metadata: run_metadata: 1,899 rows where technology = "smartseq", tissue_curation = "Embryo Imprecise" and tissue_curation

1,899 rows where technology = "smartseq", tissue_curation = "Embryo Imprecise" and tissue_curation_coarse = "All anatomical structures"

descending

Link	rowid ▼	run.accession	experiment.accession	sample.accession	study.accession	bioproject	study.title	study.alias	study.type	study.abstract	study.attributes	study.PMIDs	sample.description	sample.title	sample.alias	sample.centername	sample.attributes	GEOsample.title	GEOsample.dataprocessing	GEOsample.source	GEOsample.treatmentprotocol	GEOsample.extractprotocol	GEOsample.growthprotocol	GEOsample.characteristics	GEOsample.accession	experiment.title	experiment.alias	experiment.library_name	experiment.design_description	experiment.library_construction_protocol	experiment.attributes	experiment.library_strategy	experiment.library_source	experiment.library_selection	experiment.library_layout	experiment.platform	experiment.instrument_model	experiment.study_ref	run.title	run.attributes	run.filename	run.semantic_name	run.total_bases	run.total_spots	run.alias	run.read_lengths	run.base_counts	run.r1_length	run.r2_length	run.Acount	run.Ccount	run.Gcount	run.Tcount	run.Ncount	run.experiment	run.pool_member	submission.accession	submission.srasource	submission.bioprojectsource	seqdetective.n_mates	seqdetective.mapping_rate.mate1	seqdetective.mapping_rate.mate2	seqdetective.nofeature_rate.mate1	seqdetective.nofeature_rate.mate2	seqdetective.sparsity.mate1	seqdetective.sparsity.mate2	seqdetective.pos_strand_rate.mate1	seqdetective.pos_strand_rate.mate2	seqdetective.readlen.mate1	seqdetective.readlen.mate2	seqdetective.judgement.mate1	seqdetective.judgement.mate2	seqdetective.judgement.reason	platform_family	instrument_generation	read_bias	selection_class	prep_kit	sc_or_bulk	tech_class	technology	submission.bioprojectsource.country	earliest_date	devstage_curation	devstage_curation_coarse	tissue_curation	tissue_curation_coarse
9651	9651	ERR3266392	ERX3293003	ERS3358386	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp positive rep2	SAMEA5556346	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556346\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 6\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp positive rep2 s	sponge tdr gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_9pos_S2_L001_R1_001.fastq.gz	fastq	603238067.0	8014716.0	E MTAB 7846:sponge tdr gfp positive rep2 lane1	0:75.27 1:0	A:164797697;C:136552121;G:141138007;T:160737152;N:13090	75	0	164797697	136552121	141138007	160737152	13090	ERX3293003	ERS3358386	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95083		0.06432		0.71532		0.50098		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9652	9652	ERR3266393	ERX3293003	ERS3358386	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp positive rep2	SAMEA5556346	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556346\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 6\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp positive rep2 s	sponge tdr gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_9pos_S2_L002_R1_001.fastq.gz	fastq	603749720.0	8021069.0	E MTAB 7846:sponge tdr gfp positive rep2 lane2	0:75.27 1:0	A:164972969;C:136661417;G:141205792;T:160896264;N:13278	75	0	164972969	136661417	141205792	160896264	13278	ERX3293003	ERS3358386	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.951		0.06542		0.71768		0.50051		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9653	9653	ERR3266394	ERX3293003	ERS3358386	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp positive rep2	SAMEA5556346	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556346\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 6\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp positive rep2 s	sponge tdr gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_9pos_S2_L003_R1_001.fastq.gz	fastq	608154053.0	8079704.0	E MTAB 7846:sponge tdr gfp positive rep2 lane3	0:75.27 1:0	A:166117918;C:137731172;G:142320339;T:161970092;N:14532	75	0	166117918	137731172	142320339	161970092	14532	ERX3293003	ERS3358386	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95155		0.0657		0.71634		0.49493		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9654	9654	ERR3266395	ERX3293003	ERS3358386	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp positive rep2	SAMEA5556346	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556346\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 6\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp positive rep2 s	sponge tdr gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_9pos_S2_L004_R1_001.fastq.gz	fastq	599143392.0	7959897.0	E MTAB 7846:sponge tdr gfp positive rep2 lane4	0:75.27 1:0	A:163706904;C:135622453;G:140192351;T:159605249;N:16435	75	0	163706904	135622453	140192351	159605249	16435	ERX3293003	ERS3358386	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95061		0.06431		0.71764		0.50166		75		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9655	9655	ERR3266388	ERX3293002	ERS3358385	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp positive rep1	SAMEA5556345	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556345\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 5\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp positive rep1 s	sponge tdr gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_6pos_S4_L001_R1_001.fastq.gz	fastq	616761505.0	8202480.0	E MTAB 7846:sponge tdr gfp positive rep1 lane1	0:75.19 1:0	A:168679238;C:139548565;G:143969797;T:164545362;N:18543	75	0	168679238	139548565	143969797	164545362	18543	ERX3293002	ERS3358385	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95019		0.06806		0.7097		0.50337		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9656	9656	ERR3266389	ERX3293002	ERS3358385	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp positive rep1	SAMEA5556345	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556345\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 5\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp positive rep1 s	sponge tdr gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_6pos_S4_L002_R1_001.fastq.gz	fastq	617529482.0	8212485.0	E MTAB 7846:sponge tdr gfp positive rep1 lane2	0:75.19 1:0	A:168925757;C:139655387;G:144096837;T:164831236;N:20265	75	0	168925757	139655387	144096837	164831236	20265	ERX3293002	ERS3358385	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.9492		0.06753		0.712		0.49881		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9657	9657	ERR3266390	ERX3293002	ERS3358385	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp positive