rowid,run.accession,experiment.accession,sample.accession,study.accession,bioproject,study.title,study.alias,study.type,study.abstract,study.attributes,study.PMIDs,sample.description,sample.title,sample.alias,sample.centername,sample.attributes,GEOsample.title,GEOsample.dataprocessing,GEOsample.source,GEOsample.treatmentprotocol,GEOsample.extractprotocol,GEOsample.growthprotocol,GEOsample.characteristics,GEOsample.accession,experiment.title,experiment.alias,experiment.library_name,experiment.design_description,experiment.library_construction_protocol,experiment.attributes,experiment.library_strategy,experiment.library_source,experiment.library_selection,experiment.library_layout,experiment.platform,experiment.instrument_model,experiment.spot_descriptor,experiment.study_ref,run.title,run.attributes,run.filename,run.semantic_name,run.total_bases,run.total_spots,run.alias,run.read_lengths,run.base_counts,run.r1_length,run.r2_length,run.r3_length,run.r4_length,run.Acount,run.Ccount,run.Gcount,run.Tcount,run.Ncount,run.experiment,run.pool_member,submission.accession,submission.srasource,submission.bioprojectsource,seqdetective.n_mates,seqdetective.mapping_rate.mate1,seqdetective.mapping_rate.mate2,seqdetective.nofeature_rate.mate1,seqdetective.nofeature_rate.mate2,seqdetective.sparsity.mate1,seqdetective.sparsity.mate2,seqdetective.pos_strand_rate.mate1,seqdetective.pos_strand_rate.mate2,seqdetective.readlen.mate1,seqdetective.readlen.mate2,seqdetective.judgement.mate1,seqdetective.judgement.mate2,seqdetective.judgement.reason,platform_family,instrument_generation,read_bias,selection_class,prep_kit,sc_or_bulk,tech_class,technology,tech_variant,submission.bioprojectsource.country,earliest_date,devstage_curation,devstage_curation_coarse,tissue_curation,tissue_curation_coarse 88,DRR032736,DRX029542,DRS049941,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 100 individuals,Dr zfs:0000015 2,SAMD00028133,,sample name:Dr zfs:0000015 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:zfs:0000015|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028133,DRX029542,Dr zfs:0000015 2,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028133,,,,3129028500.0,31290285.0,DRR032736,0:100 1:0,A:849515903;C:721550282;G:717777586;T:840154982;N:29747,100,0,,,849515903,721550282,717777586,840154982,29747,DRX029542,DRS049941,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.92724,,0.07971,,0.74657,,0.47796,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Blastula,Embryo,Whole Organism,All anatomical structures 89,DRR032735,DRX029541,DRS049940,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 100 individuals,Dr zfs:0000015 1,SAMD00028132,,sample name:Dr zfs:0000015 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:zfs:0000015|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028132,DRX029541,Dr zfs:0000015 1,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028132,,,,4310219700.0,43102197.0,DRR032735,0:100 1:0,A:1169701983;C:993241399;G:986263558;T:1160969083;N:43677,100,0,,,1169701983,993241399,986263558,1160969083,43677,DRX029541,DRS049940,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.92609,,0.07773,,0.74349,,0.47849,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Blastula,Embryo,Whole Organism,All anatomical structures 8089,ERR034126,ERX012652,ERS032267,ERP000635,PRJEB2512,The Zebrafish transcriptome during early development,KI-BN-JKE-DRERIO-RNASEQ-2011,Transcriptome Analysis,Background: Zebrafish Danio rerio is an important model for the study of early vertebrate development. The transition from fertilized egg to embryo is accompanied by a multitude of changes in gene expression and the transcriptional events that underlie these processes have not been fully characterized. In this study we use RNA Seq to characterize and compare the transcriptome of four early developmental stages in zebrafish on a global scale. Results: An average of 79M total reads were detected from the different stages. Out of the total number of reads 65% 73% reads were successfully mapped to the zebrafish genome and 36% 44% out of those were uniquely mapped. The total number of detected unique gene transcripts was 11187 of which 10096 of these were already present at 1 cell stage. The largest number of common transcripts was observed between 1 cell stage and 16 cell stage. An enrichment of gene transcripts with molecular functions of DNA binding protein folding and processing as well as metal ion binding was observed with progression of development. To confirm our RNA Seq results and to further investigate the developmental expression of specific genes the transcript levels of a subset of genes were analyzed using TaqMan® array micro fluidic card TLDA. Conclusion: Clustering analysis of the detected transcripts show a majority of gene transcripts being present at steady levels with a minority of the gene transcripts clustering as increasing or decreasing in expression during development. Developmental stages pre MBT were similar when comparing highly expressed genes whereas 50% epiboly stage differed from the earlier three stages in highly expressed genes number of uniquely expressed genes and enrichment of GO molecular functions.,,,RNA extracted from zebrafish embryo at 512 cell stage,zebrafish embryo 512 cell,SAMEA791632,"Department of Biosciences and Nutrition, Karolinska Institutet, Sweden",ENA first public:2011 06 09|ENA last update:2018 03 08|External Id:SAMEA791632|INSDC center alias:KI BN|INSDC center name:Department of Biosciences and Nutrition Karolinska Institutet Sweden|INSDC first public:2011 06 09T11:04:10Z|INSDC last update:2018 03 08T15:26:39Z|INSDC status:public|Submitter Id:KI BN JKE DRERIO RNASEQ 2011 512cell|common name:zebrafish|sample name:KI BN JKE DRERIO RNASEQ 2011 512cell|sex:mixed|strain:Tuebingen,,,,,,,,,Transcriptome profiling of early zebrafish development,KI BN JKE DRERIO RNASEQ 2011 512cell,JKE Drerio rna seq,Transcriptome profiling of 512 cell stage of zebrafish embryos.,Total RNA was extracted from approximately 150 embryos per developmental stage using Trireagent Sigma Aldrich. The total RNA was then processed further according to the Small RNA Expression Kit Applied Biosystems.,,RNA-Seq,TRANSCRIPTOMIC,RANDOM,SINGLE,ABI_SOLID,AB SOLiD System 3.0,500Application ReadForward1,ERP000635,AB SOLiD System 3.0 sequencing; Transcriptome profiling of early zebrafish development,ENA FIRST PUBLIC:2011 06 09|ENA LAST UPDATE:2018 11 16,KI-BN-JKE-DRERIO-RNASEQ-2011-512cell.csfasta.gz KI-BN-JKE-DRERIO-RNASEQ-2011-512cell_QV.qual.gz,SOLiD_native SOLiD_native,3918756250.0,78375125.0,KI BN JKE DRERIO RNASEQ 2011 512cell,0:50,,50,,,,,,,,,ERX012652,ERS032267,ERA029959,KI-BN|Department of Biosciences and Nutrition,"Department of Biosciences and Nutrition, Karolinska Institutet, Sweden",1,0.63824,,0.09111,,0.91969,,0.73496,,50,,B,,usable mapping rate,legacy,early,unknown,random_priming,unknown,bulk,unknown,unknown,,Sweden,2011-06-09,Blastula,Embryo,Embryo Imprecise,All anatomical structures 9723,ERR3841996,ERX3854558,ERS3556001,ERP116106,PRJEB33323,Deconstructing the individual steps of vertebrate translation initiation,ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422,Other,In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate.,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03,,,Sphere 3,SAMEA5752542,Computational Biology Unit,ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752542|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:5|common name:zebrafish|dev stage:Sphere|sample name:5|scientific name:Danio rerio,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT Computational Biology Unit 27 01 2020 16:24:36:406 6,Sphere 3,OTHER,RNA Seq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 500,,ERP116106,NextSeq 500 sequencing,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2020 02 14,,,1439954368.0,18946768.0,ena RUN Computational Biology Unit 27 01 2020 16:24:36:406 6,0:76,A:669362698;C:280496524;G:316727778;T:173353505;N:13863,76,,,,669362698,280496524,316727778,173353505,13863,ERX3854558,ERS3556001,ERA2359305,Computational Biology Unit|European Nucleotide Archive,Computational Biology Unit,1,0.26155,,0.12068,,0.96915,,0.45719,,76,,B,,usable mapping rate,illumina,nextseq,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2019-07-03,Blastula,Embryo,Undetermined,Embryo Imprecise 9724,ERR3841995,ERX3854557,ERS3556000,ERP116106,PRJEB33323,Deconstructing the individual steps of vertebrate translation initiation,ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422,Other,In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate.,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03,,,Sphere 2,SAMEA5752541,Computational Biology Unit,ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752541|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:4|common name:zebrafish|dev stage:Sphere|sample name:4|scientific name:Danio rerio,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT Computational Biology Unit 27 01 2020 16:24:36:406 5,Sphere 2,OTHER,RNA Seq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 500,,ERP116106,NextSeq 500 sequencing,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2020 02 14,,,1592272200.0,20950950.0,ena RUN Computational Biology Unit 27 01 2020 16:24:36:406 5,0:76,A:757507948;C:308394094;G:342142775;T:184211881;N:15502,76,,,,757507948,308394094,342142775,184211881,15502,ERX3854557,ERS3556000,ERA2359305,Computational Biology Unit|European Nucleotide Archive,Computational Biology Unit,1,0.22483,,0.10923,,0.97646,,0.49458,,76,,B,,usable mapping rate,illumina,nextseq,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2019-07-03,Blastula,Embryo,Undetermined,Embryo Imprecise 9725,ERR3841994,ERX3854556,ERS3555999,ERP116106,PRJEB33323,Deconstructing the individual steps of vertebrate translation initiation,ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422,Other,In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate.,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03,,,Sphere 1,SAMEA5752540,Computational Biology Unit,ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752540|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:3|common name:zebrafish|dev stage:Sphere|sample name:3|scientific name:Danio rerio,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT Computational Biology Unit 27 01 2020 16:24:36:406 4,Sphere 1,OTHER,RNA Seq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 500,,ERP116106,NextSeq 500 sequencing,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2020 02 14,,,1332363676.0,17531101.0,ena RUN Computational Biology Unit 27 01 2020 16:24:36:406 4,0:76,A:529354355;C:299445923;G:318745973;T:184804260;N:13165,76,,,,529354355,299445923,318745973,184804260,13165,ERX3854556,ERS3555999,ERA2359305,Computational Biology Unit|European Nucleotide Archive,Computational Biology Unit,1,0.21197,,0.0829,,0.98196,,0.55753,,76,,B,,usable mapping rate,illumina,nextseq,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2019-07-03,Blastula,Embryo,Undetermined,Embryo Imprecise 9752,ERR3489858,ERX3511273,ERS3556001,ERP116106,PRJEB33323,Deconstructing the individual steps of vertebrate translation initiation,ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422,Other,In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate.,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03,,,Sphere 3,SAMEA5752542,Computational Biology Unit,ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752542|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:5|common name:zebrafish|dev stage:Sphere|sample name:5|scientific name:Danio rerio,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT Computational Biology Unit 22 08 2019 11:57:43:424 10,Sphere 3 LSU,None,RCP seq,,OTHER,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 500,,ERP116106,NextSeq 500 sequencing,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 08 22,,,2740392724.0,36057799.0,ena RUN Computational Biology Unit 22 08 2019 11:57:43:424 10,0:76,A:1790452280;C:354001675;G:431182140;T:164697730;N:58899,76,,,,1790452280,354001675,431182140,164697730,58899,ERX3511273,ERS3556001,ERA2100634,Computational Biology Unit|European Nucleotide Archive,Computational Biology Unit,1,0.87154,,0.5323,,0.99793,,0.02983,,76,,B,,usable mapping rate,illumina,nextseq,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2019-07-03,Blastula,Embryo,Undetermined,Embryo Imprecise 9753,ERR3489857,ERX3511272,ERS3556001,ERP116106,PRJEB33323,Deconstructing the individual steps of vertebrate translation initiation,ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422,Other,In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate.,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03,,,Sphere 3,SAMEA5752542,Computational Biology Unit,ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752542|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:5|common name:zebrafish|dev stage:Sphere|sample name:5|scientific name:Danio rerio,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT Computational Biology Unit 22 08 2019 11:57:43:424 9,Sphere 3 SSU,None,RCP seq,,OTHER,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 500,,ERP116106,NextSeq 500 sequencing,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 08 22,,,6277242192.0,82595292.0,ena RUN Computational Biology Unit 22 08 2019 11:57:43:424 9,0:76,A:3129446012;C:1311888416;G:1369035262;T:466745503;N:126999,76,,,,3129446012,1311888416,1369035262,466745503,126999,ERX3511272,ERS3556001,ERA2100634,Computational Biology Unit|European Nucleotide Archive,Computational Biology Unit,1,0.65637,,0.35975,,0.9936,,0.24734,,76,,B,,usable mapping rate,illumina,nextseq,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2019-07-03,Blastula,Embryo,Undetermined,Embryo Imprecise 9754,ERR3489856,ERX3511271,ERS3556000,ERP116106,PRJEB33323,Deconstructing the individual steps of vertebrate translation initiation,ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422,Other,In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate.,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03,,,Sphere 2,SAMEA5752541,Computational Biology Unit,ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752541|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:4|common name:zebrafish|dev stage:Sphere|sample name:4|scientific name:Danio rerio,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT Computational Biology Unit 22 08 2019 11:57:43:424 8,Sphere 2 LSU,None,RCP seq,,OTHER,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 500,,ERP116106,NextSeq 500 sequencing,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 08 24,,,6679993476.0,87894651.0,ena RUN Computational Biology Unit 22 08 2019 11:57:43:424 8,0:76,A:3113787833;C:1255798935;G:1750515950;T:559763997;N:126761,76,,,,3113787833,1255798935,1750515950,559763997,126761,ERX3511271,ERS3556000,ERA2100634,Computational Biology Unit|European Nucleotide Archive,Computational Biology Unit,1,0.66287,,0.41208,,0.99602,,0.17083,,76,,B,,usable mapping rate,illumina,nextseq,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2019-07-03,Blastula,Embryo,Undetermined,Embryo Imprecise 9755,ERR3489855,ERX3511270,ERS3556000,ERP116106,PRJEB33323,Deconstructing the individual steps of vertebrate translation initiation,ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422,Other,In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate.,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03,,,Sphere 2,SAMEA5752541,Computational Biology Unit,ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752541|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:4|common name:zebrafish|dev stage:Sphere|sample name:4|scientific name:Danio rerio,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT Computational Biology Unit 22 08 2019 11:57:43:423 7,Sphere 2 SSU,None,RCP seq,,OTHER,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 500,,ERP116106,NextSeq 500 sequencing,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 08 22,,,13238731764.0,174193839.0,ena RUN Computational Biology Unit 22 08 2019 11:57:43:424 7,0:76,A:7630016769;C:1835321568;G:2775223283;T:997916159;N:253985,76,,,,7630016769,1835321568,2775223283,997916159,253985,ERX3511270,ERS3556000,ERA2100634,Computational Biology Unit|European Nucleotide Archive,Computational Biology Unit,1,0.77269,,0.45994,,0.99683,,0.04249,,76,,B,,usable mapping rate,illumina,nextseq,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2019-07-03,Blastula,Embryo,Undetermined,Embryo Imprecise 9756,ERR3489854,ERX3511269,ERS3555999,ERP116106,PRJEB33323,Deconstructing the individual steps of vertebrate translation initiation,ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422,Other,In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate.,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03,,,Sphere 1,SAMEA5752540,Computational Biology Unit,ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752540|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:3|common name:zebrafish|dev stage:Sphere|sample name:3|scientific name:Danio rerio,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT Computational Biology Unit 22 08 2019 11:57:43:423 6,Sphere 1 LSU,None,RCP seq,,OTHER,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 500,,ERP116106,NextSeq 500 sequencing,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 08 24,,,3311799332.0,43576307.0,ena RUN Computational Biology Unit 22 08 2019 11:57:43:423 6,0:76,A:1182325939;C:888677953;G:922571204;T:318159754;N:64482,76,,,,1182325939,888677953,922571204,318159754,64482,ERX3511269,ERS3555999,ERA2100634,Computational Biology Unit|European Nucleotide Archive,Computational Biology Unit,1,0.57505,,0.24459,,0.99582,,0.43365,,76,,B,,usable mapping rate,illumina,nextseq,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2019-07-03,Blastula,Embryo,Undetermined,Embryo Imprecise 9757,ERR3489853,ERX3511268,ERS3555999,ERP116106,PRJEB33323,Deconstructing the individual steps of vertebrate translation initiation,ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422,Other,In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate.,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03,,,Sphere 1,SAMEA5752540,Computational Biology Unit,ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752540|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:3|common name:zebrafish|dev stage:Sphere|sample name:3|scientific name:Danio rerio,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT Computational Biology Unit 22 08 2019 11:57:43:423 5,Sphere 1 SSU,None,RCP seq,,OTHER,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 500,,ERP116106,NextSeq 500 sequencing,ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 08 22,,,7403181508.0,97410283.0,ena RUN Computational Biology Unit 22 08 2019 11:57:43:423 5,0:76,A:4338227974;C:1233250165;G:1372229712;T:459322295;N:151362,76,,,,4338227974,1233250165,1372229712,459322295,151362,ERX3511268,ERS3555999,ERA2100634,Computational Biology Unit|European Nucleotide Archive,Computational Biology Unit,1,0.765,,0.44747,,0.99515,,0.12467,,76,,B,,usable mapping rate,illumina,nextseq,unknown,other,unknown,bulk,unknown,unknown,,Unknown,2019-07-03,Blastula,Embryo,Undetermined,Embryo Imprecise 10212,ERR6511331,ERX6138167,ERS7264190,ERP131213,PRJEB46978,Nano3P seq: transcriptome wide analysis of gene expression and tail dynamics using end capture nanopore sequencing,ena-STUDY-CENTER FOR GENOMIC REGULATION (CRG)-12-08-2021-14:48:52:906-1159,Other,Nano3P seq is a simple and robust method to accurately estimate transcript levels tail lengths and tail nucleotide composition information in full length individual reads with minimal library preparation biases both in the coding and non coding transcriptome.,ENA FIRST PUBLIC:2023 12 28|ENA LAST UPDATE:2023 12 28,,Zebrafish Nano3P seq of PolyA selected sample biological replicate 1 including 4 hpf RNA,Zebrafish PolyA 4 hpf,SAMEA9541420,CENTER FOR GENOMIC REGULATION (CRG),ENA FIRST PUBLIC:2023 12 28T01:07:23Z|ENA LAST UPDATE:2023 12 28T01:07:23Z|External Id:SAMEA9541420|INSDC center name:CENTER FOR GENOMIC REGULATION CRG|INSDC first public:2023 12 28T01:07:23Z|INSDC last update:2023 12 28T01:07:23Z|INSDC status:public|Submitter Id:Zebrafish PolyA 4 hpf|common name:zebrafish|sample name:Zebrafish PolyA 4 hpf|scientific name:Danio rerio,,,,,,,,,MinION sequencing,ena EXPERIMENT CENTER FOR GENOMIC REGULATION CRG 17 08 2021 13:09:55:665 5,cDNA8523612,Nano3P seq,Nano3P seq,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,OXFORD_NANOPORE,MinION,,ERP131213,MinION sequencing,ENA FIRST PUBLIC:2023 12 28|ENA LAST UPDATE:2023 12 28,zebrafish_polya_4hpf.tar.gz,nanopore,330562220.0,233101.0,ena RUN CENTER FOR GENOMIC REGULATION CRG 17 08 2021 13:09:55:665 5,0:1418.11,A:86572446;C:74232962;G:69203462;T:100553350;N:0,1418,,,,86572446,74232962,69203462,100553350,0,ERX6138167,ERS7264190,ERA5757997,CENTER FOR GENOMIC REGULATION (CRG)|European Nucleotide Archive,CENTER FOR GENOMIC REGULATION (CRG),1,0.0,,0.0,,1.0,,,,1536,,T,,long read,ont,ont,full_length,poly_a,unknown,bulk,unknown,unknown,,Spain,2023-12-28,Blastula,Embryo,Undetermined,Embryo Imprecise 10214,ERR6617900,ERX6244443,ERS7291130,ERP131213,PRJEB46978,Nano3P seq: transcriptome wide analysis of gene expression and tail dynamics using end capture nanopore sequencing,ena-STUDY-CENTER FOR GENOMIC REGULATION (CRG)-12-08-2021-14:48:52:906-1159,Other,Nano3P seq is a simple and robust method to accurately estimate transcript levels tail lengths and tail nucleotide composition information in full length individual reads with minimal library preparation biases both in the coding and non coding transcriptome.,ENA FIRST PUBLIC:2023 12 28|ENA LAST UPDATE:2023 