run_metadata
2,380 rows where technology = "smartseq" and tissue_curation_coarse = "All anatomical structures"
This data as json, CSV (advanced)
| Link | rowid ▼ | run.accession | experiment.accession | sample.accession | study.accession | bioproject | study.title | study.alias | study.type | study.abstract | study.attributes | study.PMIDs | sample.description | sample.title | sample.alias | sample.centername | sample.attributes | GEOsample.title | GEOsample.dataprocessing | GEOsample.source | GEOsample.treatmentprotocol | GEOsample.extractprotocol | GEOsample.growthprotocol | GEOsample.characteristics | GEOsample.accession | experiment.title | experiment.alias | experiment.library_name | experiment.design_description | experiment.library_construction_protocol | experiment.attributes | experiment.library_strategy | experiment.library_source | experiment.library_selection | experiment.library_layout | experiment.platform | experiment.instrument_model | experiment.spot_descriptor | experiment.study_ref | run.title | run.attributes | run.filename | run.semantic_name | run.total_bases | run.total_spots | run.alias | run.read_lengths | run.base_counts | run.r1_length | run.r2_length | run.r3_length | run.r4_length | run.Acount | run.Ccount | run.Gcount | run.Tcount | run.Ncount | run.experiment | run.pool_member | submission.accession | submission.srasource | submission.bioprojectsource | seqdetective.n_mates | seqdetective.mapping_rate.mate1 | seqdetective.mapping_rate.mate2 | seqdetective.nofeature_rate.mate1 | seqdetective.nofeature_rate.mate2 | seqdetective.sparsity.mate1 | seqdetective.sparsity.mate2 | seqdetective.pos_strand_rate.mate1 | seqdetective.pos_strand_rate.mate2 | seqdetective.readlen.mate1 | seqdetective.readlen.mate2 | seqdetective.judgement.mate1 | seqdetective.judgement.mate2 | seqdetective.judgement.reason | platform_family | instrument_generation | read_bias | selection_class | prep_kit | sc_or_bulk | tech_class | technology | tech_variant | submission.bioprojectsource.country | earliest_date | devstage_curation | devstage_curation_coarse | tissue_curation | tissue_curation_coarse |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 9651 | 9651 | ERR3266392 | ERX3293003 | ERS3358386 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp positive rep2 | SAMEA5556346 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp positive rep2 s | sponge tdr gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_9pos_S2_L001_R1_001.fastq.gz | fastq | 603238067.0 | 8014716.0 | E MTAB 7846:sponge tdr gfp positive rep2 lane1 | 0:75.27 1:0 | A:164797697;C:136552121;G:141138007;T:160737152;N:13090 | 75 | 0 | 164797697 | 136552121 | 141138007 | 160737152 | 13090 | ERX3293003 | ERS3358386 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95083 | 0.06432 | 0.71532 | 0.50098 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9652 | 9652 | ERR3266393 | ERX3293003 | ERS3358386 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp positive rep2 | SAMEA5556346 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp positive rep2 s | sponge tdr gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_9pos_S2_L002_R1_001.fastq.gz | fastq | 603749720.0 | 8021069.0 | E MTAB 7846:sponge tdr gfp positive rep2 lane2 | 0:75.27 1:0 | A:164972969;C:136661417;G:141205792;T:160896264;N:13278 | 75 | 0 | 164972969 | 136661417 | 141205792 | 160896264 | 13278 | ERX3293003 | ERS3358386 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.951 | 0.06542 | 0.71768 | 0.50051 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9653 | 9653 | ERR3266394 | ERX3293003 | ERS3358386 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp positive rep2 | SAMEA5556346 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp positive rep2 s | sponge tdr gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_9pos_S2_L003_R1_001.fastq.gz | fastq | 608154053.0 | 8079704.0 | E MTAB 7846:sponge tdr gfp positive rep2 lane3 | 0:75.27 1:0 | A:166117918;C:137731172;G:142320339;T:161970092;N:14532 | 75 | 0 | 166117918 | 137731172 | 142320339 | 161970092 | 14532 | ERX3293003 | ERS3358386 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95155 | 0.0657 | 0.71634 | 0.49493 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9654 | 9654 | ERR3266395 | ERX3293003 | ERS3358386 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp positive rep2 | SAMEA5556346 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp positive rep2 s | sponge tdr gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_9pos_S2_L004_R1_001.fastq.gz | fastq | 599143392.0 | 7959897.0 | E MTAB 7846:sponge tdr gfp positive rep2 lane4 | 0:75.27 1:0 | A:163706904;C:135622453;G:140192351;T:159605249;N:16435 | 75 | 0 | 163706904 | 135622453 | 140192351 | 159605249 | 16435 | ERX3293003 | ERS3358386 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95061 | 0.06431 | 0.71764 | 0.50166 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9655 | 9655 | ERR3266388 | ERX3293002 | ERS3358385 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp positive rep1 | SAMEA5556345 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp positive rep1 s | sponge tdr gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_6pos_S4_L001_R1_001.fastq.gz | fastq | 616761505.0 | 8202480.0 | E MTAB 7846:sponge tdr gfp positive rep1 lane1 | 0:75.19 1:0 | A:168679238;C:139548565;G:143969797;T:164545362;N:18543 | 75 | 0 | 168679238 | 139548565 | 143969797 | 164545362 | 18543 | ERX3293002 | ERS3358385 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95019 | 0.06806 | 0.7097 | 0.50337 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9656 | 9656 | ERR3266389 | ERX3293002 | ERS3358385 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp positive rep1 | SAMEA5556345 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp positive rep1 s | sponge tdr gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_6pos_S4_L002_R1_001.fastq.gz | fastq | 617529482.0 | 8212485.0 | E MTAB 7846:sponge tdr gfp positive rep1 lane2 | 0:75.19 1:0 | A:168925757;C:139655387;G:144096837;T:164831236;N:20265 | 75 | 0 | 168925757 | 139655387 | 144096837 | 164831236 | 20265 | ERX3293002 | ERS3358385 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.9492 | 0.06753 | 0.712 | 0.49881 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9657 | 9657 | ERR3266390 | ERX3293002 | ERS3358385 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp positive rep1 | SAMEA5556345 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp positive rep1 s | sponge tdr gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_6pos_S4_L003_R1_001.fastq.gz | fastq | 624156883.0 | 8300861.0 | E MTAB 7846:sponge tdr gfp positive rep1 lane3 | 0:75.19 1:0 | A:170696950;C:141302376;G:145759286;T:166377781;N:20490 | 75 | 0 | 170696950 | 141302376 | 145759286 | 166377781 | 20490 | ERX3293002 | ERS3358385 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94917 | 0.06724 | 0.71291 | 0.50783 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9658 | 9658 | ERR3266391 | ERX3293002 | ERS3358385 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp positive rep1 | SAMEA5556345 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp positive rep1 s | sponge tdr gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_6pos_S4_L004_R1_001.fastq.gz | fastq | 615013615.0 | 8179180.0 | E MTAB 7846:sponge tdr gfp positive rep1 lane4 | 0:75.19 1:0 | A:168237742;C:139106952;G:143535658;T:164110735;N:22528 | 75 | 0 | 168237742 | 139106952 | 143535658 | 164110735 | 22528 | ERX3293002 | ERS3358385 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94892 | 0.06723 | 0.71206 | 0.50775 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9659 | 9659 | ERR3266384 | ERX3293001 | ERS3358384 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp negative rep2 | SAMEA5556344 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp negative rep2 s | sponge tdr gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_9neg_S1_L001_R1_001.fastq.gz | fastq | 659562366.0 | 8762947.0 | E MTAB 7846:sponge tdr gfp negative rep2 lane1 | 0:75.27 1:0 | A:178744772;C:150091912;G:155092318;T:175619332;N:14032 | 75 | 0 | 178744772 | 150091912 | 155092318 | 175619332 | 14032 | ERX3293001 | ERS3358384 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.9517 | 0.06908 | 0.70822 | 0.48025 | 73 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9660 | 9660 | ERR3266385 | ERX3293001 | ERS3358384 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp negative rep2 | SAMEA5556344 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp negative rep2 s | sponge tdr gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_9neg_S1_L002_R1_001.fastq.gz | fastq | 658688825.0 | 8751176.0 | E MTAB 7846:sponge tdr gfp negative rep2 lane2 | 0:75.27 1:0 | A:178540155;C:149844100;G:154850294;T:175438757;N:15519 | 75 | 0 | 178540155 | 149844100 | 154850294 | 175438757 | 15519 | ERX3293001 | ERS3358384 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95059 | 0.06748 | 0.70806 | 0.48177 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9661 | 9661 | ERR3266386 | ERX3293001 | ERS3358384 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp negative rep2 | SAMEA5556344 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp negative rep2 s | sponge tdr gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_9neg_S1_L003_R1_001.fastq.gz | fastq | 665901310.0 | 8846927.0 | E MTAB 7846:sponge tdr gfp negative rep2 lane3 | 0:75.27 1:0 | A:180412445;C:151589489;G:156677030;T:177206192;N:16154 | 75 | 0 | 180412445 | 151589489 | 156677030 | 177206192 | 16154 | ERX3293001 | ERS3358384 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95095 | 0.06855 | 0.7082 | 0.4787 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9662 | 9662 | ERR3266387 | ERX3293001 | ERS3358384 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp negative rep2 | SAMEA5556344 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp negative rep2 s | sponge tdr gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_9neg_S1_L004_R1_001.fastq.gz | fastq | 655674573.0 | 8711278.0 | E MTAB 7846:sponge tdr gfp negative rep2 lane4 | 0:75.27 1:0 | A:177658097;C:149188009;G:154201531;T:174609176;N:17760 | 75 | 0 | 177658097 | 149188009 | 154201531 | 174609176 | 17760 | ERX3293001 | ERS3358384 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.9503 | 0.06838 | 0.70926 | 0.47475 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9663 | 9663 | ERR3266380 | ERX3293000 | ERS3358383 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp negative rep1 | SAMEA5556343 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp negative rep1 s | sponge tdr gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_6neg_S3_L001_R1_001.fastq.gz | fastq | 634491637.0 | 8440052.0 | E MTAB 7846:sponge tdr gfp negative rep1 lane1 | 0:75.18 1:0 | A:170881257;C:145535643;G:150561786;T:167495156;N:17795 | 75 | 0 | 170881257 | 145535643 | 150561786 | 167495156 | 17795 | ERX3293000 | ERS3358383 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94996 | 0.05672 | 0.70571 | 0.48691 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9664 | 9664 | ERR3266381 | ERX3293000 | ERS3358383 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp negative rep1 | SAMEA5556343 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp negative rep1 s | sponge tdr gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_6neg_S3_L002_R1_001.fastq.gz | fastq | 632900752.0 | 8418846.0 | E MTAB 7846:sponge tdr gfp negative rep1 lane2 | 0:75.18 1:0 | A:170454908;C:145141392;G:150172752;T:167112562;N:19138 | 75 | 0 | 170454908 | 145141392 | 150172752 | 167112562 | 19138 | ERX3293000 | ERS3358383 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94905 | 0.05627 | 0.70457 | 0.4865 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9665 | 9665 | ERR3266382 | ERX3293000 | ERS3358383 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp negative rep1 | SAMEA5556343 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp negative rep1 s | sponge tdr gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_6neg_S3_L003_R1_001.fastq.gz | fastq | 638530115.0 | 8494045.0 | E MTAB 7846:sponge tdr gfp negative rep1 lane3 | 0:75.17 1:0 | A:171907482;C:146526309;G:151612209;T:168464163;N:19952 | 75 | 0 | 171907482 | 146526309 | 151612209 | 168464163 | 19952 | ERX3293000 | ERS3358383 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94919 | 0.05578 | 0.70849 | 0.48073 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9666 | 9666 | ERR3266383 | ERX3293000 | ERS3358383 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp negative rep1 | SAMEA5556343 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp negative rep1 s | sponge tdr gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_6neg_S3_L004_R1_001.fastq.gz | fastq | 627433322.0 | 8346505.0 | E MTAB 7846:sponge tdr gfp negative rep1 lane4 | 0:75.17 1:0 | A:169016383;C:143886824;G:148914725;T:165593528;N:21862 | 75 | 0 | 169016383 | 143886824 | 148914725 | 165593528 | 21862 | ERX3293000 | ERS3358383 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94993 | 0.05721 | 0.7052 | 0.48878 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9667 | 9667 | ERR3266376 | ERX3292999 | ERS3358382 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp positive rep2 | SAMEA5556342 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp positive rep2 s | sponge isl gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_7pos_S10_L001_R1_001.fastq.gz | fastq | 618672195.0 | 8218047.0 | E MTAB 7846:sponge isl gfp positive rep2 lane1 | 0:75.28 1:0 | A:166422886;C:142212204;G:146857539;T:163167819;N:11747 | 75 | 0 | 166422886 | 142212204 | 146857539 | 163167819 | 11747 | ERX3292999 | ERS3358382 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94979 | 0.08351 | 0.70863 | 0.47581 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9668 | 9668 | ERR3266377 | ERX3292999 | ERS3358382 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp positive rep2 | SAMEA5556342 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp positive rep2 s | sponge isl gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_7pos_S10_L002_R1_001.fastq.gz | fastq | 618709102.0 | 8218295.0 | E MTAB 7846:sponge isl gfp positive rep2 lane2 | 0:75.28 1:0 | A:166470432;C:142189977;G:146819280;T:163216323;N:13090 | 75 | 0 | 166470432 | 142189977 | 146819280 | 163216323 | 13090 | ERX3292999 | ERS3358382 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94977 | 0.08255 | 0.70644 | 0.47228 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9669 | 9669 | ERR3266378 | ERX3292999 | ERS3358382 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp positive rep2 | SAMEA5556342 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp positive rep2 s | sponge isl gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_7pos_S10_L003_R1_001.fastq.gz | fastq | 625353059.0 | 8306375.0 | E MTAB 7846:sponge isl gfp positive rep2 lane3 | 0:75.29 1:0 | A:168233274;C:143793178;G:148510556;T:164802476;N:13575 | 75 | 0 | 168233274 | 143793178 | 148510556 | 164802476 | 13575 | ERX3292999 | ERS3358382 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95014 | 0.08368 | 0.70743 | 0.47846 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9670 | 9670 | ERR3266379 | ERX3292999 | ERS3358382 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp positive rep2 | SAMEA5556342 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp positive rep2 s | sponge isl gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_7pos_S10_L004_R1_001.fastq.gz | fastq | 615204990.0 | 8171748.0 | E MTAB 7846:sponge isl gfp positive rep2 lane4 | 0:75.28 1:0 | A:165565861;C:141380152;G:146028839;T:162214263;N:15875 | 75 | 0 | 165565861 | 141380152 | 146028839 | 162214263 | 15875 | ERX3292999 | ERS3358382 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94954 | 0.08233 | 0.70834 | 0.48166 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9671 | 9671 | ERR3266372 | ERX3292998 | ERS3358381 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp positive rep1 | SAMEA5556341 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp positive rep1 s | sponge isl gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_6pos_S12_L001_R1_001.fastq.gz | fastq | 626474467.0 | 8318996.0 | E MTAB 7846:sponge isl gfp positive rep1 lane1 | 0:75.31 1:0 | A:170186220;C:142441110;G:147048643;T:166786401;N:12093 | 75 | 0 | 170186220 | 142441110 | 147048643 | 166786401 | 12093 | ERX3292998 | ERS3358381 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94907 | 0.08132 | 0.69684 | 0.4736 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9672 | 9672 | ERR3266373 | ERX3292998 | ERS3358381 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp positive rep1 | SAMEA5556341 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp positive rep1 s | sponge isl gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_6pos_S12_L002_R1_001.fastq.gz | fastq | 626477579.0 | 8318750.0 | E MTAB 7846:sponge isl gfp positive rep1 lane2 | 0:75.31 1:0 | A:170185337;C:142396801;G:147032265;T:166850532;N:12644 | 75 | 0 | 170185337 | 142396801 | 147032265 | 166850532 | 12644 | ERX3292998 | ERS3358381 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94941 | 0.08253 | 0.6957 | 0.47554 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9673 | 9673 | ERR3266374 | ERX3292998 | ERS3358381 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp positive rep1 | SAMEA5556341 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp positive rep1 s | sponge isl gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_6pos_S12_L003_R1_001.fastq.gz | fastq | 632098509.0 | 8393388.0 | E MTAB 7846:sponge isl gfp positive rep1 lane3 | 0:75.31 1:0 | A:171699353;C:143766296;G:148442110;T:168177264;N:13486 | 75 | 0 | 171699353 | 143766296 | 148442110 | 168177264 | 13486 | ERX3292998 | ERS3358381 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94866 | 0.08247 | 0.69601 | 0.48009 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9674 | 9674 | ERR3266375 | ERX3292998 | ERS3358381 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp positive rep1 | SAMEA5556341 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp positive rep1 s | sponge isl gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_6pos_S12_L004_R1_001.fastq.gz | fastq | 622997479.0 | 8272752.0 | E MTAB 7846:sponge isl gfp positive rep1 lane4 | 0:75.31 1:0 | A:169306677;C:141586415;G:146241288;T:165847752;N:15347 | 75 | 0 | 169306677 | 141586415 | 146241288 | 165847752 | 15347 | ERX3292998 | ERS3358381 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.9483 | 0.08034 | 0.69662 | 0.47868 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9675 | 9675 | ERR3266368 | ERX3292997 | ERS3358380 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp negative rep2 | SAMEA5556340 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp negative rep2 s | sponge isl gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_7neg_S9_L001_R1_001.fastq.gz | fastq | 707454819.0 | 9395082.0 | E MTAB 7846:sponge isl gfp negative rep2 lane1 | 0:75.30 1:0 | A:194991862;C:157927850;G:163280639;T:191241488;N:12980 | 75 | 0 | 194991862 | 157927850 | 163280639 | 191241488 | 12980 | ERX3292997 | ERS3358380 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.93871 | 0.08926 | 0.70806 | 0.46501 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9676 | 9676 | ERR3266369 | ERX3292997 | ERS3358380 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp negative rep2 | SAMEA5556340 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp negative rep2 s | sponge isl gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_7neg_S9_L002_R1_001.fastq.gz | fastq | 704791838.0 | 9359668.0 | E MTAB 7846:sponge isl gfp negative rep2 lane2 | 0:75.30 1:0 | A:194317422;C:157276895;G:162624670;T:190558322;N:14529 | 75 | 0 | 194317422 | 157276895 | 162624670 | 190558322 | 14529 | ERX3292997 | ERS3358380 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.93816 | 0.08859 | 0.70999 | 0.4661 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9677 | 9677 | ERR3266370 | ERX3292997 | ERS3358380 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp negative rep2 | SAMEA5556340 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp negative rep2 s | sponge isl gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_7neg_S9_L003_R1_001.fastq.gz | fastq | 715991833.0 | 9508323.0 | E MTAB 7846:sponge isl gfp negative rep2 lane3 | 0:75.30 1:0 | A:197297222;C:159913026;G:165363927;T:193402765;N:14893 | 75 | 0 | 197297222 | 159913026 | 165363927 | 193402765 | 14893 | ERX3292997 | ERS3358380 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.93844 | 0.08854 | 0.70828 | 0.46042 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9678 | 9678 | ERR3266371 | ERX3292997 | ERS3358380 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp negative rep2 | SAMEA5556340 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp negative rep2 s | sponge isl gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_7neg_S9_L004_R1_001.fastq.gz | fastq | 703723869.0 | 9345669.0 | E MTAB 7846:sponge isl gfp negative rep2 lane4 | 0:75.30 1:0 | A:194029886;C:157050176;G:162432310;T:190193608;N:17889 | 75 | 0 | 194029886 | 157050176 | 162432310 | 190193608 | 17889 | ERX3292997 | ERS3358380 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.93897 | 0.08993 | 0.70863 | 0.45707 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9679 | 9679 | ERR3266364 | ERX3292996 | ERS3358379 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp negative rep1 | SAMEA5556339 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp negative rep1 s | sponge isl gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_6neg_S11_L001_R1_001.fastq.gz | fastq | 676581458.0 | 8983758.0 | E MTAB 7846:sponge isl gfp negative rep1 lane1 | 0:75.31 1:0 | A:184297337;C:153352193;G:158268476;T:180651038;N:12414 | 75 | 0 | 184297337 | 153352193 | 158268476 | 180651038 | 12414 | ERX3292996 | ERS3358379 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94981 | 0.07715 | 0.69138 | 0.47243 | 74 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9680 | 9680 | ERR3266365 | ERX3292996 | ERS3358379 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp negative rep1 | SAMEA5556339 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp negative rep1 s | sponge isl gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_6neg_S11_L002_R1_001.fastq.gz | fastq | 676876555.0 | 8987445.0 | E MTAB 7846:sponge isl gfp negative rep1 lane2 | 0:75.31 1:0 | A:184435129;C:153332402;G:158323789;T:180770978;N:14257 | 75 | 0 | 184435129 | 153332402 | 158323789 | 180770978 | 14257 | ERX3292996 | ERS3358379 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94901 | 0.07805 | 0.69179 | 0.47182 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9681 | 9681 | ERR3266366 | ERX3292996 | ERS3358379 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp negative rep1 | SAMEA5556339 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp negative rep1 s | sponge isl gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_6neg_S11_L003_R1_001.fastq.gz | fastq | 681771213.0 | 9052615.0 | E MTAB 7846:sponge isl gfp negative rep1 lane3 | 0:75.31 1:0 | A:185717696;C:154552039;G:159567102;T:181919781;N:14595 | 75 | 0 | 185717696 | 154552039 | 159567102 | 181919781 | 14595 | ERX3292996 | ERS3358379 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94923 | 0.07768 | 0.69167 | 0.47219 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9682 | 9682 | ERR3266367 | ERX3292996 | ERS3358379 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp negative rep1 | SAMEA5556339 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp negative rep1 s | sponge isl gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_6neg_S11_L004_R1_001.fastq.gz | fastq | 671169917.0 | 8911624.0 | E MTAB 7846:sponge isl gfp negative rep1 lane4 | 0:75.31 1:0 | A:182910490;C:152045814;G:157010053;T:179186548;N:17012 | 75 | 0 | 182910490 | 152045814 | 157010053 | 179186548 | 17012 | ERX3292996 | ERS3358379 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94941 | 0.07612 | 0.69106 | 0.47736 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9683 | 9683 | ERR3266360 | ERX3292995 | ERS3358378 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp positive rep2 | SAMEA5556338 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp positive rep2 s | sponge ccn gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_8pos_S6_L001_R1_001.fastq.gz | fastq | 745666738.0 | 9917771.0 | E MTAB 7846:sponge ccn gfp positive rep2 lane1 | 0:75.18 1:0 | A:207714377;C:163732420;G:169037726;T:205161925;N:20290 | 75 | 0 | 207714377 | 163732420 | 169037726 | 205161925 | 20290 | ERX3292995 | ERS3358378 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94006 | 0.17809 | 0.68166 | 0.48912 | 74 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9684 | 9684 | ERR3266361 | ERX3292995 | ERS3358378 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp positive rep2 | SAMEA5556338 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp positive rep2 s | sponge ccn gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_8pos_S6_L002_R1_001.fastq.gz | fastq | 747693645.0 | 9944395.0 | E MTAB 7846:sponge ccn gfp positive rep2 lane2 | 0:75.19 1:0 | A:208257288;C:164106384;G:169478025;T:205830399;N:21549 | 75 | 0 | 208257288 | 164106384 | 169478025 | 205830399 | 21549 | ERX3292995 | ERS3358378 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.93873 | 0.17738 | 0.68296 | 0.49656 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9685 | 9685 | ERR3266362 | ERX3292995 | ERS3358378 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp positive rep2 | SAMEA5556338 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp positive rep2 s | sponge ccn gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_8pos_S6_L003_R1_001.fastq.gz | fastq | 756134124.0 | 10056818.0 | E MTAB 7846:sponge ccn gfp positive rep2 lane3 | 0:75.19 1:0 | A:210573012;C:166089133;G:171475300;T:207973232;N:23447 | 75 | 0 | 210573012 | 166089133 | 171475300 | 207973232 | 23447 | ERX3292995 | ERS3358378 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94077 | 0.18001 | 0.68004 | 0.49812 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9686 | 9686 | ERR3266363 | ERX3292995 | ERS3358378 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp positive rep2 | SAMEA5556338 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp positive rep2 s | sponge ccn gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_8pos_S6_L004_R1_001.fastq.gz | fastq | 747687619.0 | 9944417.0 | E MTAB 7846:sponge ccn gfp positive rep2 lane4 | 0:75.19 1:0 | A:208315943;C:164104155;G:169484250;T:205757712;N:25559 | 75 | 0 | 208315943 | 164104155 | 169484250 | 205757712 | 25559 | ERX3292995 | ERS3358378 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94025 | 0.17965 | 0.68124 | 0.49249 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9687 | 9687 | ERR3266356 | ERX3292994 | ERS3358377 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp positive rep1 | SAMEA5556337 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp positive rep1 s | sponge ccn gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_7pos_S8_L001_R1_001.fastq.gz | fastq | 600153564.0 | 7972767.0 | E MTAB 7846:sponge ccn gfp positive rep1 lane1 | 0:75.28 1:0 | A:165075878;C:133961511;G:138306424;T:162797903;N:11848 | 75 | 0 | 165075878 | 133961511 | 138306424 | 162797903 | 11848 | ERX3292994 | ERS3358377 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95367 | 0.14146 | 0.69154 | 0.46621 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9688 | 9688 | ERR3266357 | ERX3292994 | ERS3358377 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp positive rep1 | SAMEA5556337 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp positive rep1 s | sponge ccn gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_7pos_S8_L002_R1_001.fastq.gz | fastq | 600790169.0 | 7981038.0 | E MTAB 7846:sponge ccn gfp positive rep1 lane2 | 0:75.28 1:0 | A:165262968;C:133988329;G:138458635;T:163066854;N:13383 | 75 | 0 | 165262968 | 133988329 | 138458635 | 163066854 | 13383 | ERX3292994 | ERS3358377 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95365 | 0.14116 | 0.69301 | 0.46836 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9689 | 9689 | ERR3266358 | ERX3292994 | ERS3358377 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp positive rep1 | SAMEA5556337 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp positive rep1 s | sponge ccn gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_7pos_S8_L003_R1_001.fastq.gz | fastq | 608611085.0 | 8084904.0 | E MTAB 7846:sponge ccn gfp positive rep1 lane3 | 0:75.28 1:0 | A:167402055;C:135871708;G:140314669;T:165009252;N:13401 | 75 | 0 | 167402055 | 135871708 | 140314669 | 165009252 | 13401 | ERX3292994 | ERS3358377 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95403 | 0.14167 | 0.69311 | 0.4702 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9690 | 9690 | ERR3266359 | ERX3292994 | ERS3358377 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp positive rep1 | SAMEA5556337 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp positive rep1 s | sponge ccn gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_7pos_S8_L004_R1_001.fastq.gz | fastq | 599558663.0 | 7964718.0 | E MTAB 7846:sponge ccn gfp positive rep1 lane4 | 0:75.28 1:0 | A:164965131;C:133749666;G:138194884;T:162633558;N:15424 | 75 | 0 | 164965131 | 133749666 | 138194884 | 162633558 | 15424 | ERX3292994 | ERS3358377 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95285 | 0.14085 | 0.69037 | 0.47345 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9691 | 9691 | ERR3266352 | ERX3292993 | ERS3358376 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp negative rep2 | SAMEA5556336 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp negative rep2 s | sponge ccn gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_8neg_S5_L001_R1_001.fastq.gz | fastq | 599599608.0 | 7970460.0 | E MTAB 7846:sponge ccn gfp negative rep2 lane1 | 0:75.23 1:0 | A:162236409;C:136907675;G:141538730;T:158902520;N:14274 | 75 | 0 | 162236409 | 136907675 | 141538730 | 158902520 | 14274 | ERX3292993 | ERS3358376 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95404 | 0.05923 | 0.69737 | 0.48627 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9692 | 9692 | ERR3266353 | ERX3292993 | ERS3358376 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp negative rep2 | SAMEA5556336 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp negative rep2 s | sponge ccn gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_8neg_S5_L002_R1_001.fastq.gz | fastq | 600057776.0 | 7976438.0 | E MTAB 7846:sponge ccn gfp negative rep2 lane2 | 0:75.23 1:0 | A:162367410;C:136994919;G:141577782;T:159102194;N:15471 | 75 | 0 | 162367410 | 136994919 | 141577782 | 159102194 | 15471 | ERX3292993 | ERS3358376 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.953 | 0.06085 | 0.6952 | 0.48868 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9693 | 9693 | ERR3266354 | ERX3292993 | ERS3358376 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp negative rep2 | SAMEA5556336 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp negative rep2 s | sponge ccn gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_8neg_S5_L003_R1_001.fastq.gz | fastq | 607089697.0 | 8069901.0 | E MTAB 7846:sponge ccn gfp negative rep2 lane3 | 0:75.23 1:0 | A:164235344;C:138684000;G:143335680;T:160819270;N:15403 | 75 | 0 | 164235344 | 138684000 | 143335680 | 160819270 | 15403 | ERX3292993 | ERS3358376 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95245 | 0.06055 | 0.69589 | 0.48813 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9694 | 9694 | ERR3266355 | ERX3292993 | ERS3358376 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp negative rep2 | SAMEA5556336 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp negative rep2 s | sponge ccn gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_8neg_S5_L004_R1_001.fastq.gz | fastq | 598098243.0 | 7950223.0 | E MTAB 7846:sponge ccn gfp negative rep2 lane4 | 0:75.23 1:0 | A:161836808;C:136564804;G:141157424;T:158521860;N:17347 | 75 | 0 | 161836808 | 136564804 | 141157424 | 158521860 | 17347 | ERX3292993 | ERS3358376 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95299 | 0.06032 | 0.69501 | 0.48928 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9695 | 9695 | ERR3266348 | ERX3292992 | ERS3358375 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp negative rep1 | SAMEA5556335 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp negative rep1 s | sponge ccn gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_7neg_S7_L001_R1_001.fastq.gz | fastq | 668175990.0 | 8872549.0 | E MTAB 7846:sponge ccn gfp negative rep1 lane1 | 0:75.31 1:0 | A:179859350;C:153483169;G:158360605;T:176462088;N:10778 | 75 | 0 | 179859350 | 153483169 | 158360605 | 176462088 | 10778 | ERX3292992 | ERS3358375 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95955 | 0.07154 | 0.69696 | 0.46425 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9696 | 9696 | ERR3266349 | ERX3292992 | ERS3358375 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp negative rep1 | SAMEA5556335 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp negative rep1 s | sponge ccn gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_7neg_S7_L002_R1_001.fastq.gz | fastq | 668154755.0 | 8872093.0 | E MTAB 7846:sponge ccn gfp negative rep1 lane2 | 0:75.31 1:0 | A:179811687;C:153454931;G:158314391;T:176560936;N:12810 | 75 | 0 | 179811687 | 153454931 | 158314391 | 176560936 | 12810 | ERX3292992 | ERS3358375 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.96029 | 0.06969 | 0.69684 | 0.46725 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9697 | 9697 | ERR3266350 | ERX3292992 | ERS3358375 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp negative rep1 | SAMEA5556335 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp negative rep1 s | sponge ccn gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_7neg_S7_L003_R1_001.fastq.gz | fastq | 676984426.0 | 8989004.0 | E MTAB 7846:sponge ccn gfp negative rep1 lane3 | 0:75.31 1:0 | A:182159685;C:155578195;G:160511499;T:178722363;N:12684 | 75 | 0 | 182159685 | 155578195 | 160511499 | 178722363 | 12684 | ERX3292992 | ERS3358375 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.96012 | 0.07159 | 0.69554 | 0.46811 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9698 | 9698 | ERR3266351 | ERX3292992 | ERS3358375 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp negative rep1 | SAMEA5556335 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp negative rep1 s | sponge ccn gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_7neg_S7_L004_R1_001.fastq.gz | fastq | 666031892.0 | 8843695.0 | E MTAB 7846:sponge ccn gfp negative rep1 lane4 | 0:75.31 1:0 | A:179243298;C:152946459;G:157873912;T:175953752;N:14471 | 75 | 0 | 179243298 | 152946459 | 157873912 | 175953752 | 14471 | ERX3292992 | ERS3358375 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.96014 | 0.07169 | 0.69493 | 0.47058 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9775 | 9775 | ERR3838754 | ERX3851420 | ERS4266444 | ERP119601 | PRJEB36411 | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E-MTAB-8707 | Transcriptome Analysis | Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment. | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Soma prim5 wt rep2 | SAMEA6501995 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK | ENA FIRST PUBLIC:2020 04 30T04:03:48Z|ENA LAST UPDATE:2020 01 24T08:44:01Z|External Id:SAMEA6501995|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK|INSDC first public:2020 04 30T04:03:48Z|INSDC last update:2020 01 24T08:44:01Z|INSDC status:public|Submitter Id:E MTAB 8707:Soma prim5 wt rep2|age:24|broker name:ArrayExpress|cell type:whole embryo|common name:zebrafish|developmental stage:pharyngula prim 5|genotype:tgbuc:egfp|phenotype:fluorescent PGCs due to germ plasm localised GFP|sample name:E MTAB 8707:Soma prim5 wt rep2|scientific name:Danio rerio|strain:AB | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E MTAB 8707:Soma prim5 wt rep2 p | Soma prim5 wt rep2 p | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Experimental Factor: developmental stage:pharyngula prim 5|Experimental Factor: compound:n1|Experimental Factor: cell type:whole embryo | OTHER | TRANSCRIPTOMIC | RANDOM PCR | PAIRED | ILLUMINA | NextSeq 550 | ERP119601 | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | Somatic_prim5_rep2_R1.fastq.gz Somatic_prim5_rep2_R2.fastq.gz | fastq fastq | 2664555542.0 | 17942996.0 | E MTAB 8707:Somatic prim5 rep2 R | 0:74.25 1:74.25 | A:757990974;C:568005838;G:586848520;T:749991976;N:1718234 | 74 | 74 | 757990974 | 568005838 | 586848520 | 749991976 | 1718234 | ERX3851420 | ERS4266444 | ERA2354529 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | 2 | 0.92034 | 0.91779 | 0.22669 | 0.22761 | 0.74769 | 0.74911 | 0.45866 | 0.45282 | 76 | 76 | B | B | biological fallback assumption | illumina | nextseq | unknown | random_priming | unknown | sc | single_cell_plate | smartseq | United Kingdom | 2020-01-24 | Pharyngula | Embryo | Whole Organism | All anatomical structures | |||||||||||||
| 9776 | 9776 | ERR3838753 | ERX3851419 | ERS4266443 | ERP119601 | PRJEB36411 | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E-MTAB-8707 | Transcriptome Analysis | Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment. | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Soma prim5 wt rep1 | SAMEA6501994 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK | ENA FIRST PUBLIC:2020 04 30T04:03:48Z|ENA LAST UPDATE:2020 01 24T08:44:01Z|External Id:SAMEA6501994|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK|INSDC first public:2020 04 30T04:03:48Z|INSDC last update:2020 01 24T08:44:01Z|INSDC status:public|Submitter Id:E MTAB 8707:Soma prim5 wt rep1|age:24|broker name:ArrayExpress|cell type:whole embryo|common name:zebrafish|developmental stage:pharyngula prim 5|genotype:tgbuc:egfp|phenotype:fluorescent PGCs due to germ plasm localised GFP|sample name:E MTAB 8707:Soma prim5 wt rep1|scientific name:Danio rerio|strain:AB | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E MTAB 8707:Soma prim5 wt rep1 p | Soma prim5 wt rep1 p | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Experimental Factor: developmental stage:pharyngula prim 5|Experimental Factor: compound:n1|Experimental Factor: cell type:whole embryo | OTHER | TRANSCRIPTOMIC | RANDOM PCR | PAIRED | ILLUMINA | NextSeq 550 | ERP119601 | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | Somatic_prim5_rep1_R1.fastq.gz Somatic_prim5_rep1_R2.fastq.gz | fastq fastq | 1847156504.0 | 12386853.0 | E MTAB 8707:Somatic prim5 rep1 R | 0:74.56 1:74.56 | A:519724449;C:399975516;G:411702918;T:514818493;N:935128 | 74 | 74 | 519724449 | 399975516 | 411702918 | 514818493 | 935128 | ERX3851419 | ERS4266443 | ERA2354529 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | 2 | 0.93526 | 0.93319 | 0.24244 | 0.24304 | 0.75073 | 0.75201 | 0.44773 | 0.44885 | 76 | 75 | B | B | biological fallback assumption | illumina | nextseq | unknown | random_priming | unknown | sc | single_cell_plate | smartseq | United Kingdom | 2020-01-24 | Pharyngula | Embryo | Whole Organism | All anatomical structures | |||||||||||||
| 9777 | 9777 | ERR3838752 | ERX3851418 | ERS4266442 | ERP119601 | PRJEB36411 | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E-MTAB-8707 | Transcriptome Analysis | Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment. | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Soma prim5 Morpholino rep2 | SAMEA6501993 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK | ENA FIRST PUBLIC:2020 04 30T04:03:48Z|ENA LAST UPDATE:2020 01 24T08:44:01Z|External Id:SAMEA6501993|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK|INSDC first public:2020 04 30T04:03:48Z|INSDC last update:2020 01 24T08:44:01Z|INSDC status:public|Submitter Id:E MTAB 8707:Soma prim5 Morpholino rep2|age:24|broker name:ArrayExpress|cell type:whole embryo|common name:zebrafish|developmental stage:pharyngula prim 5|genotype:tgbuc:egfp|phenotype:fluorescent PGCs due to germ plasm localised GFP|sample name:E MTAB 8707:Soma prim5 Morpholino rep2|scientific name:Danio rerio|strain:AB | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E MTAB 8707:Soma prim5 Morpholino rep2 p | Soma prim5 Morpholino rep2 p | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Experimental Factor: developmental stage:pharyngula prim 5|Experimental Factor: compound:Morpholino antisense oligo against Tdrd7 transcript|Experimental Factor: dose:0.3|Experimental Factor: cell type:whole embryo | OTHER | TRANSCRIPTOMIC | RANDOM PCR | PAIRED | ILLUMINA | NextSeq 550 | ERP119601 | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | S14_R1.fastq.gz S14_R2.fastq.gz | fastq fastq | 953947657.0 | 6389852.0 | E MTAB 8707:S14 R | 0:74.64 1:74.65 | A:271485260;C:204208876;G:210319402;T:267490986;N:443133 | 74 | 74 | 271485260 | 204208876 | 210319402 | 267490986 | 443133 | ERX3851418 | ERS4266442 | ERA2354529 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | 2 | 0.93577 | 0.93619 | 0.1141 | 0.11516 | 0.72644 | 0.72892 | 0.4694 | 0.46965 | 75 | 76 | B | B | biological fallback assumption | illumina | nextseq | unknown | random_priming | unknown | sc | single_cell_plate | smartseq | United Kingdom | 2020-01-24 | Pharyngula | Embryo | Whole Organism | All anatomical structures | |||||||||||||
| 9778 | 9778 | ERR3838751 | ERX3851417 | ERS4266441 | ERP119601 | PRJEB36411 | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E-MTAB-8707 | Transcriptome Analysis | Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment. | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Soma prim5 Morpholino rep1 | SAMEA6501992 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK | ENA FIRST PUBLIC:2020 04 30T04:03:48Z|ENA LAST UPDATE:2020 01 24T08:44:01Z|External Id:SAMEA6501992|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK|INSDC first public:2020 04 30T04:03:48Z|INSDC last update:2020 01 24T08:44:01Z|INSDC status:public|Submitter Id:E MTAB 8707:Soma prim5 Morpholino rep1|age:24|broker name:ArrayExpress|cell type:whole embryo|common name:zebrafish|developmental stage:pharyngula prim 5|genotype:tgbuc:egfp|phenotype:fluorescent PGCs due to germ plasm localised GFP|sample name:E MTAB 8707:Soma prim5 Morpholino rep1|scientific name:Danio rerio|strain:AB | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E MTAB 8707:Soma prim5 Morpholino rep1 p | Soma prim5 Morpholino rep1 p | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Experimental Factor: developmental stage:pharyngula prim 5|Experimental Factor: compound:Morpholino antisense oligo against Tdrd7 transcript|Experimental Factor: dose:0.3|Experimental Factor: cell type:whole embryo | OTHER | TRANSCRIPTOMIC | RANDOM PCR | PAIRED | ILLUMINA | NextSeq 550 | ERP119601 | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | S12_R1.fastq.gz S12_R2.fastq.gz | fastq fastq | 753719404.0 | 5057589.0 | E MTAB 8707:S12 R | 0:74.51 1:74.52 | A:216097326;C:160004832;G:164724356;T:212507268;N:385622 | 74 | 74 | 216097326 | 160004832 | 164724356 | 212507268 | 385622 | ERX3851417 | ERS4266441 | ERA2354529 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | 2 | 0.93958 | 0.93943 | 0.10854 | 0.1092 | 0.73267 | 0.73663 | 0.45629 | 0.47862 | 76 | 76 | B | B | biological fallback assumption | illumina | nextseq | unknown | random_priming | unknown | sc | single_cell_plate | smartseq | United Kingdom | 2020-01-24 | Pharyngula | Embryo | Whole Organism | All anatomical structures | |||||||||||||