rep1	SAMEA5556345	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556345\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 5\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp positive rep1 s	sponge tdr gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_6pos_S4_L003_R1_001.fastq.gz	fastq	624156883.0	8300861.0	E MTAB 7846:sponge tdr gfp positive rep1 lane3	0:75.19 1:0	A:170696950;C:141302376;G:145759286;T:166377781;N:20490	75	0	170696950	141302376	145759286	166377781	20490	ERX3293002	ERS3358385	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94917		0.06724		0.71291		0.50783		75		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9658	9658	ERR3266391	ERX3293002	ERS3358385	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp positive rep1	SAMEA5556345	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556345\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 5\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp positive rep1 s	sponge tdr gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_6pos_S4_L004_R1_001.fastq.gz	fastq	615013615.0	8179180.0	E MTAB 7846:sponge tdr gfp positive rep1 lane4	0:75.19 1:0	A:168237742;C:139106952;G:143535658;T:164110735;N:22528	75	0	168237742	139106952	143535658	164110735	22528	ERX3293002	ERS3358385	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94892		0.06723		0.71206		0.50775		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9659	9659	ERR3266384	ERX3293001	ERS3358384	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp negative rep2	SAMEA5556344	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556344\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 6\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp negative rep2 s	sponge tdr gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_9neg_S1_L001_R1_001.fastq.gz	fastq	659562366.0	8762947.0	E MTAB 7846:sponge tdr gfp negative rep2 lane1	0:75.27 1:0	A:178744772;C:150091912;G:155092318;T:175619332;N:14032	75	0	178744772	150091912	155092318	175619332	14032	ERX3293001	ERS3358384	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.9517		0.06908		0.70822		0.48025		73		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9660	9660	ERR3266385	ERX3293001	ERS3358384	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp negative rep2	SAMEA5556344	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556344\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 6\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp negative rep2 s	sponge tdr gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_9neg_S1_L002_R1_001.fastq.gz	fastq	658688825.0	8751176.0	E MTAB 7846:sponge tdr gfp negative rep2 lane2	0:75.27 1:0	A:178540155;C:149844100;G:154850294;T:175438757;N:15519	75	0	178540155	149844100	154850294	175438757	15519	ERX3293001	ERS3358384	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95059		0.06748		0.70806		0.48177		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9661	9661	ERR3266386	ERX3293001	ERS3358384	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp negative rep2	SAMEA5556344	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556344\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 6\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp negative rep2 s	sponge tdr gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_9neg_S1_L003_R1_001.fastq.gz	fastq	665901310.0	8846927.0	E MTAB 7846:sponge tdr gfp negative rep2 lane3	0:75.27 1:0	A:180412445;C:151589489;G:156677030;T:177206192;N:16154	75	0	180412445	151589489	156677030	177206192	16154	ERX3293001	ERS3358384	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95095		0.06855		0.7082		0.4787		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9662	9662	ERR3266387	ERX3293001	ERS3358384	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp negative rep2	SAMEA5556344	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556344\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 6\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp negative rep2 s	sponge tdr gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_9neg_S1_L004_R1_001.fastq.gz	fastq	655674573.0	8711278.0	E MTAB 7846:sponge tdr gfp negative rep2 lane4	0:75.27 1:0	A:177658097;C:149188009;G:154201531;T:174609176;N:17760	75	0	177658097	149188009	154201531	174609176	17760	ERX3293001	ERS3358384	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.9503		0.06838		0.70926		0.47475		75		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9663	9663	ERR3266380	ERX3293000	ERS3358383	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp negative rep1	SAMEA5556343	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556343\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 5\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp negative rep1 s	sponge tdr gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_6neg_S3_L001_R1_001.fastq.gz	fastq	634491637.0	8440052.0	E MTAB 7846:sponge tdr gfp negative rep1 lane1	0:75.18 1:0	A:170881257;C:145535643;G:150561786;T:167495156;N:17795	75	0	170881257	145535643	150561786	167495156	17795	ERX3293000	ERS3358383	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94996		0.05672		0.70571		0.48691		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9664	9664	ERR3266381	ERX3293000	ERS3358383	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp negative rep1	SAMEA5556343	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556343\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 5\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp negative rep1 s	sponge tdr gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_6neg_S3_L002_R1_001.fastq.gz	fastq	632900752.0	8418846.0	E MTAB 7846:sponge tdr gfp negative rep1 lane2	0:75.18 1:0	A:170454908;C:145141392;G:150172752;T:167112562;N:19138	75	0	170454908	145141392	150172752	167112562	19138	ERX3293000	ERS3358383	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94905		0.05627		0.70457		0.4865		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9665	9665	ERR3266382	ERX3293000	ERS3358383	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp negative rep1	SAMEA5556343	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556343\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 5\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp negative rep1 s	sponge tdr gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_6neg_S3_L003_R1_001.fastq.gz	fastq	638530115.0	8494045.0	E MTAB 7846:sponge tdr gfp negative rep1 lane3	0:75.17 1:0	A:171907482;C:146526309;G:151612209;T:168464163;N:19952	75	0	171907482	146526309	151612209	168464163	19952	ERX3293000	ERS3358383	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94919		