12 28,,PolyA selected dRNA sequenced zebrafish 4hpf RNA,Zebrafish 4hpf dRNA,SAMEA9568396,CENTER FOR GENOMIC REGULATION (CRG),ENA FIRST PUBLIC:2023 12 28T01:07:30Z|ENA LAST UPDATE:2023 12 28T01:07:30Z|External Id:SAMEA9568396|INSDC center name:CENTER FOR GENOMIC REGULATION CRG|INSDC first public:2023 12 28T01:07:30Z|INSDC last update:2023 12 28T01:07:30Z|INSDC status:public|Submitter Id:Zebrafish 4hpf dRNA1|common name:zebrafish|sample name:Zebrafish 4hpf dRNA1|scientific name:Danio rerio,,,,,,,,,MinION sequencing,ena EXPERIMENT CENTER FOR GENOMIC REGULATION CRG 03 09 2021 14:33:13:450 1,dRNA Zebrafish,Direct RNA Sequencing,Direct RNA Sequencing,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,OXFORD_NANOPORE,MinION,,ERP131213,MinION sequencing,ENA FIRST PUBLIC:2023 12 28|ENA LAST UPDATE:2023 12 28,Zebrafish_4hpf_dRNA.fast5.tar.gz,nanopore,772304625.0,897768.0,ena RUN CENTER FOR GENOMIC REGULATION CRG 03 09 2021 14:33:13:450 1,0:860.25,A:224977035;C:165273397;G:156659356;T:225394837;N:0,860,,,,224977035,165273397,156659356,225394837,0,ERX6244443,ERS7291130,ERA5995143,CENTER FOR GENOMIC REGULATION (CRG)|European Nucleotide Archive,CENTER FOR GENOMIC REGULATION (CRG),1,0.5,,0.0,,0.99997,,1.0,,962,,T,,long read,ont,ont,full_length,poly_a,unknown,bulk,unknown,unknown,,Spain,2023-12-28,Blastula,Embryo,Undetermined,Embryo Imprecise 11041,ERR9995536,ERX9536682,ERS12521224,ERP138294,PRJEB53494,Nano3P seq: transcriptome wide analysis of gene expression and tail dynamics using end capture nanopore cDNA sequencing,94bf5509-4622-4d5f-b7c5-6a14bdfac340,Other,RNA polyadenylation plays a central role in RNA maturation fate and stability. In response to developmental cues polyA tail lengths can vary affecting the translation efficiency and stability of mRNAs. Here we develop Nanopore three prime end capture sequencing Nano3P seq a novel method that relies on nanopore cDNA sequencing to simultaneously quantify RNA abundance tail composition and tail length dynamics at per read resolution. By employing a template switching based sequencing protocol Nano3P seq can sequence any given RNA molecule from its three prime end regardless of its polyadenylation status without xxx need for PCR amplification or ligation of RNA adapters. We demonstrate that Nano3P seq captures a wide diversity of RNA biotypes providing quantitative estimates of RNA abundance and tail lengths in mRNA lncRNA sn/snoRNA scaRNA and rRNA molecules. We find that in addition to mRNA and lncRNA polyA tails can be identified in 16S mitochondrial rRNA in both mouse and zebrafish models. Moreover we show that mRNA tail lengths are dynamically regulated during vertebrate embryogenesis at an isoform specific level correlating with mRNA decay. Finally we identify non A bases within polyA tails of various lengths and reveal their distribution during vertebrate embryogenesis. Overall Nano3P seq is a simple and robust method for accurately estimating transcript levels tail lengths and tail composition heterogeneity in individual reads with minimal library preparation biases both in the coding and non coding transcriptome.,ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10,,dRNA seq of 4hpf Zebrafish embryos,Zebrafish dRNA 4hpf,SAMEA110422854,CENTER FOR GENOMIC REGULATION (CRG),ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10|External Id:SAMEA110422854|INSDC center alias:CENTER FOR GENOMIC REGULATION CRG|INSDC center name:CENTER FOR GENOMIC REGULATION CRG|INSDC first public:2022 10 10T00:21:01Z|INSDC last update:2022 10 10T00:21:01Z|INSDC status:public|Submitter Id:Zebrafish dRNA 4hpf|common name:zebrafish|sample name:Zebrafish dRNA 4hpf,,,,,,,,,MinION sequencing,ena EXPERIMENT TAB 27 07 2022 11:41:43:673 3,Zebrafish dRNA 4hpf,1,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,OXFORD_NANOPORE,MinION,,ERP138294,MinION sequencing,ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10|instrument model:PromethION,PDBN042841_dRNA_4hpf.tar.gz,nanopore,772304625.0,897768.0,ena RUN TAB 27 07 2022 11:41:43:690 4,0:860.25,A:224977035;C:165273397;G:156659356;T:225394837;N:0,860,,,,224977035,165273397,156659356,225394837,0,ERX9536682,ERS12521224,ERA16500713,CENTER FOR GENOMIC REGULATION (CRG)|European Nucleotide Archive,CENTER FOR GENOMIC REGULATION (CRG),,,,,,,,,,,,,,,ont,ont,3prime,poly_a,unknown,bulk,unknown,unknown,,Spain,2022-10-10,Blastula,Embryo,Embryo Imprecise,All anatomical structures 11045,ERR9839778,ERX9385635,ERS12199235,ERP138294,PRJEB53494,Nano3P seq: transcriptome wide analysis of gene expression and tail dynamics using end capture nanopore cDNA sequencing,94bf5509-4622-4d5f-b7c5-6a14bdfac340,Other,RNA polyadenylation plays a central role in RNA maturation fate and stability. In response to developmental cues polyA tail lengths can vary affecting the translation efficiency and stability of mRNAs. Here we develop Nanopore three prime end capture sequencing Nano3P seq a novel method that relies on nanopore cDNA sequencing to simultaneously quantify RNA abundance tail composition and tail length dynamics at per read resolution. By employing a template switching based sequencing protocol Nano3P seq can sequence any given RNA molecule from its three prime end regardless of its polyadenylation status without xxx need for PCR amplification or ligation of RNA adapters. We demonstrate that Nano3P seq captures a wide diversity of RNA biotypes providing quantitative estimates of RNA abundance and tail lengths in mRNA lncRNA sn/snoRNA scaRNA and rRNA molecules. We find that in addition to mRNA and lncRNA polyA tails can be identified in 16S mitochondrial rRNA in both mouse and zebrafish models. Moreover we show that mRNA tail lengths are dynamically regulated during vertebrate embryogenesis at an isoform specific level correlating with mRNA decay. Finally we identify non A bases within polyA tails of various lengths and reveal their distribution during vertebrate embryogenesis. Overall Nano3P seq is a simple and robust method for accurately estimating transcript levels tail lengths and tail composition heterogeneity in individual reads with minimal library preparation biases both in the coding and non coding transcriptome.,ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10,,Zebrafish PolyA Selected RNA 4hpf,Zebrafish pA selected,SAMEA110100410,CENTER FOR GENOMIC REGULATION (CRG),ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10|External Id:SAMEA110100410|INSDC center alias:CENTER FOR GENOMIC REGULATION CRG|INSDC center name:CENTER FOR GENOMIC REGULATION CRG|INSDC first public:2022 10 10T00:20:53Z|INSDC last update:2022 10 10T00:20:53Z|INSDC status:public|Submitter Id:Zebrafish pA selected|common name:zebrafish|sample name:Zebrafish pA selected,,,,,,,,,MinION sequencing,ena EXPERIMENT TAB 13 06 2022 16:07:52:807 811,cDNA852361 ZFPA4R1,1,,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,OXFORD_NANOPORE,MinION,,ERP138294,MinION sequencing,ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10,cDNA852361_ZFPA4R1.tar.gz,nanopore,348224822.0,233101.0,ena RUN TAB 13 06 2022 16:07:52:807 812,0:1493.88,A:88963756;C:76104775;G:73909507;T:109246784;N:0,1493,,,,88963756,76104775,73909507,109246784,0,ERX9385635,ERS12199235,ERA15547404,CENTER FOR GENOMIC REGULATION (CRG)|European Nucleotide Archive,CENTER FOR GENOMIC REGULATION (CRG),1,0.34147,,0.26829,,0.99993,,0.16666,,1537,,T,,long read,ont,ont,3prime,poly_a,unknown,bulk,unknown,unknown,,Spain,2022-10-10,Blastula,Embryo,Undetermined,Embryo Imprecise 24548,ERR964669,ERX1041632,ERS792103,ERP011038,PRJEB9889,The Zebrafish transcriptome during early development,ena-STUDY-KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION-15-07-2015-15:13:51:747-22,Other,Zebrafish has emerged as a model organism to investigate vertebrate development and human genetic diseases. However currently zebrafish annotation is still ongoing and clearly not sufficed therefore providing opportunity for novel transcript finding. With the introduction of massive parallel sequencing whole transcriptome investigations became possible through assembling entire transcriptome from overlapped sequencing reads. In the study we were aiming to discover novel transcribed regions NTRs using data from RNA sequencing. We have developed an in house bioinformatics pipeline for NTR discovery. Using the pipeline we detected 165 putative NTRs which could involve in early zebrafish development and not annotated anywhere. Six randomly selected NTRs were successfully validated experimentally using RT PCR. These NTRs provided new candidates for zebrafish transcriptome studies and zebrafish genome annotation.,,,,KI BN JKE DRERIO RNASEQ,SAMEA3484818,KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION,ENA first public:2015 07 16|ENA last update:2015 07 15|External Id:SAMEA3484818|INSDC center alias:KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION|INSDC center name:KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION|INSDC first public:2015 07 16T15:54:30Z|INSDC last update:2015 07 15T15:02:15Z|INSDC status:public|Submitter Id:KI BN JKE DRERIO RNASEQ 2009 512cell|common name:zebrafish|dev stage:512 cell|sample name:KI BN JKE DRERIO RNASEQ 2009 512cell|strain:Tuebingen,,,,,,,,,AB SOLiD System 3.0 sequencing,ena EXPERIMENT KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION 15 07 2015 15:13:47:871 3,unspecified,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ABI_SOLID,AB SOLiD System 3.0,,ERP011038,AB SOLiD System 3.0 sequencing,ENA FIRST PUBLIC:2015 07 16|ENA LAST UPDATE:2018 11 16,KI-BN-JKE-DRERIO-RNASEQ-20090709-512cell_F3.csfasta.gz KI-BN-JKE-DRERIO-RNASEQ-20090709-512cell_F3_QV.qual.gz,SOLiD_native SOLiD_native,5452772750.0,109055455.0,ena RUN KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION 15 07 2015 15:13:47:871 3,0:50,0:1391108289;1:1312099760;2:1551659810;3:1179923010;.:17981881,50,,,,,,,,,ERX1041632,ERS792103,ERA458495,KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION|European Nucleotide Archive,KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION,1,0.73133,,0.07897,,0.88057,,0.63645,,50,,B,,usable mapping rate,legacy,early,full_length,random_priming,unknown,bulk,unknown,unknown,,Sweden,2015-07-15,Blastula,Embryo,Undetermined,Embryo Imprecise 24552,ERR964673,ERX1041636,ERS792103,ERP011038,PRJEB9889,The Zebrafish transcriptome during early development,ena-STUDY-KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION-15-07-2015-15:13:51:747-22,Other,Zebrafish has emerged as a model organism to investigate vertebrate development and human genetic diseases. However currently zebrafish annotation is still ongoing and clearly not sufficed therefore providing opportunity for novel transcript finding. With the introduction of massive parallel sequencing whole transcriptome investigations became possible through assembling entire transcriptome from overlapped sequencing reads. In the study we were aiming to discover novel transcribed regions NTRs using data from RNA sequencing. We have developed an in house bioinformatics pipeline for NTR discovery. Using the pipeline we detected 165 putative NTRs which could involve in early zebrafish development and not annotated anywhere. Six randomly selected NTRs were successfully validated experimentally using RT PCR. These NTRs provided new candidates for zebrafish transcriptome studies and zebrafish genome annotation.,,,,KI BN JKE DRERIO RNASEQ,SAMEA3484818,KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION,ENA first public:2015 07 16|ENA last update:2015 07 15|External Id:SAMEA3484818|INSDC center alias:KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION|INSDC center name:KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION|INSDC first public:2015 07 16T15:54:30Z|INSDC last update:2015 07 15T15:02:15Z|INSDC status:public|Submitter Id:KI BN JKE DRERIO RNASEQ 2009 512cell|common name:zebrafish|dev stage:512 cell|sample name:KI BN JKE DRERIO RNASEQ 2009 512cell|strain:Tuebingen,,,,,,,,,AB SOLiD System 3.0 sequencing,ena EXPERIMENT KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION 15 07 2015 15:13:47:872 7,unspecified,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ABI_SOLID,AB SOLiD System 3.0,,ERP011038,AB SOLiD System 3.0 sequencing,ENA FIRST PUBLIC:2015 07 16|ENA LAST UPDATE:2018 11 16,KI-BN-JKE-DRERIO-RNASEQ-20091014-512cell_F3.csfasta.gz KI-BN-JKE-DRERIO-RNASEQ-20091014-512cell_F3_QV.qual.gz,SOLiD_native SOLiD_native,2027760000.0,40555200.0,ena RUN KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION 15 07 2015 15:13:47:872 7,0:50,0:511413081;1:492642968;2:594959353;3:426692118;.:2052480,50,,,,,,,,,ERX1041636,ERS792103,ERA458495,KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION|European Nucleotide Archive,KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION,1,0.77106,,0.08154,,0.85675,,0.64875,,50,,B,,usable mapping rate,legacy,early,full_length,random_priming,unknown,bulk,unknown,unknown,,Sweden,2015-07-15,Blastula,Embryo,Undetermined,Embryo Imprecise 25275,SRR25764093,SRX21486761,SRS18719061,SRP457108,PRJNA1009807,Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [RNA Seq],GSE241752,Transcriptome Analysis,Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.,parent bioproject:PRJNA1009800,pubmed:39402326,,WT sphere 4 hpf RNA seq rep2,GSM7734766,,source name:Blastula|strain:TLAB strain|tissue:Blastula|developmental stage:Sphere 4 hpf|genotype:WT|geo loc name:missing|collection date:missing,WT sphere 4 hpf RNA seq rep2,3’ adapters were trimmed using Trim Galore v0.6.4 with default settings retaining reads of length ≥20. Reads were aligned to the GRCz11 zebrafish genome using STAR v2.6.1c with the following parameters: outSAMtype BAM SortedByCoordinate outFilterMultimapNmax 1 outFilterMismatchNmax 1 quantMode TranscriptomeSAM GeneCounts alignEndsType Local seedSearchStartLmax 14 alignIntronMax 10000 outFilterIntronMotifs RemoveNoncanonicalUnannotated. featureCounts v1.6.2 was used to count reads overlapping a filtered set of protein coding gene annotations from the GENCODE basic gene annotation. Differential gene expression analysis was performed using DESEq2 v1.38.1 with default settings and gene counts from featureCounts. Assembly: GRCz11 Supplementary files format and content: csv; transcripts per million TPM counts per transcript in MANE annotation,Blastula,unperturbed growth conditions in E3 medium for zebrafish embryos.,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. 250 ng of the same total RNA used for mim tRNAseq library preparation were used for mRNA Seq library construction with the Zymo Seq RiboFree Total RNA Library Kit Zymo Research #R3000. Libraries were sequenced on a NextSeq 500 platform.,Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle.,strain:TLAB strain|tissue:Blastula|developmental stage:Sphere 4 hpf|genotype:WT,GSM7734766,GSM7734766: WT sphere 4 hpf RNA seq rep2; Danio rerio; RNA Seq,GSM7734766 r1,GSM7734766,1,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. 250 ng of the same total RNA used for mim tRNAseq library preparation were used for mRNA Seq library construction with the Zymo Seq RiboFree Total RNA Library Kit Zymo Research #R3000. Libraries were sequenced on a NextSeq 500 platform.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP457108,,,WT_mRNA_sphere_2.fastq.gz,fastq,2455317157.0,30934591.0,GSM7734766 r1,0:79.37,A:614860604;C:588586084;G:522132289;T:729655621;N:82559,79,,,,614860604,588586084,522132289,729655621,82559,SRX21486761,SRS18719061,SRA1700431,"Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry",Max Planck Institute of Biochemistry,1,0.94124,,0.10502,,0.74876,,0.57752,,80,,B,,usable mapping rate,illumina,nextseq,unknown,small_rna,unknown,bulk,bulk,bulk,,Germany,2023-08-28,Blastula,Embryo,Whole Organism,All anatomical structures 25276,SRR25764094,SRX21486760,SRS18719060,SRP457108,PRJNA1009807,Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [RNA Seq],GSE241752,Transcriptome Analysis,Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.,parent bioproject:PRJNA1009800,pubmed:39402326,,WT sphere 4 hpf RNA seq rep1,GSM7734765,,source name:Blastula|strain:TLAB strain|tissue:Blastula|developmental stage:Sphere 4 hpf|genotype:WT|geo loc name:missing|collection date:missing,WT sphere 4 hpf RNA seq rep1,3’ adapters were trimmed using Trim Galore v0.6.4 with default settings retaining reads of length ≥20. Reads were aligned to the GRCz11 zebrafish genome using STAR v2.6.1c with the following parameters: outSAMtype BAM SortedByCoordinate outFilterMultimapNmax 1 outFilterMismatchNmax 1 quantMode TranscriptomeSAM GeneCounts alignEndsType Local seedSearchStartLmax 14 alignIntronMax 10000 outFilterIntronMotifs RemoveNoncanonicalUnannotated. featureCounts v1.6.2 was used to count reads overlapping a filtered set of protein coding gene annotations from the GENCODE basic gene annotation. Differential gene expression analysis was performed using DESEq2 v1.38.1 with default settings and gene counts from featureCounts. Assembly: GRCz11 Supplementary files format and content: csv; transcripts per million TPM counts per transcript in MANE annotation,Blastula,unperturbed growth conditions in E3 medium for zebrafish embryos.,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. 250 ng of the same total RNA used for mim tRNAseq library preparation were used for mRNA Seq library construction with the Zymo Seq RiboFree Total RNA Library Kit Zymo Research #R3000. Libraries were sequenced on a NextSeq 500 platform.,Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle.,strain:TLAB strain|tissue:Blastula|developmental stage:Sphere 4 hpf|genotype:WT,GSM7734765,GSM7734765: WT sphere 4 hpf RNA seq rep1; Danio rerio; RNA Seq,GSM7734765 r1,GSM7734765,1,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. 250 ng of the same total RNA used for mim tRNAseq library preparation were used for mRNA Seq library construction with the Zymo Seq RiboFree Total RNA Library Kit Zymo Research #R3000. Libraries were sequenced on a NextSeq 500 platform.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP457108,,,WT_mRNA_sphere_1.fastq.gz,fastq,2399640874.0,30232118.0,GSM7734765 r1,0:79.37,A:589069860;C:593745131;G:511439690;T:705305674;N:80519,79,,,,589069860,593745131,511439690,705305674,80519,SRX21486760,SRS18719060,SRA1700431,"Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry",Max Planck Institute of Biochemistry,1,0.85882,,0.11848,,0.75122,,0.5883,,80,,B,,usable mapping rate,illumina,nextseq,unknown,small_rna,unknown,bulk,bulk,bulk,,Germany,2023-08-28,Blastula,Embryo,Whole Organism,All anatomical structures 25287,SRR25764125,SRX21486797,SRS18719094,SRP457111,PRJNA1009808,Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq],GSE241754,Transcriptome Analysis,Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.,parent bioproject:PRJNA1009800,pubmed:39402326,,WT sphere 4 hpf tRNA seq rep2,GSM7734778,,source name:Blastula|strain:TLAB strain|tissue:Blastula|developmental stage:Sphere 4 hpf|genotype:WT|geo loc name:missing|collection date:missing,WT sphere 4 hpf tRNA seq rep2,Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts,Blastula,unperturbed growth conditions in E3 medium for zebrafish embryos.,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle.,strain:TLAB strain|tissue:Blastula|developmental stage:Sphere 4 hpf|genotype:WT,GSM7734778,GSM7734778: WT sphere 4 hpf tRNA seq rep2; Danio rerio; ncRNA Seq,GSM7734778 r1,GSM7734778,1,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP457111,,,WT_tRNA_sphere_2.fastq.gz,fastq,196089572.0,2998867.0,GSM7734778 r1,0:65.39,A:39134451;C:53803100;G:53602781;T:49548779;N:461,65,,,,39134451,53803100,53602781,49548779,461,SRX21486797,SRS18719094,SRA1700461,"Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry",Max Planck Institute of Biochemistry,1,0.28808,,0.01959,,0.91553,,0.47742,,78,,B,,usable mapping rate,illumina,nextseq,5prime,size_fractionation,unknown,bulk,unknown,unknown,,Germany,2023-08-28,Blastula,Embryo,Whole Organism,All anatomical structures 25288,SRR25764126,SRX21486796,SRS18719096,SRP457111,PRJNA1009808,Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq],GSE241754,Transcriptome Analysis,Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.,parent bioproject:PRJNA1009800,pubmed:39402326,,WT sphere 4 hpf tRNA seq rep1,GSM7734777,,source name:Blastula|strain:TLAB strain|tissue:Blastula|developmental stage:Sphere 4 hpf|genotype:WT|geo loc name:missing|collection date:missing,WT sphere 4 hpf tRNA seq rep1,Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts,Blastula,unperturbed growth conditions in E3 medium for zebrafish embryos.,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle.,strain:TLAB strain|tissue:Blastula|developmental stage:Sphere 4 hpf|genotype:WT,GSM7734777,GSM7734777: WT sphere 4 hpf tRNA seq rep1; Danio rerio; ncRNA Seq,GSM7734777 r1,GSM7734777,1,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP457111,,,WT_tRNA_sphere_1.fastq.gz,fastq,273027894.0,4080366.0,GSM7734777 r1,0:66.91,A:54678043;C:74713512;G:74872888;T:68762883;N:568,66,,,,54678043,74713512,74872888,68762883,568,SRX21486796,SRS18719096,SRA1700461,"Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry",Max Planck Institute of Biochemistry,1,0.30124,,0.01877,,0.9163,,0.49987,,79,,B,,usable mapping rate,illumina,nextseq,5prime,size_fractionation,unknown,bulk,unknown,unknown,,Germany,2023-08-28,Blastula,Embryo,Whole Organism,All anatomical structures 25289,SRR25764127,SRX21486795,SRS18719097,SRP457111,PRJNA1009808,Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq],GSE241754,Transcriptome Analysis,Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.,parent bioproject:PRJNA1009800,pubmed:39402326,,WT 1000 cell 3 hpf tRNA seq