| 9779 | 9779 | ERR3838750 | ERX3851416 | ERS4266440 | ERP119601 | PRJEB36411 | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E-MTAB-8707 | Transcriptome Analysis | Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment. | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Soma prim5 5mismatch Morpholino rep2 | SAMEA6501991 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK | ENA FIRST PUBLIC:2020 04 30T04:03:48Z|ENA LAST UPDATE:2020 01 24T08:44:01Z|External Id:SAMEA6501991|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK|INSDC first public:2020 04 30T04:03:48Z|INSDC last update:2020 01 24T08:44:01Z|INSDC status:public|Submitter Id:E MTAB 8707:Soma prim5 5mismatch Morpholino rep2|age:24|broker name:ArrayExpress|cell type:whole embryo|common name:zebrafish|developmental stage:pharyngula prim 5|genotype:tgbuc:egfp|phenotype:fluorescent PGCs due to germ plasm localised GFP|sample name:E MTAB 8707:Soma prim5 5mismatch Morpholino rep2|scientific name:Danio rerio|strain:AB | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E MTAB 8707:Soma prim5 5mismatch Morpholino rep2 p | Soma prim5 5mismatch Morpholino rep2 p | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Experimental Factor: developmental stage:pharyngula prim 5|Experimental Factor: compound:Control morpholino antisense oligo with 5 mismatches|Experimental Factor: dose:0.3|Experimental Factor: cell type:whole embryo | OTHER | TRANSCRIPTOMIC | RANDOM PCR | PAIRED | ILLUMINA | NextSeq 550 | ERP119601 | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | S18_R1.fastq.gz S18_R2.fastq.gz | fastq fastq | 847966718.0 | 5668126.0 | E MTAB 8707:S18 R | 0:74.80 1:74.80 | A:230723434;C:191446710;G:197114792;T:228326953;N:354829 | 74 | 74 | 230723434 | 191446710 | 197114792 | 228326953 | 354829 | ERX3851416 | ERS4266440 | ERA2354529 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | 2 | 0.92436 | 0.92488 | 0.08973 | 0.09012 | 0.73971 | 0.74192 | 0.45291 | 0.45397 | 76 | 73 | B | B | biological fallback assumption | illumina | nextseq | unknown | random_priming | unknown | sc | single_cell_plate | smartseq | United Kingdom | 2020-01-24 | Pharyngula | Embryo | Whole Organism | All anatomical structures | |||||||||||||
| 9780 | 9780 | ERR3838749 | ERX3851415 | ERS4266439 | ERP119601 | PRJEB36411 | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E-MTAB-8707 | Transcriptome Analysis | Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment. | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Soma prim5 5mismatch Morpholino rep1 | SAMEA6501990 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK | ENA FIRST PUBLIC:2020 04 30T04:03:48Z|ENA LAST UPDATE:2020 01 24T08:44:01Z|External Id:SAMEA6501990|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK|INSDC first public:2020 04 30T04:03:48Z|INSDC last update:2020 01 24T08:44:01Z|INSDC status:public|Submitter Id:E MTAB 8707:Soma prim5 5mismatch Morpholino rep1|age:24|broker name:ArrayExpress|cell type:whole embryo|common name:zebrafish|developmental stage:pharyngula prim 5|genotype:tgbuc:egfp|phenotype:fluorescent PGCs due to germ plasm localised GFP|sample name:E MTAB 8707:Soma prim5 5mismatch Morpholino rep1|scientific name:Danio rerio|strain:AB | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E MTAB 8707:Soma prim5 5mismatch Morpholino rep1 p | Soma prim5 5mismatch Morpholino rep1 p | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Experimental Factor: developmental stage:pharyngula prim 5|Experimental Factor: compound:Control morpholino antisense oligo with 5 mismatches|Experimental Factor: dose:0.3|Experimental Factor: cell type:whole embryo | OTHER | TRANSCRIPTOMIC | RANDOM PCR | PAIRED | ILLUMINA | NextSeq 550 | ERP119601 | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | S16_R1.fastq.gz S16_R2.fastq.gz | fastq fastq | 444518989.0 | 2971315.0 | E MTAB 8707:S16 R | 0:74.80 1:74.80 | A:121398448;C:100282796;G:103112415;T:119559792;N:165538 | 74 | 74 | 121398448 | 100282796 | 103112415 | 119559792 | 165538 | ERX3851415 | ERS4266439 | ERA2354529 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | 2 | 0.92469 | 0.92438 | 0.09917 | 0.10006 | 0.72279 | 0.7251 | 0.45852 | 0.46016 | 73 | 76 | B | B | biological fallback assumption | illumina | nextseq | unknown | random_priming | unknown | sc | single_cell_plate | smartseq | United Kingdom | 2020-01-24 | Pharyngula | Embryo | Whole Organism | All anatomical structures | |||||||||||||
| 9781 | 9781 | ERR3838748 | ERX3851414 | ERS4266438 | ERP119601 | PRJEB36411 | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E-MTAB-8707 | Transcriptome Analysis | Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment. | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Soma High rep2 | SAMEA6501989 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK | ENA FIRST PUBLIC:2020 04 30T04:03:48Z|ENA LAST UPDATE:2020 01 24T08:44:01Z|External Id:SAMEA6501989|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK|INSDC first public:2020 04 30T04:03:48Z|INSDC last update:2020 01 24T08:44:01Z|INSDC status:public|Submitter Id:E MTAB 8707:Soma High rep2|age:3.3|broker name:ArrayExpress|cell type:whole embryo|common name:zebrafish|developmental stage:blastula high|genotype:tgbuc:egfp|phenotype:fluorescent PGCs due to germ plasm localised GFP|sample name:E MTAB 8707:Soma High rep2|scientific name:Danio rerio|strain:AB | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E MTAB 8707:Soma High rep2 p | Soma High rep2 p | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Experimental Factor: developmental stage:blastula high|Experimental Factor: compound:n1|Experimental Factor: cell type:whole embryo | OTHER | TRANSCRIPTOMIC | RANDOM PCR | PAIRED | ILLUMINA | NextSeq 550 | ERP119601 | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | Fabio_High_rep2_soma_R1.fastq.gz Fabio_High_rep2_soma_R2.fastq.gz | fastq fastq | 2072343523.0 | 13904136.0 | E MTAB 8707:Fabio High rep2 soma R | 0:74.52 1:74.53 | A:596021076;C:439789413;G:451992691;T:583604290;N:936053 | 74 | 74 | 596021076 | 439789413 | 451992691 | 583604290 | 936053 | ERX3851414 | ERS4266438 | ERA2354529 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | 2 | 0.94263 | 0.94098 | 0.04804 | 0.04844 | 0.75797 | 0.76039 | 0.50847 | 0.5014 | 75 | 76 | B | B | biological fallback assumption | illumina | nextseq | unknown | random_priming | unknown | sc | single_cell_plate | smartseq | United Kingdom | 2020-01-24 | Blastula | Embryo | Whole Organism | All anatomical structures | |||||||||||||
| 9782 | 9782 | ERR3838747 | ERX3851413 | ERS4266437 | ERP119601 | PRJEB36411 | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E-MTAB-8707 | Transcriptome Analysis | Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment. | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Soma High rep1 | SAMEA6501988 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK | ENA FIRST PUBLIC:2020 04 30T04:03:48Z|ENA LAST UPDATE:2020 01 24T08:44:01Z|External Id:SAMEA6501988|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK|INSDC first public:2020 04 30T04:03:48Z|INSDC last update:2020 01 24T08:44:01Z|INSDC status:public|Submitter Id:E MTAB 8707:Soma High rep1|age:3.3|broker name:ArrayExpress|cell type:whole embryo|common name:zebrafish|developmental stage:blastula high|genotype:tgbuc:egfp|phenotype:fluorescent PGCs due to germ plasm localised GFP|sample name:E MTAB 8707:Soma High rep1|scientific name:Danio rerio|strain:AB | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E MTAB 8707:Soma High rep1 p | Soma High rep1 p | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Experimental Factor: developmental stage:blastula high|Experimental Factor: compound:n1|Experimental Factor: cell type:whole embryo | OTHER | TRANSCRIPTOMIC | RANDOM PCR | PAIRED | ILLUMINA | NextSeq 550 | ERP119601 | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | Somatic_High_rep1_R1.fastq.gz Somatic_High_rep1_R2.fastq.gz | fastq fastq | 6013555644.0 | 40662218.0 | E MTAB 8707:Somatic High rep1 R | 0:73.94 1:73.95 | A:1821348300;C:1185534582;G:1227848010;T:1774836657;N:3988095 | 73 | 73 | 1821348300 | 1185534582 | 1227848010 | 1774836657 | 3988095 | ERX3851413 | ERS4266437 | ERA2354529 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | 2 | 0.93539 | 0.9357 | 0.07066 | 0.07028 | 0.76197 | 0.76386 | 0.54301 | 0.54343 | 76 | 75 | B | B | biological fallback assumption | illumina | nextseq | unknown | random_priming | unknown | sc | single_cell_plate | smartseq | United Kingdom | 2020-01-24 | Blastula | Embryo | Whole Organism | All anatomical structures | |||||||||||||
| 9783 | 9783 | ERR3838746 | ERX3851412 | ERS4266436 | ERP119601 | PRJEB36411 | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E-MTAB-8707 | Transcriptome Analysis | Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment. | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Soma dome rep2 | SAMEA6501987 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK | ENA FIRST PUBLIC:2020 04 30T04:03:48Z|ENA LAST UPDATE:2020 01 24T08:44:00Z|External Id:SAMEA6501987|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK|INSDC first public:2020 04 30T04:03:48Z|INSDC last update:2020 01 24T08:44:00Z|INSDC status:public|Submitter Id:E MTAB 8707:Soma dome rep2|age:4.3|broker name:ArrayExpress|cell type:whole embryo|common name:zebrafish|developmental stage:blastula dome|genotype:tgbuc:egfp|phenotype:fluorescent PGCs due to germ plasm localised GFP|sample name:E MTAB 8707:Soma dome rep2|scientific name:Danio rerio|strain:AB | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E MTAB 8707:Soma dome rep2 p | Soma dome rep2 p | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Experimental Factor: developmental stage:blastula dome|Experimental Factor: compound:n1|Experimental Factor: cell type:whole embryo | OTHER | TRANSCRIPTOMIC | RANDOM PCR | PAIRED | ILLUMINA | NextSeq 550 | ERP119601 | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | S10_R1.fastq.gz S10_R2.fastq.gz | fastq fastq | 1086124503.0 | 7272505.0 | E MTAB 8707:S10 R | 0:74.67 1:74.68 | A:305920447;C:235855931;G:243442186;T:300439294;N:466645 | 74 | 74 | 305920447 | 235855931 | 243442186 | 300439294 | 466645 | ERX3851412 | ERS4266436 | ERA2354529 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | 2 | 0.94089 | 0.94085 | 0.04872 | 0.04916 | 0.7419 | 0.74355 | 0.51209 | 0.5119 | 74 | 76 | B | B | biological fallback assumption | illumina | nextseq | unknown | random_priming | unknown | sc | single_cell_plate | smartseq | United Kingdom | 2020-01-24 | Blastula | Embryo | Whole Organism | All anatomical structures | |||||||||||||
| 9784 | 9784 | ERR3838745 | ERX3851411 | ERS4266435 | ERP119601 | PRJEB36411 | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E-MTAB-8707 | Transcriptome Analysis | Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment. | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Soma dome rep1 | SAMEA6501986 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK | ENA FIRST PUBLIC:2020 04 30T04:03:48Z|ENA LAST UPDATE:2020 01 24T08:44:00Z|External Id:SAMEA6501986|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK|INSDC first public:2020 04 30T04:03:48Z|INSDC last update:2020 01 24T08:44:00Z|INSDC status:public|Submitter Id:E MTAB 8707:Soma dome rep1|age:4.3|broker name:ArrayExpress|cell type:whole embryo|common name:zebrafish|developmental stage:blastula dome|genotype:tgbuc:egfp|phenotype:fluorescent PGCs due to germ plasm localised GFP|sample name:E MTAB 8707:Soma dome rep1|scientific name:Danio rerio|strain:AB | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E MTAB 8707:Soma dome rep1 p | Soma dome rep1 p | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Experimental Factor: developmental stage:blastula dome|Experimental Factor: compound:n1|Experimental Factor: cell type:whole embryo | OTHER | TRANSCRIPTOMIC | RANDOM PCR | PAIRED | ILLUMINA | NextSeq 550 | ERP119601 | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | S8_R1.fastq.gz S8_R2.fastq.gz | fastq fastq | 336100162.0 | 2240589.0 | E MTAB 8707:S8 R | 0:75.00 1:75.00 | A:93960580;C:73499585;G:75981355;T:92580945;N:77697 | 75 | 75 | 93960580 | 73499585 | 75981355 | 92580945 | 77697 | ERX3851411 | ERS4266435 | ERA2354529 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | 2 | 0.93874 | 0.93856 | 0.05265 | 0.0517 | 0.74188 | 0.74381 | 0.51181 | 0.51086 | 75 | 75 | B | B | biological fallback assumption | illumina | nextseq | unknown | random_priming | unknown | sc | single_cell_plate | smartseq | United Kingdom | 2020-01-24 | Blastula | Embryo | Whole Organism | All anatomical structures | |||||||||||||
| 9785 | 9785 | ERR3838744 | ERX3851410 | ERS4266434 | ERP119601 | PRJEB36411 | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E-MTAB-8707 | Transcriptome Analysis | Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment. | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Soma 256 cell rep2 | SAMEA6501985 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK | ENA FIRST PUBLIC:2020 04 30T04:03:48Z|ENA LAST UPDATE:2020 01 24T08:44:00Z|External Id:SAMEA6501985|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK|INSDC first public:2020 04 30T04:03:48Z|INSDC last update:2020 01 24T08:44:00Z|INSDC status:public|Submitter Id:E MTAB 8707:Soma 256 cell rep2|age:2.5|broker name:ArrayExpress|cell type:whole embryo|common name:zebrafish|developmental stage:blastula 256 cell|genotype:tgbuc:egfp|phenotype:fluorescent PGCs due to germ plasm localised GFP|sample name:E MTAB 8707:Soma 256 cell rep2|scientific name:Danio rerio|strain:AB | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E MTAB 8707:Soma 256 cell rep2 p | Soma 256 cell rep2 p | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Experimental Factor: developmental stage:blastula 256 cell|Experimental Factor: compound:n1|Experimental Factor: cell type:whole embryo | OTHER | TRANSCRIPTOMIC | RANDOM PCR | PAIRED | ILLUMINA | NextSeq 550 | ERP119601 | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | S2_R1.fastq.gz S2_R2.fastq.gz | fastq fastq | 1272080863.0 | 8551103.0 | E MTAB 8707:S2 R | 0:74.38 1:74.38 | A:364033393;C:268850689;G:276270908;T:362172455;N:753418 | 74 | 74 | 364033393 | 268850689 | 276270908 | 362172455 | 753418 | ERX3851410 | ERS4266434 | ERA2354529 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | 2 | 0.80562 | 0.80436 | 0.23702 | 0.23786 | 0.77914 | 0.77991 | 0.51225 | 0.5092 | 76 | 76 | B | B | biological fallback assumption | illumina | nextseq | unknown | random_priming | unknown | sc | single_cell_plate | smartseq | United Kingdom | 2020-01-24 | Blastula | Embryo | Whole Organism | All anatomical structures | |||||||||||||
| 9786 | 9786 | ERR3838743 | ERX3851409 | ERS4266433 | ERP119601 | PRJEB36411 | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E-MTAB-8707 | Transcriptome Analysis | Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment. | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Soma 256 cell rep1 | SAMEA6501984 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK | ENA FIRST PUBLIC:2020 04 30T04:03:48Z|ENA LAST UPDATE:2020 01 24T08:44:00Z|External Id:SAMEA6501984|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK|INSDC first public:2020 04 30T04:03:48Z|INSDC last update:2020 01 24T08:44:00Z|INSDC status:public|Submitter Id:E MTAB 8707:Soma 256 cell rep1|age:2.5|broker name:ArrayExpress|cell type:whole embryo|common name:zebrafish|developmental stage:blastula 256 cell|genotype:tgbuc:egfp|phenotype:fluorescent PGCs due to germ plasm localised GFP|sample name:E MTAB 8707:Soma 256 cell rep1|scientific name:Danio rerio|strain:AB | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E MTAB 8707:Soma 256 cell rep1 p | Soma 256 cell rep1 p | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Experimental Factor: developmental stage:blastula 256 cell|Experimental Factor: compound:n1|Experimental Factor: cell type:whole embryo | OTHER | TRANSCRIPTOMIC | RANDOM PCR | PAIRED | ILLUMINA | NextSeq 550 | ERP119601 | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | Somatic_256_rep1_R1.fastq.gz Somatic_256_rep1_R2.fastq.gz | fastq fastq | 2254901578.0 | 15144857.0 | E MTAB 8707:Somatic 256 rep1 R | 0:74.44 1:74.45 | A:648357135;C:475813294;G:492914743;T:636658631;N:1157775 | 74 | 74 | 648357135 | 475813294 | 492914743 | 636658631 | 1157775 | ERX3851409 | ERS4266433 | ERA2354529 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | 2 | 0.92992 | 0.92787 | 0.07245 | 0.07214 | 0.7599 | 0.76084 | 0.53758 | 0.53839 | 74 | 76 | B | B | biological fallback assumption | illumina | nextseq | unknown | random_priming | unknown | sc | single_cell_plate | smartseq | United Kingdom | 2020-01-24 | Blastula | Embryo | Whole Organism | All anatomical structures | |||||||||||||
| 9787 | 9787 | ERR3838742 | ERX3851408 | ERS4266432 | ERP119601 | PRJEB36411 | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E-MTAB-8707 | Transcriptome Analysis | Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment. | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Soma 10somites rep2 | SAMEA6501983 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK | ENA FIRST PUBLIC:2020 04 30T04:03:48Z|ENA LAST UPDATE:2020 01 24T08:44:00Z|External Id:SAMEA6501983|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK|INSDC first public:2020 04 30T04:03:48Z|INSDC last update:2020 01 24T08:44:00Z|INSDC status:public|Submitter Id:E MTAB 8707:Soma 10somites rep2|age:14|broker name:ArrayExpress|cell type:whole embryo|common name:zebrafish|developmental stage:10 somites|genotype:tgbuc:egfp|phenotype:fluorescent PGCs due to germ plasm localised GFP|sample name:E MTAB 8707:Soma 10somites rep2|scientific name:Danio rerio|strain:AB | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E MTAB 8707:Soma 10somites rep2 p | Soma 10somites rep2 p | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Experimental Factor: developmental stage:10 somites|Experimental Factor: compound:n1|Experimental Factor: cell type:whole embryo | OTHER | TRANSCRIPTOMIC | RANDOM PCR | PAIRED | ILLUMINA | NextSeq 550 | ERP119601 | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | S6_R1.fastq.gz S6_R2.fastq.gz | fastq fastq | 1244080980.0 | 8338002.0 | E MTAB 8707:S6 R | 0:74.60 1:74.60 | A:356418931;C:263292901;G:270630630;T:353140798;N:597720 | 74 | 74 | 356418931 | 263292901 | 270630630 | 353140798 | 597720 | ERX3851408 | ERS4266432 | ERA2354529 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | 2 | 0.86791 | 0.86732 | 0.20223 | 0.20398 | 0.75588 | 0.75883 | 0.4862 | 0.48313 | 76 | 75 | B | B | biological fallback assumption | illumina | nextseq | unknown | random_priming | unknown | sc | single_cell_plate | smartseq | United Kingdom | 2020-01-24 | Segmentation | Embryo | Whole Organism | All anatomical structures | |||||||||||||
| 9788 | 9788 | ERR3838741 | ERX3851407 | ERS4266431 | ERP119601 | PRJEB36411 | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E-MTAB-8707 | Transcriptome Analysis | Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment. | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Soma 10somites rep1 | SAMEA6501982 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK | ENA FIRST PUBLIC:2020 04 30T04:03:48Z|ENA LAST UPDATE:2020 01 24T08:44:00Z|External Id:SAMEA6501982|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK|INSDC first public:2020 04 30T04:03:48Z|INSDC last update:2020 01 24T08:44:00Z|INSDC status:public|Submitter Id:E MTAB 8707:Soma 10somites rep1|age:14|broker name:ArrayExpress|cell type:whole embryo|common name:zebrafish|developmental stage:10 somites|genotype:tgbuc:egfp|phenotype:fluorescent PGCs due to germ plasm localised GFP|sample name:E MTAB 8707:Soma 10somites rep1|scientific name:Danio rerio|strain:AB | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E MTAB 8707:Soma 10somites rep1 p | Soma 10somites rep1 p | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Experimental Factor: developmental stage:10 somites|Experimental Factor: compound:n1|Experimental Factor: cell type:whole embryo | OTHER | TRANSCRIPTOMIC | RANDOM PCR | PAIRED | ILLUMINA | NextSeq 550 | ERP119601 | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | S4_R1.fastq.gz S4_R2.fastq.gz | fastq fastq | 946153328.0 | 6354843.0 | E MTAB 8707:S4 R | 0:74.44 1:74.45 | A:268310887;C:203457903;G:208969410;T:264875129;N:539999 | 74 | 74 | 268310887 | 203457903 | 208969410 | 264875129 | 539999 | ERX3851407 | ERS4266431 | ERA2354529 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | 2 | 0.92415 | 0.92372 | 0.12138 | 0.12268 | 0.74061 | 0.74422 | 0.47246 | 0.47448 | 76 | 76 | B | B | biological fallback assumption | illumina | nextseq | unknown | random_priming | unknown | sc | single_cell_plate | smartseq | United Kingdom | 2020-01-24 | Segmentation | Embryo | Whole Organism | All anatomical structures | |||||||||||||