0.05578		0.70849		0.48073		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9666	9666	ERR3266383	ERX3293000	ERS3358383	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp negative rep1	SAMEA5556343	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556343\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 5\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp negative rep1 s	sponge tdr gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_6neg_S3_L004_R1_001.fastq.gz	fastq	627433322.0	8346505.0	E MTAB 7846:sponge tdr gfp negative rep1 lane4	0:75.17 1:0	A:169016383;C:143886824;G:148914725;T:165593528;N:21862	75	0	169016383	143886824	148914725	165593528	21862	ERX3293000	ERS3358383	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94993		0.05721		0.7052		0.48878		75		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9667	9667	ERR3266376	ERX3292999	ERS3358382	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp positive rep2	SAMEA5556342	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556342\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 2\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp positive rep2 s	sponge isl gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_7pos_S10_L001_R1_001.fastq.gz	fastq	618672195.0	8218047.0	E MTAB 7846:sponge isl gfp positive rep2 lane1	0:75.28 1:0	A:166422886;C:142212204;G:146857539;T:163167819;N:11747	75	0	166422886	142212204	146857539	163167819	11747	ERX3292999	ERS3358382	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94979		0.08351		0.70863		0.47581		75		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9668	9668	ERR3266377	ERX3292999	ERS3358382	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp positive rep2	SAMEA5556342	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556342\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 2\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp positive rep2 s	sponge isl gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_7pos_S10_L002_R1_001.fastq.gz	fastq	618709102.0	8218295.0	E MTAB 7846:sponge isl gfp positive rep2 lane2	0:75.28 1:0	A:166470432;C:142189977;G:146819280;T:163216323;N:13090	75	0	166470432	142189977	146819280	163216323	13090	ERX3292999	ERS3358382	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94977		0.08255		0.70644		0.47228		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9669	9669	ERR3266378	ERX3292999	ERS3358382	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp positive rep2	SAMEA5556342	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556342\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 2\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp positive rep2 s	sponge isl gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_7pos_S10_L003_R1_001.fastq.gz	fastq	625353059.0	8306375.0	E MTAB 7846:sponge isl gfp positive rep2 lane3	0:75.29 1:0	A:168233274;C:143793178;G:148510556;T:164802476;N:13575	75	0	168233274	143793178	148510556	164802476	13575	ERX3292999	ERS3358382	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95014		0.08368		0.70743		0.47846		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9670	9670	ERR3266379	ERX3292999	ERS3358382	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp positive rep2	SAMEA5556342	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556342\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 2\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp positive rep2 s	sponge isl gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_7pos_S10_L004_R1_001.fastq.gz	fastq	615204990.0	8171748.0	E MTAB 7846:sponge isl gfp positive rep2 lane4	0:75.28 1:0	A:165565861;C:141380152;G:146028839;T:162214263;N:15875	75	0	165565861	141380152	146028839	162214263	15875	ERX3292999	ERS3358382	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94954		0.08233		0.70834		0.48166		75		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9671	9671	ERR3266372	ERX3292998	ERS3358381	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp positive rep1	SAMEA5556341	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556341\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 1\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp positive rep1 s	sponge isl gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_6pos_S12_L001_R1_001.fastq.gz	fastq	626474467.0	8318996.0	E MTAB 7846:sponge isl gfp positive rep1 lane1	0:75.31 1:0	A:170186220;C:142441110;G:147048643;T:166786401;N:12093	75	0	170186220	142441110	147048643	166786401	12093	ERX3292998	ERS3358381	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94907		0.08132		0.69684		0.4736		75		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9672	9672	ERR3266373	ERX3292998	ERS3358381	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp positive rep1	SAMEA5556341	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556341\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 1\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp positive rep1 s	sponge isl gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_6pos_S12_L002_R1_001.fastq.gz	fastq	626477579.0	8318750.0	E MTAB 7846:sponge isl gfp positive rep1 lane2	0:75.31 1:0	A:170185337;C:142396801;G:147032265;T:166850532;N:12644	75	0	170185337	142396801	147032265	166850532	12644	ERX3292998	ERS3358381	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94941		0.08253		0.6957		0.47554		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9673	9673	ERR3266374	ERX3292998	ERS3358381	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp positive rep1	SAMEA5556341	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556341\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 1\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp positive rep1 s	sponge isl gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_6pos_S12_L003_R1_001.fastq.gz	fastq	632098509.0	8393388.0	E MTAB 7846:sponge isl gfp positive rep1 lane3	0:75.31 1:0	A:171699353;C:143766296;G:148442110;T:168177264;N:13486	75	0	171699353	143766296	148442110	168177264	13486	ERX3292998	ERS3358381	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94866		0.08247		0.69601		0.48009		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9674	9674	ERR3266375	ERX3292998	ERS3358381	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp positive rep1	SAMEA5556341	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556341\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 1\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp positive rep1 s	sponge isl gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_6pos_S12_L004_R1_001.fastq.gz	fastq	622997479.0	8272752.0	E MTAB 7846:sponge isl gfp positive rep1 lane4	0:75.31 