rep2,GSM7734776,,source name:Blastula|strain:TLAB strain|tissue:Blastula|developmental stage:1000 cell 3 hpf|genotype:WT|geo loc name:missing|collection date:missing,WT 1000 cell 3 hpf tRNA seq rep2,Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts,Blastula,unperturbed growth conditions in E3 medium for zebrafish embryos.,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle.,strain:TLAB strain|tissue:Blastula|developmental stage:1000 cell 3 hpf|genotype:WT,GSM7734776,GSM7734776: WT 1000 cell 3 hpf tRNA seq rep2; Danio rerio; ncRNA Seq,GSM7734776 r1,GSM7734776,1,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP457111,,,WT_tRNA_1Kcell_2.fastq.gz,fastq,240973473.0,3918764.0,GSM7734776 r1,0:61.49,A:48091658;C:66684510;G:65183534;T:61013184;N:587,61,,,,48091658,66684510,65183534,61013184,587,SRX21486795,SRS18719097,SRA1700461,"Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry",Max Planck Institute of Biochemistry,1,0.26629,,0.02297,,0.92305,,0.48525,,79,,B,,usable mapping rate,illumina,nextseq,5prime,size_fractionation,unknown,bulk,unknown,unknown,,Germany,2023-08-28,Blastula,Embryo,Whole Organism,All anatomical structures 25290,SRR25764128,SRX21486794,SRS18719095,SRP457111,PRJNA1009808,Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq],GSE241754,Transcriptome Analysis,Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.,parent bioproject:PRJNA1009800,pubmed:39402326,,WT 1000 cell 3 hpf tRNA seq rep1,GSM7734775,,source name:Blastula|strain:TLAB strain|tissue:Blastula|developmental stage:1000 cell 3 hpf|genotype:WT|geo loc name:missing|collection date:missing,WT 1000 cell 3 hpf tRNA seq rep1,Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts,Blastula,unperturbed growth conditions in E3 medium for zebrafish embryos.,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle.,strain:TLAB strain|tissue:Blastula|developmental stage:1000 cell 3 hpf|genotype:WT,GSM7734775,GSM7734775: WT 1000 cell 3 hpf tRNA seq rep1; Danio rerio; ncRNA Seq,GSM7734775 r1,GSM7734775,1,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP457111,,,WT_tRNA_1Kcell_1.fastq.gz,fastq,153597915.0,2445091.0,GSM7734775 r1,0:62.82,A:30905842;C:42377268;G:41639937;T:38674503;N:365,62,,,,30905842,42377268,41639937,38674503,365,SRX21486794,SRS18719095,SRA1700461,"Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry",Max Planck Institute of Biochemistry,1,0.27317,,0.02516,,0.92454,,0.49385,,77,,B,,usable mapping rate,illumina,nextseq,5prime,size_fractionation,unknown,bulk,unknown,unknown,,Germany,2023-08-28,Blastula,Embryo,Whole Organism,All anatomical structures 25291,SRR25764129,SRX21486793,SRS18719091,SRP457111,PRJNA1009808,Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq],GSE241754,Transcriptome Analysis,Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.,parent bioproject:PRJNA1009800,pubmed:39402326,,WT 256 cell 2.5 hpf tRNA seq rep2,GSM7734774,,source name:Blastula|strain:TLAB strain|tissue:Blastula|developmental stage:256 cell 2.5 hpf|genotype:WT|geo loc name:missing|collection date:missing,WT 256 cell 2.5 hpf tRNA seq rep2,Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts,Blastula,unperturbed growth conditions in E3 medium for zebrafish embryos.,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle.,strain:TLAB strain|tissue:Blastula|developmental stage:256 cell 2.5 hpf|genotype:WT,GSM7734774,GSM7734774: WT 256 cell 2.5 hpf tRNA seq rep2; Danio rerio; ncRNA Seq,GSM7734774 r1,GSM7734774,1,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP457111,,,WT_tRNA_256cell_2.fastq.gz,fastq,844659062.0,13660310.0,GSM7734774 r1,0:61.83,A:165996817;C:234451560;G:230230791;T:213977958;N:1936,61,,,,165996817,234451560,230230791,213977958,1936,SRX21486793,SRS18719091,SRA1700461,"Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry",Max Planck Institute of Biochemistry,1,0.26001,,0.01993,,0.92594,,0.45714,,61,,B,,usable mapping rate,illumina,nextseq,5prime,size_fractionation,unknown,bulk,unknown,unknown,,Germany,2023-08-28,Blastula,Embryo,Whole Organism,All anatomical structures 25292,SRR25764130,SRX21486792,SRS18719088,SRP457111,PRJNA1009808,Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq],GSE241754,Transcriptome Analysis,Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.,parent bioproject:PRJNA1009800,pubmed:39402326,,WT 256 cell 2.5 hpf tRNA seq rep1,GSM7734773,,source name:Blastula|strain:TLAB strain|tissue:Blastula|developmental stage:256 cell 2.5 hpf|genotype:WT|geo loc name:missing|collection date:missing,WT 256 cell 2.5 hpf tRNA seq rep1,Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts,Blastula,unperturbed growth conditions in E3 medium for zebrafish embryos.,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle.,strain:TLAB strain|tissue:Blastula|developmental stage:256 cell 2.5 hpf|genotype:WT,GSM7734773,GSM7734773: WT 256 cell 2.5 hpf tRNA seq rep1; Danio rerio; ncRNA Seq,GSM7734773 r1,GSM7734773,1,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP457111,,,WT_tRNA_256cell_1.fastq.gz,fastq,215968508.0,3436266.0,GSM7734773 r1,0:62.85,A:43791388;C:59547637;G:58130851;T:54498124;N:508,62,,,,43791388,59547637,58130851,54498124,508,SRX21486792,SRS18719088,SRA1700461,"Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry",Max Planck Institute of Biochemistry,1,0.27383,,0.02205,,0.92748,,0.46217,,71,,B,,usable mapping rate,illumina,nextseq,5prime,size_fractionation,unknown,bulk,unknown,unknown,,Germany,2023-08-28,Blastula,Embryo,Whole Organism,All anatomical structures 25296,SRR25764046,SRX21486722,SRS18719023,SRP457105,PRJNA1009809,Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [Ribo Seq],GSE241753,Other,Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.,parent bioproject:PRJNA1009800,pubmed:39402326,,WT sphere 4 hpf Ribo seq rep1,GSM7734769,,source name:Blastula|strain:TLAB strain|tissue:Blastula|developmental stage:Sphere 4 hpf|treatment:100 µg/ml CHX 100 µg/ml TIG|geo loc name:missing|collection date:missing,WT sphere 4 hpf Ribo seq rep1,We identified the A site location in each mapped read with Scikit ribo [Fang et al. 2018] which uses a random forest with recursive feature selection and a generalized linear model for accurate A site prediction based on matched ribosome profiling and RNA Seq datasets. Kallisto 0.44.0 with parameters b 100 single l 180 s 20 t 40 was used to quantify transcript abundances in Transcripts Per Million TPM from RNA Seq data based on the reference set of MANE annotated transcripts see Codon usage analysis for description of this annotation. To avoid memory errors due to the large size of the human genome and the presence of multiple transcript isoforms all RNAfold dependencies in Scikit ribo were omitted and the index was built separately for each chromosome. To make the hg38 GTF compatible with Scikit ribo transcript/UTR annotations were removed. For each transcript the start codon in the first exon and the stop codon in the last exon were adjusted to represent transcript start and end coordinates taking into account the gene strand. To estimate codon dwell times short 20 23 nt and long 28 33 nt ribosome footprints were analyzed separately. rRNA filtered reads were aligned to GRCz11.108 using STAR v2.6.1c [Dobin et al. 2013] the following options: outFilterMultimapNmax 1 seedSearchStartLmax 15 outSAMtype BAM SortedByCoordinate outFilterMismatchNmax 2 alignEndsType EndToEnd quantMode TranscriptomeSAM outSAMattributes NH HI AS nM NM MD We identified the A site location in each mapped read with Scikit ribo [Fang et al. 2018] which uses a random forest with recursive feature selection and a generalized linear model for accurate A site prediction based on matched ribosome profiling and RNA Seq datasets. Kallisto 0.44.0 with parameters b 100 single l 180 s 20 t 40 was used to quantify transcript abundances in Transcripts Per Million TPM from RNA Seq data based on the reference set of MANE annotated transcripts see Codon usage analysis for description of this annotation. To avoid memory errors due to the large size of the human genome and the presence of multiple transcript isoforms all RNAfold dependencies in Scikit ribo were omitted and the index was built separately for each chromosome. To make the GRCz11 GTF compatible with Scikit ribo transcript/UTR annotations were removed. For each transcript the start codon in the first exon and the stop codon in the last exon were adjusted to represent transcript start and end coordinates taking into account the gene strand. To estimate codon dwell times we utilised ribosome footprints with length 30 34 nt. Assembly: GRCz11 Supplementary files format and content: csv; codon dwell times from scikit ribo for all samples Supplementary files format and content: csv; transcript per million TPM counts per transcript in MANE annotation Library strategy: Ribo Seq,Blastula,unperturbed growth conditions in E3 medium for zebrafish embryos.,200 whole embryos were flash frozen in liquid nitrogen and subsequently lysed in footprint lysis buffer containing 100 µg/ml CHX and 100 µg/ml TIG 0.1% NP 40 10 µg/ml aprotinin 20 µM leupeptin 2.5 µM pepstatin A 0.5 mM AEBSF and 1x Phosphatase Inhibitor Cocktail. Samples were vortexed vigorously triturated through a 26G gauge needle and spun down for 7 minutes at 16 000xg/ 4°C. Supernatant was transferred to a new tube. 20 µg RNA in 200 µl polysome lysis buffer were digested with 50 U RNase I for 45 minutes at 2 000 rpm/22°C. post incubation on ice for 5 minutes extracts were pre cleared by centrifugation for 5 minutes at 3 000 g/ 4°C. Ribosomes were pelleted through 3 ml of a sucrose cushion 1 M sucrose 20 mM Tris pH=8.0 140 mM KCl 5 mM MgCl2 1 mM DTT by spinning the layered solutions in the Type 70 Ti rotor for 120 minutes at 50 000 rpm/ 4°C. Ribosome pellets were rinsed once dissolved in 200 µl drug free polysome lysis buffer and incubated with 200 U hiPSC or 300 U NPC RNase I for 45 minutes at 2 000 rpm/22°C. Ribosome footprint libraries were prepared essentially as described McGlincy and Ingolia 2017; Wu 2019 with minor modifications. RNase I digestion was stopped by addition of 100 U Superase In and extracts were loaded on a sucrose cushion. The pellet was dissolved in 400 µl LiDS/LET lysis buffer and RNA was extracted with the acid phenol protocol. Fragments in the range of 19 to 32 nucleotides were isolated by gel size selection with T4 PNK and ligated to pre adenylated adapters containing 5 random nucleotides at their 5’ ends McGlinzy 2017 with T4 RNA Ligase 2 truncated KQ. Adapter ligated RNA was subjected to rRNA depletion using the Ribo Seq riboPOOL h/m/r depletion kit siTOOLs for CHX only samples and legacy RiboZero Gold kit Illumina for CHX+TIG samples The rRNA depleted footprints were reverse transcribed with Protoscript II and cDNA was circularized with recombinant TS2126 RNA ligase 1 commercially available as CircLigase. Libraries were constructed from circularized cDNA with KAPA HiFi DNA Polymerase and single end sequencing was performed on a NextSeq 500 platform Illumina.,Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle.,strain:TLAB strain|tissue:Blastula|developmental stage:Sphere 4 hpf|treatment:100 µg/ml CHX 100 µg/ml TIG,GSM7734769,GSM7734769: WT sphere 4 hpf Ribo seq rep1; Danio rerio; OTHER,GSM7734769 r1,GSM7734769,1,200 whole embryos were flash frozen in liquid nitrogen and subsequently lysed in footprint lysis buffer containing 100 µg/ml CHX and 100 µg/ml TIG 0.1% NP 40 10 µg/ml aprotinin 20 µM leupeptin 2.5 µM pepstatin A 0.5 mM AEBSF and 1x Phosphatase Inhibitor Cocktail. Samples were vortexed vigorously triturated through a 26G gauge needle and spun down for 7 minutes at 16 000xg/ 4°C. Supernatant was transferred to a new tube. 20 µg RNA in 200 µl polysome lysis buffer were digested with 50 U RNase I for 45 minutes at 2 000 rpm/22°C. post incubation on ice for 5 minutes extracts were pre cleared by centrifugation for 5 minutes at 3 000 g/ 4°C. Ribosomes were pelleted through 3 ml of a sucrose cushion 1 M sucrose 20 mM Tris pH=8.0 140 mM KCl 5 mM MgCl2 1 mM DTT by spinning the layered solutions in the Type 70 Ti rotor for 120 minutes at 50 000 rpm/ 4°C. Ribosome pellets were rinsed once dissolved in 200 µl drug free polysome lysis buffer and incubated with 200 U hiPSC or 300 U NPC RNase I for 45 minutes at 2 000 rpm/22°C. Ribosome footprint libraries were prepared essentially as described McGlincy and Ingolia 2017; Wu 2019 with minor modifications. RNase I digestion was stopped by addition of 100 U Superase In and extracts were loaded on a sucrose cushion. The pellet was dissolved in 400 µl LiDS/LET lysis buffer and RNA was extracted with the acid phenol protocol. Fragments in the range of 19 to 32 nucleotides were isolated by gel size selection with T4 PNK and ligated to pre adenylated adapters containing 5 random nucleotides at their five prime ends McGlinzy 2017 with T4 RNA Ligase 2 truncated KQ. Adapter ligated RNA was subjected to rRNA depletion using the Ribo Seq riboPOOL h/m/r depletion kit siTOOLs for CHX only samples and legacy RiboZero Gold kit Illumina for CHX+TIG samples The rRNA depleted footprints were reverse transcribed with Protoscript II and cDNA was circularized with recombinant TS2126 RNA ligase 1 commercially available as CircLigase. Libraries were constructed from circularized cDNA with KAPA HiFi DNA Polymerase and single end sequencing was performed on a NextSeq 500 platform Illumina.,,OTHER,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 500,,SRP457105,,,WT_ribo_sphere_1.fastq.gz,fastq,1336027898.0,47907512.0,GSM7734769 r1,0:27.89,A:229038284;C:439455963;G:429428292;T:238088512;N:16847,27,,,,229038284,439455963,429428292,238088512,16847,SRX21486722,SRS18719023,SRA1700409,"Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry",Max Planck Institute of Biochemistry,1,0.85867,,0.20418,,0.8776,,0.79481,,24,,B,,usable mapping rate,illumina,nextseq,5prime,rrna_depletion,ribozero,bulk,unknown,unknown,,Germany,2023-08-28,Blastula,Embryo,Whole Organism,All anatomical structures 28539,SRR26395013,SRX22100921,SRS19166047,SRP466518,PRJNA1028258,Zygotic activation of transposable elements during zebrafish early embryogenesis,PRJNA1028258,Other,Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age.,,pubmed:40246845,,,zfs:0000015 Iso seq,,strain:AB x India|age:4.7 hpf|dev stage:zfs:0000015|collection date:2021 01|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:LR 9|BioSampleModel:Model organism or animal,,,,,,,,,PacBio Iso seq of zebrafish: zfs:0000015,DR 009,DR 009,Total RNA was isolated from each developmental stages of zebrafish embryos using TRIzolTM Reagent Invitrogen. RNA purity and concentration were assessed with the NanoPhotometer spectrophotometer IMPLEN CA USA and the Qubit RNA Assay Kit in the Qubit 3.0 Fluorometer Life Technologies CA USA. The RNA integrity number RIN was determined using the RNA Nano 6000 Assay Kit and Agilent Bioanalyzer 2100 system Agilent Technologies CA USA. RNA samples with a RIN 8 were used to synthesize cDNA with SMARTerPCR cDNA Synthesis Kit Takara Bio USA Inc. Mountain View CA USA. PCR amplification was performed using a KAPA HiFi PCR Kit Kapa Biosystems Wilmington MA USA with the optimized number of cycles. Size selection of PCR products cDNA for each sample was applied using the BluePippin System: <3 kb and >3 kb. Subsequently two cDNA libraries <3 kb >3 kb were prepared using a SMRTbell Template Prep Kit 1.0 Pacific Biosciences Menlo Park CA USA and sequenced on the PacBio sequel II platform.,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,PACBIO_SMRT,Sequel II,,SRP466518,,,30epiboly.ccs.fq.gz,fastq,5233736965.0,1358516.0,zfs:0000015.ccs.fq.gz,0:3852.54,A:1425421240;C:1199630062;G:1191034759;T:1417650904;N:0,3852,,,,1425421240,1199630062,1191034759,1417650904,0,SRX22100921,SRS19166047,SRA1731898,University of Michigan|Computational Medicine and Bioinformatics,University of Michigan,1,0.40862,,0.00581,,0.86123,,0.47684,,3440,,T,,long read,pacbio,pacbio_modern,full_length,poly_a,unknown,bulk,unknown,unknown,,United States,2023-10-16,Blastula,Embryo,Embryo Imprecise,All anatomical structures 28540,SRR26395014,SRX22100920,SRS19166046,SRP466518,PRJNA1028258,Zygotic activation of transposable elements during zebrafish early embryogenesis,PRJNA1028258,Other,Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age.,,pubmed:40246845,,,dome Iso seq,,strain:AB x India|age:4.3 hpf|dev stage:dome|collection date:2021 01|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:LR 8|BioSampleModel:Model organism or animal,,,,,,,,,PacBio Iso seq of zebrafish: dome,DR 008,DR 008,Total RNA was isolated from each developmental stages of zebrafish embryos using TRIzolTM Reagent Invitrogen. RNA purity and concentration were assessed with the NanoPhotometer spectrophotometer IMPLEN CA USA and the Qubit RNA Assay Kit in the Qubit 3.0 Fluorometer Life Technologies CA USA. The RNA integrity number RIN was determined using the RNA Nano 6000 Assay Kit and Agilent Bioanalyzer 2100 system Agilent Technologies CA USA. RNA samples with a RIN 8 were used to synthesize cDNA with SMARTerPCR cDNA Synthesis Kit Takara Bio USA Inc. Mountain View CA USA. PCR amplification was performed using a KAPA HiFi PCR Kit Kapa Biosystems Wilmington MA USA with the optimized number of cycles. Size selection of PCR products cDNA for each sample was applied using the BluePippin System: <3 kb and >3 kb. Subsequently two cDNA libraries <3 kb >3 kb were prepared using a SMRTbell Template Prep Kit 1.0 Pacific Biosciences Menlo Park CA USA and sequenced on the PacBio sequel II platform.,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,PACBIO_SMRT,Sequel II,,SRP466518,,,dome.ccs.fq.gz,fastq,6426069602.0,1667809.0,dome.ccs.fq.gz,0:3853.00,A:1735630855;C:1486999783;G:1476424228;T:1727014736;N:0,3853,,,,1735630855,1486999783,1476424228,1727014736,0,SRX22100920,SRS19166046,SRA1731898,University of Michigan|Computational Medicine and Bioinformatics,University of Michigan,1,0.20197,,0.00145,,0.91388,,0.06247,,6938,,T,,long read,pacbio,pacbio_modern,full_length,poly_a,unknown,bulk,unknown,unknown,,United States,2023-10-16,Blastula,Embryo,Embryo Imprecise,All anatomical structures 28541,SRR26395015,SRX22100919,SRS19166045,SRP466518,PRJNA1028258,Zygotic activation of transposable elements during zebrafish early embryogenesis,PRJNA1028258,Other,Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age.,,pubmed:40246845,,,sphere Iso seq,,strain:AB x India|age:4 hpf|dev stage:sphere|collection date:2021 01|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:LR 7|BioSampleModel:Model organism or animal,,,,,,,,,PacBio Iso seq of zebrafish: sphere,DR 007,DR 007,Total RNA was isolated from each developmental stages of zebrafish embryos using TRIzolTM Reagent Invitrogen. RNA purity and concentration were assessed with the NanoPhotometer spectrophotometer IMPLEN CA USA and the Qubit RNA Assay Kit in the Qubit 3.0 Fluorometer Life Technologies CA USA. The RNA integrity number RIN was determined using the RNA Nano 6000 Assay Kit and Agilent Bioanalyzer 2100 system Agilent Technologies CA USA. RNA samples with a RIN 8 were used to synthesize cDNA with SMARTerPCR cDNA Synthesis Kit Takara Bio USA Inc. Mountain View CA USA. PCR amplification was performed using a KAPA HiFi PCR Kit Kapa Biosystems Wilmington MA USA with the optimized number of cycles. Size selection of PCR products cDNA for each sample was applied using the BluePippin System: <3 kb and >3 kb. Subsequently two cDNA libraries <3 kb >3 kb were prepared using a SMRTbell Template Prep Kit 1.0 Pacific Biosciences Menlo Park CA USA and sequenced on the PacBio sequel II platform.,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,PACBIO_SMRT,Sequel II,,SRP466518,,,sphere.ccs.fq.gz,fastq,7456522395.0,2030744.0,sphere.ccs.fq.gz,0:3671.82,A:2009379061;C:1725915606;G:1718055774;T:2003171954;N:0,3671,,,,2009379061,1725915606,1718055774,2003171954,0,SRX22100919,SRS19166045,SRA1731898,University of Michigan|Computational Medicine and Bioinformatics,University of Michigan,1,0.41317,,0.00317,,0.85504,,0.46671,,5517,,T,,long read,pacbio,pacbio_modern,full_length,poly_a,unknown,bulk,unknown,unknown,,United States,2023-10-16,Blastula,Embryo,Embryo Imprecise,All anatomical structures 28543,SRR26395017,SRX22100916,SRS19166042,SRP466518,PRJNA1028258,Zygotic activation of transposable elements during zebrafish early embryogenesis,PRJNA1028258,Other,Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age.,,pubmed:40246845,,,oblong Iso seq,,strain:AB x India|age:3.7 hpf|dev stage:oblong|collection date:2021 01|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:LR 6|BioSampleModel:Model organism or animal,,,,,,,,,PacBio Iso seq of zebrafish: oblong,DR 006,DR 006,Total RNA was isolated from each developmental stages of zebrafish embryos using TRIzolTM Reagent Invitrogen. RNA purity and concentration were assessed with the NanoPhotometer spectrophotometer IMPLEN CA USA and the Qubit RNA Assay Kit in the Qubit 3.0 Fluorometer Life Technologies CA USA. The RNA integrity number RIN was determined using the RNA Nano 6000 Assay Kit and Agilent Bioanalyzer 2100 system Agilent Technologies CA USA. RNA samples with a RIN 8 were used to synthesize cDNA with SMARTerPCR cDNA Synthesis Kit Takara Bio USA Inc. Mountain View CA USA. PCR amplification was performed using a KAPA HiFi PCR Kit Kapa Biosystems Wilmington MA USA with the optimized number of cycles. Size selection of PCR products cDNA for each sample was applied using the BluePippin System: <3 kb and >3 kb. Subsequently two cDNA libraries <3 kb >3 kb were prepared using a SMRTbell Template Prep Kit 1.0 Pacific Biosciences Menlo Park CA USA and sequenced on the PacBio sequel II