| 9789 | 9789 | ERR3838740 | ERX3851406 | ERS4266430 | ERP119601 | PRJEB36411 | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E-MTAB-8707 | Transcriptome Analysis | Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment. | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | PGC prim5 wt rep2 | SAMEA6501981 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK | ENA FIRST PUBLIC:2020 04 30T04:03:48Z|ENA LAST UPDATE:2020 01 24T08:44:00Z|External Id:SAMEA6501981|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK|INSDC first public:2020 04 30T04:03:48Z|INSDC last update:2020 01 24T08:44:00Z|INSDC status:public|Submitter Id:E MTAB 8707:PGC prim5 wt rep2|age:24|broker name:ArrayExpress|cell type:primordial germ cell|common name:zebrafish|developmental stage:pharyngula prim 5|genotype:tgbuc:egfp|phenotype:fluorescent PGCs due to germ plasm localised GFP|sample name:E MTAB 8707:PGC prim5 wt rep2|scientific name:Danio rerio|strain:AB | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E MTAB 8707:PGC prim5 wt rep2 p | PGC prim5 wt rep2 p | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Experimental Factor: developmental stage:pharyngula prim 5|Experimental Factor: compound:n1|Experimental Factor: cell type:primordial germ cell | OTHER | TRANSCRIPTOMIC | RANDOM PCR | PAIRED | ILLUMINA | NextSeq 550 | ERP119601 | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | PGC_prim5_rep2_R1.fastq.gz PGC_prim5_rep2_R2.fastq.gz | fastq fastq | 2236371655.0 | 15023634.0 | E MTAB 8707:PGC prim5 rep2 R | 0:74.43 1:74.43 | A:619039687;C:495191024;G:509021767;T:611885185;N:1233992 | 74 | 74 | 619039687 | 495191024 | 509021767 | 611885185 | 1233992 | ERX3851406 | ERS4266430 | ERA2354529 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | 2 | 0.93137 | 0.92838 | 0.23991 | 0.24045 | 0.71435 | 0.71591 | 0.49054 | 0.49302 | 76 | 76 | B | B | biological fallback assumption | illumina | nextseq | unknown | random_priming | unknown | sc | single_cell_plate | smartseq | United Kingdom | 2020-01-24 | Pharyngula | Embryo | Whole Organism | All anatomical structures | |||||||||||||
| 9790 | 9790 | ERR3838739 | ERX3851405 | ERS4266429 | ERP119601 | PRJEB36411 | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E-MTAB-8707 | Transcriptome Analysis | Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment. | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | PGC prim5 wt rep1 | SAMEA6501980 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK | ENA FIRST PUBLIC:2020 04 30T04:03:48Z|ENA LAST UPDATE:2020 01 24T08:44:00Z|External Id:SAMEA6501980|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK|INSDC first public:2020 04 30T04:03:48Z|INSDC last update:2020 01 24T08:44:00Z|INSDC status:public|Submitter Id:E MTAB 8707:PGC prim5 wt rep1|age:24|broker name:ArrayExpress|cell type:primordial germ cell|common name:zebrafish|developmental stage:pharyngula prim 5|genotype:tgbuc:egfp|phenotype:fluorescent PGCs due to germ plasm localised GFP|sample name:E MTAB 8707:PGC prim5 wt rep1|scientific name:Danio rerio|strain:AB | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E MTAB 8707:PGC prim5 wt rep1 p | PGC prim5 wt rep1 p | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Experimental Factor: developmental stage:pharyngula prim 5|Experimental Factor: compound:n1|Experimental Factor: cell type:primordial germ cell | OTHER | TRANSCRIPTOMIC | RANDOM PCR | PAIRED | ILLUMINA | NextSeq 550 | ERP119601 | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | PGC_prim5_rep1_R1.fastq.gz PGC_prim5_rep1_R2.fastq.gz | fastq fastq | 1619398294.0 | 10873533.0 | E MTAB 8707:PGC prim5 rep1 R | 0:74.46 1:74.47 | A:450612629;C:355178930;G:365650222;T:447083613;N:872900 | 74 | 74 | 450612629 | 355178930 | 365650222 | 447083613 | 872900 | ERX3851405 | ERS4266429 | ERA2354529 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | 2 | 0.92755 | 0.92901 | 0.22893 | 0.22952 | 0.71131 | 0.71372 | 0.49829 | 0.50019 | 76 | 76 | B | B | biological fallback assumption | illumina | nextseq | unknown | random_priming | unknown | sc | single_cell_plate | smartseq | United Kingdom | 2020-01-24 | Pharyngula | Embryo | Whole Organism | All anatomical structures | |||||||||||||
| 9791 | 9791 | ERR3838738 | ERX3851404 | ERS4266428 | ERP119601 | PRJEB36411 | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E-MTAB-8707 | Transcriptome Analysis | Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment. | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | PGC prim5 Morpholino rep2 | SAMEA6501979 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK | ENA FIRST PUBLIC:2020 04 30T04:03:48Z|ENA LAST UPDATE:2020 01 24T08:44:00Z|External Id:SAMEA6501979|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK|INSDC first public:2020 04 30T04:03:48Z|INSDC last update:2020 01 24T08:44:00Z|INSDC status:public|Submitter Id:E MTAB 8707:PGC prim5 Morpholino rep2|age:24|broker name:ArrayExpress|cell type:primordial germ cell|common name:zebrafish|developmental stage:pharyngula prim 5|genotype:tgbuc:egfp|phenotype:fluorescent PGCs due to germ plasm localised GFP|sample name:E MTAB 8707:PGC prim5 Morpholino rep2|scientific name:Danio rerio|strain:AB | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E MTAB 8707:PGC prim5 Morpholino rep2 p | PGC prim5 Morpholino rep2 p | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Experimental Factor: developmental stage:pharyngula prim 5|Experimental Factor: compound:Morpholino antisense oligo against Tdrd7 transcript|Experimental Factor: dose:0.3|Experimental Factor: cell type:primordial germ cell | OTHER | TRANSCRIPTOMIC | RANDOM PCR | PAIRED | ILLUMINA | NextSeq 550 | ERP119601 | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | S13_R1.fastq.gz S13_R2.fastq.gz | fastq fastq | 906443913.0 | 6069224.0 | E MTAB 8707:S13 R | 0:74.67 1:74.68 | A:256935983;C:195137600;G:200975999;T:253026767;N:367564 | 74 | 74 | 256935983 | 195137600 | 200975999 | 253026767 | 367564 | ERX3851404 | ERS4266428 | ERA2354529 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | 2 | 0.93468 | 0.93605 | 0.09793 | 0.09817 | 0.71163 | 0.71291 | 0.48766 | 0.48921 | 75 | 76 | B | B | biological fallback assumption | illumina | nextseq | unknown | random_priming | unknown | sc | single_cell_plate | smartseq | United Kingdom | 2020-01-24 | Pharyngula | Embryo | Whole Organism | All anatomical structures | |||||||||||||
| 9792 | 9792 | ERR3838737 | ERX3851403 | ERS4266427 | ERP119601 | PRJEB36411 | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E-MTAB-8707 | Transcriptome Analysis | Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment. | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | PGC prim5 Morpholino rep1 | SAMEA6501978 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK | ENA FIRST PUBLIC:2020 04 30T04:03:48Z|ENA LAST UPDATE:2020 01 24T08:44:00Z|External Id:SAMEA6501978|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK|INSDC first public:2020 04 30T04:03:48Z|INSDC last update:2020 01 24T08:44:00Z|INSDC status:public|Submitter Id:E MTAB 8707:PGC prim5 Morpholino rep1|age:24|broker name:ArrayExpress|cell type:primordial germ cell|common name:zebrafish|developmental stage:pharyngula prim 5|genotype:tgbuc:egfp|phenotype:fluorescent PGCs due to germ plasm localised GFP|sample name:E MTAB 8707:PGC prim5 Morpholino rep1|scientific name:Danio rerio|strain:AB | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E MTAB 8707:PGC prim5 Morpholino rep1 p | PGC prim5 Morpholino rep1 p | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Experimental Factor: developmental stage:pharyngula prim 5|Experimental Factor: compound:Morpholino antisense oligo against Tdrd7 transcript|Experimental Factor: dose:0.3|Experimental Factor: cell type:primordial germ cell | OTHER | TRANSCRIPTOMIC | RANDOM PCR | PAIRED | ILLUMINA | NextSeq 550 | ERP119601 | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | Fabio_cat_11_R1.fastq.gz Fabio_cat_11_R2.fastq.gz | fastq fastq | 1078919524.0 | 7241200.0 | E MTAB 8707:Fabio cat 11 R | 0:74.50 1:74.50 | A:308200726;C:229836659;G:236649504;T:303673221;N:559414 | 74 | 74 | 308200726 | 229836659 | 236649504 | 303673221 | 559414 | ERX3851403 | ERS4266427 | ERA2354529 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | 2 | 0.93808 | 0.93753 | 0.10449 | 0.10446 | 0.70733 | 0.71017 | 0.48103 | 0.48247 | 75 | 76 | B | B | biological fallback assumption | illumina | nextseq | unknown | random_priming | unknown | sc | single_cell_plate | smartseq | United Kingdom | 2020-01-24 | Pharyngula | Embryo | Whole Organism | All anatomical structures | |||||||||||||
| 9793 | 9793 | ERR3838736 | ERX3851402 | ERS4266426 | ERP119601 | PRJEB36411 | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E-MTAB-8707 | Transcriptome Analysis | Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment. | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | PGC prim5 5mismatch Morpholino rep2 | SAMEA6501977 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK | ENA FIRST PUBLIC:2020 04 30T04:03:48Z|ENA LAST UPDATE:2020 01 24T08:44:00Z|External Id:SAMEA6501977|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK|INSDC first public:2020 04 30T04:03:48Z|INSDC last update:2020 01 24T08:44:00Z|INSDC status:public|Submitter Id:E MTAB 8707:PGC prim5 5mismatch Morpholino rep2|age:24|broker name:ArrayExpress|cell type:primordial germ cell|common name:zebrafish|developmental stage:pharyngula prim 5|genotype:tgbuc:egfp|phenotype:fluorescent PGCs due to germ plasm localised GFP|sample name:E MTAB 8707:PGC prim5 5mismatch Morpholino rep2|scientific name:Danio rerio|strain:AB | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E MTAB 8707:PGC prim5 5mismatch Morpholino rep2 p | PGC prim5 5mismatch Morpholino rep2 p | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Experimental Factor: developmental stage:pharyngula prim 5|Experimental Factor: compound:Control morpholino antisense oligo with 5 mismatches|Experimental Factor: dose:0.3|Experimental Factor: cell type:primordial germ cell | OTHER | TRANSCRIPTOMIC | RANDOM PCR | PAIRED | ILLUMINA | NextSeq 550 | ERP119601 | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | S17_R1.fastq.gz S17_R2.fastq.gz | fastq fastq | 673911944.0 | 4501723.0 | E MTAB 8707:S17 R | 0:74.85 1:74.85 | A:184466911;C:150779527;G:155693395;T:182720480;N:251631 | 74 | 74 | 184466911 | 150779527 | 155693395 | 182720480 | 251631 | ERX3851402 | ERS4266426 | ERA2354529 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | 2 | 0.9199 | 0.92023 | 0.08791 | 0.08923 | 0.70132 | 0.70378 | 0.49183 | 0.49425 | 75 | 75 | B | B | biological fallback assumption | illumina | nextseq | unknown | random_priming | unknown | sc | single_cell_plate | smartseq | United Kingdom | 2020-01-24 | Pharyngula | Embryo | Whole Organism | All anatomical structures | |||||||||||||
| 9794 | 9794 | ERR3838735 | ERX3851401 | ERS4266425 | ERP119601 | PRJEB36411 | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E-MTAB-8707 | Transcriptome Analysis | Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment. | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | PGC prim5 5mismatch Morpholino rep1 | SAMEA6501976 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK | ENA FIRST PUBLIC:2020 04 30T04:03:48Z|ENA LAST UPDATE:2020 01 24T08:44:00Z|External Id:SAMEA6501976|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK|INSDC first public:2020 04 30T04:03:48Z|INSDC last update:2020 01 24T08:44:00Z|INSDC status:public|Submitter Id:E MTAB 8707:PGC prim5 5mismatch Morpholino rep1|age:24|broker name:ArrayExpress|cell type:primordial germ cell|common name:zebrafish|developmental stage:pharyngula prim 5|genotype:tgbuc:egfp|phenotype:fluorescent PGCs due to germ plasm localised GFP|sample name:E MTAB 8707:PGC prim5 5mismatch Morpholino rep1|scientific name:Danio rerio|strain:AB | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E MTAB 8707:PGC prim5 5mismatch Morpholino rep1 p | PGC prim5 5mismatch Morpholino rep1 p | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Experimental Factor: developmental stage:pharyngula prim 5|Experimental Factor: compound:Control morpholino antisense oligo with 5 mismatches|Experimental Factor: dose:0.3|Experimental Factor: cell type:primordial germ cell | OTHER | TRANSCRIPTOMIC | RANDOM PCR | PAIRED | ILLUMINA | NextSeq 550 | ERP119601 | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | S15_R1.fastq.gz S15_R2.fastq.gz | fastq fastq | 565636692.0 | 3782000.0 | E MTAB 8707:S15 R | 0:74.78 1:74.78 | A:157353454;C:124504476;G:128260137;T:155314004;N:204621 | 74 | 74 | 157353454 | 124504476 | 128260137 | 155314004 | 204621 | ERX3851401 | ERS4266425 | ERA2354529 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | 2 | 0.91956 | 0.91996 | 0.08306 | 0.08458 | 0.69982 | 0.70203 | 0.48525 | 0.48771 | 76 | 76 | B | B | biological fallback assumption | illumina | nextseq | unknown | random_priming | unknown | sc | single_cell_plate | smartseq | United Kingdom | 2020-01-24 | Pharyngula | Embryo | Whole Organism | All anatomical structures | |||||||||||||
| 9795 | 9795 | ERR3838734 | ERX3851400 | ERS4266424 | ERP119601 | PRJEB36411 | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E-MTAB-8707 | Transcriptome Analysis | Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment. | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | PGC High rep2 | SAMEA6501975 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK | ENA FIRST PUBLIC:2020 04 30T04:03:48Z|ENA LAST UPDATE:2020 01 24T08:44:00Z|External Id:SAMEA6501975|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK|INSDC first public:2020 04 30T04:03:48Z|INSDC last update:2020 01 24T08:44:00Z|INSDC status:public|Submitter Id:E MTAB 8707:PGC High rep2|age:3.3|broker name:ArrayExpress|cell type:primordial germ cell|common name:zebrafish|developmental stage:blastula high|genotype:tgbuc:egfp|phenotype:fluorescent PGCs due to germ plasm localised GFP|sample name:E MTAB 8707:PGC High rep2|scientific name:Danio rerio|strain:AB | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E MTAB 8707:PGC High rep2 p | PGC High rep2 p | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Experimental Factor: developmental stage:blastula high|Experimental Factor: compound:n1|Experimental Factor: cell type:primordial germ cell | OTHER | TRANSCRIPTOMIC | RANDOM PCR | PAIRED | ILLUMINA | NextSeq 550 | ERP119601 | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | PGC_High_rep2_R1.fastq.gz PGC_High_rep2_R2.fastq.gz | fastq fastq | 2491013839.0 | 16740632.0 | E MTAB 8707:PGC High rep2 R | 0:74.40 1:74.40 | A:715637079;C:527451931;G:545855323;T:700774175;N:1295331 | 74 | 74 | 715637079 | 527451931 | 545855323 | 700774175 | 1295331 | ERX3851400 | ERS4266424 | ERA2354529 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | 2 | 0.93381 | 0.93556 | 0.06095 | 0.06172 | 0.76094 | 0.76364 | 0.52942 | 0.53118 | 74 | 76 | B | B | biological fallback assumption | illumina | nextseq | unknown | random_priming | unknown | sc | single_cell_plate | smartseq | United Kingdom | 2020-01-24 | Blastula | Embryo | Whole Organism | All anatomical structures | |||||||||||||
| 9796 | 9796 | ERR3838733 | ERX3851399 | ERS4266423 | ERP119601 | PRJEB36411 | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E-MTAB-8707 | Transcriptome Analysis | Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment. | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | PGC High rep1 | SAMEA6501974 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK | ENA FIRST PUBLIC:2020 04 30T04:03:48Z|ENA LAST UPDATE:2020 01 24T08:44:00Z|External Id:SAMEA6501974|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK|INSDC first public:2020 04 30T04:03:48Z|INSDC last update:2020 01 24T08:44:00Z|INSDC status:public|Submitter Id:E MTAB 8707:PGC High rep1|age:3.3|broker name:ArrayExpress|cell type:primordial germ cell|common name:zebrafish|developmental stage:blastula high|genotype:tgbuc:egfp|phenotype:fluorescent PGCs due to germ plasm localised GFP|sample name:E MTAB 8707:PGC High rep1|scientific name:Danio rerio|strain:AB | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E MTAB 8707:PGC High rep1 p | PGC High rep1 p | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Experimental Factor: developmental stage:blastula high|Experimental Factor: compound:n1|Experimental Factor: cell type:primordial germ cell | OTHER | TRANSCRIPTOMIC | RANDOM PCR | PAIRED | ILLUMINA | NextSeq 550 | ERP119601 | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | PGC_High_rep1_R1.fastq.gz PGC_High_rep1_R2.fastq.gz | fastq fastq | 2055218051.0 | 13801653.0 | E MTAB 8707:PGC High rep1 R | 0:74.45 1:74.46 | A:594747301;C:431446277;G:445665283;T:582330624;N:1028566 | 74 | 74 | 594747301 | 431446277 | 445665283 | 582330624 | 1028566 | ERX3851399 | ERS4266423 | ERA2354529 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | 2 | 0.93644 | 0.93494 | 0.06937 | 0.07015 | 0.76353 | 0.7653 | 0.45909 | 0.44979 | 76 | 76 | B | B | biological fallback assumption | illumina | nextseq | unknown | random_priming | unknown | sc | single_cell_plate | smartseq | United Kingdom | 2020-01-24 | Blastula | Embryo | Whole Organism | All anatomical structures | |||||||||||||
| 9797 | 9797 | ERR3838732 | ERX3851398 | ERS4266422 | ERP119601 | PRJEB36411 | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E-MTAB-8707 | Transcriptome Analysis | Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment. | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | PGC dome rep2 | SAMEA6501973 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK | ENA FIRST PUBLIC:2020 04 30T04:03:48Z|ENA LAST UPDATE:2020 01 24T08:44:00Z|External Id:SAMEA6501973|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK|INSDC first public:2020 04 30T04:03:48Z|INSDC last update:2020 01 24T08:44:00Z|INSDC status:public|Submitter Id:E MTAB 8707:PGC dome rep2|age:4.3|broker name:ArrayExpress|cell type:primordial germ cell|common name:zebrafish|developmental stage:blastula dome|genotype:tgbuc:egfp|phenotype:fluorescent PGCs due to germ plasm localised GFP|sample name:E MTAB 8707:PGC dome rep2|scientific name:Danio rerio|strain:AB | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E MTAB 8707:PGC dome rep2 p | PGC dome rep2 p | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Experimental Factor: developmental stage:blastula dome|Experimental Factor: compound:n1|Experimental Factor: cell type:primordial germ cell | OTHER | TRANSCRIPTOMIC | RANDOM PCR | PAIRED | ILLUMINA | NextSeq 550 | ERP119601 | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | S9_R1.fastq.gz S9_R2.fastq.gz | fastq fastq | 882858901.0 | 5912255.0 | E MTAB 8707:S9 R | 0:74.66 1:74.67 | A:246639630;C:193554406;G:199940889;T:242369366;N:354610 | 74 | 74 | 246639630 | 193554406 | 199940889 | 242369366 | 354610 | ERX3851398 | ERS4266422 | ERA2354529 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | 2 | 0.94045 | 0.9404 | 0.04635 | 0.04658 | 0.74582 | 0.74777 | 0.4915 | 0.49248 | 76 | 76 | B | B | biological fallback assumption | illumina | nextseq | unknown | random_priming | unknown | sc | single_cell_plate | smartseq | United Kingdom | 2020-01-24 | Blastula | Embryo | Whole Organism | All anatomical structures | |||||||||||||
| 9798 | 9798 | ERR3838731 | ERX3851397 | ERS4266421 | ERP119601 | PRJEB36411 | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E-MTAB-8707 | Transcriptome Analysis | Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment. | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | PGC dome rep1 | SAMEA6501972 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK | ENA FIRST PUBLIC:2020 04 30T04:03:48Z|ENA LAST UPDATE:2020 01 24T08:44:00Z|External Id:SAMEA6501972|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK|INSDC first public:2020 04 30T04:03:48Z|INSDC last update:2020 01 24T08:44:00Z|INSDC status:public|Submitter Id:E MTAB 8707:PGC dome rep1|age:4.3|broker name:ArrayExpress|cell type:primordial germ cell|common name:zebrafish|developmental stage:blastula dome|genotype:tgbuc:egfp|phenotype:fluorescent PGCs due to germ plasm localised GFP|sample name:E MTAB 8707:PGC dome rep1|scientific name:Danio rerio|strain:AB | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E MTAB 8707:PGC dome rep1 p | PGC dome rep1 p | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Experimental Factor: developmental stage:blastula dome|Experimental Factor: compound:n1|Experimental Factor: cell type:primordial germ cell | OTHER | TRANSCRIPTOMIC | RANDOM PCR | PAIRED | ILLUMINA | NextSeq 550 | ERP119601 | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | S7_R1.fastq.gz S7_R2.fastq.gz | fastq fastq | 592299285.0 | 3961989.0 | E MTAB 8707:S7 R | 0:74.75 1:74.75 | A:166664600;C:128421892;G:132787149;T:164189412;N:236232 | 74 | 74 | 166664600 | 128421892 | 132787149 | 164189412 | 236232 | ERX3851397 | ERS4266421 | ERA2354529 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | 2 | 0.93981 | 0.94032 | 0.04868 | 0.04843 | 0.74627 | 0.74722 | 0.49243 | 0.48872 | 75 | 76 | B | B | biological fallback assumption | illumina | nextseq | unknown | random_priming | unknown | sc | single_cell_plate | smartseq | United Kingdom | 2020-01-24 | Blastula | Embryo | Whole Organism | All anatomical structures | |||||||||||||
| 9799 | 9799 | ERR3838730 | ERX3851396 | ERS4266420 | ERP119601 | PRJEB36411 | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E-MTAB-8707 | Transcriptome Analysis | Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment. | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | PGC 256 cell rep2 | SAMEA6501971 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK | ENA FIRST PUBLIC:2020 04 30T04:03:48Z|ENA LAST UPDATE:2020 01 24T08:44:00Z|External Id:SAMEA6501971|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK|INSDC first public:2020 04 30T04:03:48Z|INSDC last update:2020 01 24T08:44:00Z|INSDC status:public|Submitter Id:E MTAB 8707:PGC 256 cell rep2|age:2.5|broker name:ArrayExpress|cell type:primordial germ cell|common name:zebrafish|developmental stage:blastula 256 cell|genotype:tgbuc:egfp|phenotype:fluorescent PGCs due to germ plasm localised GFP|sample name:E MTAB 8707:PGC 256 cell rep2|scientific name:Danio rerio|strain:AB | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E MTAB 8707:PGC 256 cell rep2 p | PGC 256 cell rep2 p | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Experimental Factor: developmental stage:blastula 256 cell|Experimental Factor: compound:n1|Experimental Factor: cell type:primordial germ cell | OTHER | TRANSCRIPTOMIC | RANDOM PCR | PAIRED | ILLUMINA | NextSeq 550 | ERP119601 | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | S1_R1.fastq.gz S1_R2.fastq.gz | fastq fastq | 745277323.0 | 4983607.0 | E MTAB 8707:S1 R | 0:74.77 1:74.77 | A:208352741;C:163024343;G:168234953;T:205391192;N:274094 | 74 | 74 | 208352741 | 163024343 | 168234953 | 205391192 | 274094 | ERX3851396 | ERS4266420 | ERA2354529 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | 2 | 0.9393 | 0.9395 | 0.03941 | 0.03941 | 0.75473 | 0.75708 | 0.51338 | 0.51754 | 75 | 76 | B | B | biological fallback assumption | illumina | nextseq | unknown | random_priming | unknown | sc | single_cell_plate | smartseq | United Kingdom | 2020-01-24 | Blastula | Embryo | Whole Organism | All anatomical structures | |||||||||||||