1:0	A:169306677;C:141586415;G:146241288;T:165847752;N:15347	75	0	169306677	141586415	146241288	165847752	15347	ERX3292998	ERS3358381	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.9483		0.08034		0.69662		0.47868		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9675	9675	ERR3266368	ERX3292997	ERS3358380	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp negative rep2	SAMEA5556340	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556340\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 2\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp negative rep2 s	sponge isl gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_7neg_S9_L001_R1_001.fastq.gz	fastq	707454819.0	9395082.0	E MTAB 7846:sponge isl gfp negative rep2 lane1	0:75.30 1:0	A:194991862;C:157927850;G:163280639;T:191241488;N:12980	75	0	194991862	157927850	163280639	191241488	12980	ERX3292997	ERS3358380	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.93871		0.08926		0.70806		0.46501		75		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9676	9676	ERR3266369	ERX3292997	ERS3358380	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp negative rep2	SAMEA5556340	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556340\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 2\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp negative rep2 s	sponge isl gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_7neg_S9_L002_R1_001.fastq.gz	fastq	704791838.0	9359668.0	E MTAB 7846:sponge isl gfp negative rep2 lane2	0:75.30 1:0	A:194317422;C:157276895;G:162624670;T:190558322;N:14529	75	0	194317422	157276895	162624670	190558322	14529	ERX3292997	ERS3358380	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.93816		0.08859		0.70999		0.4661		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9677	9677	ERR3266370	ERX3292997	ERS3358380	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp negative rep2	SAMEA5556340	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556340\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 2\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp negative rep2 s	sponge isl gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_7neg_S9_L003_R1_001.fastq.gz	fastq	715991833.0	9508323.0	E MTAB 7846:sponge isl gfp negative rep2 lane3	0:75.30 1:0	A:197297222;C:159913026;G:165363927;T:193402765;N:14893	75	0	197297222	159913026	165363927	193402765	14893	ERX3292997	ERS3358380	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.93844		0.08854		0.70828		0.46042		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9678	9678	ERR3266371	ERX3292997	ERS3358380	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp negative rep2	SAMEA5556340	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556340\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 2\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp negative rep2 s	sponge isl gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_7neg_S9_L004_R1_001.fastq.gz	fastq	703723869.0	9345669.0	E MTAB 7846:sponge isl gfp negative rep2 lane4	0:75.30 1:0	A:194029886;C:157050176;G:162432310;T:190193608;N:17889	75	0	194029886	157050176	162432310	190193608	17889	ERX3292997	ERS3358380	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.93897		0.08993		0.70863		0.45707		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9679	9679	ERR3266364	ERX3292996	ERS3358379	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp negative rep1	SAMEA5556339	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556339\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 1\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp negative rep1 s	sponge isl gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_6neg_S11_L001_R1_001.fastq.gz	fastq	676581458.0	8983758.0	E MTAB 7846:sponge isl gfp negative rep1 lane1	0:75.31 1:0	A:184297337;C:153352193;G:158268476;T:180651038;N:12414	75	0	184297337	153352193	158268476	180651038	12414	ERX3292996	ERS3358379	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94981		0.07715		0.69138		0.47243		74		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9680	9680	ERR3266365	ERX3292996	ERS3358379	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp negative rep1	SAMEA5556339	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556339\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 1\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp negative rep1 s	sponge isl gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_6neg_S11_L002_R1_001.fastq.gz	fastq	676876555.0	8987445.0	E MTAB 7846:sponge isl gfp negative rep1 lane2	0:75.31 1:0	A:184435129;C:153332402;G:158323789;T:180770978;N:14257	75	0	184435129	153332402	158323789	180770978	14257	ERX3292996	ERS3358379	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94901		0.07805		0.69179		0.47182		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9681	9681	ERR3266366	ERX3292996	ERS3358379	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp negative rep1	SAMEA5556339	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556339\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 1\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp negative rep1 s	sponge isl gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_6neg_S11_L003_R1_001.fastq.gz	fastq	681771213.0	9052615.0	E MTAB 7846:sponge isl gfp negative rep1 lane3	0:75.31 1:0	A:185717696;C:154552039;G:159567102;T:181919781;N:14595	75	0	185717696	154552039	159567102	181919781	14595	ERX3292996	ERS3358379	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94923		0.07768		0.69167		0.47219		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9682	9682	ERR3266367	ERX3292996	ERS3358379	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp negative rep1	SAMEA5556339	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556339\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 1\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp negative rep1 s	sponge isl gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_6neg_S11_L004_R1_001.fastq.gz	fastq	671169917.0	8911624.0	E MTAB 7846:sponge isl gfp negative rep1 lane4	0:75.31 1:0	A:182910490;C:152045814;G:157010053;T:179186548;N:17012	75	0	182910490	152045814	157010053	179186548	17012	ERX3292996	ERS3358379	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94941		0.07612		0.69106		0.47736		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9683	9683	ERR3266360	ERX3292995	ERS3358378	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp positive rep2	SAMEA5556338	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556338\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 4\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp positive rep2 s	sponge ccn gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_8pos_S6_L001_R1_001.fastq.gz	fastq	745666738.0	9917771.0	E MTAB 7846:sponge ccn gfp positive rep2 lane1	0:75.18 1:0	A:207714377;C:163732420;G:169037726;T:205161925;N:20290	75	0	207714377	163732420	169037726	205161925	20290	ERX3292995	ERS3358378	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94006		0.17809		0.68166		0.48912		74		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9684	9684	ERR3266361	ERX3292995	ERS3358378	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp positive rep2	SAMEA5556338	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556338\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 4\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp positive rep2 s	sponge ccn gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_8pos_S6_L002_R1_001.fastq.gz	fastq	747693645.0	9944395.0	E MTAB 7846:sponge ccn gfp positive rep2 lane2	0:75.19 1:0	A:208257288;C:164106384;G:169478025;T:205830399;N:21549	75	0	208257288	164106384	169478025	205830399	21549	ERX3292995	ERS3358378	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.93873		0.17738		0.68296		0.49656		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9685	9685	ERR3266362	ERX3292995	ERS3358378	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp positive rep2	SAMEA5556338	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556338\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 4\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp positive rep2 s	sponge ccn gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_8pos_S6_L003_R1_001.fastq.gz	fastq	756134124.0	10056818.0	E MTAB 7846:sponge ccn gfp positive rep2 lane3	0:75.19 1:0	A:210573012;C:166089133;G:171475300;T:207973232;N:23447	75	0	210573012	166089133	171475300	207973232	23447	ERX3292995	ERS3358378	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94077		0.18001		0.68004		0.49812		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9686	9686	ERR3266363	ERX3292995	ERS3358378	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp positive rep2	SAMEA5556338	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556338\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 4\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp positive rep2 s	sponge ccn gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_8pos_S6_L004_R1_001.fastq.gz	fastq	747687619.0	9944417.0	E MTAB 7846:sponge ccn gfp positive rep2 lane4	0:75.19 1:0	A:208315943;C:164104155;G:169484250;T:205757712;N:25559	75	0	208315943	164104155	169484250	205757712	25559	ERX3292995	ERS3358378	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94025		0.17965		0.68124		0.49249		75		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9687	9687	ERR3266356	ERX3292994	ERS3358377	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp positive rep1	SAMEA5556337	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556337\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 3\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp positive rep1 s	sponge ccn gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_7pos_S8_L001_R1_001.fastq.gz	fastq	600153564.0	7972767.0	E MTAB 7846:sponge ccn gfp positive rep1 lane1	0:75.28 1:0	A:165075878;C:133961511;G:138306424;T:162797903;N:11848	75	0	165075878	133961511	138306424	162797903	11848	ERX3292994	ERS3358377	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95367		0.14146		0.69154		0.46621		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9688	9688	ERR3266357	ERX3292994	ERS3358377	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp positive rep1	SAMEA5556337	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556337\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 3\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp positive rep1 s	sponge ccn gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_7pos_S8_L002_R1_001.fastq.gz	fastq	600790169.0	7981038.0	E MTAB 7846:sponge ccn gfp positive rep1 lane2	0:75.28 1:0	A:165262968;C:133988329;G:138458635;T:163066854;N:13383	75	0	165262968	133988329	138458635	163066854	13383	ERX3292994	ERS3358377	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95365		0.14116		0.69301		0.46836		75		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9689	9689	ERR3266358	ERX3292994	ERS3358377	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp positive rep1	SAMEA5556337	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556337\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 3\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp positive rep1 s	sponge ccn gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_7pos_S8_L003_R1_001.fastq.gz	fastq	608611085.0	8084904.0	E MTAB 7846:sponge ccn gfp positive rep1 lane3	0:75.28 1:0	A:167402055;C:135871708;G:140314669;T:165009252;N:13401	75	0	167402055	135871708	140314669	165009252	13401	ERX3292994	ERS3358377	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95403		0.14167		0.69311		0.4702		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9690	9690	ERR3266359	ERX3292994	ERS3358377	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp positive rep1	SAMEA5556337	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556337\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 3\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp positive rep1 s	sponge ccn gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_7pos_S8_L004_R1_001.fastq.gz	fastq	599558663.0	7964718.0	E MTAB 7846:sponge ccn gfp positive rep1 lane4	0:75.28 1:0	A:164965131;C:133749666;G:138194884;T:162633558;N:15424	75	0	164965131	133749666	138194884	162633558	15424	ERX3292994	ERS3358377	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95285		0.14085		0.69037		0.47345		75		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9691	9691	ERR3266352	ERX3292993	ERS3358376	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp negative rep2	SAMEA5556336	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556336\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 4\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp negative rep2 s	sponge ccn gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_8neg_S5_L001_R1_001.fastq.gz	fastq	599599608.0	7970460.0	E MTAB 7846:sponge ccn gfp negative rep2 lane1	0:75.23 1:0	A:162236409;C:136907675;G:141538730;T:158902520;N:14274	75	0	162236409	136907675	141538730	158902520	14274	ERX3292993	ERS3358376	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95404		0.05923		0.69737		0.48627		75		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9692	9692	ERR3266353	ERX3292993	ERS3358376	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp negative