platform.,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,PACBIO_SMRT,Sequel II,,SRP466518,,,oblong.ccs.fq.gz,fastq,5138806264.0,1450821.0,oblong.ccs.fq.gz,0:3542.00,A:1387179645;C:1186984765;G:1181776562;T:1382865292;N:0,3542,,,,1387179645,1186984765,1181776562,1382865292,0,SRX22100916,SRS19166042,SRA1731898,University of Michigan|Computational Medicine and Bioinformatics,University of Michigan,1,0.41494,,0.0019,,0.85267,,0.45513,,8789,,T,,long read,pacbio,pacbio_modern,full_length,poly_a,unknown,bulk,unknown,unknown,,United States,2023-10-16,Blastula,Embryo,Embryo Imprecise,All anatomical structures 28554,SRR26395028,SRX22100905,SRS19166031,SRP466518,PRJNA1028258,Zygotic activation of transposable elements during zebrafish early embryogenesis,PRJNA1028258,Other,Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age.,,pubmed:40246845,,,high Iso seq,,strain:AB x India|age:3.3 hpf|dev stage:high|collection date:2021 01|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:LR 5|BioSampleModel:Model organism or animal,,,,,,,,,PacBio Iso seq of zebrafish: high,DR 005,DR 005,Total RNA was isolated from each developmental stages of zebrafish embryos using TRIzolTM Reagent Invitrogen. RNA purity and concentration were assessed with the NanoPhotometer spectrophotometer IMPLEN CA USA and the Qubit RNA Assay Kit in the Qubit 3.0 Fluorometer Life Technologies CA USA. The RNA integrity number RIN was determined using the RNA Nano 6000 Assay Kit and Agilent Bioanalyzer 2100 system Agilent Technologies CA USA. RNA samples with a RIN 8 were used to synthesize cDNA with SMARTerPCR cDNA Synthesis Kit Takara Bio USA Inc. Mountain View CA USA. PCR amplification was performed using a KAPA HiFi PCR Kit Kapa Biosystems Wilmington MA USA with the optimized number of cycles. Size selection of PCR products cDNA for each sample was applied using the BluePippin System: <3 kb and >3 kb. Subsequently two cDNA libraries <3 kb >3 kb were prepared using a SMRTbell Template Prep Kit 1.0 Pacific Biosciences Menlo Park CA USA and sequenced on the PacBio sequel II platform.,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,PACBIO_SMRT,Sequel II,,SRP466518,,,high.ccs.fq.gz,fastq,6811221417.0,1785766.0,high.ccs.fq.gz,0:3814.17,A:1820349159;C:1592171013;G:1583702800;T:1814998445;N:0,3814,,,,1820349159,1592171013,1583702800,1814998445,0,SRX22100905,SRS19166031,SRA1731898,University of Michigan|Computational Medicine and Bioinformatics,University of Michigan,1,0.42981,,0.00073,,0.86182,,0.47846,,4404,,T,,long read,pacbio,pacbio_modern,full_length,poly_a,unknown,bulk,unknown,unknown,,United States,2023-10-16,Blastula,Embryo,Embryo Imprecise,All anatomical structures 28565,SRR26395039,SRX22100894,SRS19166020,SRP466518,PRJNA1028258,Zygotic activation of transposable elements during zebrafish early embryogenesis,PRJNA1028258,Other,Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age.,,pubmed:40246845,,,1k cell Iso seq,,strain:AB x India|age:3 hpf|dev stage:1k cell|collection date:2021 01|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:LR 4|BioSampleModel:Model organism or animal,,,,,,,,,PacBio Iso seq of zebrafish: 1k cell,DR 004,DR 004,Total RNA was isolated from each developmental stages of zebrafish embryos using TRIzolTM Reagent Invitrogen. RNA purity and concentration were assessed with the NanoPhotometer spectrophotometer IMPLEN CA USA and the Qubit RNA Assay Kit in the Qubit 3.0 Fluorometer Life Technologies CA USA. The RNA integrity number RIN was determined using the RNA Nano 6000 Assay Kit and Agilent Bioanalyzer 2100 system Agilent Technologies CA USA. RNA samples with a RIN 8 were used to synthesize cDNA with SMARTerPCR cDNA Synthesis Kit Takara Bio USA Inc. Mountain View CA USA. PCR amplification was performed using a KAPA HiFi PCR Kit Kapa Biosystems Wilmington MA USA with the optimized number of cycles. Size selection of PCR products cDNA for each sample was applied using the BluePippin System: <3 kb and >3 kb. Subsequently two cDNA libraries <3 kb >3 kb were prepared using a SMRTbell Template Prep Kit 1.0 Pacific Biosciences Menlo Park CA USA and sequenced on the PacBio sequel II platform.,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,PACBIO_SMRT,Sequel II,,SRP466518,,,1k.ccs.fq.gz,fastq,8036121763.0,2087907.0,1k.ccs.fq.gz,0:3848.89,A:2152838341;C:1873567602;G:1863627936;T:2146087884;N:0,3848,,,,2152838341,1873567602,1863627936,2146087884,0,SRX22100894,SRS19166020,SRA1731898,University of Michigan|Computational Medicine and Bioinformatics,University of Michigan,1,0.43117,,0.00077,,0.86352,,0.48891,,2071,,T,,long read,pacbio,pacbio_modern,full_length,poly_a,unknown,bulk,unknown,unknown,,United States,2023-10-16,Blastula,Embryo,Embryo Imprecise,All anatomical structures 28926,SRR26845660,SRX22541160,SRS19550743,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 5hour wt 75mM s4u r3,GSM7903266,,tissue:Embryos at 5 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 5hour wt 75mM s4u r3,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 5 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:5 hpf of [AB TU]x[TL TLF],GSM7903266,GSM7903266: zebrafish 5hour wt 75mM s4u r3; Danio rerio; RNA Seq,GSM7903266 r1,GSM7903266,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s5h_4.fastq.gz,fastq,3876675223.0,38382923.0,GSM7903266 r1,0:101,A:1271025001;C:726585936;G:783833897;T:1093102254;N:2128135,101,,,,1271025001,726585936,783833897,1093102254,2128135,SRX22541160,SRS19550743,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.71995,,0.15648,,0.80602,,0.63112,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Blastula,Embryo,Embryo Imprecise,All anatomical structures 28927,SRR26845661,SRX22541159,SRS19550745,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 5hour wt 75mM s4u r2,GSM7903265,,tissue:Embryos at 5 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 5hour wt 75mM s4u r2,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 5 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:5 hpf of [AB TU]x[TL TLF],GSM7903265,GSM7903265: zebrafish 5hour wt 75mM s4u r2; Danio rerio; RNA Seq,GSM7903265 r1,GSM7903265,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s5h_3.fastq.gz,fastq,3838231795.0,38002295.0,GSM7903265 r1,0:101,A:1278788159;C:716521940;G:779898774;T:1060882131;N:2140791,101,,,,1278788159,716521940,779898774,1060882131,2140791,SRX22541159,SRS19550745,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.72109,,0.21985,,0.80807,,0.6147,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Blastula,Embryo,Embryo Imprecise,All anatomical structures 28928,SRR26845662,SRX22541158,SRS19550744,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 5hour wt 75mM s4u r1,GSM7903264,,tissue:Embryos at 5 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 5hour wt 75mM s4u r1,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 5 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:5 hpf of [AB TU]x[TL TLF],GSM7903264,GSM7903264: zebrafish 5hour wt 75mM s4u r1; Danio rerio; RNA Seq,GSM7903264 r1,GSM7903264,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s5h_1.fastq.gz,fastq,3890509395.0,38519895.0,GSM7903264 r1,0:101,A:1318641089;C:721557782;G:786950925;T:1061229739;N:2129860,101,,,,1318641089,721557782,786950925,1061229739,2129860,SRX22541158,SRS19550744,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.68576,,0.20717,,0.81935,,0.62842,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Blastula,Embryo,Embryo Imprecise,All anatomical structures 28929,SRR26845663,SRX22541157,SRS19550742,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 4hour wt 75mM s4u r3,GSM7903263,,tissue:Embryos at 4 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 4hour wt 75mM s4u r3,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 4 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:4 hpf of [AB TU]x[TL TLF],GSM7903263,GSM7903263: zebrafish 4hour wt 75mM s4u r3; Danio rerio; RNA Seq,GSM7903263 r1,GSM7903263,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s4h_3.fastq.gz,fastq,3922621133.0,38837833.0,GSM7903263 r1,0:101,A:1326034870;C:729550784;G:798297898;T:1066568859;N:2168722,101,,,,1326034870,729550784,798297898,1066568859,2168722,SRX22541157,SRS19550742,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.68783,,0.16779,,0.81621,,0.62761,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Blastula,Embryo,Embryo Imprecise,All anatomical structures 28930,SRR26845664,SRX22541156,SRS19550741,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 4hour wt 75mM s4u r2,GSM7903262,,tissue:Embryos at 4 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 4hour wt 75mM s4u r2,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 4 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:4 hpf of [AB TU]x[TL TLF],GSM7903262,GSM7903262: zebrafish 4hour wt 75mM s4u r2; Danio rerio; RNA Seq,GSM7903262 r1,GSM7903262,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s4h_2.fastq.gz,fastq,3885845316.0,38473716.0,GSM7903262 r1,0:101,A:1305297185;C:711282734;G:795936400;T:1071155283;N:2173714,101,,,,1305297185,711282734,795936400,1071155283,2173714,SRX22541156,SRS19550741,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.7205,,0.20229,,0.81556,,0.63986,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Blastula,Embryo,Embryo Imprecise,All anatomical structures 28931,SRR26845665,SRX22541155,SRS19550740,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 4hour wt 75mM s4u r1,GSM7903261,,tissue:Embryos at 4 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 4hour wt 75mM s4u r1,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 4 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:4 hpf of [AB TU]x[TL TLF],GSM7903261,GSM7903261: zebrafish 4hour wt 75mM s4u r1; Danio rerio; RNA Seq,GSM7903261 r1,GSM7903261,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s4h_1.fastq.gz,fastq,4087186695.0,40467195.0,GSM7903261 r1,0:101,A:1367436080;C:761579394;G:848347911;T:1107470497;N:2352813,101,,,,1367436080,761579394,848347911,1107470497,2352813,SRX22541155,SRS19550740,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.7191,,0.20848,,0.81688,,0.63923,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Blastula,Embryo,Embryo Imprecise,All anatomical structures 28932,SRR26845666,SRX22541154,SRS19550739,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 3hour wt 75mM s4u r3,GSM7903260,,tissue:Embryos at 3 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 3hour wt 75mM s4u r3,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 3 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:3 hpf of [AB TU]x[TL TLF],GSM7903260,GSM7903260: zebrafish 3hour wt 75mM s4u r3; Danio rerio; RNA Seq,GSM7903260 r1,GSM7903260,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s3h_3.fastq.gz,fastq,4736832532.0,46899332.0,GSM7903260 r1,0:101,A:1624181445;C:861735952;G:963083636;T:1285203347;N:2628152,101,,,,1624181445,861735952,963083636,1285203347,2628152,SRX22541154,SRS19550739,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.71216,,0.21983,,0.81793,,0.63217,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Blastula,Embryo,Embryo Imprecise,All anatomical structures 28933,SRR26845667,SRX22541153,SRS19550738,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 3hour wt 75mM s4u r2,GSM7903259,,tissue:Embryos at 3 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 3hour wt 75mM s4u r2,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 3 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:3 hpf of [AB TU]x[TL TLF],GSM7903259,GSM7903259: zebrafish 3hour wt 75mM s4u r2; Danio rerio; RNA Seq,GSM7903259 r1,GSM7903259,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s3h_2.fastq.gz,fastq,5318262969.0,52656069.0,GSM7903259 r1,0:101,A:1802889178;C:966732133;G:1084801674;T:1460906618;N:2933366,101,,,,1802889178,966732133,1084801674,1460906618,2933366,SRX22541153,SRS19550738,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.70675,,0.15939,,0.81126,,0.61384,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Blastula,Embryo,Embryo Imprecise,All anatomical structures 28934,SRR26845668,SRX22541152,SRS19550736,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 3hour wt 75mM s4u r1,GSM7903258,,tissue:Embryos at 3 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 3hour wt 75mM s4u r1,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 3 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:3 hpf of [AB TU]x[TL TLF],GSM7903258,GSM7903258: zebrafish 3hour wt 75mM s4u r1; Danio rerio; RNA Seq,GSM7903258 r1,GSM7903258,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s3h_1.fastq.gz,fastq,4206425679.0,41647779.0,GSM7903258 r1,0:101,A:1441873469;C:764690995;G:869706025;T:1127812036;N:2343154,101,,,,1441873469,764690995,869706025,1127812036,2343154,SRX22541152,SRS19550736,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.67591,,0.16274,,0.82175,,0.62057,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Blastula,Embryo,Embryo Imprecise,All anatomical structures 29723,SRR27485668,SRX23156881,SRS20107302,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,Dome R2,,strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:5 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|replicate:2|BioSampleModel:Model organism or animal,,,,,,,,,mRNA seq of zebrafish: embryo 5 hpf rep4,EV06005,EV06005,RNA was extracted with Trizol and processed with QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina Lexogen. 500 ng total RNA per sample. Single indexed QuantSeq libraries were QC checked on a Bioanalyzer 2100 Agilent using a High Sensitivity DNA Kit for correct insert size and quantified using Qubit dsDNA HS Assay Invitrogen. Pooled libraries were sequenced on a NextSeq500 instrument Illumina in 1x75bp single end sequencing mode,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV06005.R1.fastq.gz,fastq,776568876.0,10317721.0,EV06005.R1.fastq.gz,0:75.27,A:238745211;C:151859247;G:171793387;T:214113382;N:57649,75,,,,238745211,151859247,171793387,214113382,57649,SRX23156881,SRS20107302,SRA1783314,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,0.87227,,0.14085,,0.81797,,0.72906,,76,,B,,usable mapping rate,illumina,nextseq,3prime,poly_a,lexogen,bulk,unknown,unknown,,Austria,2024-01-11,Blastula,Embryo,Whole Organism,All anatomical structures 29724,SRR27485669,SRX23156880,SRS20107301,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,1K cell R2,,strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:3 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|replicate:2|BioSampleModel:Model organism or animal,,,,,,,,,mRNA seq of zebrafish: embryo 3 hpf rep4,EV06004,EV06004,RNA was extracted with Trizol and processed with QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina Lexogen. 500 ng total RNA per sample. Single indexed QuantSeq libraries were QC checked on a Bioanalyzer 2100 Agilent using a High Sensitivity DNA Kit for correct insert size and quantified using Qubit dsDNA HS Assay Invitrogen. Pooled libraries were sequenced on a NextSeq500 instrument Illumina in 1x75bp single end sequencing mode,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV06004.R1.fastq.gz,fastq,682509965.0,9050328.0,EV06004.R1.fastq.gz,0:75.41,A:196111480;C:138950038;G:156032208;T:191368964;N:47275,75,,,,196111480,138950038,156032208,191368964,47275,SRX23156880,SRS20107301,SRA1783314,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,0.91494,,0.12926,,0.80044,,0.71156,,76,,B,,usable mapping rate,illumina,nextseq,3prime,poly_a,lexogen,bulk,unknown,unknown,,Austria,2024-01-11,Blastula,Embryo,Whole Organism,All anatomical structures 29728,SRR27485673,SRX23156876,SRS20107297,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,Dome R3,,strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:5 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|replicate:3|BioSampleModel:Model organism or animal,,,,,,,,,mRNA seq of zebrafish: embryo 5 hpf rep4,EV06012,EV06012,RNA was extracted with Trizol and processed with QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina Lexogen. 500 ng total RNA per sample. Single indexed QuantSeq libraries were QC checked on a Bioanalyzer 2100 Agilent using a High Sensitivity DNA Kit for correct insert size and quantified using Qubit dsDNA HS Assay Invitrogen. Pooled libraries were sequenced on a NextSeq500 instrument Illumina in 1x75bp single end sequencing mode,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV06012.R1.fastq.gz,fastq,612322255.0,8128508.0,EV06012.R1.fastq.gz,0:75.33,A:190142665;C:119966127;G:131824584;T:170353082;N:35797,75,,,,190142665,119966127,131824584,170353082,35797,SRX23156876,SRS20107297,SRA1783314,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,0.89638,,0.12215,,0.8196,,0.79176,,75,,B,,usable mapping rate,illumina,nextseq,3prime,poly_a,lexogen,bulk,unknown,unknown,,Austria,2024-01-11,Blastula,Embryo,Whole Organism,All anatomical structures 29729,SRR27485674,SRX23156875,SRS20107296,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,1K cell R3,,strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:3 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|replicate:3|BioSampleModel:Model organism or animal,,,,,,,,,mRNA seq of zebrafish: embryo 3 hpf rep4,EV06011,EV06011,RNA was extracted with Trizol and processed with QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina Lexogen. 500 ng total RNA per sample. Single indexed QuantSeq libraries were QC checked on a Bioanalyzer 2100 Agilent using a High Sensitivity DNA Kit for correct insert size and quantified using Qubit dsDNA HS Assay Invitrogen. Pooled libraries were sequenced on a NextSeq500 instrument Illumina in 1x75bp single end sequencing mode,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV06011.R1.fastq.gz,fastq,516168257.0,6849932.0,EV06011.R1.fastq.gz,0:75.35,A:157131780;C:98595108;G:111327650;T:149089977;N:23742,75,,,,157131780,98595108,111327650,149089977,23742,SRX23156875,SRS20107296,SRA1783314,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,0.89456,,0.0693,,0.80306,,0.73611,,75,,B,,usable mapping rate,illumina,nextseq,3prime,poly_a,lexogen,bulk,unknown,unknown,,Austria,2024-01-11,Blastula,Embryo,Whole Organism,All anatomical structures 29734,SRR27477294,SRX23148653,SRS20099369,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,Dome R4,,strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:5 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|replicate:4|BioSampleModel:Model organism or animal,,,,,,,,,mRNA seq of zebrafish: embryo 5 hpf rep4,EV09005,EV09005,RNA was extracted with Trizol and processed with QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina Lexogen. 500 ng total RNA per sample. Single indexed QuantSeq libraries were QC checked on a Bioanalyzer 2100 Agilent using a High Sensitivity DNA Kit for correct insert size and quantified using Qubit dsDNA HS Assay Invitrogen. Pooled libraries were sequenced on a NextSeq500 instrument Illumina in 1x75bp single end sequencing mode,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV09005.R1.fastq.gz,fastq,1231107704.0,16463264.0,EV09005.R1.fastq.gz,0:74.78,A:408948044;C:228823967;G:256397453;T:336404532;N:533708,74,,,,408948044,228823967,256397453,336404532,533708,SRX23148653,SRS20099369,SRA1782413,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,0.84006,,0.08028,,0.80647,,0.73016,,73,,B,,usable mapping rate,illumina,nextseq,3prime,poly_a,lexogen,bulk,unknown,unknown,,Austria,2024-01-10,Blastula,Embryo,Whole Organism,All anatomical structures 29735,SRR27477295,SRX23148652,SRS20099365,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,1K cell R4,,strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:3 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|replicate:4|BioSampleModel:Model organism or animal,,,,,,,,,mRNA seq of zebrafish: embryo 3 hpf rep4,EV09004,EV09004,RNA was extracted with Trizol and processed with QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina Lexogen. 