| 9800 | 9800 | ERR3838729 | ERX3851395 | ERS4266419 | ERP119601 | PRJEB36411 | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E-MTAB-8707 | Transcriptome Analysis | Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment. | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | PGC 256 cell rep1 | SAMEA6501970 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK | ENA FIRST PUBLIC:2020 04 30T04:03:48Z|ENA LAST UPDATE:2020 01 24T08:44:00Z|External Id:SAMEA6501970|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK|INSDC first public:2020 04 30T04:03:48Z|INSDC last update:2020 01 24T08:44:00Z|INSDC status:public|Submitter Id:E MTAB 8707:PGC 256 cell rep1|age:2.5|broker name:ArrayExpress|cell type:primordial germ cell|common name:zebrafish|developmental stage:blastula 256 cell|genotype:tgbuc:egfp|phenotype:fluorescent PGCs due to germ plasm localised GFP|sample name:E MTAB 8707:PGC 256 cell rep1|scientific name:Danio rerio|strain:AB | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E MTAB 8707:PGC 256 cell rep1 p | PGC 256 cell rep1 p | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Experimental Factor: developmental stage:blastula 256 cell|Experimental Factor: compound:n1|Experimental Factor: cell type:primordial germ cell | OTHER | TRANSCRIPTOMIC | RANDOM PCR | PAIRED | ILLUMINA | NextSeq 550 | ERP119601 | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | PGC_256_rep1_R1.fastq.gz PGC_256_rep1_R2.fastq.gz | fastq fastq | 1876891175.0 | 12625794.0 | E MTAB 8707:PGC 256 rep1 R | 0:74.32 1:74.33 | A:539140549;C:396392844;G:411568412;T:528672735;N:1116635 | 74 | 74 | 539140549 | 396392844 | 411568412 | 528672735 | 1116635 | ERX3851395 | ERS4266419 | ERA2354529 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | 2 | 0.92251 | 0.92173 | 0.06705 | 0.06723 | 0.76059 | 0.76374 | 0.54467 | 0.54135 | 76 | 75 | B | B | biological fallback assumption | illumina | nextseq | unknown | random_priming | unknown | sc | single_cell_plate | smartseq | United Kingdom | 2020-01-24 | Blastula | Embryo | Whole Organism | All anatomical structures | |||||||||||||
| 9801 | 9801 | ERR3838728 | ERX3851394 | ERS4266418 | ERP119601 | PRJEB36411 | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E-MTAB-8707 | Transcriptome Analysis | Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment. | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | PGC 10somites rep2 | SAMEA6501969 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK | ENA FIRST PUBLIC:2020 04 30T04:03:48Z|ENA LAST UPDATE:2020 01 24T08:44:00Z|External Id:SAMEA6501969|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK|INSDC first public:2020 04 30T04:03:48Z|INSDC last update:2020 01 24T08:44:00Z|INSDC status:public|Submitter Id:E MTAB 8707:PGC 10somites rep2|age:14|broker name:ArrayExpress|cell type:primordial germ cell|common name:zebrafish|developmental stage:10 somites|genotype:tgbuc:egfp|phenotype:fluorescent PGCs due to germ plasm localised GFP|sample name:E MTAB 8707:PGC 10somites rep2|scientific name:Danio rerio|strain:AB | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E MTAB 8707:PGC 10somites rep2 p | PGC 10somites rep2 p | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Experimental Factor: developmental stage:10 somites|Experimental Factor: compound:n1|Experimental Factor: cell type:primordial germ cell | OTHER | TRANSCRIPTOMIC | RANDOM PCR | PAIRED | ILLUMINA | NextSeq 550 | ERP119601 | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | S5_R1.fastq.gz S5_R2.fastq.gz | fastq fastq | 1186993033.0 | 7958634.0 | E MTAB 8707:S5 R | 0:74.57 1:74.58 | A:332263881;C:259239478;G:267014990;T:327946611;N:528073 | 74 | 74 | 332263881 | 259239478 | 267014990 | 327946611 | 528073 | ERX3851394 | ERS4266418 | ERA2354529 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | 2 | 0.90713 | 0.9062 | 0.10071 | 0.1016 | 0.73058 | 0.73279 | 0.48458 | 0.48038 | 74 | 75 | B | B | biological fallback assumption | illumina | nextseq | unknown | random_priming | unknown | sc | single_cell_plate | smartseq | United Kingdom | 2020-01-24 | Segmentation | Embryo | Whole Organism | All anatomical structures | |||||||||||||
| 9802 | 9802 | ERR3838727 | ERX3851393 | ERS4266417 | ERP119601 | PRJEB36411 | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E-MTAB-8707 | Transcriptome Analysis | Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment. | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | PGC 10somites rep1 | SAMEA6501968 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK | ENA FIRST PUBLIC:2020 04 30T04:03:48Z|ENA LAST UPDATE:2020 01 24T08:44:00Z|External Id:SAMEA6501968|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK|INSDC first public:2020 04 30T04:03:48Z|INSDC last update:2020 01 24T08:44:00Z|INSDC status:public|Submitter Id:E MTAB 8707:PGC 10somites rep1|age:14|broker name:ArrayExpress|cell type:primordial germ cell|common name:zebrafish|developmental stage:10 somites|genotype:tgbuc:egfp|phenotype:fluorescent PGCs due to germ plasm localised GFP|sample name:E MTAB 8707:PGC 10somites rep1|scientific name:Danio rerio|strain:AB | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E MTAB 8707:PGC 10somites rep1 p | PGC 10somites rep1 p | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Experimental Factor: developmental stage:10 somites|Experimental Factor: compound:n1|Experimental Factor: cell type:primordial germ cell | OTHER | TRANSCRIPTOMIC | RANDOM PCR | PAIRED | ILLUMINA | NextSeq 550 | ERP119601 | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 01 24 | S3_R1.fastq.gz S3_R2.fastq.gz | fastq fastq | 1230551446.0 | 8251644.0 | E MTAB 8707:S3 R | 0:74.56 1:74.57 | A:345409587;C:267720436;G:275626594;T:341185818;N:609011 | 74 | 74 | 345409587 | 267720436 | 275626594 | 341185818 | 609011 | ERX3851393 | ERS4266417 | ERA2354529 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | 2 | 0.90983 | 0.90985 | 0.1005 | 0.10037 | 0.72622 | 0.72825 | 0.49116 | 0.49135 | 76 | 75 | B | B | biological fallback assumption | illumina | nextseq | unknown | random_priming | unknown | sc | single_cell_plate | smartseq | United Kingdom | 2020-01-24 | Segmentation | Embryo | Whole Organism | All anatomical structures | |||||||||||||
| 10111 | 10111 | ERR4911024 | ERX4777847 | ERS5435613 | ERP125516 | PRJEB41701 | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E-MTAB-9857 | Transcriptome Analysis | In this rescue experiment embryos were injected with a Tdrd7 targeting morpholino to block translation of tdrd7 RNA and simultaneously provided with a Tdrd7 morpholino resistant RNA. | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 12 02 | Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. A rescue experiment was performed with Tdrd7 MO resistant RNA from tdrd7 transcript. The RNA was in vitro transcribed and co injected in once cell embryo to rescue MO mediated Tdrd7 KD. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | PGC Rescue rep2 | SAMEA7678632 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK | ENA first public:2020 12 24|ENA last update:2020 12 02|External Id:SAMEA7678632|INSDC center alias:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK|INSDC first public:2020 12 24T04:05:28Z|INSDC last update:2020 12 02T17:13:26Z|INSDC status:public|Submitter Id:E MTAB 9857:PGC Rescue rep2|age:24|broker name:ArrayExpress|cell type:primordial germ cell|common name:zebrafish|developmental stage:pharyngula prim 5|genotype:tgbuc:gfp|sample name:E MTAB 9857:PGC Rescue rep2|strain:AB | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E MTAB 9857:PGC Rescue rep2 p | PGC Rescue rep2 p | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. A rescue experiment was performed with Tdrd7 MO resistant RNA from tdrd7 transcript. The RNA was in vitro transcribed and co injected in once cell embryo to rescue MO mediated Tdrd7 KD. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Experimental Factor: compound:tdrd7 MO + tdrd7 rescue RNA | RNA-Seq | TRANSCRIPTOMIC | RANDOM PCR | PAIRED | ILLUMINA | NextSeq 550 | ERP125516 | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 12 09 | Tdrd7_Rescue_PGC_rep2_R1.fastq.gz Tdrd7_Rescue_PGC_rep2_R2.fastq.gz | fastq fastq | 6487121744.0 | 43103086.0 | E MTAB 9857:Tdrd7 Rescue PGC rep2 R | 0:75.26 1:75.24 | A:1769293880;C:1469053016;G:1516553427;T:1729496045;N:2725376 | 75 | 75 | 1769293880 | 1469053016 | 1516553427 | 1729496045 | 2725376 | ERX4777847 | ERS5435613 | ERA3184570 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | 2 | 0.95185 | 0.95349 | 0.04302 | 0.04315 | 0.72829 | 0.73022 | 0.47176 | 0.47104 | 75 | 76 | B | B | biological fallback assumption | illumina | nextseq | unknown | random_priming | unknown | sc | single_cell_plate | smartseq | United Kingdom | 2020-12-02 | Pharyngula | Embryo | Whole Organism | All anatomical structures | |||||||||||||
| 10112 | 10112 | ERR4911023 | ERX4777846 | ERS5435612 | ERP125516 | PRJEB41701 | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E-MTAB-9857 | Transcriptome Analysis | In this rescue experiment embryos were injected with a Tdrd7 targeting morpholino to block translation of tdrd7 RNA and simultaneously provided with a Tdrd7 morpholino resistant RNA. | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 12 02 | Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. A rescue experiment was performed with Tdrd7 MO resistant RNA from tdrd7 transcript. The RNA was in vitro transcribed and co injected in once cell embryo to rescue MO mediated Tdrd7 KD. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | PGC Rescue rep1 | SAMEA7678631 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK | ENA first public:2020 12 24|ENA last update:2020 12 02|External Id:SAMEA7678631|INSDC center alias:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK|INSDC first public:2020 12 24T04:05:28Z|INSDC last update:2020 12 02T17:13:26Z|INSDC status:public|Submitter Id:E MTAB 9857:PGC Rescue rep1|age:24|broker name:ArrayExpress|cell type:primordial germ cell|common name:zebrafish|developmental stage:pharyngula prim 5|genotype:tgbuc:gfp|sample name:E MTAB 9857:PGC Rescue rep1|strain:AB | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E MTAB 9857:PGC Rescue rep1 p | PGC Rescue rep1 p | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. A rescue experiment was performed with Tdrd7 MO resistant RNA from tdrd7 transcript. The RNA was in vitro transcribed and co injected in once cell embryo to rescue MO mediated Tdrd7 KD. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Experimental Factor: compound:tdrd7 MO + tdrd7 rescue RNA | RNA-Seq | TRANSCRIPTOMIC | RANDOM PCR | PAIRED | ILLUMINA | NextSeq 550 | ERP125516 | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 12 09 | Tdrd7_Rescue_PGC_rep1_R1.fastq.gz Tdrd7_Rescue_PGC_rep1_R2.fastq.gz | fastq fastq | 5952473889.0 | 39454929.0 | E MTAB 9857:Tdrd7 Rescue PGC rep1 R | 0:75.44 1:75.43 | A:1640467527;C:1332668425;G:1380033115;T:1597665169;N:1639653 | 75 | 75 | 1640467527 | 1332668425 | 1380033115 | 1597665169 | 1639653 | ERX4777846 | ERS5435612 | ERA3184570 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | 2 | 0.95086 | 0.95226 | 0.06292 | 0.0629 | 0.70341 | 0.70579 | 0.46524 | 0.46691 | 75 | 76 | B | B | biological fallback assumption | illumina | nextseq | unknown | random_priming | unknown | sc | single_cell_plate | smartseq | United Kingdom | 2020-12-02 | Pharyngula | Embryo | Whole Organism | All anatomical structures | |||||||||||||
| 10113 | 10113 | ERR4911022 | ERX4777845 | ERS5435611 | ERP125516 | PRJEB41701 | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E-MTAB-9857 | Transcriptome Analysis | In this rescue experiment embryos were injected with a Tdrd7 targeting morpholino to block translation of tdrd7 RNA and simultaneously provided with a Tdrd7 morpholino resistant RNA. | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 12 02 | Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. A rescue experiment was performed with Tdrd7 MO resistant RNA from tdrd7 transcript. The RNA was in vitro transcribed and co injected in once cell embryo to rescue MO mediated Tdrd7 KD. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | PGC MO rep2 | SAMEA7678630 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK | ENA first public:2020 12 24|ENA last update:2020 12 02|External Id:SAMEA7678630|INSDC center alias:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK|INSDC first public:2020 12 24T04:05:28Z|INSDC last update:2020 12 02T17:13:26Z|INSDC status:public|Submitter Id:E MTAB 9857:PGC MO rep2|age:24|broker name:ArrayExpress|cell type:primordial germ cell|common name:zebrafish|developmental stage:pharyngula prim 5|genotype:tgbuc:gfp|sample name:E MTAB 9857:PGC MO rep2|strain:AB | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E MTAB 9857:PGC MO rep2 p | PGC MO rep2 p | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. A rescue experiment was performed with Tdrd7 MO resistant RNA from tdrd7 transcript. The RNA was in vitro transcribed and co injected in once cell embryo to rescue MO mediated Tdrd7 KD. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Experimental Factor: compound:tdrd7 targeting MO | RNA-Seq | TRANSCRIPTOMIC | RANDOM PCR | PAIRED | ILLUMINA | NextSeq 550 | ERP125516 | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 12 09 | Tdrd7_MO_PGC_rep2_R1.fastq.gz Tdrd7_MO_PGC_rep2_R2.fastq.gz | fastq fastq | 906443913.0 | 6069224.0 | E MTAB 9857:Tdrd7 MO PGC rep2 R | 0:74.67 1:74.68 | A:256935983;C:195137600;G:200975999;T:253026767;N:367564 | 74 | 74 | 256935983 | 195137600 | 200975999 | 253026767 | 367564 | ERX4777845 | ERS5435611 | ERA3184570 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | 2 | 0.93468 | 0.93603 | 0.09796 | 0.09848 | 0.7119 | 0.71439 | 0.48682 | 0.48933 | 75 | 76 | B | B | biological fallback assumption | illumina | nextseq | unknown | random_priming | unknown | sc | single_cell_plate | smartseq | United Kingdom | 2020-12-02 | Pharyngula | Embryo | Whole Organism | All anatomical structures | |||||||||||||
| 10114 | 10114 | ERR4911021 | ERX4777844 | ERS5435610 | ERP125516 | PRJEB41701 | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E-MTAB-9857 | Transcriptome Analysis | In this rescue experiment embryos were injected with a Tdrd7 targeting morpholino to block translation of tdrd7 RNA and simultaneously provided with a Tdrd7 morpholino resistant RNA. | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 12 02 | Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. A rescue experiment was performed with Tdrd7 MO resistant RNA from tdrd7 transcript. The RNA was in vitro transcribed and co injected in once cell embryo to rescue MO mediated Tdrd7 KD. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | PGC MO rep1 | SAMEA7678629 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK | ENA first public:2020 12 24|ENA last update:2020 12 02|External Id:SAMEA7678629|INSDC center alias:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK|INSDC first public:2020 12 24T04:05:28Z|INSDC last update:2020 12 02T17:13:26Z|INSDC status:public|Submitter Id:E MTAB 9857:PGC MO rep1|age:24|broker name:ArrayExpress|cell type:primordial germ cell|common name:zebrafish|developmental stage:pharyngula prim 5|genotype:tgbuc:gfp|sample name:E MTAB 9857:PGC MO rep1|strain:AB | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E MTAB 9857:PGC MO rep1 p | PGC MO rep1 p | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. A rescue experiment was performed with Tdrd7 MO resistant RNA from tdrd7 transcript. The RNA was in vitro transcribed and co injected in once cell embryo to rescue MO mediated Tdrd7 KD. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Experimental Factor: compound:tdrd7 targeting MO | RNA-Seq | TRANSCRIPTOMIC | RANDOM PCR | PAIRED | ILLUMINA | NextSeq 550 | ERP125516 | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 12 09 | Tdrd7_MO_PGC_rep1_R1.fastq.gz Tdrd7_MO_PGC_rep1_R2.fastq.gz | fastq fastq | 1078919524.0 | 7241200.0 | E MTAB 9857:Tdrd7 MO PGC rep1 R | 0:74.50 1:74.50 | A:308200726;C:229836659;G:236649504;T:303673221;N:559414 | 74 | 74 | 308200726 | 229836659 | 236649504 | 303673221 | 559414 | ERX4777844 | ERS5435610 | ERA3184570 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | 2 | 0.938 | 0.93748 | 0.10463 | 0.10431 | 0.7077 | 0.70999 | 0.48098 | 0.48239 | 75 | 76 | B | B | biological fallback assumption | illumina | nextseq | unknown | random_priming | unknown | sc | single_cell_plate | smartseq | United Kingdom | 2020-12-02 | Pharyngula | Embryo | Whole Organism | All anatomical structures | |||||||||||||
| 10115 | 10115 | ERR4911020 | ERX4777843 | ERS5435609 | ERP125516 | PRJEB41701 | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E-MTAB-9857 | Transcriptome Analysis | In this rescue experiment embryos were injected with a Tdrd7 targeting morpholino to block translation of tdrd7 RNA and simultaneously provided with a Tdrd7 morpholino resistant RNA. | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 12 02 | Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. A rescue experiment was performed with Tdrd7 MO resistant RNA from tdrd7 transcript. The RNA was in vitro transcribed and co injected in once cell embryo to rescue MO mediated Tdrd7 KD. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | PGC 5mm rep2 | SAMEA7678628 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK | ENA first public:2020 12 24|ENA last update:2020 12 02|External Id:SAMEA7678628|INSDC center alias:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK|INSDC first public:2020 12 24T04:05:28Z|INSDC last update:2020 12 02T17:13:26Z|INSDC status:public|Submitter Id:E MTAB 9857:PGC 5mm rep2|age:24|broker name:ArrayExpress|cell type:primordial germ cell|common name:zebrafish|developmental stage:pharyngula prim 5|genotype:tgbuc:gfp|sample name:E MTAB 9857:PGC 5mm rep2|strain:AB | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E MTAB 9857:PGC 5mm rep2 p | PGC 5mm rep2 p | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. A rescue experiment was performed with Tdrd7 MO resistant RNA from tdrd7 transcript. The RNA was in vitro transcribed and co injected in once cell embryo to rescue MO mediated Tdrd7 KD. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Experimental Factor: compound:tdrd7 5mismatch MO | RNA-Seq | TRANSCRIPTOMIC | RANDOM PCR | PAIRED | ILLUMINA | NextSeq 550 | ERP125516 | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 12 09 | Tdrd7_5mm_PGC_rep2_R1.fastq.gz Tdrd7_5mm_PGC_rep2_R2.fastq.gz | fastq fastq | 673911944.0 | 4501723.0 | E MTAB 9857:Tdrd7 5mm PGC rep2 R | 0:74.85 1:74.85 | A:184466911;C:150779527;G:155693395;T:182720480;N:251631 | 74 | 74 | 184466911 | 150779527 | 155693395 | 182720480 | 251631 | ERX4777843 | ERS5435609 | ERA3184570 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | 2 | 0.91989 | 0.92025 | 0.08795 | 0.08919 | 0.70096 | 0.70416 | 0.49184 | 0.49415 | 75 | 75 | B | B | biological fallback assumption | illumina | nextseq | unknown | random_priming | unknown | sc | single_cell_plate | smartseq | United Kingdom | 2020-12-02 | Pharyngula | Embryo | Whole Organism | All anatomical structures | |||||||||||||
| 10116 | 10116 | ERR4911019 | ERX4777842 | ERS5435608 | ERP125516 | PRJEB41701 | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E-MTAB-9857 | Transcriptome Analysis | In this rescue experiment embryos were injected with a Tdrd7 targeting morpholino to block translation of tdrd7 RNA and simultaneously provided with a Tdrd7 morpholino resistant RNA. | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 12 02 | Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. A rescue experiment was performed with Tdrd7 MO resistant RNA from tdrd7 transcript. The RNA was in vitro transcribed and co injected in once cell embryo to rescue MO mediated Tdrd7 KD. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | PGC 5mm rep1 | SAMEA7678627 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK | ENA first public:2020 12 24|ENA last update:2020 12 02|External Id:SAMEA7678627|INSDC center alias:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK|INSDC first public:2020 12 24T04:05:28Z|INSDC last update:2020 12 02T17:13:26Z|INSDC status:public|Submitter Id:E MTAB 9857:PGC 5mm rep1|age:24|broker name:ArrayExpress|cell type:primordial germ cell|common name:zebrafish|developmental stage:pharyngula prim 5|genotype:tgbuc:gfp|sample name:E MTAB 9857:PGC 5mm rep1|strain:AB | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | E MTAB 9857:PGC 5mm rep1 p | PGC 5mm rep1 p | RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. A rescue experiment was performed with Tdrd7 MO resistant RNA from tdrd7 transcript. The RNA was in vitro transcribed and co injected in once cell embryo to rescue MO mediated Tdrd7 KD. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA. | Experimental Factor: compound:tdrd7 5mismatch MO | RNA-Seq | TRANSCRIPTOMIC | RANDOM PCR | PAIRED | ILLUMINA | NextSeq 550 | ERP125516 | NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis | ENA FIRST PUBLIC:2020 12 24|ENA LAST UPDATE:2020 12 09 | Tdrd7_5mm_PGC_rep1_R1.fastq.gz Tdrd7_5mm_PGC_rep1_R2.fastq.gz | fastq fastq | 565636692.0 | 3782000.0 | E MTAB 9857:Tdrd7 5mm PGC rep1 R | 0:74.78 1:74.78 | A:157353454;C:124504476;G:128260137;T:155314004;N:204621 | 74 | 74 | 157353454 | 124504476 | 128260137 | 155314004 | 204621 | ERX4777842 | ERS5435608 | ERA3184570 | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK|European Nucleotide Archive | 2 | 0.91957 | 0.91995 | 0.08301 | 0.0845 | 0.69929 | 0.70195 | 0.48544 | 0.4877 | 76 | 76 | B | B | biological fallback assumption | illumina | nextseq | unknown | random_priming | unknown | sc | single_cell_plate | smartseq | United Kingdom | 2020-12-02 | Pharyngula | Embryo | Whole Organism | All anatomical structures | |||||||||||||