rep2	SAMEA5556336	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556336\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 4\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp negative rep2 s	sponge ccn gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_8neg_S5_L002_R1_001.fastq.gz	fastq	600057776.0	7976438.0	E MTAB 7846:sponge ccn gfp negative rep2 lane2	0:75.23 1:0	A:162367410;C:136994919;G:141577782;T:159102194;N:15471	75	0	162367410	136994919	141577782	159102194	15471	ERX3292993	ERS3358376	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.953		0.06085		0.6952		0.48868		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9693	9693	ERR3266354	ERX3292993	ERS3358376	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp negative rep2	SAMEA5556336	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556336\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 4\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp negative rep2 s	sponge ccn gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_8neg_S5_L003_R1_001.fastq.gz	fastq	607089697.0	8069901.0	E MTAB 7846:sponge ccn gfp negative rep2 lane3	0:75.23 1:0	A:164235344;C:138684000;G:143335680;T:160819270;N:15403	75	0	164235344	138684000	143335680	160819270	15403	ERX3292993	ERS3358376	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95245		0.06055		0.69589		0.48813		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9694	9694	ERR3266355	ERX3292993	ERS3358376	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp negative rep2	SAMEA5556336	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556336\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 4\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp negative rep2 s	sponge ccn gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_8neg_S5_L004_R1_001.fastq.gz	fastq	598098243.0	7950223.0	E MTAB 7846:sponge ccn gfp negative rep2 lane4	0:75.23 1:0	A:161836808;C:136564804;G:141157424;T:158521860;N:17347	75	0	161836808	136564804	141157424	158521860	17347	ERX3292993	ERS3358376	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95299		0.06032		0.69501		0.48928		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9695	9695	ERR3266348	ERX3292992	ERS3358375	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp negative rep1	SAMEA5556335	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556335\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 3\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp negative rep1 s	sponge ccn gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_7neg_S7_L001_R1_001.fastq.gz	fastq	668175990.0	8872549.0	E MTAB 7846:sponge ccn gfp negative rep1 lane1	0:75.31 1:0	A:179859350;C:153483169;G:158360605;T:176462088;N:10778	75	0	179859350	153483169	158360605	176462088	10778	ERX3292992	ERS3358375	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95955		0.07154		0.69696		0.46425		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9696	9696	ERR3266349	ERX3292992	ERS3358375	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp negative rep1	SAMEA5556335	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556335\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 3\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp negative rep1 s	sponge ccn gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_7neg_S7_L002_R1_001.fastq.gz	fastq	668154755.0	8872093.0	E MTAB 7846:sponge ccn gfp negative rep1 lane2	0:75.31 1:0	A:179811687;C:153454931;G:158314391;T:176560936;N:12810	75	0	179811687	153454931	158314391	176560936	12810	ERX3292992	ERS3358375	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.96029		0.06969		0.69684		0.46725		75		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9697	9697	ERR3266350	ERX3292992	ERS3358375	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp negative rep1	SAMEA5556335	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556335\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 3\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp negative rep1 s	sponge ccn gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_7neg_S7_L003_R1_001.fastq.gz	fastq	676984426.0	8989004.0	E MTAB 7846:sponge ccn gfp negative rep1 lane3	0:75.31 1:0	A:182159685;C:155578195;G:160511499;T:178722363;N:12684	75	0	182159685	155578195	160511499	178722363	12684	ERX3292992	ERS3358375	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.96012		0.07159		0.69554		0.46811		75		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9698	9698	ERR3266351	ERX3292992	ERS3358375	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08		Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp negative rep1	SAMEA5556335	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556335\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 3\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp negative rep1 s	sponge ccn gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_7neg_S7_L004_R1_001.fastq.gz	fastq	666031892.0	8843695.0	E MTAB 7846:sponge ccn gfp negative rep1 lane4	0:75.31 1:0	A:179243298;C:152946459;G:157873912;T:175953752;N:14471	75	0	179243298	152946459	157873912	175953752	14471	ERX3292992	ERS3358375	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.96014		0.07169		0.69493		0.47058		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
29202	29202	SRR27329257	SRX23006269	SRS19970080	SRP479683	PRJNA1055904	BMP dependent patterning of ectoderm tissue material properties modulates lateral mesendoderm cell migration during early zebrafish gastrulation	GSE251904	Transcriptome Analysis	Cell migration is a fundamental process during embryonic development. Most studies in vivo have focussed on the migration of cells using the extracellular matrix ECM as their substrate for migration. In contrast much less is known about how cells migrate on other cells as found in early embryos when the ECM has not yet formed. Here we show that lateral mesendoderm LME cells in the early zebrafish gastrula use the ectoderm as their substrate for migration. We show that the lateral ectoderm is permissive for the animal pole directed migration of LME cells while the ectoderm at the animal pole halts it. These differences in the permissiveness depend on the lateral ectoderm being more cohesive than the animal ectoderm a property controlled by BMP signalling within the ectoderm. Collectively these findings identify ectoderm tissue cohesion as one critical factor regulating LME migration during zebrafish gastrulation. Overall design: To investigate the differences in gene expression between animal and lateral ectoderm causing the difference in material properties between the two ectodermal tissues.		