500 ng total RNA per sample. Single indexed QuantSeq libraries were QC checked on a Bioanalyzer 2100 Agilent using a High Sensitivity DNA Kit for correct insert size and quantified using Qubit dsDNA HS Assay Invitrogen. Pooled libraries were sequenced on a NextSeq500 instrument Illumina in 1x75bp single end sequencing mode,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV09004.R1.fastq.gz,fastq,471461315.0,6271281.0,EV09004.R1.fastq.gz,0:75.18,A:148103215;C:93173628;G:103496734;T:126647635;N:40103,75,,,,148103215,93173628,103496734,126647635,40103,SRX23148652,SRS20099365,SRA1782413,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,0.87715,,0.11105,,0.80606,,0.74204,,75,,B,,usable mapping rate,illumina,nextseq,3prime,poly_a,lexogen,bulk,unknown,unknown,,Austria,2024-01-10,Blastula,Embryo,Whole Organism,All anatomical structures 29739,SRR27467672,SRX23139234,SRS20090275,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,Dome mock R2,,strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:5 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:mock|BioSampleModel:Model organism or animal,,,,,,,,,tRAM seq of zebrafish: embryo 5 hpf mock rep2,EV04009,EV04009,RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.,,,OTHER,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV04009.R1.fastq.gz,fastq,609590940.0,4354221.0,EV04009.R1.fastq.gz,0:140,A:155062144;C:147628702;G:168099121;T:138772205;N:28768,140,,,,155062144,147628702,168099121,138772205,28768,SRX23139234,SRS20090275,SRA1781872,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,0.0,,0.0,,1.0,,,,140,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Austria,2024-01-09,Blastula,Embryo,Whole Organism,All anatomical structures 29740,SRR27467673,SRX23139233,SRS20090278,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,1K cell BS R2,,strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:3 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:BS|BioSampleModel:Model organism or animal,,,,,,,,,tRAM seq of zebrafish: embryo 3 hpf BS rep2,EV04008,EV04008,RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.,,,OTHER,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV04008.R1.fastq.gz,fastq,675505180.0,4825037.0,EV04008.R1.fastq.gz,0:140,A:178823976;C:121648962;G:198428643;T:176572292;N:31307,140,,,,178823976,121648962,198428643,176572292,31307,SRX23139233,SRS20090278,SRA1781872,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,0.0,,0.0,,1.0,,,,140,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Austria,2024-01-09,Blastula,Embryo,Whole Organism,All anatomical structures 29741,SRR27467674,SRX23139232,SRS20090272,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,1K cell DM R2,,strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:3 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:DM|BioSampleModel:Model organism or animal,,,,,,,,,tRAM seq of zebrafish: embryo 3 hpf DM rep2,EV04007,EV04007,RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.,,,OTHER,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV04007.R1.fastq.gz,fastq,702064440.0,5014746.0,EV04007.R1.fastq.gz,0:140,A:176719694;C:166467163;G:207893965;T:150951950;N:31668,140,,,,176719694,166467163,207893965,150951950,31668,SRX23139232,SRS20090272,SRA1781872,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,2e-05,,0.0,,0.99997,,1.0,,140,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Austria,2024-01-09,Blastula,Embryo,Whole Organism,All anatomical structures 29742,SRR27467675,SRX23139231,SRS20090271,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,1K cell mock R2,,strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:3 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:mock|BioSampleModel:Model organism or animal,,,,,,,,,tRAM seq of zebrafish: embryo 3 hpf mock rep2,EV04006,EV04006,RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.,,,OTHER,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV04006.R1.fastq.gz,fastq,664790700.0,4748505.0,EV04006.R1.fastq.gz,0:140,A:172014219;C:146545691;G:200358431;T:145840649;N:31710,140,,,,172014219,146545691,200358431,145840649,31710,SRX23139231,SRS20090271,SRA1781872,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,3e-05,,0.0,,0.99993,,1.0,,140,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Austria,2024-01-09,Blastula,Embryo,Whole Organism,All anatomical structures 29753,SRR27467686,SRX23139220,SRS20090263,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,Dome BS R2,,strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:5 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:BS|BioSampleModel:Model organism or animal,,,,,,,,,tRAM seq of zebrafish: embryo 5 hpf BS rep2,EV04011,EV04011,RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.,,,OTHER,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV04011.R1.fastq.gz,fastq,720913200.0,5149380.0,EV04011.R1.fastq.gz,0:140,A:185414155;C:126110104;G:238649631;T:170706590;N:32720,140,,,,185414155,126110104,238649631,170706590,32720,SRX23139220,SRS20090263,SRA1781872,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,0.0,,0.0,,1.0,,,,140,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Austria,2024-01-09,Blastula,Embryo,Whole Organism,All anatomical structures 29754,SRR27467687,SRX23139219,SRS20090259,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,Dome DM R2,,strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:5 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:DM|BioSampleModel:Model organism or animal,,,,,,,,,tRAM seq of zebrafish: embryo 5 hpf DM rep2,EV04010,EV04010,RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.,,,OTHER,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV04010.R1.fastq.gz,fastq,443650200.0,3168930.0,EV04010.R1.fastq.gz,0:140,A:114663509;C:102512276;G:135709753;T:90744641;N:20021,140,,,,114663509,102512276,135709753,90744641,20021,SRX23139219,SRS20090259,SRA1781872,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,1e-05,,0.0,,0.99997,,1.0,,140,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Austria,2024-01-09,Blastula,Embryo,Whole Organism,All anatomical structures 29757,SRR27437477,SRX23109820,SRS20064574,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,1K cell mock R3,,strain:TLAB fish|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|dev stage:3 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:mock|BioSampleModel:Model organism or animal,,,,,,,,,tRAM seq of zebrafish: embryo 3 hpf mock rep3,EV07007,EV07007,RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.,,,OTHER,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV07007.R1.fastq.gz,fastq,479994620.0,3428533.0,EV07007.R1.fastq.gz,0:140,A:124628886;C:116843590;G:123136721;T:115372734;N:12689,140,,,,124628886,116843590,123136721,115372734,12689,SRX23109820,SRS20064574,SRA1780298,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,6e-05,,1e-05,,0.99989,,1.0,,140,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Austria,2024-01-06,Blastula,Embryo,Whole Organism,All anatomical structures 29771,SRR27437491,SRX23109806,SRS20064560,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,Dome BS R3,,strain:TLAB fish|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|dev stage:5 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:BS|BioSampleModel:Model organism or animal,,,,,,,,,tRAM seq of zebrafish: embryo 5 hpf BS rep3,EV07011,EV07011,RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.,,,OTHER,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV07011.R1.fastq.gz,fastq,893528580.0,6382347.0,EV07011.R1.fastq.gz,0:140,A:240101890;C:155985797;G:262065322;T:235351334;N:24237,140,,,,240101890,155985797,262065322,235351334,24237,SRX23109806,SRS20064560,SRA1780298,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,0.0,,0.0,,1.0,,,,140,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Austria,2024-01-06,Blastula,Embryo,Whole Organism,All anatomical structures 29772,SRR27437492,SRX23109805,SRS20064559,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,Dome DM R3,,strain:TLAB fish|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|dev stage:5 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:DM|BioSampleModel:Model organism or animal,,,,,,,,,tRAM seq of zebrafish: embryo 5 hpf DM rep3,EV07012,EV07012,RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.,,,OTHER,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV07012.R1.fastq.gz,fastq,797662600.0,5697590.0,EV07012.R1.fastq.gz,0:140,A:201908589;C:182656132;G:249672167;T:163404182;N:21530,140,,,,201908589,182656132,249672167,163404182,21530,SRX23109805,SRS20064559,SRA1780298,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,3e-05,,0.0,,0.99991,,0.75,,140,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Austria,2024-01-06,Blastula,Embryo,Whole Organism,All anatomical structures 29773,SRR27437493,SRX23109804,SRS20064558,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,Dome mock R3,,strain:TLAB fish|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|dev stage:5 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:mock|BioSampleModel:Model organism or animal,,,,,,,,,tRAM seq of zebrafish: embryo 5 hpf mock rep3,EV07010,EV07010,RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.,,,OTHER,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV07010.R1.fastq.gz,fastq,467593280.0,3339952.0,EV07010.R1.fastq.gz,0:140,A:122604957;C:118747514;G:124074466;T:102153374;N:12969,140,,,,122604957,118747514,124074466,102153374,12969,SRX23109804,SRS20064558,SRA1780298,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,4e-05,,0.0,,0.99993,,1.0,,140,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Austria,2024-01-06,Blastula,Embryo,Whole Organism,All anatomical structures 29774,SRR27437494,SRX23109803,SRS20064557,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,1K cell BS R3,,strain:TLAB fish|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|dev stage:3 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:BS|BioSampleModel:Model organism or animal,,,,,,,,,tRAM seq of zebrafish: embryo 3 hpf BS rep3,EV07008,EV07008,RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.,,,OTHER,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV07008.R1.fastq.gz,fastq,705682040.0,5040586.0,EV07008.R1.fastq.gz,0:140,A:194506527;C:127442743;G:192893716;T:190818958;N:20096,140,,,,194506527,127442743,192893716,190818958,20096,SRX23109803,SRS20064557,SRA1780298,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,0.0,,0.0,,1.0,,,,140,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Austria,2024-01-06,Blastula,Embryo,Whole Organism,All anatomical structures 29775,SRR27437495,SRX23109802,SRS20064556,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,1K cell DM R3,,strain:TLAB fish|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|dev stage:3 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:DM|BioSampleModel:Model organism or animal,,,,,,,,,tRAM seq of zebrafish: embryo 3 hpf DM rep3,EV07009,EV07009,RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.,,,OTHER,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV07009.R1.fastq.gz,fastq,380716280.0,2719402.0,EV07009.R1.fastq.gz,0:140,A:95351632;C:89558330;G:115625953;T:80169603;N:10762,140,,,,95351632,89558330,115625953,80169603,10762,SRX23109802,SRS20064556,SRA1780298,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,6e-05,,1e-05,,0.99991,,0.75,,140,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Austria,2024-01-06,Blastula,Embryo,Whole Organism,All anatomical structures 29778,SRR27435863,SRX23108233,SRS20063070,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,1K cell mock R4,,strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:3 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:mock|BioSampleModel:Model organism or animal,,,,,,,,,tRAM seq of zebrafish: embryo 3 hpf mock rep4,EV08010,EV08010,RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.,,,OTHER,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV08010.R1.fastq.gz,fastq,678729520.0,4848068.0,EV08010.R1.fastq.gz,0:140,A:170672553;C:182320916;G:171865707;T:153824163;N:46181,140,,,,170672553,182320916,171865707,153824163,46181,SRX23108233,SRS20063070,SRA1780265,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,0.0006,,4e-05,,0.99878,,0.79069,,140,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Austria,2024-01-05,Blastula,Embryo,Whole Organism,All anatomical structures 29792,SRR27435877,SRX23108219,SRS20063056,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,Dome BS R4,,strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:5 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:BS|BioSampleModel:Model organism or animal,,,,,,,,,tRAM seq of zebrafish: embryo 5 hpf BS rep4,EV08015,EV08015,RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.,,,OTHER,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV08015.R1.fastq.gz,fastq,804598200.0,5747130.0,EV08015.R1.fastq.gz,0:140,A:215467427;C:134937180;G:189531758;T:264604493;N:57342,140,,,,215467427,134937180,189531758,264604493,57342,SRX23108219,SRS20063056,SRA1780265,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,2e-05,,0.0,,0.99995,,1.0,,140,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Austria,2024-01-05,Blastula,Embryo,Whole Organism,All anatomical structures 29793,SRR27435878,SRX23108218,SRS20063055,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,Dome DM R4,,strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:5 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:DM|BioSampleModel:Model organism or animal,,,,,,,,,tRAM seq of zebrafish: embryo 5 hpf DM rep4,EV08014,EV08014,RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.,,,OTHER,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV08014.R1.fastq.gz,fastq,662443740.0,4731741.0,EV08014.R1.fastq.gz,0:140,A:164941700;C:167025964;G:177255084;T:153175163;N:45829,140,,,,164941700,167025964,177255084,153175163,45829,SRX23108218,SRS20063055,SRA1780265,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,0.00069,,0.0001,,0.9992,,0.83076,,140,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Austria,2024-01-05,Blastula,Embryo,Whole Organism,All anatomical structures 29794,SRR27435879,SRX23108217,SRS20063052,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,Dome mock R4,,strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:5 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:mock|BioSampleModel:Model organism or animal,,,,,,,,,tRAM seq of zebrafish: embryo 5 hpf mock rep4,EV08013,EV08013,RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.,,,OTHER,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV08013.R1.fastq.gz,fastq,794760540.0,5676861.0,EV08013.R1.fastq.gz,0:140,A:197361776;C:210230329;G:205734036;T:181380205;N:54194,140,,,,197361776,210230329,205734036,181380205,54194,SRX23108217,SRS20063052,SRA1780265,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,0.00066,,9e-05,,0.99894,,0.78378,,140,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Austria,2024-01-05,Blastula,Embryo,Whole Organism,All anatomical structures 29795,SRR27435880,SRX23108216,SRS20063054,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,1K cell BS R4,,strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:3 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:BS|BioSampleModel:Model organism or animal,,,,,,,,,tRAM seq of zebrafish: embryo 3 hpf BS rep4,EV08012,EV08012,RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.,,,OTHER,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV08012.R1.fastq.gz,fastq,722593200.0,5161380.0,EV08012.R1.fastq.gz,0:140,A:188475497;C:119550806;G:173208825;T:241306038;N:52034,140,,,,188475497,119550806,173208825,241306038,52034,SRX23108216,SRS20063054,SRA1780265,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,0.0,,0.0,,1.0,,,,140,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Austria,2024-01-05,Blastula,Embryo,Whole Organism,All anatomical structures 29796,SRR27435881,SRX23108215,SRS20063053,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,1K cell DM R4,,strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:3 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:DM|BioSampleModel:Model organism or animal,,,,,,,,,tRAM seq of zebrafish: embryo 3 hpf DM rep4,EV08011,EV08011,RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.,,,OTHER,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV08011.R1.fastq.gz,fastq,753783380.0,5384167.0,EV08011.R1.fastq.gz,0:140,A:190029713;C:193734250;G:194752855;T:175212145;N:54417,140,,,,190029713,193734250,194752855,175212145,54417,SRX23108215,SRS20063053,SRA1780265,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,0.00076,,5e-05,,0.99859,,0.70873,,140,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Austria,2024-01-05,Blastula,Embryo,Whole Organism,All anatomical structures 30599,SRR27865238,SRX23527802,SRS20377517,SRP488009,PRJNA1073183,Transcriptome of SEMA5A MT ATP6 ZNF662 and KDM4C in zebrafish embryos,PRJNA1073183,Other,,,,,Embryos transcriptome,Embryos transcriptome,,strain:AB|breed:Egg water|age:5hpf|dev stage:5hpf|sex:not applicable|tissue:Embryos|collection date:not applicable|geo loc name:not applicable|BioSampleModel:Model organism or animal,,,,,,,,,con MO,6,6,con MO,,,RNA-Seq,TRANSCRIPTOMIC,RT-PCR,SINGLE,ILLUMINA,Illumina HiSeq 4000,,SRP488009,,,con-KDM_1.fq.gz con-KDM_2.fq.gz,fastq fastq,7088132100.0,23627107.0,con KDM 1.fq.gz,0:150 1:150,A:1893419600;C:1649526065;G:1662549202;T:1882459200;N:178033,150,150,,,1893419600,1649526065,1662549202,1882459200,178033,SRX23527802,SRS20377517,SRA1797184,Sichuan University|West China Second University Hospital,Sichuan University,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2024-02-04,Blastula,Embryo,Embryo Imprecise,All anatomical structures 30600,SRR27865239,SRX23527801,SRS20377517,SRP488009,PRJNA1073183,Transcriptome of SEMA5A MT ATP6 ZNF662 and KDM4C in zebrafish embryos,PRJNA1073183,Other,,,,,Embryos transcriptome,Embryos transcriptome,,strain:AB|breed:Egg water|age:5hpf|dev stage:5hpf|sex:not applicable|tissue:Embryos|collection date:not applicable|geo loc name:not applicable|BioSampleModel:Model organism or animal,,,,,,,,,KDM4C MO,5,5,KDM4C MO,,,RNA-Seq,TRANSCRIPTOMIC,RT-PCR,SINGLE,ILLUMINA,Illumina HiSeq 4000,,SRP488009,,,KDM-MO_1.fq.gz KDM-MO_2.fq.gz,fastq fastq,7876840500.0,26256135.0,KDM MO 1.fq.gz,0:150 1:150,A:2104173142;C:1831662159;G:1843980192;T:2096831538;N:193469,150,150,,,2104173142,1831662159,1843980192,2096831538,193469,SRX23527801,SRS20377517,SRA1797184,Sichuan University|West China Second University Hospital,Sichuan University,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2024-02-04,Blastula,Embryo,Embryo Imprecise,All anatomical structures 30601,SRR27865240,SRX23527800,SRS20377517,SRP488009,PRJNA1073183,Transcriptome of SEMA5A MT ATP6 ZNF662 and KDM4C in zebrafish embryos,PRJNA1073183,Other,,,,,Embryos transcriptome,Embryos transcriptome,,strain:AB|breed:Egg water|age:5hpf|dev stage:5hpf|sex:not applicable|tissue:Embryos|collection date:not applicable|geo loc name:not applicable|BioSampleModel:Model organism or animal,,,,,,,,,ZNF662 MO,4,4,ZNF662 MO,,,RNA-Seq,TRANSCRIPTOMIC,RT-PCR,SINGLE,ILLUMINA,Illumina HiSeq 4000,,SRP488009,,,znf547-MO_1.fq.gz znf547-MO_2.fq.gz,fastq fastq,7573815300.0,25246051.0,znf547 MO 1.fq.gz,0:150 1:150,A:2014197761;C:1766587259;G:1782217029;T:2010540623;N:272628,150,150,,,2014197761,1766587259,1782217029,2010540623,272628,SRX23527800,SRS20377517,SRA1797184,Sichuan University|West China Second University Hospital,Sichuan University,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2024-02-04,Blastula,Embryo,Embryo Imprecise,All anatomical structures 30602,SRR27865241,SRX23527799,SRS20377517,SRP488009,PRJNA1073183,Transcriptome of SEMA5A MT ATP6 ZNF662 and KDM4C in zebrafish embryos,PRJNA1073183,Other,,,,,Embryos transcriptome,Embryos transcriptome,,strain:AB|breed:Egg water|age:5hpf|dev stage:5hpf|sex:not applicable|tissue:Embryos|collection date:not applicable|geo loc name:not applicable|BioSampleModel:Model organism or animal,,,,,,,,,SEMA5A RNA,3,3,SEMA5A RNA,,,RNA-Seq,TRANSCRIPTOMIC,RT-PCR,SINGLE,ILLUMINA,Illumina HiSeq 4000,,SRP488009,,,semRNA_1.fq.gz semRNA_2.fq.gz,fastq fastq,5575566000.0,18585220.0,semRNA 1.fq.gz,0:150 1:150,A:1456001758;C:1325628099;G:1339796989;T:1454076989;N:62165,150,150,,,1456001758,1325628099,1339796989,1454076989,62165,SRX23527799,SRS20377517,SRA1797184,Sichuan University|West China Second University Hospital,Sichuan University,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2024-02-04,Blastula,Embryo,Embryo Imprecise,All anatomical structures 30603,SRR27865242,SRX23527798,SRS20377517,SRP488009,PRJNA1073183,Transcriptome of SEMA5A MT ATP6 ZNF662 and KDM4C in zebrafish embryos,PRJNA1073183,Other,,,,,Embryos transcriptome,Embryos transcriptome,,strain:AB|breed:Egg water|age:5hpf|dev stage:5hpf|sex:not applicable|tissue:Embryos|collection date:not applicable|geo loc name:not applicable|BioSampleModel:Model organism or animal,,,,,,,,,MT ATP6 RNA,2,2,MT ATP6 RNA,,,RNA-Seq,TRANSCRIPTOMIC,RT-PCR,SINGLE,ILLUMINA,Illumina HiSeq 4000,,SRP488009,,,ATP6-RNA_1.fq.gz ATP6-RNA_2.fq.gz,fastq fastq,5437771200.0,18125904.0,ATP6 RNA 1.fq.gz,0:150 1:150,A:1438540045;C:1272310670;G:1290121053;T:1436739799;N:59633,150,150,,,1438540045,1272310670,1290121053,1436739799,59633,SRX23527798,SRS20377517,SRA1797184,Sichuan University|West China Second University Hospital,Sichuan University,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2024-02-04,Blastula,Embryo,Embryo Imprecise,All anatomical structures 30604,SRR27865243,SRX23527797,SRS20377517,SRP488009,PRJNA1073183,Transcriptome of SEMA5A MT ATP6 ZNF662 and KDM4C in zebrafish embryos,PRJNA1073183,Other,,,,,Embryos transcriptome,Embryos transcriptome,,strain:AB|breed:Egg water|age:5hpf|dev stage:5hpf|sex:not applicable|tissue:Embryos|collection date:not applicable|geo loc name:not applicable|BioSampleModel:Model organism or animal,,,,,,,,,con RNA,1,1,con RNA,,,RNA-Seq,TRANSCRIPTOMIC,RT-PCR,SINGLE,ILLUMINA,Illumina HiSeq 4000,,SRP488009,,,con-RNA_1.fq.gz con-RNA_2.fq.gz,fastq fastq,6733158900.0,22443863.0,con RNA 1.fq.gz,0:150 1:150,A:1766014369;C:1595337569;G:1610127771;T:1761604971;N:74220,150,150,,,1766014369,1595337569,1610127771,1761604971,74220,SRX23527797,SRS20377517,SRA1797184,Sichuan University|West China Second University Hospital,Sichuan University,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,China,2024-02-04,Blastula,Embryo,Embryo Imprecise,All anatomical structures 30766,SRR28348932,SRX23954964,SRS20755385,SRP495323,PRJNA1088158,Protein profiling of zebrafish embryos unmasks regulatory layers during early embryogenesis.,GSE261646,Transcriptome Analysis,The maternal to zygotic transition is crucial in embryonic development marked by the degradation of maternally provided mRNAs and initiation of zygotic gene expression. However the changes occurring at the protein level during this transition remain unclear. Here we conducted protein profiling throughout zebrafish embryogenesis using quantitative mass spectrometry integrating transcriptomics and translatomics datasets. Our data shows that unlike RNA changes protein changes are less dynamic. Further increases in protein levels correlate with mRNA translation whereas declines in protein levels do not suggesting active protein degradation processes. Interestingly proteins from pure zygotic genes are present at fertilization challenging existing mRNA based gene classifications. As a proof of concept we utilized CRISPR Cas13d to target znf281b mRNA a gene whose protein significantly accumulates within the first two hpf demonstrating its crucial role in development. Consequently our protein profiling coupled with CRISPR Cas13d offers a new approach to unravel maternal mRNAs function during embryonic development. Overall design: Two biological replicate samples containing 50 zebrafish oocytes per stage were collected by pairing females in natural matings to ''purge'' mature eggs and used to establish an oogenesis time line. Fish were euthanized and ovaries harvested within 1–11 days post purging dpp. Stage I and II oocytes were collected at 1–2 dpp stage III oocytes germinal vesicle in central position at 4–7 dpp and stage IV oocytes germinal vesicle asymmetrically located at 8–10 dpp. Oocyte isolations were based on73 and conducted in isolation medium Leibovitz L 15 Sigma Aldrich #L5520 plus Collagenase I and II depending on the stages as follows. Stages I and II were isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130 and 3 mg/mL Collagenase II Gibco 17101015. Stage III was isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130. Stage IV was isolated by mechanical stripping with forceps and needle without xxx use of Collagenases. Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. Three biological replicate samples containing 20 dechorionated zebrafish embryos were snap frozen in TRIzol Invitrogen #15596026. Four time points of embryonic development were included: 1 cell stage 0 hpf hpf 2 hpf 4 hpf and 6 hpf. RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols.,,pubmed:39302832,,Zebrafish Embryo 4hpf rep3,GSM8147861,,source name:Whole embryo|tissue:Whole embryo|developmental stage:4hpf|genotype:AB TF and TLF|geo loc name:missing|collection date:missing,Zebrafish Embryo 4hpf rep3,Raw reads from zebrafish oocytes stages I IV and embryos 0 2 4 and 6 hpf were demultiplexed into FASTQ format allowing up to one mismatch using Illumina bcl convert 3.10.5. Reads were aligned to UCSC genome danRer11 with STAR aligner version 2.7.3a using Ensembl 106 gene models. Counts were converted to TPM values using RSEM version v1.3.0 and all subsequent analysis was done using TPM. Assembly: danRer11 Ensembl 106 gene models Supplementary files format and content: comma separated files with TPMs from all replicates,Whole embryo,,Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer’s protocols. 0 2 4 and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer’s protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0 2 4 and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer’s directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598 and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled quantified and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer’s instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina Cat. No. 20020598 and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized pooled and sequenced on a NextSeq 500 instrument Illumina as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.,,tissue:Whole embryo|developmental stage:4hpf|genotype:AB TF and TLF,GSM8147861,GSM8147861: Zebrafish Embryo 4hpf rep3; Danio rerio; RNA Seq,GSM8147861 r1,GSM8147861,1,Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. 0 2 4 and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0 2 4 and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer's directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598 and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled quantified and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer's instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina Cat. No. 20020598 and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized pooled and sequenced on a NextSeq 500 instrument Illumina as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP495323,,,s_4hpf_3.fastq,fastq,1795835160.0,23629410.0,GSM8147861 r1,0:76,A:438577940;C:442051089;G:414188325;T:500933940;N:83866,76,,,,438577940,442051089,414188325,500933940,83866,SRX23954964,SRS20755385,SRA1824599,"Computational Biology, Stowers Institute for Medical Research","Computational Biology, Stowers Institute for Medical Research",,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,trueseq,bulk,bulk,bulk,,United States,2024-03-14,Blastula,Embryo,Whole Organism,All anatomical structures 30767,SRR28348933,SRX23954963,SRS20755384,SRP495323,PRJNA1088158,Protein profiling of zebrafish embryos unmasks regulatory layers during early embryogenesis.,GSE261646,Transcriptome Analysis,The maternal to zygotic transition is crucial in embryonic development marked by the degradation of maternally provided mRNAs and initiation of zygotic gene expression. However the changes occurring at the protein level during this transition remain unclear. Here we conducted protein profiling throughout zebrafish embryogenesis using quantitative mass spectrometry integrating transcriptomics and translatomics datasets. Our data shows that unlike RNA changes protein changes are less dynamic. Further increases in protein levels correlate with mRNA translation whereas declines in protein levels do not suggesting active protein degradation processes. Interestingly proteins from pure zygotic genes are present at fertilization challenging existing mRNA based gene classifications. As a proof of concept we utilized CRISPR Cas13d to target znf281b mRNA a gene whose protein significantly accumulates within the first two hpf demonstrating its crucial role in development. Consequently our protein profiling coupled with CRISPR Cas13d offers a new approach to unravel maternal mRNAs function during embryonic development. Overall design: Two biological replicate samples containing 50 zebrafish oocytes per stage were collected by pairing females in natural matings to ''purge'' mature eggs and used to establish an oogenesis time line. Fish were euthanized and ovaries harvested within 1–11 days post purging dpp. Stage I and II oocytes were collected at 1–2 dpp stage III oocytes germinal vesicle in central position at 4–7 dpp and stage IV oocytes germinal vesicle asymmetrically located at 8–10 dpp. Oocyte isolations were based on73 and conducted in isolation medium Leibovitz L 15 Sigma Aldrich #L5520 plus Collagenase I and II depending on the stages as follows. Stages I and II were isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130 and 3 mg/mL Collagenase II Gibco 17101015. Stage III was isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130. Stage IV was isolated by mechanical stripping with forceps and needle without xxx use of Collagenases. Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. Three biological replicate samples containing 20 dechorionated zebrafish embryos were snap frozen in TRIzol Invitrogen #15596026. Four time points of embryonic development were included: 1 cell stage 0 hpf hpf 2 hpf 4 hpf and 6 hpf. RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols.,,pubmed:39302832,,Zebrafish Embryo 4hpf rep2,GSM8147860,,source name:Whole embryo|tissue:Whole embryo|developmental stage:4hpf|genotype:AB TF and TLF|geo loc name:missing|collection date:missing,Zebrafish Embryo 4hpf rep2,Raw reads from zebrafish oocytes stages I IV and embryos 0 2 4 and 6 hpf were demultiplexed into FASTQ format allowing up to one mismatch using Illumina bcl convert 3.10.5. Reads were aligned to UCSC genome danRer11 with STAR aligner version 2.7.3a using Ensembl 106 gene models. Counts were converted to TPM values using RSEM version v1.3.0 and all subsequent analysis was done using TPM. Assembly: danRer11 Ensembl 106 gene models Supplementary files format and content: comma separated files with TPMs from all replicates,Whole embryo,,Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer’s protocols. 0 2 4 and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer’s protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0 2 4 and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer’s directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598 and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled quantified and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer’s instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina Cat. No. 20020598 and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized pooled and sequenced on a NextSeq 500 instrument Illumina as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.,,tissue:Whole embryo|developmental stage:4hpf|genotype:AB TF and TLF,GSM8147860,GSM8147860: Zebrafish Embryo 4hpf rep2; Danio rerio; RNA Seq,GSM8147860 r1,GSM8147860,1,Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. 0 2 4 and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0 2 4 and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer's directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598 and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled quantified and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer's instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina Cat. No. 20020598 and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized pooled and sequenced on a NextSeq 500 instrument Illumina as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP495323,,,s_4hpf_2.fastq,fastq,1665073892.0,21908867.0,GSM8147860 r1,0:76,A:405272447;C:411954373;G:384597098;T:463177801;N:72173,76,,,,405272447,411954373,384597098,463177801,72173,SRX23954963,SRS20755384,SRA1824599,"Computational Biology, Stowers Institute for Medical Research","Computational Biology, Stowers Institute for Medical Research",,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,trueseq,bulk,bulk,bulk,,United States,2024-03-14,Blastula,Embryo,Whole Organism,All anatomical structures 30768,SRR28348934,SRX23954962,SRS20755383,SRP495323,PRJNA1088158,Protein profiling of zebrafish embryos unmasks regulatory layers during early embryogenesis.,GSE261646,Transcriptome Analysis,The maternal to zygotic transition is crucial in embryonic development marked by the degradation of maternally provided mRNAs and initiation of zygotic gene expression. However the changes occurring at the protein level during this transition remain unclear. Here we conducted protein profiling throughout zebrafish embryogenesis using quantitative mass spectrometry integrating transcriptomics and translatomics datasets. Our data shows that unlike RNA changes protein changes are less dynamic. Further increases in protein levels correlate with mRNA translation whereas declines in protein levels do not suggesting active protein degradation processes. Interestingly proteins from pure zygotic genes are present at fertilization challenging existing mRNA based gene classifications. As a proof of concept we utilized CRISPR Cas13d to target znf281b mRNA a gene whose protein significantly accumulates within the first two hpf demonstrating its crucial role in development. Consequently our protein profiling coupled with CRISPR Cas13d offers a new approach to unravel maternal mRNAs function during embryonic development. Overall design: Two biological replicate samples containing 50 zebrafish oocytes per stage were collected by pairing females in natural matings to ''purge'' mature eggs and used to establish an oogenesis time line. Fish were euthanized and ovaries harvested within 1–11 days post purging dpp. Stage I and II oocytes were collected at 1–2 dpp stage III oocytes germinal vesicle in central position at 4–7 dpp and stage IV oocytes germinal vesicle asymmetrically located at 8–10 dpp. Oocyte isolations were based on73 and conducted in isolation medium Leibovitz L 15 Sigma Aldrich #L5520 plus Collagenase I and II depending on the stages as follows. Stages I and II were isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130 and 3 mg/mL Collagenase II Gibco 17101015. Stage III was isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130. Stage IV was isolated by mechanical stripping with forceps and needle without xxx use of Collagenases. Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. Three biological replicate samples containing 20 dechorionated zebrafish embryos were snap frozen in TRIzol Invitrogen #15596026. Four time points of embryonic development were included: 1 cell stage 0 hpf hpf 2 hpf 4 hpf and 6 hpf. RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols.,,pubmed:39302832,,Zebrafish Embryo 4hpf rep1,GSM8147859,,source name:Whole embryo|tissue:Whole embryo|developmental stage:4hpf|genotype:AB TF and TLF|geo loc name:missing|collection date:missing,Zebrafish Embryo 4hpf rep1,Raw reads from zebrafish oocytes stages I IV and embryos 0 2 4 and 6 hpf were demultiplexed into FASTQ format allowing up to one mismatch using Illumina bcl convert 3.10.5. Reads were aligned to UCSC genome danRer11 with STAR aligner version 2.7.3a using Ensembl 106 gene models. Counts were converted to TPM values using RSEM version v1.3.0 and all subsequent analysis was done using TPM. Assembly: danRer11 Ensembl 106 gene models Supplementary files format and content: comma separated files with TPMs from all replicates,Whole embryo,,Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer’s protocols. 0 2 4 and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer’s protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0 2 4 and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer’s directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598 and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled quantified and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer’s instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina Cat. No. 20020598 and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized pooled and sequenced on a NextSeq 500 instrument Illumina as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.,,tissue:Whole embryo|developmental stage:4hpf|genotype:AB TF and TLF,GSM8147859,GSM8147859: Zebrafish Embryo 4hpf rep1; Danio rerio; RNA Seq,GSM8147859 r1,GSM8147859,1,Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. 0 2 4 and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0 2 4 and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer's directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598 and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled quantified and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer's instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina Cat. No. 20020598 and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized pooled and sequenced on a NextSeq 500 instrument Illumina as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP495323,,,s_4hpf_1.fastq,fastq,1494269972.0,19661447.0,GSM8147859 r1,0:76,A:365052201;C:369717962;G:351357642;T:408073055;N:69112,76,,,,365052201,369717962,351357642,408073055,69112,SRX23954962,SRS20755383,SRA1824599,"Computational Biology, Stowers Institute for Medical Research","Computational Biology, Stowers Institute for Medical Research",,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,trueseq,bulk,bulk,bulk,,United States,2024-03-14,Blastula,Embryo,Whole Organism,All anatomical structures 32044,SRR29007855,SRX24534915,SRS21280597,SRP507323,PRJNA1111056,Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis,GSE267318,Transcriptome Analysis,Mitochondrial energy production is essential for development yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity abundance morphology metabolome proteome and phospho proteome as well as respiratory chain enzymatic activity we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis is not limited by metabolic substrates at early stages and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and actinomycin injected embryos to block zygotic transcription.,,,,oligomycin 4h 242215,GSM8263867,,source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:oligomycin|time:4 hpf|geo loc name:missing|collection date:missing,oligomycin 4h 242215,Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome phiX174 genome and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample,Embryo,Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore 495455 1µM actinomycin D Sigma Aldrich A1410 10µg/ml. Untreated embryos were kept alongside as controls.,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue.,tissue:Embryo|genotype:WT TLAB|treatment:oligomycin|time:4 hpf,GSM8263867,GSM8263867: oligomycin 4h 242215; Danio rerio; RNA Seq,GSM8263867 r1,GSM8263867,1,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP507323,,loader:fastq load.py,242215_S23_R1_001.fastq.gz,fastq,1099252600.0,10992526.0,GSM8263867 r1,0:100,A:394615526;C:165624413;G:213165848;T:325764464;N:82349,100,,,,394615526,165624413,213165848,325764464,82349,SRX24534915,SRS21280597,SRA1865615,"Pauli, IMP","Pauli, IMP",,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq_v2,unknown,poly_a,lexogen,bulk,unknown,unknown,,Austria,2024-05-13,Blastula,Embryo,Embryo Imprecise,All anatomical structures 32045,SRR29007856,SRX24534914,SRS21280596,SRP507323,PRJNA1111056,Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis,GSE267318,Transcriptome Analysis,Mitochondrial energy production is essential for development yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity abundance morphology metabolome proteome and phospho proteome as well as respiratory chain enzymatic activity we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis is not limited by metabolic substrates at early stages and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and actinomycin injected embryos to block zygotic transcription.,,,,actinomycinD 4h 242212,GSM8263866,,source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:actinomycin D|time:4 hpf|geo loc name:missing|collection date:missing,actinomycinD 4h 242212,Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome phiX174 genome and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample,Embryo,Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore 495455 1µM actinomycin D Sigma Aldrich A1410 10µg/ml. Untreated embryos were kept alongside as controls.,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue.,tissue:Embryo|genotype:WT TLAB|treatment:actinomycin D|time:4 hpf,GSM8263866,GSM8263866: actinomycinD 4h 242212; Danio rerio; RNA Seq,GSM8263866 r1,GSM8263866,1,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP507323,,loader:fastq load.py,242212_S20_R1_001.fastq.gz,fastq,1070478700.0,10704787.0,GSM8263866 r1,0:100,A:386458341;C:166600394;G:207856798;T:309482168;N:80999,100,,,,386458341,166600394,207856798,309482168,80999,SRX24534914,SRS21280596,SRA1865615,"Pauli, IMP","Pauli, IMP",,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq_v2,unknown,poly_a,lexogen,bulk,unknown,unknown,,Austria,2024-05-13,Blastula,Embryo,Embryo Imprecise,All anatomical structures 32046,SRR29007857,SRX24534913,SRS21280595,SRP507323,PRJNA1111056,Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis,GSE267318,Transcriptome Analysis,Mitochondrial energy production is essential for development yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity abundance morphology metabolome proteome and phospho proteome as well as respiratory chain enzymatic activity we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis is not limited by metabolic substrates at early stages and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and actinomycin injected embryos to block zygotic transcription.,,,,untreated 4h 242211,GSM8263865,,source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:untreated|time:4 hpf|geo loc name:missing|collection date:missing,untreated 4h 242211,Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome phiX174 genome and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample,Embryo,Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore 495455 1µM actinomycin D Sigma Aldrich A1410 10µg/ml. Untreated embryos were kept alongside as controls.,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue.,tissue:Embryo|genotype:WT TLAB|treatment:untreated|time:4 hpf,GSM8263865,GSM8263865: untreated 4h 242211; Danio rerio; RNA Seq,GSM8263865 r1,GSM8263865,1,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP507323,,loader:fastq load.py,242211_S19_R1_001.fastq.gz,fastq,1093429200.0,10934292.0,GSM8263865 r1,0:100,A:392334220;C:167896391;G:211513304;T:321602672;N:82613,100,,,,392334220,167896391,211513304,321602672,82613,SRX24534913,SRS21280595,SRA1865615,"Pauli, IMP","Pauli, IMP",,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq_v2,unknown,poly_a,lexogen,bulk,unknown,unknown,,Austria,2024-05-13,Blastula,Embryo,Embryo Imprecise,All anatomical structures 32047,SRR29007858,SRX24534912,SRS21280594,SRP507323,PRJNA1111056,Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis,GSE267318,Transcriptome Analysis,Mitochondrial energy production is essential for development yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity abundance morphology metabolome proteome and phospho proteome as well as respiratory chain enzymatic activity we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis is not limited by metabolic substrates at early stages and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and actinomycin injected embryos to block zygotic transcription.,,,,oligomycin 3h 242209,GSM8263864,,source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:oligomycin|time:3 hpf|geo loc name:missing|collection date:missing,oligomycin 3h 242209,Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome phiX174 genome and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample,Embryo,Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore 495455 1µM actinomycin D Sigma Aldrich A1410 10µg/ml. Untreated embryos were