| 29202 | 29202 | SRR27329257 | SRX23006269 | SRS19970080 | SRP479683 | PRJNA1055904 | BMP dependent patterning of ectoderm tissue material properties modulates lateral mesendoderm cell migration during early zebrafish gastrulation | GSE251904 | Transcriptome Analysis | Cell migration is a fundamental process during embryonic development. Most studies in vivo have focussed on the migration of cells using the extracellular matrix ECM as their substrate for migration. In contrast much less is known about how cells migrate on other cells as found in early embryos when the ECM has not yet formed. Here we show that lateral mesendoderm LME cells in the early zebrafish gastrula use the ectoderm as their substrate for migration. We show that the lateral ectoderm is permissive for the animal pole directed migration of LME cells while the ectoderm at the animal pole halts it. These differences in the permissiveness depend on the lateral ectoderm being more cohesive than the animal ectoderm a property controlled by BMP signalling within the ectoderm. Collectively these findings identify ectoderm tissue cohesion as one critical factor regulating LME migration during zebrafish gastrulation. Overall design: To investigate the differences in gene expression between animal and lateral ectoderm causing the difference in material properties between the two ectodermal tissues. | pubmed:40057955 | Zebrafish Lateral Ectoderm 7.5 hpf 4 | GSM7989708 | source name:Lateral Ectoderm|tissue:Lateral Ectoderm|genotype:WT TgSebox::eGFP embryos|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS|geo loc name:missing|collection date:missing | Zebrafish Lateral Ectoderm 7.5 hpf 4 | FastQC quality control Trimmomatic adapter & quality trimming; parameters: 2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:19 FastQC controlling trimming results salmon Alignment; used flags: seqBias qcBias R DESeq2 differential gene expression analysis; DESEq2 apeglm tximport genefilter GenomicRanges R EnhancedVolcano & biomaRt visualization Assembly: Danio rerio GRCz11 Supplementary files format and content: tab delimited text file with gene name gene length effective length tpm and number of reads for each sample | Lateral Ectoderm | Embryo were injected with 125 pg of PAmCherry1 mRNA at xxx cell stage. At 6 hpf embryos were mounted for up right imaging and a 444 x 220 x 58.5 µm volume was photoactivated using a 405 nm laser either at the animal pole or on the lateral side. The photoactivation process was composed of 10 cycles of 28 sec per embryo in a time window of approximately 90 min. post photoactivation embryos were transferred in Ca2+ free Ringer solution and dissociated by gently pipetting using a P 1000 pipette to obtain a single cell suspension. 5000 PAmCherry1+ cells were sorted in 150 µl of RTL plus lysis buffer RNeasy Plus Micro Kit QIAGEN with 1% of 2 mercaptoethanol. | Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems. | Embryos were kept at 28.5 C until dissociation | tissue:Lateral Ectoderm|genotype:WT TgSebox::eGFP embryos|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS | GSM7989708 | GSM7989708: Zebrafish Lateral Ectoderm 7.5 hpf 4; Danio rerio; RNA Seq | GSM7989708 r1 | GSM7989708 | 1 | Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP479683 | Lateral_Ectoderm_4.mate1.fastq.gz Lateral_Ectoderm_4.mate2.fastq.gz | fastq fastq | 6211000588.0 | 26929501.0 | GSM7989708 r1 | 0:80.64 1:150 | A:1950010947;C:1101223011;G:1497556265;T:1656016608;N:6193757 | 80 | 150 | 1950010947 | 1101223011 | 1497556265 | 1656016608 | 6193757 | SRX23006269 | SRS19970080 | SRA1774740 | Heisenberg group, Institute of Science and Technology Austria (ISTA) | Heisenberg group, Institute of Science and Technology Austria (ISTA) | 2 | 0.65918 | 0.4633 | 0.04875 | 0.02201 | 0.90623 | 0.92608 | 0.79936 | 0.77887 | 68 | 150 | B | B | mate2-mate1 similar by mapping diff | illumina | novaseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | Austria | 2023-12-22 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||
| 29203 | 29203 | SRR27329258 | SRX23006268 | SRS19970081 | SRP479683 | PRJNA1055904 | BMP dependent patterning of ectoderm tissue material properties modulates lateral mesendoderm cell migration during early zebrafish gastrulation | GSE251904 | Transcriptome Analysis | Cell migration is a fundamental process during embryonic development. Most studies in vivo have focussed on the migration of cells using the extracellular matrix ECM as their substrate for migration. In contrast much less is known about how cells migrate on other cells as found in early embryos when the ECM has not yet formed. Here we show that lateral mesendoderm LME cells in the early zebrafish gastrula use the ectoderm as their substrate for migration. We show that the lateral ectoderm is permissive for the animal pole directed migration of LME cells while the ectoderm at the animal pole halts it. These differences in the permissiveness depend on the lateral ectoderm being more cohesive than the animal ectoderm a property controlled by BMP signalling within the ectoderm. Collectively these findings identify ectoderm tissue cohesion as one critical factor regulating LME migration during zebrafish gastrulation. Overall design: To investigate the differences in gene expression between animal and lateral ectoderm causing the difference in material properties between the two ectodermal tissues. | pubmed:40057955 | Zebrafish Lateral Ectoderm 7.5 hpf 3 | GSM7989707 | source name:Lateral Ectoderm|tissue:Lateral Ectoderm|genotype:WT TgSebox::eGFP embryos|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS|geo loc name:missing|collection date:missing | Zebrafish Lateral Ectoderm 7.5 hpf 3 | FastQC quality control Trimmomatic adapter & quality trimming; parameters: 2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:19 FastQC controlling trimming results salmon Alignment; used flags: seqBias qcBias R DESeq2 differential gene expression analysis; DESEq2 apeglm tximport genefilter GenomicRanges R EnhancedVolcano & biomaRt visualization Assembly: Danio rerio GRCz11 Supplementary files format and content: tab delimited text file with gene name gene length effective length tpm and number of reads for each sample | Lateral Ectoderm | Embryo were injected with 125 pg of PAmCherry1 mRNA at xxx cell stage. At 6 hpf embryos were mounted for up right imaging and a 444 x 220 x 58.5 µm volume was photoactivated using a 405 nm laser either at the animal pole or on the lateral side. The photoactivation process was composed of 10 cycles of 28 sec per embryo in a time window of approximately 90 min. post photoactivation embryos were transferred in Ca2+ free Ringer solution and dissociated by gently pipetting using a P 1000 pipette to obtain a single cell suspension. 5000 PAmCherry1+ cells were sorted in 150 µl of RTL plus lysis buffer RNeasy Plus Micro Kit QIAGEN with 1% of 2 mercaptoethanol. | Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems. | Embryos were kept at 28.5 C until dissociation | tissue:Lateral Ectoderm|genotype:WT TgSebox::eGFP embryos|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS | GSM7989707 | GSM7989707: Zebrafish Lateral Ectoderm 7.5 hpf 3; Danio rerio; RNA Seq | GSM7989707 r1 | GSM7989707 | 1 | Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP479683 | Lateral_Ectoderm_3.mate1.fastq.gz Lateral_Ectoderm_3.mate2.fastq.gz | fastq fastq | 5066130338.0 | 22014930.0 | GSM7989707 r1 | 0:80.12 1:150 | A:1476750755;C:934859886;G:1246347548;T:1403280136;N:4892013 | 80 | 150 | 1476750755 | 934859886 | 1246347548 | 1403280136 | 4892013 | SRX23006268 | SRS19970081 | SRA1774740 | Heisenberg group, Institute of Science and Technology Austria (ISTA) | Heisenberg group, Institute of Science and Technology Austria (ISTA) | 2 | 0.7566 | 0.52272 | 0.0462 | 0.02684 | 0.89489 | 0.91246 | 0.78848 | 0.77633 | 68 | 150 | B | B | mate2-mate1 similar by mapping diff | illumina | novaseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | Austria | 2023-12-22 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||
| 29204 | 29204 | SRR27329259 | SRX23006267 | SRS19970078 | SRP479683 | PRJNA1055904 | BMP dependent patterning of ectoderm tissue material properties modulates lateral mesendoderm cell migration during early zebrafish gastrulation | GSE251904 | Transcriptome Analysis | Cell migration is a fundamental process during embryonic development. Most studies in vivo have focussed on the migration of cells using the extracellular matrix ECM as their substrate for migration. In contrast much less is known about how cells migrate on other cells as found in early embryos when the ECM has not yet formed. Here we show that lateral mesendoderm LME cells in the early zebrafish gastrula use the ectoderm as their substrate for migration. We show that the lateral ectoderm is permissive for the animal pole directed migration of LME cells while the ectoderm at the animal pole halts it. These differences in the permissiveness depend on the lateral ectoderm being more cohesive than the animal ectoderm a property controlled by BMP signalling within the ectoderm. Collectively these findings identify ectoderm tissue cohesion as one critical factor regulating LME migration during zebrafish gastrulation. Overall design: To investigate the differences in gene expression between animal and lateral ectoderm causing the difference in material properties between the two ectodermal tissues. | pubmed:40057955 | Zebrafish Lateral Ectoderm 7.5 hpf 2 | GSM7989706 | source name:Lateral Ectoderm|tissue:Lateral Ectoderm|genotype:WT TgSebox::eGFP embryos|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS|geo loc name:missing|collection date:missing | Zebrafish Lateral Ectoderm 7.5 hpf 2 | FastQC quality control Trimmomatic adapter & quality trimming; parameters: 2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:19 FastQC controlling trimming results salmon Alignment; used flags: seqBias qcBias R DESeq2 differential gene expression analysis; DESEq2 apeglm tximport genefilter GenomicRanges R EnhancedVolcano & biomaRt visualization Assembly: Danio rerio GRCz11 Supplementary files format and content: tab delimited text file with gene name gene length effective length tpm and number of reads for each sample | Lateral Ectoderm | Embryo were injected with 125 pg of PAmCherry1 mRNA at xxx cell stage. At 6 hpf embryos were mounted for up right imaging and a 444 x 220 x 58.5 µm volume was photoactivated using a 405 nm laser either at the animal pole or on the lateral side. The photoactivation process was composed of 10 cycles of 28 sec per embryo in a time window of approximately 90 min. post photoactivation embryos were transferred in Ca2+ free Ringer solution and dissociated by gently pipetting using a P 1000 pipette to obtain a single cell suspension. 5000 PAmCherry1+ cells were sorted in 150 µl of RTL plus lysis buffer RNeasy Plus Micro Kit QIAGEN with 1% of 2 mercaptoethanol. | Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems. | Embryos were kept at 28.5 C until dissociation | tissue:Lateral Ectoderm|genotype:WT TgSebox::eGFP embryos|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS | GSM7989706 | GSM7989706: Zebrafish Lateral Ectoderm 7.5 hpf 2; Danio rerio; RNA Seq | GSM7989706 r1 | GSM7989706 | 1 | Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP479683 | Lateral_Ectoderm_2.mate1.fastq.gz Lateral_Ectoderm_2.mate2.fastq.gz | fastq fastq | 6372234032.0 | 27787436.0 | GSM7989706 r1 | 0:79.32 1:150 | A:1908123129;C:1195826989;G:1555786583;T:1706205499;N:6291832 | 79 | 150 | 1908123129 | 1195826989 | 1555786583 | 1706205499 | 6291832 | SRX23006267 | SRS19970078 | SRA1774740 | Heisenberg group, Institute of Science and Technology Austria (ISTA) | Heisenberg group, Institute of Science and Technology Austria (ISTA) | 2 | 0.52417 | 0.50653 | 0.02922 | 0.02493 | 0.89479 | 0.90938 | 0.74721 | 0.74563 | 68 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | Austria | 2023-12-22 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||
| 29205 | 29205 | SRR27329260 | SRX23006266 | SRS19970079 | SRP479683 | PRJNA1055904 | BMP dependent patterning of ectoderm tissue material properties modulates lateral mesendoderm cell migration during early zebrafish gastrulation | GSE251904 | Transcriptome Analysis | Cell migration is a fundamental process during embryonic development. Most studies in vivo have focussed on the migration of cells using the extracellular matrix ECM as their substrate for migration. In contrast much less is known about how cells migrate on other cells as found in early embryos when the ECM has not yet formed. Here we show that lateral mesendoderm LME cells in the early zebrafish gastrula use the ectoderm as their substrate for migration. We show that the lateral ectoderm is permissive for the animal pole directed migration of LME cells while the ectoderm at the animal pole halts it. These differences in the permissiveness depend on the lateral ectoderm being more cohesive than the animal ectoderm a property controlled by BMP signalling within the ectoderm. Collectively these findings identify ectoderm tissue cohesion as one critical factor regulating LME migration during zebrafish gastrulation. Overall design: To investigate the differences in gene expression between animal and lateral ectoderm causing the difference in material properties between the two ectodermal tissues. | pubmed:40057955 | Zebrafish Lateral Ectoderm 7.5 hpf 1 | GSM7989705 | source name:Lateral Ectoderm|tissue:Lateral Ectoderm|genotype:WT TgSebox::eGFP embryos|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS|geo loc name:missing|collection date:missing | Zebrafish Lateral Ectoderm 7.5 hpf 1 | FastQC quality control Trimmomatic adapter & quality trimming; parameters: 2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:19 FastQC controlling trimming results salmon Alignment; used flags: seqBias qcBias R DESeq2 differential gene expression analysis; DESEq2 apeglm tximport genefilter GenomicRanges R EnhancedVolcano & biomaRt visualization Assembly: Danio rerio GRCz11 Supplementary files format and content: tab delimited text file with gene name gene length effective length tpm and number of reads for each sample | Lateral Ectoderm | Embryo were injected with 125 pg of PAmCherry1 mRNA at xxx cell stage. At 6 hpf embryos were mounted for up right imaging and a 444 x 220 x 58.5 µm volume was photoactivated using a 405 nm laser either at the animal pole or on the lateral side. The photoactivation process was composed of 10 cycles of 28 sec per embryo in a time window of approximately 90 min. post photoactivation embryos were transferred in Ca2+ free Ringer solution and dissociated by gently pipetting using a P 1000 pipette to obtain a single cell suspension. 5000 PAmCherry1+ cells were sorted in 150 µl of RTL plus lysis buffer RNeasy Plus Micro Kit QIAGEN with 1% of 2 mercaptoethanol. | Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems. | Embryos were kept at 28.5 C until dissociation | tissue:Lateral Ectoderm|genotype:WT TgSebox::eGFP embryos|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS | GSM7989705 | GSM7989705: Zebrafish Lateral Ectoderm 7.5 hpf 1; Danio rerio; RNA Seq | GSM7989705 r1 | GSM7989705 | 1 | Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP479683 | Lateral_Ectoderm_1.mate2.fastq.gz Lateral_Ectoderm_1.mate1.fastq.gz | fastq fastq | 10106832046.0 | 43799441.0 | GSM7989705 r1 | 0:80.75 1:150 | A:3384386532;C:1698196797;G:2308026869;T:2706071735;N:10150113 | 80 | 150 | 3384386532 | 1698196797 | 2308026869 | 2706071735 | 10150113 | SRX23006266 | SRS19970079 | SRA1774740 | Heisenberg group, Institute of Science and Technology Austria (ISTA) | Heisenberg group, Institute of Science and Technology Austria (ISTA) | 2 | 0.64457 | 0.42542 | 0.04802 | 0.01964 | 0.91541 | 0.93878 | 0.83455 | 0.83564 | 68 | 150 | B | B | mate2-mate1 similar by mapping diff | illumina | novaseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | Austria | 2023-12-22 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||
| 29206 | 29206 | SRR27329261 | SRX23006265 | SRS19970077 | SRP479683 | PRJNA1055904 | BMP dependent patterning of ectoderm tissue material properties modulates lateral mesendoderm cell migration during early zebrafish gastrulation | GSE251904 | Transcriptome Analysis | Cell migration is a fundamental process during embryonic development. Most studies in vivo have focussed on the migration of cells using the extracellular matrix ECM as their substrate for migration. In contrast much less is known about how cells migrate on other cells as found in early embryos when the ECM has not yet formed. Here we show that lateral mesendoderm LME cells in the early zebrafish gastrula use the ectoderm as their substrate for migration. We show that the lateral ectoderm is permissive for the animal pole directed migration of LME cells while the ectoderm at the animal pole halts it. These differences in the permissiveness depend on the lateral ectoderm being more cohesive than the animal ectoderm a property controlled by BMP signalling within the ectoderm. Collectively these findings identify ectoderm tissue cohesion as one critical factor regulating LME migration during zebrafish gastrulation. Overall design: To investigate the differences in gene expression between animal and lateral ectoderm causing the difference in material properties between the two ectodermal tissues. | pubmed:40057955 | Zebrafish Animal Ectoderm 7.5 hpf 4 | GSM7989704 | source name:Animal Ectoderm|tissue:Animal Ectoderm|genotype:WT TgSebox::eGFP embryos|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS|geo loc name:missing|collection date:missing | Zebrafish Animal Ectoderm 7.5 hpf 4 | FastQC quality control Trimmomatic adapter & quality trimming; parameters: 2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:19 FastQC controlling trimming results salmon Alignment; used flags: seqBias qcBias R DESeq2 differential gene expression analysis; DESEq2 apeglm tximport genefilter GenomicRanges R EnhancedVolcano & biomaRt visualization Assembly: Danio rerio GRCz11 Supplementary files format and content: tab delimited text file with gene name gene length effective length tpm and number of reads for each sample | Animal Ectoderm | Embryo were injected with 125 pg of PAmCherry1 mRNA at xxx cell stage. At 6 hpf embryos were mounted for up right imaging and a 444 x 220 x 58.5 µm volume was photoactivated using a 405 nm laser either at the animal pole or on the lateral side. The photoactivation process was composed of 10 cycles of 28 sec per embryo in a time window of approximately 90 min. post photoactivation embryos were transferred in Ca2+ free Ringer solution and dissociated by gently pipetting using a P 1000 pipette to obtain a single cell suspension. 5000 PAmCherry1+ cells were sorted in 150 µl of RTL plus lysis buffer RNeasy Plus Micro Kit QIAGEN with 1% of 2 mercaptoethanol. | Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems. | Embryos were kept at 28.5 C until dissociation | tissue:Animal Ectoderm|genotype:WT TgSebox::eGFP embryos|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS | GSM7989704 | GSM7989704: Zebrafish Animal Ectoderm 7.5 hpf 4; Danio rerio; RNA Seq | GSM7989704 r1 | GSM7989704 | 1 | Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP479683 | Animal_Ectoderm_4.mate1.fastq.gz Animal_Ectoderm_4.mate2.fastq.gz | fastq fastq | 5882974802.0 | 25612144.0 | GSM7989704 r1 | 0:79.69 1:150.00 | A:1784390197;C:1112846767;G:1392719296;T:1587227818;N:5790724 | 79 | 150 | 1784390197 | 1112846767 | 1392719296 | 1587227818 | 5790724 | SRX23006265 | SRS19970077 | SRA1774740 | Heisenberg group, Institute of Science and Technology Austria (ISTA) | Heisenberg group, Institute of Science and Technology Austria (ISTA) | 2 | 0.72169 | 0.51947 | 0.04749 | 0.0244 | 0.89061 | 0.91007 | 0.76259 | 0.75355 | 90 | 150 | B | B | mate2-mate1 similar by mapping diff | illumina | novaseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | Austria | 2023-12-22 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||