pubmed:40057955		Zebrafish Lateral Ectoderm 7.5 hpf 4	GSM7989708		source name:Lateral Ectoderm\|tissue:Lateral Ectoderm\|genotype:WT TgSebox::eGFP embryos\|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS\|geo loc name:missing\|collection date:missing	Zebrafish Lateral Ectoderm 7.5 hpf 4	FastQC quality control Trimmomatic adapter & quality trimming; parameters: 2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:19 FastQC controlling trimming results salmon Alignment; used flags: seqBias qcBias R DESeq2 differential gene expression analysis; DESEq2 apeglm tximport genefilter GenomicRanges R EnhancedVolcano & biomaRt visualization Assembly: Danio rerio GRCz11 Supplementary files format and content: tab delimited text file with gene name gene length effective length tpm and number of reads for each sample	Lateral Ectoderm	Embryo were injected with 125 pg of PAmCherry1 mRNA at xxx cell stage. At 6 hpf embryos were mounted for up right imaging and a 444 x 220 x 58.5 µm volume was photoactivated using a 405 nm laser either at the animal pole or on the lateral side. The photoactivation process was composed of 10 cycles of 28 sec per embryo in a time window of approximately 90 min. post photoactivation embryos were transferred in Ca2+ free Ringer solution and dissociated by gently pipetting using a P 1000 pipette to obtain a single cell suspension. 5000 PAmCherry1+ cells were sorted in 150 µl of RTL plus lysis buffer RNeasy Plus Micro Kit QIAGEN with 1% of 2 mercaptoethanol.	Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems.	Embryos were kept at 28.5 C until dissociation	tissue:Lateral Ectoderm\|genotype:WT TgSebox::eGFP embryos\|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS	GSM7989708	GSM7989708: Zebrafish Lateral Ectoderm 7.5 hpf 4; Danio rerio; RNA Seq	GSM7989708 r1	GSM7989708	1	Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP479683			Lateral_Ectoderm_4.mate1.fastq.gz Lateral_Ectoderm_4.mate2.fastq.gz	fastq fastq	6211000588.0	26929501.0	GSM7989708 r1	0:80.64 1:150	A:1950010947;C:1101223011;G:1497556265;T:1656016608;N:6193757	80	150	1950010947	1101223011	1497556265	1656016608	6193757	SRX23006269	SRS19970080	SRA1774740	Heisenberg group, Institute of Science and Technology Austria (ISTA)	Heisenberg group, Institute of Science and Technology Austria (ISTA)	2	0.65918	0.4633	0.04875	0.02201	0.90623	0.92608	0.79936	0.77887	68	150	B	B	mate2-mate1 similar by mapping diff	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	Austria	2023-12-22	Gastrula	Embryo	Embryo Imprecise	All anatomical structures
29203	29203	SRR27329258	SRX23006268	SRS19970081	SRP479683	PRJNA1055904	BMP dependent patterning of ectoderm tissue material properties modulates lateral mesendoderm cell migration during early zebrafish gastrulation	GSE251904	Transcriptome Analysis	Cell migration is a fundamental process during embryonic development. Most studies in vivo have focussed on the migration of cells using the extracellular matrix ECM as their substrate for migration. In contrast much less is known about how cells migrate on other cells as found in early embryos when the ECM has not yet formed. Here we show that lateral mesendoderm LME cells in the early zebrafish gastrula use the ectoderm as their substrate for migration. We show that the lateral ectoderm is permissive for the animal pole directed migration of LME cells while the ectoderm at the animal pole halts it. These differences in the permissiveness depend on the lateral ectoderm being more cohesive than the animal ectoderm a property controlled by BMP signalling within the ectoderm. Collectively these findings identify ectoderm tissue cohesion as one critical factor regulating LME migration during zebrafish gastrulation. Overall design: To investigate the differences in gene expression between animal and lateral ectoderm causing the difference in material properties between the two ectodermal tissues.		pubmed:40057955		Zebrafish Lateral Ectoderm 7.5 hpf 3	GSM7989707		source name:Lateral Ectoderm\|tissue:Lateral Ectoderm\|genotype:WT TgSebox::eGFP embryos\|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS\|geo loc name:missing\|collection date:missing	Zebrafish Lateral Ectoderm 7.5 hpf 3	FastQC quality control Trimmomatic adapter & quality trimming; parameters: 2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:19 FastQC controlling trimming results salmon Alignment; used flags: seqBias qcBias R DESeq2 differential gene expression analysis; DESEq2 apeglm tximport genefilter GenomicRanges R EnhancedVolcano & biomaRt visualization Assembly: Danio rerio GRCz11 Supplementary files format and content: tab delimited text file with gene name gene length effective length tpm and number of reads for each sample	Lateral Ectoderm	Embryo were injected with 125 pg of PAmCherry1 mRNA at xxx cell stage. At 6 hpf embryos were mounted for up right imaging and a 444 x 220 x 58.5 µm volume was photoactivated using a 405 nm laser either at the animal pole or on the lateral side. The photoactivation process was composed of 10 cycles of 28 sec per embryo in a time window of approximately 90 min. post photoactivation embryos were transferred in Ca2+ free Ringer solution and dissociated by gently pipetting using a P 1000 pipette to obtain a single cell suspension. 5000 PAmCherry1+ cells were sorted in 150 µl of RTL plus lysis buffer RNeasy Plus Micro Kit QIAGEN with 1% of 2 mercaptoethanol.	Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems.	Embryos were kept at 28.5 C until dissociation	tissue:Lateral Ectoderm\|genotype:WT TgSebox::eGFP embryos\|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS	GSM7989707	GSM7989707: Zebrafish Lateral Ectoderm 7.5 hpf 3; Danio rerio; RNA Seq	GSM7989707 r1	GSM7989707	1	Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP479683			Lateral_Ectoderm_3.mate1.fastq.gz Lateral_Ectoderm_3.mate2.fastq.gz	fastq fastq	5066130338.0	22014930.0	GSM7989707 r1	0:80.12 1:150	A:1476750755;C:934859886;G:1246347548;T:1403280136;N:4892013	80	150	1476750755	934859886	1246347548	1403280136	4892013	SRX23006268	SRS19970081	SRA1774740	Heisenberg group, Institute of Science and Technology Austria (ISTA)	Heisenberg group, Institute of Science and Technology Austria (ISTA)	2	0.7566	0.52272	0.0462	0.02684	0.89489	0.91246	0.78848	0.77633	68	150	B	B	mate2-mate1 similar by mapping diff	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	Austria	2023-12-22	Gastrula	Embryo	Embryo Imprecise	All anatomical structures