kept alongside as controls.,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue.,tissue:Embryo|genotype:WT TLAB|treatment:oligomycin|time:3 hpf,GSM8263864,GSM8263864: oligomycin 3h 242209; Danio rerio; RNA Seq,GSM8263864 r1,GSM8263864,1,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP507323,,loader:fastq load.py,242209_S17_R1_001.fastq.gz,fastq,1033704400.0,10337044.0,GSM8263864 r1,0:100,A:369215986;C:155452490;G:201728964;T:307228931;N:78029,100,,,,369215986,155452490,201728964,307228931,78029,SRX24534912,SRS21280594,SRA1865615,"Pauli, IMP","Pauli, IMP",,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq_v2,unknown,poly_a,lexogen,bulk,unknown,unknown,,Austria,2024-05-13,Blastula,Embryo,Embryo Imprecise,All anatomical structures 32048,SRR29007859,SRX24534911,SRS21280593,SRP507323,PRJNA1111056,Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis,GSE267318,Transcriptome Analysis,Mitochondrial energy production is essential for development yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity abundance morphology metabolome proteome and phospho proteome as well as respiratory chain enzymatic activity we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis is not limited by metabolic substrates at early stages and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and actinomycin injected embryos to block zygotic transcription.,,,,actinomycinD 3h 242206,GSM8263863,,source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:actinomycin D|time:3 hpf|geo loc name:missing|collection date:missing,actinomycinD 3h 242206,Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome phiX174 genome and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample,Embryo,Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore 495455 1µM actinomycin D Sigma Aldrich A1410 10µg/ml. Untreated embryos were kept alongside as controls.,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue.,tissue:Embryo|genotype:WT TLAB|treatment:actinomycin D|time:3 hpf,GSM8263863,GSM8263863: actinomycinD 3h 242206; Danio rerio; RNA Seq,GSM8263863 r1,GSM8263863,1,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP507323,,loader:fastq load.py,242206_S14_R1_001.fastq.gz,fastq,953006400.0,9530064.0,GSM8263863 r1,0:100,A:347108918;C:144085943;G:185036985;T:276702150;N:72404,100,,,,347108918,144085943,185036985,276702150,72404,SRX24534911,SRS21280593,SRA1865615,"Pauli, IMP","Pauli, IMP",,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq_v2,unknown,poly_a,lexogen,bulk,unknown,unknown,,Austria,2024-05-13,Blastula,Embryo,Embryo Imprecise,All anatomical structures 32049,SRR29007860,SRX24534910,SRS21280592,SRP507323,PRJNA1111056,Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis,GSE267318,Transcriptome Analysis,Mitochondrial energy production is essential for development yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity abundance morphology metabolome proteome and phospho proteome as well as respiratory chain enzymatic activity we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis is not limited by metabolic substrates at early stages and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and actinomycin injected embryos to block zygotic transcription.,,,,untreated 3h 242205,GSM8263862,,source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:untreated|time:3 hpf|geo loc name:missing|collection date:missing,untreated 3h 242205,Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome phiX174 genome and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample,Embryo,Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore 495455 1µM actinomycin D Sigma Aldrich A1410 10µg/ml. Untreated embryos were kept alongside as controls.,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue.,tissue:Embryo|genotype:WT TLAB|treatment:untreated|time:3 hpf,GSM8263862,GSM8263862: untreated 3h 242205; Danio rerio; RNA Seq,GSM8263862 r1,GSM8263862,1,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP507323,,loader:fastq load.py,242205_S13_R1_001.fastq.gz,fastq,982492000.0,9824920.0,GSM8263862 r1,0:100,A:357327274;C:147958580;G:190520366;T:286610800;N:74980,100,,,,357327274,147958580,190520366,286610800,74980,SRX24534910,SRS21280592,SRA1865615,"Pauli, IMP","Pauli, IMP",,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq_v2,unknown,poly_a,lexogen,bulk,unknown,unknown,,Austria,2024-05-13,Blastula,Embryo,Embryo Imprecise,All anatomical structures 32050,SRR29007861,SRX24534909,SRS21280591,SRP507323,PRJNA1111056,Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis,GSE267318,Transcriptome Analysis,Mitochondrial energy production is essential for development yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity abundance morphology metabolome proteome and phospho proteome as well as respiratory chain enzymatic activity we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis is not limited by metabolic substrates at early stages and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and actinomycin injected embryos to block zygotic transcription.,,,,oligomycin 4h 242203,GSM8263861,,source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:oligomycin|time:4 hpf|geo loc name:missing|collection date:missing,oligomycin 4h 242203,Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome phiX174 genome and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample,Embryo,Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore 495455 1µM actinomycin D Sigma Aldrich A1410 10µg/ml. Untreated embryos were kept alongside as controls.,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue.,tissue:Embryo|genotype:WT TLAB|treatment:oligomycin|time:4 hpf,GSM8263861,GSM8263861: oligomycin 4h 242203; Danio rerio; RNA Seq,GSM8263861 r1,GSM8263861,1,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP507323,,loader:fastq load.py,242203_S11_R1_001.fastq.gz,fastq,1079609500.0,10796095.0,GSM8263861 r1,0:100,A:394901944;C:165258089;G:209628914;T:309738395;N:82158,100,,,,394901944,165258089,209628914,309738395,82158,SRX24534909,SRS21280591,SRA1865615,"Pauli, IMP","Pauli, IMP",,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq_v2,unknown,poly_a,lexogen,bulk,unknown,unknown,,Austria,2024-05-13,Blastula,Embryo,Embryo Imprecise,All anatomical structures 32051,SRR29007862,SRX24534908,SRS21280590,SRP507323,PRJNA1111056,Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis,GSE267318,Transcriptome Analysis,Mitochondrial energy production is essential for development yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity abundance morphology metabolome proteome and phospho proteome as well as respiratory chain enzymatic activity we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis is not limited by metabolic substrates at early stages and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and actinomycin injected embryos to block zygotic transcription.,,,,actinomycinD 4h 242200,GSM8263860,,source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:actinomycin D|time:4 hpf|geo loc name:missing|collection date:missing,actinomycinD 4h 242200,Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome phiX174 genome and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample,Embryo,Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore 495455 1µM actinomycin D Sigma Aldrich A1410 10µg/ml. Untreated embryos were kept alongside as controls.,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue.,tissue:Embryo|genotype:WT TLAB|treatment:actinomycin D|time:4 hpf,GSM8263860,GSM8263860: actinomycinD 4h 242200; Danio rerio; RNA Seq,GSM8263860 r1,GSM8263860,1,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP507323,,loader:fastq load.py,242200_S8_R1_001.fastq.gz,fastq,1408252700.0,14082527.0,GSM8263860 r1,0:100,A:522222777;C:222590725;G:272313366;T:391018385;N:107447,100,,,,522222777,222590725,272313366,391018385,107447,SRX24534908,SRS21280590,SRA1865615,"Pauli, IMP","Pauli, IMP",,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq_v2,unknown,poly_a,lexogen,bulk,unknown,unknown,,Austria,2024-05-13,Blastula,Embryo,Embryo Imprecise,All anatomical structures 32052,SRR29007863,SRX24534907,SRS21280589,SRP507323,PRJNA1111056,Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis,GSE267318,Transcriptome Analysis,Mitochondrial energy production is essential for development yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity abundance morphology metabolome proteome and phospho proteome as well as respiratory chain enzymatic activity we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis is not limited by metabolic substrates at early stages and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and actinomycin injected embryos to block zygotic transcription.,,,,untreated 4h 242199,GSM8263859,,source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:untreated|time:4 hpf|geo loc name:missing|collection date:missing,untreated 4h 242199,Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome phiX174 genome and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample,Embryo,Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore 495455 1µM actinomycin D Sigma Aldrich A1410 10µg/ml. Untreated embryos were kept alongside as controls.,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue.,tissue:Embryo|genotype:WT TLAB|treatment:untreated|time:4 hpf,GSM8263859,GSM8263859: untreated 4h 242199; Danio rerio; RNA Seq,GSM8263859 r1,GSM8263859,1,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP507323,,loader:fastq load.py,242199_S7_R1_001.fastq.gz,fastq,1125950000.0,11259500.0,GSM8263859 r1,0:100,A:414249487;C:173739254;G:216615243;T:321259585;N:86431,100,,,,414249487,173739254,216615243,321259585,86431,SRX24534907,SRS21280589,SRA1865615,"Pauli, IMP","Pauli, IMP",,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq_v2,unknown,poly_a,lexogen,bulk,unknown,unknown,,Austria,2024-05-13,Blastula,Embryo,Embryo Imprecise,All anatomical structures 32053,SRR29007864,SRX24534906,SRS21280588,SRP507323,PRJNA1111056,Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis,GSE267318,Transcriptome Analysis,Mitochondrial energy production is essential for development yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity abundance morphology metabolome proteome and phospho proteome as well as respiratory chain enzymatic activity we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis is not limited by metabolic substrates at early stages and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and actinomycin injected embryos to block zygotic transcription.,,,,oligomycin 3h 242197,GSM8263858,,source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:oligomycin|time:3 hpf|geo loc name:missing|collection date:missing,oligomycin 3h 242197,Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome phiX174 genome and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample,Embryo,Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore 495455 1µM actinomycin D Sigma Aldrich A1410 10µg/ml. Untreated embryos were kept alongside as controls.,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue.,tissue:Embryo|genotype:WT TLAB|treatment:oligomycin|time:3 hpf,GSM8263858,GSM8263858: oligomycin 3h 242197; Danio rerio; RNA Seq,GSM8263858 r1,GSM8263858,1,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP507323,,loader:fastq load.py,242197_S5_R1_001.fastq.gz,fastq,947773600.0,9477736.0,GSM8263858 r1,0:100,A:338345008;C:149341339;G:191300275;T:268714670;N:72308,100,,,,338345008,149341339,191300275,268714670,72308,SRX24534906,SRS21280588,SRA1865615,"Pauli, IMP","Pauli, IMP",,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq_v2,unknown,poly_a,lexogen,bulk,unknown,unknown,,Austria,2024-05-13,Blastula,Embryo,Embryo Imprecise,All anatomical structures 32054,SRR29007865,SRX24534905,SRS21280587,SRP507323,PRJNA1111056,Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis,GSE267318,Transcriptome Analysis,Mitochondrial energy production is essential for development yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity abundance morphology metabolome proteome and phospho proteome as well as respiratory chain enzymatic activity we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis is not limited by metabolic substrates at early stages and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and actinomycin injected embryos to block zygotic transcription.,,,,actinomycinD 3h 242194,GSM8263857,,source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:actinomycin D|time:3 hpf|geo loc name:missing|collection date:missing,actinomycinD 3h 242194,Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome phiX174 genome and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample,Embryo,Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore 495455 1µM actinomycin D Sigma Aldrich A1410 10µg/ml. Untreated embryos were kept alongside as controls.,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue.,tissue:Embryo|genotype:WT TLAB|treatment:actinomycin D|time:3 hpf,GSM8263857,GSM8263857: actinomycinD 3h 242194; Danio rerio; RNA Seq,GSM8263857 r1,GSM8263857,1,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP507323,,loader:fastq load.py,242194_S2_R1_001.fastq.gz,fastq,886739500.0,8867395.0,GSM8263857 r1,0:100,A:323640364;C:133799218;G:171921906;T:257310512;N:67500,100,,,,323640364,133799218,171921906,257310512,67500,SRX24534905,SRS21280587,SRA1865615,"Pauli, IMP","Pauli, IMP",,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq_v2,unknown,poly_a,lexogen,bulk,unknown,unknown,,Austria,2024-05-13,Blastula,Embryo,Embryo Imprecise,All anatomical structures 32055,SRR29007866,SRX24534904,SRS21280586,SRP507323,PRJNA1111056,Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis,GSE267318,Transcriptome Analysis,Mitochondrial energy production is essential for development yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity abundance morphology metabolome proteome and phospho proteome as well as respiratory chain enzymatic activity we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis is not limited by metabolic substrates at early stages and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and actinomycin injected embryos to block zygotic transcription.,,,,untreated 3h 242193,GSM8263856,,source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:untreated|time:3 hpf|geo loc name:missing|collection date:missing,untreated 3h 242193,Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome phiX174 genome and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample,Embryo,Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore 495455 1µM actinomycin D Sigma Aldrich A1410 10µg/ml. Untreated embryos were kept alongside as controls.,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue.,tissue:Embryo|genotype:WT TLAB|treatment:untreated|time:3 hpf,GSM8263856,GSM8263856: untreated 3h 242193; Danio rerio; RNA Seq,GSM8263856 r1,GSM8263856,1,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP507323,,loader:fastq load.py,242193_S1_R1_001.fastq.gz,fastq,916695300.0,9166953.0,GSM8263856 r1,0:100,A:336335924;C:139550128;G:175519815;T:265220434;N:68999,100,,,,336335924,139550128,175519815,265220434,68999,SRX24534904,SRS21280586,SRA1865615,"Pauli, IMP","Pauli, IMP",,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq_v2,unknown,poly_a,lexogen,bulk,unknown,unknown,,Austria,2024-05-13,Blastula,Embryo,Embryo Imprecise,All anatomical structures 32056,SRR29007867,SRX24534903,SRS21280585,SRP507323,PRJNA1111056,Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis,GSE267318,Transcriptome Analysis,Mitochondrial energy production is essential for development yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity abundance morphology metabolome proteome and phospho proteome as well as respiratory chain enzymatic activity we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis is not limited by metabolic substrates at early stages and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and actinomycin injected embryos to block zygotic transcription.,,,,oligomycin 4h 239880,GSM8263855,,source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:oligomycin|time:4 hpf|geo loc name:missing|collection date:missing,oligomycin 4h 239880,Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome phiX174 genome and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample,Embryo,Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore 495455 1µM actinomycin D Sigma Aldrich A1410 10µg/ml. Untreated embryos were kept alongside as controls.,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue.,tissue:Embryo|genotype:WT TLAB|treatment:oligomycin|time:4 hpf,GSM8263855,GSM8263855: oligomycin 4h 239880; Danio rerio; RNA Seq,GSM8263855 r1,GSM8263855,1,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP507323,,loader:fastq load.py,239880_S26_R1_001.fastq.gz,fastq,941675800.0,9416758.0,GSM8263855 r1,0:100,A:336490804;C:149956011;G:188167115;T:266990985;N:70885,100,,,,336490804,149956011,188167115,266990985,70885,SRX24534903,SRS21280585,SRA1865615,"Pauli, IMP","Pauli, IMP",,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq_v2,unknown,poly_a,lexogen,bulk,unknown,unknown,,Austria,2024-05-13,Blastula,Embryo,Embryo Imprecise,All anatomical structures 32057,SRR29007868,SRX24534902,SRS21280584,SRP507323,PRJNA1111056,Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis,GSE267318,Transcriptome Analysis,Mitochondrial energy production is essential for development yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity abundance morphology metabolome proteome and phospho proteome as well as respiratory chain enzymatic activity we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis is not limited by metabolic substrates at early stages and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and actinomycin injected embryos to block zygotic transcription.,,,,actinomycinD 4h 239877,GSM8263854,,source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:actinomycin D|time:4 hpf|geo loc name:missing|collection date:missing,actinomycinD 4h 239877,Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome phiX174 genome and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample,Embryo,Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore 495455 1µM actinomycin D Sigma Aldrich A1410 10µg/ml. Untreated embryos were kept alongside as controls.,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue.,tissue:Embryo|genotype:WT TLAB|treatment:actinomycin D|time:4 hpf,GSM8263854,GSM8263854: actinomycinD 4h 239877; Danio rerio; RNA Seq,GSM8263854 r1,GSM8263854,1,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP507323,,loader:fastq load.py,239877_S29_R1_001.fastq.gz,fastq,948649000.0,9486490.0,GSM8263854 r1,0:100,A:342507039;C:152067872;G:190301212;T:263700389;N:72488,100,,,,342507039,152067872,190301212,263700389,72488,SRX24534902,SRS21280584,SRA1865615,"Pauli, IMP","Pauli, IMP",,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq_v2,unknown,poly_a,lexogen,bulk,unknown,unknown,,Austria,2024-05-13,Blastula,Embryo,Embryo Imprecise,All anatomical structures 32058,SRR29007869,SRX24534901,SRS21280583,SRP507323,PRJNA1111056,Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis,GSE267318,Transcriptome Analysis,Mitochondrial energy production is essential for development yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity abundance morphology metabolome proteome and phospho proteome as well as respiratory chain enzymatic activity we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis is not limited by metabolic substrates at early stages and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and actinomycin injected embryos to block zygotic transcription.,,,,untreated 4h 239876,GSM8263853,,source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:untreated|time:4 hpf|geo loc name:missing|collection date:missing,untreated 4h 239876,Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome phiX174 genome and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample,Embryo,Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore 495455 1µM actinomycin D Sigma Aldrich A1410 10µg/ml. Untreated embryos were kept alongside as controls.,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue.,tissue:Embryo|genotype:WT TLAB|treatment:untreated|time:4 hpf,GSM8263853,GSM8263853: untreated 4h 239876; Danio rerio; RNA Seq,GSM8263853 r1,GSM8263853,1,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP507323,,loader:fastq load.py,239876_S30_R1_001.fastq.gz,fastq,1007891300.0,10078913.0,GSM8263853 r1,0:100,A:364202353;C:163475447;G:200200777;T:279934364;N:78359,100,,,,364202353,163475447,200200777,279934364,78359,SRX24534901,SRS21280583,SRA1865615,"Pauli, IMP","Pauli, IMP",,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq_v2,unknown,poly_a,lexogen,bulk,unknown,unknown,,Austria,2024-05-13,Blastula,Embryo,Embryo Imprecise,All anatomical structures 32059,SRR29007870,SRX24534900,SRS21280582,SRP507323,PRJNA1111056,Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis,GSE267318,Transcriptome Analysis,Mitochondrial energy production is essential for development yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity abundance morphology metabolome proteome and phospho proteome as well as respiratory chain enzymatic activity we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis is not limited by metabolic substrates at early stages and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and actinomycin injected embryos to block zygotic transcription.,,,,oligomycin 3h 239874,GSM8263852,,source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:oligomycin|time:3 hpf|geo loc name:missing|collection date:missing,oligomycin 3h 239874,Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome phiX174 genome