| 29207 | 29207 | SRR27329262 | SRX23006264 | SRS19970076 | SRP479683 | PRJNA1055904 | BMP dependent patterning of ectoderm tissue material properties modulates lateral mesendoderm cell migration during early zebrafish gastrulation | GSE251904 | Transcriptome Analysis | Cell migration is a fundamental process during embryonic development. Most studies in vivo have focussed on the migration of cells using the extracellular matrix ECM as their substrate for migration. In contrast much less is known about how cells migrate on other cells as found in early embryos when the ECM has not yet formed. Here we show that lateral mesendoderm LME cells in the early zebrafish gastrula use the ectoderm as their substrate for migration. We show that the lateral ectoderm is permissive for the animal pole directed migration of LME cells while the ectoderm at the animal pole halts it. These differences in the permissiveness depend on the lateral ectoderm being more cohesive than the animal ectoderm a property controlled by BMP signalling within the ectoderm. Collectively these findings identify ectoderm tissue cohesion as one critical factor regulating LME migration during zebrafish gastrulation. Overall design: To investigate the differences in gene expression between animal and lateral ectoderm causing the difference in material properties between the two ectodermal tissues. | pubmed:40057955 | Zebrafish Animal Ectoderm 7.5 hpf 3 | GSM7989703 | source name:Animal Ectoderm|tissue:Animal Ectoderm|genotype:WT TgSebox::eGFP embryos|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS|geo loc name:missing|collection date:missing | Zebrafish Animal Ectoderm 7.5 hpf 3 | FastQC quality control Trimmomatic adapter & quality trimming; parameters: 2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:19 FastQC controlling trimming results salmon Alignment; used flags: seqBias qcBias R DESeq2 differential gene expression analysis; DESEq2 apeglm tximport genefilter GenomicRanges R EnhancedVolcano & biomaRt visualization Assembly: Danio rerio GRCz11 Supplementary files format and content: tab delimited text file with gene name gene length effective length tpm and number of reads for each sample | Animal Ectoderm | Embryo were injected with 125 pg of PAmCherry1 mRNA at xxx cell stage. At 6 hpf embryos were mounted for up right imaging and a 444 x 220 x 58.5 µm volume was photoactivated using a 405 nm laser either at the animal pole or on the lateral side. The photoactivation process was composed of 10 cycles of 28 sec per embryo in a time window of approximately 90 min. post photoactivation embryos were transferred in Ca2+ free Ringer solution and dissociated by gently pipetting using a P 1000 pipette to obtain a single cell suspension. 5000 PAmCherry1+ cells were sorted in 150 µl of RTL plus lysis buffer RNeasy Plus Micro Kit QIAGEN with 1% of 2 mercaptoethanol. | Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems. | Embryos were kept at 28.5 C until dissociation | tissue:Animal Ectoderm|genotype:WT TgSebox::eGFP embryos|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS | GSM7989703 | GSM7989703: Zebrafish Animal Ectoderm 7.5 hpf 3; Danio rerio; RNA Seq | GSM7989703 r1 | GSM7989703 | 1 | Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP479683 | Animal_Ectoderm_3.mate1.fastq.gz Animal_Ectoderm_3.mate2.fastq.gz | fastq fastq | 6802628678.0 | 29741168.0 | GSM7989703 r1 | 0:78.73 1:150 | A:1935418861;C:1362666541;G:1651315180;T:1846520380;N:6707716 | 78 | 150 | 1935418861 | 1362666541 | 1651315180 | 1846520380 | 6707716 | SRX23006264 | SRS19970076 | SRA1774740 | Heisenberg group, Institute of Science and Technology Austria (ISTA) | Heisenberg group, Institute of Science and Technology Austria (ISTA) | 2 | 0.74265 | 0.48713 | 0.04983 | 0.02636 | 0.87771 | 0.90335 | 0.72388 | 0.71557 | 68 | 150 | B | B | mate2-mate1 similar by mapping diff | illumina | novaseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | Austria | 2023-12-22 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||
| 29208 | 29208 | SRR27329263 | SRX23006263 | SRS19970075 | SRP479683 | PRJNA1055904 | BMP dependent patterning of ectoderm tissue material properties modulates lateral mesendoderm cell migration during early zebrafish gastrulation | GSE251904 | Transcriptome Analysis | Cell migration is a fundamental process during embryonic development. Most studies in vivo have focussed on the migration of cells using the extracellular matrix ECM as their substrate for migration. In contrast much less is known about how cells migrate on other cells as found in early embryos when the ECM has not yet formed. Here we show that lateral mesendoderm LME cells in the early zebrafish gastrula use the ectoderm as their substrate for migration. We show that the lateral ectoderm is permissive for the animal pole directed migration of LME cells while the ectoderm at the animal pole halts it. These differences in the permissiveness depend on the lateral ectoderm being more cohesive than the animal ectoderm a property controlled by BMP signalling within the ectoderm. Collectively these findings identify ectoderm tissue cohesion as one critical factor regulating LME migration during zebrafish gastrulation. Overall design: To investigate the differences in gene expression between animal and lateral ectoderm causing the difference in material properties between the two ectodermal tissues. | pubmed:40057955 | Zebrafish Animal Ectoderm 7.5 hpf 2 | GSM7989702 | source name:Animal Ectoderm|tissue:Animal Ectoderm|genotype:WT TgSebox::eGFP embryos|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS|geo loc name:missing|collection date:missing | Zebrafish Animal Ectoderm 7.5 hpf 2 | FastQC quality control Trimmomatic adapter & quality trimming; parameters: 2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:19 FastQC controlling trimming results salmon Alignment; used flags: seqBias qcBias R DESeq2 differential gene expression analysis; DESEq2 apeglm tximport genefilter GenomicRanges R EnhancedVolcano & biomaRt visualization Assembly: Danio rerio GRCz11 Supplementary files format and content: tab delimited text file with gene name gene length effective length tpm and number of reads for each sample | Animal Ectoderm | Embryo were injected with 125 pg of PAmCherry1 mRNA at xxx cell stage. At 6 hpf embryos were mounted for up right imaging and a 444 x 220 x 58.5 µm volume was photoactivated using a 405 nm laser either at the animal pole or on the lateral side. The photoactivation process was composed of 10 cycles of 28 sec per embryo in a time window of approximately 90 min. post photoactivation embryos were transferred in Ca2+ free Ringer solution and dissociated by gently pipetting using a P 1000 pipette to obtain a single cell suspension. 5000 PAmCherry1+ cells were sorted in 150 µl of RTL plus lysis buffer RNeasy Plus Micro Kit QIAGEN with 1% of 2 mercaptoethanol. | Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems. | Embryos were kept at 28.5 C until dissociation | tissue:Animal Ectoderm|genotype:WT TgSebox::eGFP embryos|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS | GSM7989702 | GSM7989702: Zebrafish Animal Ectoderm 7.5 hpf 2; Danio rerio; RNA Seq | GSM7989702 r1 | GSM7989702 | 1 | Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP479683 | Animal_Ectoderm_2.mate1.fastq.gz Animal_Ectoderm_2.mate2.fastq.gz | fastq fastq | 6083410864.0 | 26183986.0 | GSM7989702 r1 | 0:82.33 1:150 | A:1976903262;C:1110974120;G:1376486325;T:1613990197;N:5056960 | 82 | 150 | 1976903262 | 1110974120 | 1376486325 | 1613990197 | 5056960 | SRX23006263 | SRS19970075 | SRA1774740 | Heisenberg group, Institute of Science and Technology Austria (ISTA) | Heisenberg group, Institute of Science and Technology Austria (ISTA) | 2 | 0.73078 | 0.55778 | 0.04052 | 0.02684 | 0.89509 | 0.91106 | 0.77391 | 0.7649 | 68 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | Austria | 2023-12-22 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||
| 29209 | 29209 | SRR27329264 | SRX23006262 | SRS19970074 | SRP479683 | PRJNA1055904 | BMP dependent patterning of ectoderm tissue material properties modulates lateral mesendoderm cell migration during early zebrafish gastrulation | GSE251904 | Transcriptome Analysis | Cell migration is a fundamental process during embryonic development. Most studies in vivo have focussed on the migration of cells using the extracellular matrix ECM as their substrate for migration. In contrast much less is known about how cells migrate on other cells as found in early embryos when the ECM has not yet formed. Here we show that lateral mesendoderm LME cells in the early zebrafish gastrula use the ectoderm as their substrate for migration. We show that the lateral ectoderm is permissive for the animal pole directed migration of LME cells while the ectoderm at the animal pole halts it. These differences in the permissiveness depend on the lateral ectoderm being more cohesive than the animal ectoderm a property controlled by BMP signalling within the ectoderm. Collectively these findings identify ectoderm tissue cohesion as one critical factor regulating LME migration during zebrafish gastrulation. Overall design: To investigate the differences in gene expression between animal and lateral ectoderm causing the difference in material properties between the two ectodermal tissues. | pubmed:40057955 | Zebrafish Animal Ectoderm 7.5 hpf 1 | GSM7989701 | source name:Animal Ectoderm|tissue:Animal Ectoderm|genotype:WT TgSebox::eGFP embryos|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS|geo loc name:missing|collection date:missing | Zebrafish Animal Ectoderm 7.5 hpf 1 | FastQC quality control Trimmomatic adapter & quality trimming; parameters: 2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:19 FastQC controlling trimming results salmon Alignment; used flags: seqBias qcBias R DESeq2 differential gene expression analysis; DESEq2 apeglm tximport genefilter GenomicRanges R EnhancedVolcano & biomaRt visualization Assembly: Danio rerio GRCz11 Supplementary files format and content: tab delimited text file with gene name gene length effective length tpm and number of reads for each sample | Animal Ectoderm | Embryo were injected with 125 pg of PAmCherry1 mRNA at xxx cell stage. At 6 hpf embryos were mounted for up right imaging and a 444 x 220 x 58.5 µm volume was photoactivated using a 405 nm laser either at the animal pole or on the lateral side. The photoactivation process was composed of 10 cycles of 28 sec per embryo in a time window of approximately 90 min. post photoactivation embryos were transferred in Ca2+ free Ringer solution and dissociated by gently pipetting using a P 1000 pipette to obtain a single cell suspension. 5000 PAmCherry1+ cells were sorted in 150 µl of RTL plus lysis buffer RNeasy Plus Micro Kit QIAGEN with 1% of 2 mercaptoethanol. | Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems. | Embryos were kept at 28.5 C until dissociation | tissue:Animal Ectoderm|genotype:WT TgSebox::eGFP embryos|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS | GSM7989701 | GSM7989701: Zebrafish Animal Ectoderm 7.5 hpf 1; Danio rerio; RNA Seq | GSM7989701 r1 | GSM7989701 | 1 | Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP479683 | Animal_Ectoderm_1.mate1.fastq.gz Animal_Ectoderm_1.mate2.fastq.gz | fastq fastq | 7195859200.0 | 31306406.0 | GSM7989701 r1 | 0:79.85 1:150 | A:2025250331;C:1450062111;G:1771726396;T:1941745747;N:7074615 | 79 | 150 | 2025250331 | 1450062111 | 1771726396 | 1941745747 | 7074615 | SRX23006262 | SRS19970074 | SRA1774740 | Heisenberg group, Institute of Science and Technology Austria (ISTA) | Heisenberg group, Institute of Science and Technology Austria (ISTA) | 2 | 0.74201 | 0.52197 | 0.04312 | 0.02595 | 0.87941 | 0.9013 | 0.74298 | 0.71509 | 68 | 150 | B | B | mate2-mate1 similar by mapping diff | illumina | novaseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | Austria | 2023-12-22 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||
| 31773 | 31773 | SRR28590145 | SRX24189497 | SRS20963520 | SRP500320 | PRJNA1097627 | GPI transamidase complex is required for primordial germ cell migration and development in zebrafish | GSE263481 | Transcriptome Analysis | Proteins without xxx domains could be anchored to the cell surface for regulating various biological processes when covalently linked to glycosylphosphatidylinositol GPI molecules by the GPI transamidase GPIT complex. However it remains poorly understood whether and how the GPIT complex affects primordial germ cell PGC development. In this study we report the important roles of GPI transamidase in PGC migration and development in zebrafish embryos. Mutation of pigu or pigk both encoding essential GPIT complex subunits resulted in defective PGC migration with ectopically located PGCs and reduction of PGC counts. Notably a detailed analysis of filopodia in PGCs reveals the attenuated polarity of filopodia distribution along the migration direction in mutant embryos. PGC transplantation and PGC specific rescue experiments demonstrate that both PGC and somatic cell expressed Pigu are required for PGC migration. Furthermore expression levels of PGC specific genes are decreased in pigu mutant PGCs with the derepression of somatic cell genes. Hence we propose that the GPIT complex plays a critical role during PGC migration and development. Overall design: To reveal molecular mechanisms underlying GPI transamidase mediated PGC migration regulation we performed RNA seq of PGCs in wild type and pigu / embryos at the shield and bud stages. We manually picked GFP positive PGCs post cell dissociation of embryos at the shield and bud stages. Then post genotyping of rest somatic cells PGCs with the same genotypes were pooled together and lysed for Smart seq of two biological replicates. | pubmed:39741393 | WT shield PGCs RNA rep2 | GSM8193374 | source name:embryo|tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:Wile type|geo loc name:missing|collection date:missing | WT shield PGCs RNA rep2 | RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer11 by STAR version: STAR 2.5.3a modified. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1. Assembly: danRer11 Supplementary files format and content: tab delimited ext file includes FPKM values for each samples | embryo | GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 214 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. | Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer’s instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification. | The wild type Tuebingen Tu and India strains were used throughout the experiments. The transgenic line Tgkop:EGFP nanos 3’UTR citation was described before. Unless stated all embryos were raised in Holtfreter’s solution at 28.5°C and staged as described previously. | tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:Wile type | GSM8193374 | GSM8193374: WT shield PGCs RNA rep2; Danio rerio; RNA Seq | GSM8193374 r1 | GSM8193374 | 1 | Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer's instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP500320 | WT_shield_PGCs_RNA_rep2_r1.fq.gz WT_shield_PGCs_RNA_rep2_r2.fq.gz | fastq fastq | 1476298800.0 | 4920996.0 | GSM8193374 r1 | 0:150 1:150 | A:364072227;C:345274481;G:387289011;T:379660776;N:2305 | 150 | 150 | 364072227 | 345274481 | 387289011 | 379660776 | 2305 | SRX24189497 | SRS20963520 | SRA1842063 | Tsinghua University | Tsinghua University | 2 | 0.9277 | 0.92845 | 0.26727 | 0.2672 | 0.86803 | 0.86969 | 0.75933 | 0.75985 | 150 | 150 | B | B | biological fallback assumption | illumina | nextseq | unknown | poly_a | unknown | sc | single_cell_plate | smartseq | China | 2024-04-08 | Multi-stage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||
| 31774 | 31774 | SRR28590146 | SRX24189496 | SRS20963519 | SRP500320 | PRJNA1097627 | GPI transamidase complex is required for primordial germ cell migration and development in zebrafish | GSE263481 | Transcriptome Analysis | Proteins without xxx domains could be anchored to the cell surface for regulating various biological processes when covalently linked to glycosylphosphatidylinositol GPI molecules by the GPI transamidase GPIT complex. However it remains poorly understood whether and how the GPIT complex affects primordial germ cell PGC development. In this study we report the important roles of GPI transamidase in PGC migration and development in zebrafish embryos. Mutation of pigu or pigk both encoding essential GPIT complex subunits resulted in defective PGC migration with ectopically located PGCs and reduction of PGC counts. Notably a detailed analysis of filopodia in PGCs reveals the attenuated polarity of filopodia distribution along the migration direction in mutant embryos. PGC transplantation and PGC specific rescue experiments demonstrate that both PGC and somatic cell expressed Pigu are required for PGC migration. Furthermore expression levels of PGC specific genes are decreased in pigu mutant PGCs with the derepression of somatic cell genes. Hence we propose that the GPIT complex plays a critical role during PGC migration and development. Overall design: To reveal molecular mechanisms underlying GPI transamidase mediated PGC migration regulation we performed RNA seq of PGCs in wild type and pigu / embryos at the shield and bud stages. We manually picked GFP positive PGCs post cell dissociation of embryos at the shield and bud stages. Then post genotyping of rest somatic cells PGCs with the same genotypes were pooled together and lysed for Smart seq of two biological replicates. | pubmed:39741393 | WT shield PGCs RNA rep1 | GSM8193373 | source name:embryo|tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:Wile type|geo loc name:missing|collection date:missing | WT shield PGCs RNA rep1 | RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer11 by STAR version: STAR 2.5.3a modified. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1. Assembly: danRer11 Supplementary files format and content: tab delimited ext file includes FPKM values for each samples | embryo | GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 212 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. | Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer’s instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification. | The wild type Tuebingen Tu and India strains were used throughout the experiments. The transgenic line Tgkop:EGFP nanos 3’UTR citation was described before. Unless stated all embryos were raised in Holtfreter’s solution at 28.5°C and staged as described previously. | tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:Wile type | GSM8193373 | GSM8193373: WT shield PGCs RNA rep1; Danio rerio; RNA Seq | GSM8193373 r1 | GSM8193373 | 1 | Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer's instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP500320 | WT_shield_PGCs_RNA_rep1_r2.fq.gz WT_shield_PGCs_RNA_rep1_r1.fq.gz | fastq fastq | 2758778100.0 | 9195927.0 | GSM8193373 r1 | 0:150 1:150 | A:769058521;C:582931819;G:614181069;T:792602904;N:3787 | 150 | 150 | 769058521 | 582931819 | 614181069 | 792602904 | 3787 | SRX24189496 | SRS20963519 | SRA1842063 | Tsinghua University | Tsinghua University | 2 | 0.93691 | 0.91581 | 0.06844 | 0.06665 | 0.7683 | 0.76995 | 0.53645 | 0.52363 | 150 | 150 | B | B | biological fallback assumption | illumina | nextseq | unknown | poly_a | unknown | sc | single_cell_plate | smartseq | China | 2024-04-08 | Multi-stage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||
| 31775 | 31775 | SRR28590147 | SRX24189495 | SRS20963518 | SRP500320 | PRJNA1097627 | GPI transamidase complex is required for primordial germ cell migration and development in zebrafish | GSE263481 | Transcriptome Analysis | Proteins without xxx domains could be anchored to the cell surface for regulating various biological processes when covalently linked to glycosylphosphatidylinositol GPI molecules by the GPI transamidase GPIT complex. However it remains poorly understood whether and how the GPIT complex affects primordial germ cell PGC development. In this study we report the important roles of GPI transamidase in PGC migration and development in zebrafish embryos. Mutation of pigu or pigk both encoding essential GPIT complex subunits resulted in defective PGC migration with ectopically located PGCs and reduction of PGC counts. Notably a detailed analysis of filopodia in PGCs reveals the attenuated polarity of filopodia distribution along the migration direction in mutant embryos. PGC transplantation and PGC specific rescue experiments demonstrate that both PGC and somatic cell expressed Pigu are required for PGC migration. Furthermore expression levels of PGC specific genes are decreased in pigu mutant PGCs with the derepression of somatic cell genes. Hence we propose that the GPIT complex plays a critical role during PGC migration and development. Overall design: To reveal molecular mechanisms underlying GPI transamidase mediated PGC migration regulation we performed RNA seq of PGCs in wild type and pigu / embryos at the shield and bud stages. We manually picked GFP positive PGCs post cell dissociation of embryos at the shield and bud stages. Then post genotyping of rest somatic cells PGCs with the same genotypes were pooled together and lysed for Smart seq of two biological replicates. | pubmed:39741393 | WT bud PGCs RNA rep2 | GSM8193372 | source name:embryo|tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:Wile type|geo loc name:missing|collection date:missing | WT bud PGCs RNA rep2 | RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer11 by STAR version: STAR 2.5.3a modified. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1. Assembly: danRer11 Supplementary files format and content: tab delimited ext file includes FPKM values for each samples | embryo | GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 210 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. | Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer’s instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification. | The wild type Tuebingen Tu and India strains were used throughout the experiments. The transgenic line Tgkop:EGFP nanos 3’UTR citation was described before. Unless stated all embryos were raised in Holtfreter’s solution at 28.5°C and staged as described previously. | tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:Wile type | GSM8193372 | GSM8193372: WT bud PGCs RNA rep2; Danio rerio; RNA Seq | GSM8193372 r1 | GSM8193372 | 1 | Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer's instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP500320 | WT_bud_PGCs_RNA_rep2_r1.fq.gz WT_bud_PGCs_RNA_rep2_r2.fq.gz | fastq fastq | 3111261300.0 | 10370871.0 | GSM8193372 r1 | 0:150 1:150 | A:817262319;C:691724200;G:751270343;T:850999265;N:5173 | 150 | 150 | 817262319 | 691724200 | 751270343 | 850999265 | 5173 | SRX24189495 | SRS20963518 | SRA1842063 | Tsinghua University | Tsinghua University | 2 | 0.90729 | 0.9053 | 0.11596 | 0.1166 | 0.79963 | 0.79981 | 0.60276 | 0.59912 | 150 | 150 | B | B | biological fallback assumption | illumina | nextseq | unknown | poly_a | unknown | sc | single_cell_plate | smartseq | China | 2024-04-08 | Multi-stage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||
