,small_rna,unknown,bulk,unknown,unknown,,United States,2013-11-27,Cleavage,Embryo,Embryo Imprecise,All anatomical structures
37244,SRR1039874,SRX384684,SRS508884,SRP033369,PRJNA230112,PolyA tail profiling reveals an embryonic switch in translational control,GSE52809,Other,PolyA tails enhance the stability and translation of most eukaryotic messenger RNAs but difficulties in globally measuring polyA tail lengths have impeded greater understanding of polyA tail function. Here we describe polyA tail length profiling by sequencing PAL seq and apply it to measure tail lengths of millions of individual RNAs isolated from yeasts cell lines Arabidopsis thaliana leaves mouse liver and zebrafish and frog embryos. PolyA tail lengths were conserved between orthologous mRNAs with mRNAs encoding ribosomal proteins and other 'housekeeping' proteins tending to have shorter tails. As expected tail lengths were coupled to translational efficiencies in early zebrafish and frog embryos. However this strong coupling diminished at gastrulation and was absent in non embryonic samples indicating a rapid developmental switch in the nature of translational control. This switch complements an earlier switch to zygotic transcriptional control and explains why the predominant effect of microRNA mediated deadenylation concurrently shifts from translational repression to mRNA destabilization. Overall design: 64 samples from a variety of species,,pubmed:24476825,,Dre 132 2hpf RPF,GSM1276555,,tissue:zebrafish embryo|strain:AB|developmental stage:2 hpf,Dre 132 2hpf RPF,Raw read files were stripped of adaptor and mapped to the appropriate species' genome and/or transcriptome. RNA seq and ribosome profiling reads mapping within the coding sequence of an annotated gene excluding the first 50 nucleotides of the coding sequence were assigned to that gene and used to calculate its RPKM value. PolyA tail length measurements were generated using PAL seq tags that mapped within the three prime UTR of an annotated gene. Genome build: Human: hg18; Mouse: mm9; Zebrafish: danRer7; Drosophila: dm3; Arabidopsis: tair10; S. cerevisiae: sacCer3; S. pombe: Spombe1; Xenopus: Unigene Supplementary files format and content: One set of processed data files contains abundance and polyA tail length measurements for each gene. Another set contains raw fluorescence intensities for each base for each cycle of sequencing by synthesis and streptavidin flow in for each sequencing cluster. Another set contains normalized streptavidin fluorescence intensities for each sequencing cluster.,zebrafish embryo,RNA seq: Cytoplasmically enriched RNA was extracted polyA selected randomly fragmented by partial alkaline hydrolysis and then size selected RNA fragments were used for library preparation. Ribosome profiling: Cell extracts were processed as described in Subtelny et al. 2014 GSE52809. PAL seq: Polyadenylated ends in total RNA were ligated to a biotinylated adaptor then partially digested with RNase T1. The resulting fragments were size selected 104 750 nt captured on streptavidin beads and used for library preparation.,Libraries were constructed exactly as described in Subtelny et al. 2014 GSE52809,Each sample was grown or maintained in accordance with standard protocols.,strain:AB|developmental stage:2 hpf,GSM1276555,GSM1276555: Dre 132 2hpf RPF; Danio rerio; RNA Seq,GSM1276555,,1,Libraries were constructed exactly as described in Guo et al. 2010 GSE22004 RNA seq,GEO Accession:GSM1276555,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP033369,,,Dre_132_2hpf_RPF_ACAGTG-s_2_1_sequence.txt,fastq,1178603560.0,29465089.0,GSM1276555 r1,0:40,A:298397078;C:284717833;G:331869329;T:263329002;N:290318,40,,,,298397078,284717833,331869329,263329002,290318,SRX384684,SRS508884,SRA114402,GEO,"Bartel, Biology, Whitehead Institute for Biomedical Research",1,0.05095,,0.00846,,0.94111,,0.79521,,40,,B,,usable mapping rate,illumina,hiseq_era,3prime,small_rna,unknown,bulk,unknown,unknown,,United States,2013-11-27,Cleavage,Embryo,Embryo Imprecise,All anatomical structures