and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample,Embryo,Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore 495455 1µM actinomycin D Sigma Aldrich A1410 10µg/ml. Untreated embryos were kept alongside as controls.,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue.,tissue:Embryo|genotype:WT TLAB|treatment:oligomycin|time:3 hpf,GSM8263852,GSM8263852: oligomycin 3h 239874; Danio rerio; RNA Seq,GSM8263852 r1,GSM8263852,1,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP507323,,loader:fastq load.py,239874_S32_R1_001.fastq.gz,fastq,921745200.0,9217452.0,GSM8263852 r1,0:100,A:336277555;C:146537533;G:183166424;T:255692785;N:70903,100,,,,336277555,146537533,183166424,255692785,70903,SRX24534900,SRS21280582,SRA1865615,"Pauli, IMP","Pauli, IMP",,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq_v2,unknown,poly_a,lexogen,bulk,unknown,unknown,,Austria,2024-05-13,Blastula,Embryo,Embryo Imprecise,All anatomical structures 32060,SRR29007871,SRX24534899,SRS21280581,SRP507323,PRJNA1111056,Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis,GSE267318,Transcriptome Analysis,Mitochondrial energy production is essential for development yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity abundance morphology metabolome proteome and phospho proteome as well as respiratory chain enzymatic activity we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis is not limited by metabolic substrates at early stages and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and actinomycin injected embryos to block zygotic transcription.,,,,actinomycinD 3h 239871,GSM8263851,,source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:actinomycin D|time:3 hpf|geo loc name:missing|collection date:missing,actinomycinD 3h 239871,Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome phiX174 genome and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample,Embryo,Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore 495455 1µM actinomycin D Sigma Aldrich A1410 10µg/ml. Untreated embryos were kept alongside as controls.,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue.,tissue:Embryo|genotype:WT TLAB|treatment:actinomycin D|time:3 hpf,GSM8263851,GSM8263851: actinomycinD 3h 239871; Danio rerio; RNA Seq,GSM8263851 r1,GSM8263851,1,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP507323,,loader:fastq load.py,239871_S35_R1_001.fastq.gz,fastq,916824700.0,9168247.0,GSM8263851 r1,0:100,A:339437453;C:141033621;G:179228990;T:257055652;N:68984,100,,,,339437453,141033621,179228990,257055652,68984,SRX24534899,SRS21280581,SRA1865615,"Pauli, IMP","Pauli, IMP",,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq_v2,unknown,poly_a,lexogen,bulk,unknown,unknown,,Austria,2024-05-13,Blastula,Embryo,Embryo Imprecise,All anatomical structures 32061,SRR29007872,SRX24534898,SRS21280580,SRP507323,PRJNA1111056,Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis,GSE267318,Transcriptome Analysis,Mitochondrial energy production is essential for development yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity abundance morphology metabolome proteome and phospho proteome as well as respiratory chain enzymatic activity we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis is not limited by metabolic substrates at early stages and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and actinomycin injected embryos to block zygotic transcription.,,,,untreated 3h 239870,GSM8263850,,source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:untreated|time:3 hpf|geo loc name:missing|collection date:missing,untreated 3h 239870,Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome phiX174 genome and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample,Embryo,Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore 495455 1µM actinomycin D Sigma Aldrich A1410 10µg/ml. Untreated embryos were kept alongside as controls.,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue.,tissue:Embryo|genotype:WT TLAB|treatment:untreated|time:3 hpf,GSM8263850,GSM8263850: untreated 3h 239870; Danio rerio; RNA Seq,GSM8263850 r1,GSM8263850,1,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP507323,,loader:fastq load.py,239870_S36_R1_001.fastq.gz,fastq,1093077000.0,10930770.0,GSM8263850 r1,0:100,A:401209579;C:172475514;G:213719175;T:305590035;N:82697,100,,,,401209579,172475514,213719175,305590035,82697,SRX24534898,SRS21280580,SRA1865615,"Pauli, IMP","Pauli, IMP",,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq_v2,unknown,poly_a,lexogen,bulk,unknown,unknown,,Austria,2024-05-13,Blastula,Embryo,Embryo Imprecise,All anatomical structures 32062,SRR29007873,SRX24534897,SRS21280579,SRP507323,PRJNA1111056,Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis,GSE267318,Transcriptome Analysis,Mitochondrial energy production is essential for development yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity abundance morphology metabolome proteome and phospho proteome as well as respiratory chain enzymatic activity we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis is not limited by metabolic substrates at early stages and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and actinomycin injected embryos to block zygotic transcription.,,,,oligomycin 4h 239868,GSM8263849,,source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:oligomycin|time:4 hpf|geo loc name:missing|collection date:missing,oligomycin 4h 239868,Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome phiX174 genome and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample,Embryo,Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore 495455 1µM actinomycin D Sigma Aldrich A1410 10µg/ml. Untreated embryos were kept alongside as controls.,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue.,tissue:Embryo|genotype:WT TLAB|treatment:oligomycin|time:4 hpf,GSM8263849,GSM8263849: oligomycin 4h 239868; Danio rerio; RNA Seq,GSM8263849 r1,GSM8263849,1,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP507323,,loader:fastq load.py,239868_S38_R1_001.fastq.gz,fastq,931115800.0,9311158.0,GSM8263849 r1,0:100,A:338486092;C:143219862;G:183831900;T:265505765;N:72181,100,,,,338486092,143219862,183831900,265505765,72181,SRX24534897,SRS21280579,SRA1865615,"Pauli, IMP","Pauli, IMP",,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq_v2,unknown,poly_a,lexogen,bulk,unknown,unknown,,Austria,2024-05-13,Blastula,Embryo,Embryo Imprecise,All anatomical structures 32063,SRR29007874,SRX24534896,SRS21280578,SRP507323,PRJNA1111056,Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis,GSE267318,Transcriptome Analysis,Mitochondrial energy production is essential for development yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity abundance morphology metabolome proteome and phospho proteome as well as respiratory chain enzymatic activity we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis is not limited by metabolic substrates at early stages and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and actinomycin injected embryos to block zygotic transcription.,,,,actinomycinD 4h 239865,GSM8263848,,source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:actinomycin D|time:4 hpf|geo loc name:missing|collection date:missing,actinomycinD 4h 239865,Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome phiX174 genome and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample,Embryo,Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore 495455 1µM actinomycin D Sigma Aldrich A1410 10µg/ml. Untreated embryos were kept alongside as controls.,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue.,tissue:Embryo|genotype:WT TLAB|treatment:actinomycin D|time:4 hpf,GSM8263848,GSM8263848: actinomycinD 4h 239865; Danio rerio; RNA Seq,GSM8263848 r1,GSM8263848,1,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP507323,,loader:fastq load.py,239865_S41_R1_001.fastq.gz,fastq,980144600.0,9801446.0,GSM8263848 r1,0:100,A:357739294;C:155149563;G:194671261;T:272508646;N:75836,100,,,,357739294,155149563,194671261,272508646,75836,SRX24534896,SRS21280578,SRA1865615,"Pauli, IMP","Pauli, IMP",,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq_v2,unknown,poly_a,lexogen,bulk,unknown,unknown,,Austria,2024-05-13,Blastula,Embryo,Embryo Imprecise,All anatomical structures 32064,SRR29007875,SRX24534895,SRS21280577,SRP507323,PRJNA1111056,Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis,GSE267318,Transcriptome Analysis,Mitochondrial energy production is essential for development yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity abundance morphology metabolome proteome and phospho proteome as well as respiratory chain enzymatic activity we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis is not limited by metabolic substrates at early stages and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and actinomycin injected embryos to block zygotic transcription.,,,,untreated 4h 239864,GSM8263847,,source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:untreated|time:4 hpf|geo loc name:missing|collection date:missing,untreated 4h 239864,Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome phiX174 genome and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample,Embryo,Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore 495455 1µM actinomycin D Sigma Aldrich A1410 10µg/ml. Untreated embryos were kept alongside as controls.,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue.,tissue:Embryo|genotype:WT TLAB|treatment:untreated|time:4 hpf,GSM8263847,GSM8263847: untreated 4h 239864; Danio rerio; RNA Seq,GSM8263847 r1,GSM8263847,1,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP507323,,loader:fastq load.py,239864_S42_R1_001.fastq.gz,fastq,1087115200.0,10871152.0,GSM8263847 r1,0:100,A:399350905;C:169940057;G:211828210;T:305913039;N:82989,100,,,,399350905,169940057,211828210,305913039,82989,SRX24534895,SRS21280577,SRA1865615,"Pauli, IMP","Pauli, IMP",,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq_v2,unknown,poly_a,lexogen,bulk,unknown,unknown,,Austria,2024-05-13,Blastula,Embryo,Embryo Imprecise,All anatomical structures 32065,SRR29007876,SRX24534894,SRS21280576,SRP507323,PRJNA1111056,Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis,GSE267318,Transcriptome Analysis,Mitochondrial energy production is essential for development yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity abundance morphology metabolome proteome and phospho proteome as well as respiratory chain enzymatic activity we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis is not limited by metabolic substrates at early stages and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and actinomycin injected embryos to block zygotic transcription.,,,,oligomycin 3h 239862,GSM8263846,,source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:oligomycin|time:3 hpf|geo loc name:missing|collection date:missing,oligomycin 3h 239862,Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome phiX174 genome and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample,Embryo,Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore 495455 1µM actinomycin D Sigma Aldrich A1410 10µg/ml. Untreated embryos were kept alongside as controls.,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue.,tissue:Embryo|genotype:WT TLAB|treatment:oligomycin|time:3 hpf,GSM8263846,GSM8263846: oligomycin 3h 239862; Danio rerio; RNA Seq,GSM8263846 r1,GSM8263846,1,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP507323,,loader:fastq load.py,239862_S44_R1_001.fastq.gz,fastq,964699000.0,9646990.0,GSM8263846 r1,0:100,A:356569674;C:145609333;G:187599003;T:274847064;N:73926,100,,,,356569674,145609333,187599003,274847064,73926,SRX24534894,SRS21280576,SRA1865615,"Pauli, IMP","Pauli, IMP",,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq_v2,unknown,poly_a,lexogen,bulk,unknown,unknown,,Austria,2024-05-13,Blastula,Embryo,Embryo Imprecise,All anatomical structures 32066,SRR29007877,SRX24534893,SRS21280575,SRP507323,PRJNA1111056,Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis,GSE267318,Transcriptome Analysis,Mitochondrial energy production is essential for development yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity abundance morphology metabolome proteome and phospho proteome as well as respiratory chain enzymatic activity we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis is not limited by metabolic substrates at early stages and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and actinomycin injected embryos to block zygotic transcription.,,,,actinomycinD 3h 239859,GSM8263845,,source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:actinomycin D|time:3 hpf|geo loc name:missing|collection date:missing,actinomycinD 3h 239859,Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome phiX174 genome and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample,Embryo,Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore 495455 1µM actinomycin D Sigma Aldrich A1410 10µg/ml. Untreated embryos were kept alongside as controls.,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue.,tissue:Embryo|genotype:WT TLAB|treatment:actinomycin D|time:3 hpf,GSM8263845,GSM8263845: actinomycinD 3h 239859; Danio rerio; RNA Seq,GSM8263845 r1,GSM8263845,1,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP507323,,loader:fastq load.py,239859_S47_R1_001.fastq.gz,fastq,859559300.0,8595593.0,GSM8263845 r1,0:100,A:318619535;C:133947193;G:169107548;T:237818588;N:66436,100,,,,318619535,133947193,169107548,237818588,66436,SRX24534893,SRS21280575,SRA1865615,"Pauli, IMP","Pauli, IMP",,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq_v2,unknown,poly_a,lexogen,bulk,unknown,unknown,,Austria,2024-05-13,Blastula,Embryo,Embryo Imprecise,All anatomical structures 32067,SRR29007878,SRX24534892,SRS21280574,SRP507323,PRJNA1111056,Increase in ER mitochondria contacts and mitochondrial fusion are hallmarks of mitochondrial activation during embryogenesis,GSE267318,Transcriptome Analysis,Mitochondrial energy production is essential for development yet the mechanisms underlying the continuous increase in mitochondrial activity during embryogenesis remain elusive. Using zebrafish as a model system for vertebrate development we identify two sequentially acting mechanisms that could contribute to the rise in mitochondrial activity: an increased association between mitochondria and the endoplasmic reticulum ER at early stages followed by the fusion of mitochondria leading to their elongated morphology at later embryonic stages. By comprehensively profiling mitochondrial activity abundance morphology metabolome proteome and phospho proteome as well as respiratory chain enzymatic activity we find that the increase in mitochondrial activity during embryogenesis does not require mitochondrial biogenesis is not limited by metabolic substrates at early stages and occurs under steady levels of respiratory chain complexes and enzymatic activities. Instead our analyses pinpoint a previously unexplored increase in mitochondrial ER association during early stages in combination with changes in mitochondrial morphology at later stages as possible contributors to the rise in mitochondrial activity during embryogenesis. Overall our systematic profiling of the molecular and morphological changes to mitochondria during embryogenesis provides a valuable resource for further studying mitochondrial function during embryogenesis. Overall design: To investigate whether oligomycin treated embryos we performed RNA seq experiment to detect ZGA genes. As a control we used untreated and actinomycin injected embryos to block zygotic transcription.,,,,untreated 3h 239858,GSM8263844,,source name:Embryo|tissue:Embryo|genotype:WT TLAB|treatment:untreated|time:3 hpf|geo loc name:missing|collection date:missing,untreated 3h 239858,Reads were preprocessed using umi2index Lexogen to add the UMI sequence to the read identifier and trimmed using BBDuk v38.06 ref=polyA.fa.gz truseq.fa.gz k=13 ktrim=r useshortkmers=t mink=5 qtrim=r trimq=10 minlength=20. Reads mapping to abundant sequences mitochondrial chromosome phiX174 genome and silva zebrafish rRNAs from the SILVA rRNA database were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c alignments were processed using collapse UMI bam Lexogen and reads in genes were counted with featureCounts subread v1.6.2 using strand specific read counting s 1 . Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample,Embryo,Embryos were collected as soon as they were laid and put into E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue containing inhibitors. Embryos were kept in this medium for the duration of the experiment. For this experiment we used already established concentrations for inhibitors: oligomycin Millipore 495455 1µM actinomycin D Sigma Aldrich A1410 10µg/ml. Untreated embryos were kept alongside as controls.,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,E3 medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 10−5% methylene blue.,tissue:Embryo|genotype:WT TLAB|treatment:untreated|time:3 hpf,GSM8263844,GSM8263844: untreated 3h 239858; Danio rerio; RNA Seq,GSM8263844 r1,GSM8263844,1,Total RNA was extracted using RNeasy Mini Kit Qiagen 175023525. 1.5µg of total RNA was used for the construction of sequencing libraries. Samples were submitted to VBCF NGS facility for library preparation and NGS sequencing. Samples were prepared with Quantseq kit Lexogen protocol.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP507323,,loader:fastq load.py,239858_S48_R1_001.fastq.gz,fastq,1010623900.0,10106239.0,GSM8263844 r1,0:100,A:373739615;C:157656802;G:195927428;T:283222400;N:77655,100,,,,373739615,157656802,195927428,283222400,77655,SRX24534892,SRS21280574,SRA1865615,"Pauli, IMP","Pauli, IMP",,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq_v2,unknown,poly_a,lexogen,bulk,unknown,unknown,,Austria,2024-05-13,Blastula,Embryo,Embryo Imprecise,All anatomical structures 32935,SRR29524807,SRX25034958,SRS21734129,SRP515684,PRJNA1127455,Enhanced RNA targeting CRISPR Cas technology in zebrafish I,GSE270527,Transcriptome Analysis,Transient elimination of RNAs by CRISPR Cas13 systems has been widely used in basic and applied sciences over the last years. However the efficiency of the system can be enhanced in vivo and its application has generated controversy due to the recently described collateral activity in mammalian cells and mouse models. Here we have optimized the CRISPR RfxCas13d CasRx system for an optimized RNA targeting in vivo in zebrafish embryos by different and compatible approaches. These strategies include the use of chemically modified guide RNAs to increase and sustain mRNA knockdown an improved nuclear targeting and the evaluation of ex vivo computational models for predicting gRNA efficiency in vivo. Furthermore our study demonstrated that transient CRISPR RfxCas13d approaches can effectively deplete endogenous mRNAs in zebrafish embryos without xxx collateral effects except for targeting extremely abundant RNAs. For that we have implemented alternative RNA targeting CRISPR Cas systems with reduced or absent collateral activity in zebrafish embryos. Altogether these findings contribute to optimize CRISPR Cas technology for RNA targeting in zebrafish through transient approaches and assist the progress of potential implications for knockdown therapies in vivo. Overall design: To investigate the efficacy of ex vivo computational models predicting in vivo mRNA depletion using data from 200 gRNAs in 8 cocktails of 25 gRNAs 10 pg/embryo,parent bioproject:PRJNA1128082,pubmed:40091120,,RfxCas13d control rep2,GSM8346200,,source name:whole embryo|tissue:whole embryo|cell line:4 hpf|cell type:RfxCas13d control|geo loc name:missing|collection date:missing,RfxCas13d control rep2,Following sequencing Illumina Primary Analysis version NextSeq RTA 2.11.3.0 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files. Assembly: danrer11 Supplementary files format and content: tab delimited txt file includes raw counts for each Sample,whole embryo,,Total RNA then was extracted using Direct zol RNA Miniprep Kit #R2050 Zymo Research following manufacturer’s instructions. Libraries were generated with the Mosquito HV Genomics SPT Labtech nanoliter liquid handling instrument using the Nextera XT DNA Library Preparation Kit Illumina FC 131 1096 at 1/8th reaction volumes paired with IDT for Illumina DNA/RNA UD Indexes Set A Illumina 20027213 and purified using the Ampure XP bead based reagent Beckman Coulter Cat. No. A63882.,,tissue:whole embryo|cell line:4 hpf|cell type:RfxCas13d control,GSM8346200,GSM8346200: RfxCas13d control rep2; Danio rerio; RNA Seq,GSM8346200 r1,GSM8346200,1,Total RNA then was extracted using Direct zol RNA Miniprep Kit #R2050 Zymo Research following manufacturer's instructions. Libraries were generated with the Mosquito HV Genomics SPT Labtech nanoliter liquid handling instrument using the Nextera XT DNA Library Preparation Kit Illumina FC 131 1096 at 1/8th reaction volumes paired with IDT for Illumina DNA/RNA UD Indexes Set A Illumina 20027213 and purified using the Ampure XP bead based reagent Beckman Coulter Cat. No. A63882.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP515684,,,RfxCas13d_R2_a.fastq.gz,fastq,84322630.0,1204609.0,GSM8346200 r1,0:70,A:22796111;C:19390347;G:19371692;T:22760579;N:3901,70,,,,22796111,19390347,19371692,22760579,3901,SRX25034958,SRS21734129,SRA1907176,Stowers Institute for Medical Research,Stowers Institute for Medical Research,1,0.95152,,0.12414,,0.74608,,0.52074,,70,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,bulk,unknown,unknown,,United States,2024-06-24,Blastula,Embryo,Whole Organism,All anatomical structures