| 31776 | 31776 | SRR28590148 | SRX24189494 | SRS20963517 | SRP500320 | PRJNA1097627 | GPI transamidase complex is required for primordial germ cell migration and development in zebrafish | GSE263481 | Transcriptome Analysis | Proteins without xxx domains could be anchored to the cell surface for regulating various biological processes when covalently linked to glycosylphosphatidylinositol GPI molecules by the GPI transamidase GPIT complex. However it remains poorly understood whether and how the GPIT complex affects primordial germ cell PGC development. In this study we report the important roles of GPI transamidase in PGC migration and development in zebrafish embryos. Mutation of pigu or pigk both encoding essential GPIT complex subunits resulted in defective PGC migration with ectopically located PGCs and reduction of PGC counts. Notably a detailed analysis of filopodia in PGCs reveals the attenuated polarity of filopodia distribution along the migration direction in mutant embryos. PGC transplantation and PGC specific rescue experiments demonstrate that both PGC and somatic cell expressed Pigu are required for PGC migration. Furthermore expression levels of PGC specific genes are decreased in pigu mutant PGCs with the derepression of somatic cell genes. Hence we propose that the GPIT complex plays a critical role during PGC migration and development. Overall design: To reveal molecular mechanisms underlying GPI transamidase mediated PGC migration regulation we performed RNA seq of PGCs in wild type and pigu / embryos at the shield and bud stages. We manually picked GFP positive PGCs post cell dissociation of embryos at the shield and bud stages. Then post genotyping of rest somatic cells PGCs with the same genotypes were pooled together and lysed for Smart seq of two biological replicates. | pubmed:39741393 | WT bud PGCs RNA rep1 | GSM8193371 | source name:embryo|tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:Wile type|geo loc name:missing|collection date:missing | WT bud PGCs RNA rep1 | RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer11 by STAR version: STAR 2.5.3a modified. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1. Assembly: danRer11 Supplementary files format and content: tab delimited ext file includes FPKM values for each samples | embryo | GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 208 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. | Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer’s instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification. | The wild type Tuebingen Tu and India strains were used throughout the experiments. The transgenic line Tgkop:EGFP nanos 3’UTR citation was described before. Unless stated all embryos were raised in Holtfreter’s solution at 28.5°C and staged as described previously. | tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:Wile type | GSM8193371 | GSM8193371: WT bud PGCs RNA rep1; Danio rerio; RNA Seq | GSM8193371 r1 | GSM8193371 | 1 | Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer's instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP500320 | WT_bud_PGCs_RNA_rep1_r1.fq.gz WT_bud_PGCs_RNA_rep1_r2.fq.gz | fastq fastq | 3758269200.0 | 12527564.0 | GSM8193371 r1 | 0:150 1:150 | A:1041649283;C:801966468;G:845188264;T:1069459832;N:5353 | 150 | 150 | 1041649283 | 801966468 | 845188264 | 1069459832 | 5353 | SRX24189494 | SRS20963517 | SRA1842063 | Tsinghua University | Tsinghua University | 2 | 0.93714 | 0.91161 | 0.07974 | 0.07673 | 0.75785 | 0.76037 | 0.52906 | 0.52822 | 150 | 150 | B | B | biological fallback assumption | illumina | nextseq | unknown | poly_a | unknown | sc | single_cell_plate | smartseq | China | 2024-04-08 | Multi-stage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||
| 31777 | 31777 | SRR28590149 | SRX24189493 | SRS20963516 | SRP500320 | PRJNA1097627 | GPI transamidase complex is required for primordial germ cell migration and development in zebrafish | GSE263481 | Transcriptome Analysis | Proteins without xxx domains could be anchored to the cell surface for regulating various biological processes when covalently linked to glycosylphosphatidylinositol GPI molecules by the GPI transamidase GPIT complex. However it remains poorly understood whether and how the GPIT complex affects primordial germ cell PGC development. In this study we report the important roles of GPI transamidase in PGC migration and development in zebrafish embryos. Mutation of pigu or pigk both encoding essential GPIT complex subunits resulted in defective PGC migration with ectopically located PGCs and reduction of PGC counts. Notably a detailed analysis of filopodia in PGCs reveals the attenuated polarity of filopodia distribution along the migration direction in mutant embryos. PGC transplantation and PGC specific rescue experiments demonstrate that both PGC and somatic cell expressed Pigu are required for PGC migration. Furthermore expression levels of PGC specific genes are decreased in pigu mutant PGCs with the derepression of somatic cell genes. Hence we propose that the GPIT complex plays a critical role during PGC migration and development. Overall design: To reveal molecular mechanisms underlying GPI transamidase mediated PGC migration regulation we performed RNA seq of PGCs in wild type and pigu / embryos at the shield and bud stages. We manually picked GFP positive PGCs post cell dissociation of embryos at the shield and bud stages. Then post genotyping of rest somatic cells PGCs with the same genotypes were pooled together and lysed for Smart seq of two biological replicates. | pubmed:39741393 | pigu homo shield PGCs RNA rep2 | GSM8193370 | source name:embryo|tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:pigu homo|geo loc name:missing|collection date:missing | pigu homo shield PGCs RNA rep2 | RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer11 by STAR version: STAR 2.5.3a modified. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1. Assembly: danRer11 Supplementary files format and content: tab delimited ext file includes FPKM values for each samples | embryo | GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 206 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. | Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer’s instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification. | The wild type Tuebingen Tu and India strains were used throughout the experiments. The transgenic line Tgkop:EGFP nanos 3’UTR citation was described before. Unless stated all embryos were raised in Holtfreter’s solution at 28.5°C and staged as described previously. | tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:pigu homo | GSM8193370 | GSM8193370: pigu homo shield PGCs RNA rep2; Danio rerio; RNA Seq | GSM8193370 r1 | GSM8193370 | 1 | Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer's instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP500320 | pigu_homo_shield_PGCs_RNA_rep2_r2.fq.gz pigu_homo_shield_PGCs_RNA_rep2_r1.fq.gz | fastq fastq | 875630700.0 | 2918769.0 | GSM8193370 r1 | 0:150 1:150 | A:229625544;C:190227589;G:217096984;T:238679075;N:1508 | 150 | 150 | 229625544 | 190227589 | 217096984 | 238679075 | 1508 | SRX24189493 | SRS20963516 | SRA1842063 | Tsinghua University | Tsinghua University | 2 | 0.81852 | 0.81643 | 0.19346 | 0.19329 | 0.89852 | 0.89897 | 0.83525 | 0.83082 | 150 | 150 | B | B | biological fallback assumption | illumina | nextseq | unknown | poly_a | unknown | sc | single_cell_plate | smartseq | China | 2024-04-08 | Multi-stage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||
| 31778 | 31778 | SRR28590150 | SRX24189492 | SRS20963515 | SRP500320 | PRJNA1097627 | GPI transamidase complex is required for primordial germ cell migration and development in zebrafish | GSE263481 | Transcriptome Analysis | Proteins without xxx domains could be anchored to the cell surface for regulating various biological processes when covalently linked to glycosylphosphatidylinositol GPI molecules by the GPI transamidase GPIT complex. However it remains poorly understood whether and how the GPIT complex affects primordial germ cell PGC development. In this study we report the important roles of GPI transamidase in PGC migration and development in zebrafish embryos. Mutation of pigu or pigk both encoding essential GPIT complex subunits resulted in defective PGC migration with ectopically located PGCs and reduction of PGC counts. Notably a detailed analysis of filopodia in PGCs reveals the attenuated polarity of filopodia distribution along the migration direction in mutant embryos. PGC transplantation and PGC specific rescue experiments demonstrate that both PGC and somatic cell expressed Pigu are required for PGC migration. Furthermore expression levels of PGC specific genes are decreased in pigu mutant PGCs with the derepression of somatic cell genes. Hence we propose that the GPIT complex plays a critical role during PGC migration and development. Overall design: To reveal molecular mechanisms underlying GPI transamidase mediated PGC migration regulation we performed RNA seq of PGCs in wild type and pigu / embryos at the shield and bud stages. We manually picked GFP positive PGCs post cell dissociation of embryos at the shield and bud stages. Then post genotyping of rest somatic cells PGCs with the same genotypes were pooled together and lysed for Smart seq of two biological replicates. | pubmed:39741393 | pigu homo shield PGCs RNA rep1 | GSM8193369 | source name:embryo|tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:pigu homo|geo loc name:missing|collection date:missing | pigu homo shield PGCs RNA rep1 | RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer11 by STAR version: STAR 2.5.3a modified. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1. Assembly: danRer11 Supplementary files format and content: tab delimited ext file includes FPKM values for each samples | embryo | GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 204 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. | Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer’s instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification. | The wild type Tuebingen Tu and India strains were used throughout the experiments. The transgenic line Tgkop:EGFP nanos 3’UTR citation was described before. Unless stated all embryos were raised in Holtfreter’s solution at 28.5°C and staged as described previously. | tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:pigu homo | GSM8193369 | GSM8193369: pigu homo shield PGCs RNA rep1; Danio rerio; RNA Seq | GSM8193369 r1 | GSM8193369 | 1 | Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer's instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP500320 | pigu_homo_shield_PGCs_RNA_rep1_r2.fq.gz pigu_homo_shield_PGCs_RNA_rep1_r1.fq.gz | fastq fastq | 2204383800.0 | 7347946.0 | GSM8193369 r1 | 0:150 1:150 | A:618947181;C:459789570;G:491705141;T:633938869;N:3039 | 150 | 150 | 618947181 | 459789570 | 491705141 | 633938869 | 3039 | SRX24189492 | SRS20963515 | SRA1842063 | Tsinghua University | Tsinghua University | 2 | 0.91971 | 0.9203 | 0.0732 | 0.07256 | 0.77512 | 0.77516 | 0.53347 | 0.53419 | 150 | 150 | B | B | biological fallback assumption | illumina | nextseq | unknown | poly_a | unknown | sc | single_cell_plate | smartseq | China | 2024-04-08 | Multi-stage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||
| 31779 | 31779 | SRR28590151 | SRX24189491 | SRS20963514 | SRP500320 | PRJNA1097627 | GPI transamidase complex is required for primordial germ cell migration and development in zebrafish | GSE263481 | Transcriptome Analysis | Proteins without xxx domains could be anchored to the cell surface for regulating various biological processes when covalently linked to glycosylphosphatidylinositol GPI molecules by the GPI transamidase GPIT complex. However it remains poorly understood whether and how the GPIT complex affects primordial germ cell PGC development. In this study we report the important roles of GPI transamidase in PGC migration and development in zebrafish embryos. Mutation of pigu or pigk both encoding essential GPIT complex subunits resulted in defective PGC migration with ectopically located PGCs and reduction of PGC counts. Notably a detailed analysis of filopodia in PGCs reveals the attenuated polarity of filopodia distribution along the migration direction in mutant embryos. PGC transplantation and PGC specific rescue experiments demonstrate that both PGC and somatic cell expressed Pigu are required for PGC migration. Furthermore expression levels of PGC specific genes are decreased in pigu mutant PGCs with the derepression of somatic cell genes. Hence we propose that the GPIT complex plays a critical role during PGC migration and development. Overall design: To reveal molecular mechanisms underlying GPI transamidase mediated PGC migration regulation we performed RNA seq of PGCs in wild type and pigu / embryos at the shield and bud stages. We manually picked GFP positive PGCs post cell dissociation of embryos at the shield and bud stages. Then post genotyping of rest somatic cells PGCs with the same genotypes were pooled together and lysed for Smart seq of two biological replicates. | pubmed:39741393 | pigu homo bud PGCs RNA rep2 | GSM8193368 | source name:embryo|tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:pigu homo|geo loc name:missing|collection date:missing | pigu homo bud PGCs RNA rep2 | RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer11 by STAR version: STAR 2.5.3a modified. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1. Assembly: danRer11 Supplementary files format and content: tab delimited ext file includes FPKM values for each samples | embryo | GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 202 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. | Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer’s instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification. | The wild type Tuebingen Tu and India strains were used throughout the experiments. The transgenic line Tgkop:EGFP nanos 3’UTR citation was described before. Unless stated all embryos were raised in Holtfreter’s solution at 28.5°C and staged as described previously. | tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:pigu homo | GSM8193368 | GSM8193368: pigu homo bud PGCs RNA rep2; Danio rerio; RNA Seq | GSM8193368 r1 | GSM8193368 | 1 | Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer's instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP500320 | pigu_homo_bud_PGCs_RNA_rep2_r1.fq.gz pigu_homo_bud_PGCs_RNA_rep2_r2.fq.gz | fastq fastq | 2137638000.0 | 7125460.0 | GSM8193368 r1 | 0:150 1:150 | A:588045273;C:460739300;G:496293927;T:592556088;N:3412 | 150 | 150 | 588045273 | 460739300 | 496293927 | 592556088 | 3412 | SRX24189491 | SRS20963514 | SRA1842063 | Tsinghua University | Tsinghua University | 2 | 0.36533 | 0.36278 | 0.05703 | 0.057 | 0.87754 | 0.87811 | 0.60206 | 0.59677 | 150 | 150 | B | B | biological fallback assumption | illumina | nextseq | unknown | poly_a | unknown | sc | single_cell_plate | smartseq | China | 2024-04-08 | Multi-stage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||
| 31780 | 31780 | SRR28590152 | SRX24189490 | SRS20963513 | SRP500320 | PRJNA1097627 | GPI transamidase complex is required for primordial germ cell migration and development in zebrafish | GSE263481 | Transcriptome Analysis | Proteins without xxx domains could be anchored to the cell surface for regulating various biological processes when covalently linked to glycosylphosphatidylinositol GPI molecules by the GPI transamidase GPIT complex. However it remains poorly understood whether and how the GPIT complex affects primordial germ cell PGC development. In this study we report the important roles of GPI transamidase in PGC migration and development in zebrafish embryos. Mutation of pigu or pigk both encoding essential GPIT complex subunits resulted in defective PGC migration with ectopically located PGCs and reduction of PGC counts. Notably a detailed analysis of filopodia in PGCs reveals the attenuated polarity of filopodia distribution along the migration direction in mutant embryos. PGC transplantation and PGC specific rescue experiments demonstrate that both PGC and somatic cell expressed Pigu are required for PGC migration. Furthermore expression levels of PGC specific genes are decreased in pigu mutant PGCs with the derepression of somatic cell genes. Hence we propose that the GPIT complex plays a critical role during PGC migration and development. Overall design: To reveal molecular mechanisms underlying GPI transamidase mediated PGC migration regulation we performed RNA seq of PGCs in wild type and pigu / embryos at the shield and bud stages. We manually picked GFP positive PGCs post cell dissociation of embryos at the shield and bud stages. Then post genotyping of rest somatic cells PGCs with the same genotypes were pooled together and lysed for Smart seq of two biological replicates. | pubmed:39741393 | pigu homo bud PGCs RNA rep1 | GSM8193367 | source name:embryo|tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:pigu homo|geo loc name:missing|collection date:missing | pigu homo bud PGCs RNA rep1 | RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer11 by STAR version: STAR 2.5.3a modified. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1. Assembly: danRer11 Supplementary files format and content: tab delimited ext file includes FPKM values for each samples | embryo | GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. | Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer’s instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification. | The wild type Tuebingen Tu and India strains were used throughout the experiments. The transgenic line Tgkop:EGFP nanos 3’UTR citation was described before. Unless stated all embryos were raised in Holtfreter’s solution at 28.5°C and staged as described previously. | tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:pigu homo | GSM8193367 | GSM8193367: pigu homo bud PGCs RNA rep1; Danio rerio; RNA Seq | GSM8193367 r1 | GSM8193367 | 1 | Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer's instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP500320 | pigu_homo_bud_PGCs_RNA_rep1_r1.fq.gz pigu_homo_bud_PGCs_RNA_rep1_r2.fq.gz | fastq fastq | 2734187100.0 | 9113957.0 | GSM8193367 r1 | 0:150 1:150 | A:729072634;C:614811431;G:644751435;T:745548063;N:3537 | 150 | 150 | 729072634 | 614811431 | 644751435 | 745548063 | 3537 | SRX24189490 | SRS20963513 | SRA1842063 | Tsinghua University | Tsinghua University | 2 | 0.94018 | 0.93763 | 0.11685 | 0.1143 | 0.77749 | 0.78204 | 0.50988 | 0.50832 | 150 | 150 | B | B | biological fallback assumption | illumina | nextseq | unknown | poly_a | unknown | sc | single_cell_plate | smartseq | China | 2024-04-08 | Multi-stage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||
| 35474 | 35474 | SRR32818793 | SRX28102226 | SRS24458273 | SRP572438 | PRJNA1240805 | Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset | GSE292682 | Transcriptome Analysis | Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset. | pubmed:40145570 | sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 4 | GSM8863184 | source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf|geo loc name:missing|collection date:missing | sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 4 | Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples | FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos | 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate. | tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf | GSM8863184 | GSM8863184: sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 4; Danio rerio; RNA Seq | GSM8863184 r1 | GSM8863184 | 1 | 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP572438 | p48-4-READ1-Sequences.txt p48-4-READ2-Sequences.txt | fastq fastq | 6624217400.0 | 33121087.0 | GSM8863184 r1 | 0:100 1:100 | A:1723006485;C:1604147349;G:1556891221;T:1739763662;N:408683 | 100 | 100 | 1723006485 | 1604147349 | 1556891221 | 1739763662 | 408683 | SRX28102226 | SRS24458273 | SRA2098458 | UC Irvine | UC Irvine | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_plate | smartseq | United States | 2025-03-23 | Multi-stage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||
| 35475 | 35475 | SRR32818794 | SRX28102225 | SRS24458272 | SRP572438 | PRJNA1240805 | Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset | GSE292682 | Transcriptome Analysis | Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset. | pubmed:40145570 | sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 3 | GSM8863183 | source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf|geo loc name:missing|collection date:missing | sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 3 | Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples | FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos | 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate. | tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf | GSM8863183 | GSM8863183: sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 3; Danio rerio; RNA Seq | GSM8863183 r1 | GSM8863183 | 1 | 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP572438 | p48-3-READ1-Sequences.txt p48-3-READ2-Sequences.txt | fastq fastq | 5127128400.0 | 25635642.0 | GSM8863183 r1 | 0:100 1:100 | A:1321647066;C:1250868808;G:1210591826;T:1343703952;N:316748 | 100 | 100 | 1321647066 | 1250868808 | 1210591826 | 1343703952 | 316748 | SRX28102225 | SRS24458272 | SRA2098458 | UC Irvine | UC Irvine | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_plate | smartseq | United States | 2025-03-23 | Multi-stage | Embryo | Embryo Imprecise | All anatomical structures |
Advanced export
JSON shape: default, array, newline-delimited
CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;