29204	29204	SRR27329259	SRX23006267	SRS19970078	SRP479683	PRJNA1055904	BMP dependent patterning of ectoderm tissue material properties modulates lateral mesendoderm cell migration during early zebrafish gastrulation	GSE251904	Transcriptome Analysis	Cell migration is a fundamental process during embryonic development. Most studies in vivo have focussed on the migration of cells using the extracellular matrix ECM as their substrate for migration. In contrast much less is known about how cells migrate on other cells as found in early embryos when the ECM has not yet formed. Here we show that lateral mesendoderm LME cells in the early zebrafish gastrula use the ectoderm as their substrate for migration. We show that the lateral ectoderm is permissive for the animal pole directed migration of LME cells while the ectoderm at the animal pole halts it. These differences in the permissiveness depend on the lateral ectoderm being more cohesive than the animal ectoderm a property controlled by BMP signalling within the ectoderm. Collectively these findings identify ectoderm tissue cohesion as one critical factor regulating LME migration during zebrafish gastrulation. Overall design: To investigate the differences in gene expression between animal and lateral ectoderm causing the difference in material properties between the two ectodermal tissues.		pubmed:40057955		Zebrafish Lateral Ectoderm 7.5 hpf 2	GSM7989706		source name:Lateral Ectoderm\|tissue:Lateral Ectoderm\|genotype:WT TgSebox::eGFP embryos\|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS\|geo loc name:missing\|collection date:missing	Zebrafish Lateral Ectoderm 7.5 hpf 2	FastQC quality control Trimmomatic adapter & quality trimming; parameters: 2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:19 FastQC controlling trimming results salmon Alignment; used flags: seqBias qcBias R DESeq2 differential gene expression analysis; DESEq2 apeglm tximport genefilter GenomicRanges R EnhancedVolcano & biomaRt visualization Assembly: Danio rerio GRCz11 Supplementary files format and content: tab delimited text file with gene name gene length effective length tpm and number of reads for each sample	Lateral Ectoderm	Embryo were injected with 125 pg of PAmCherry1 mRNA at xxx cell stage. At 6 hpf embryos were mounted for up right imaging and a 444 x 220 x 58.5 µm volume was photoactivated using a 405 nm laser either at the animal pole or on the lateral side. The photoactivation process was composed of 10 cycles of 28 sec per embryo in a time window of approximately 90 min. post photoactivation embryos were transferred in Ca2+ free Ringer solution and dissociated by gently pipetting using a P 1000 pipette to obtain a single cell suspension. 5000 PAmCherry1+ cells were sorted in 150 µl of RTL plus lysis buffer RNeasy Plus Micro Kit QIAGEN with 1% of 2 mercaptoethanol.	Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems.	Embryos were kept at 28.5 C until dissociation	tissue:Lateral Ectoderm\|genotype:WT TgSebox::eGFP embryos\|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS	GSM7989706	GSM7989706: Zebrafish Lateral Ectoderm 7.5 hpf 2; Danio rerio; RNA Seq	GSM7989706 r1	GSM7989706	1	Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP479683			Lateral_Ectoderm_2.mate1.fastq.gz Lateral_Ectoderm_2.mate2.fastq.gz	fastq fastq	6372234032.0	27787436.0	GSM7989706 r1	0:79.32 1:150	A:1908123129;C:1195826989;G:1555786583;T:1706205499;N:6291832	79	150	1908123129	1195826989	1555786583	1706205499	6291832	SRX23006267	SRS19970078	SRA1774740	Heisenberg group, Institute of Science and Technology Austria (ISTA)	Heisenberg group, Institute of Science and Technology Austria (ISTA)	2	0.52417	0.50653	0.02922	0.02493	0.89479	0.90938	0.74721	0.74563	68	150	B	B	biological fallback assumption	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	Austria	2023-12-22	Gastrula	Embryo	Embryo Imprecise	All anatomical structures
29205	29205	SRR27329260	SRX23006266	SRS19970079	SRP479683	PRJNA1055904	BMP dependent patterning of ectoderm tissue material properties modulates lateral mesendoderm cell migration during early zebrafish gastrulation	GSE251904	Transcriptome Analysis	Cell migration is a fundamental process during embryonic development. Most studies in vivo have focussed on the migration of cells using the extracellular matrix ECM as their substrate for migration. In contrast much less is known about how cells migrate on other cells as found in early embryos when the ECM has not yet formed. Here we show that lateral mesendoderm LME cells in the early zebrafish gastrula use the ectoderm as their substrate for migration. We show that the lateral ectoderm is permissive for the animal pole directed migration of LME cells while the ectoderm at the animal pole halts it. These differences in the permissiveness depend on the lateral ectoderm being more cohesive than the animal ectoderm a property controlled by BMP signalling within the ectoderm. Collectively these findings identify ectoderm tissue cohesion as one critical factor regulating LME migration during zebrafish gastrulation. Overall design: To investigate the differences in gene expression between animal and lateral ectoderm causing the difference in material properties between the two ectodermal tissues.		pubmed:40057955		Zebrafish Lateral Ectoderm 7.5 hpf 1	GSM7989705		source name:Lateral Ectoderm\|tissue:Lateral Ectoderm\|genotype:WT TgSebox::eGFP embryos\|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS\|geo loc name:missing\|collection date:missing	Zebrafish Lateral Ectoderm 7.5 hpf 1	FastQC quality control Trimmomatic adapter & quality trimming; parameters: 2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:19 FastQC controlling trimming results salmon Alignment; used flags: seqBias qcBias R DESeq2 differential gene expression analysis; DESEq2 apeglm tximport genefilter GenomicRanges R EnhancedVolcano & biomaRt visualization Assembly: Danio rerio GRCz11 Supplementary files format and content: tab delimited text file with gene name gene length effective length tpm and number of reads for each sample	Lateral Ectoderm	Embryo were injected with 125 pg of PAmCherry1 mRNA at xxx cell stage. At 6 hpf embryos were mounted for up right imaging and a 444 x 220 x 58.5 µm volume was photoactivated using a 405 nm laser either at the animal pole or on the lateral side. The photoactivation process was composed of 10 cycles of 28 sec per embryo in a time window of approximately 90 min. post photoactivation embryos were transferred in Ca2+ free Ringer solution and dissociated by gently pipetting using a P 1000 pipette to obtain a single cell suspension. 5000 PAmCherry1+ cells were sorted in 150 µl of RTL plus lysis buffer RNeasy Plus Micro Kit QIAGEN with 1% of 2 mercaptoethanol.	Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems.	Embryos were kept at 28.5 C until dissociation	tissue:Lateral Ectoderm\|genotype:WT TgSebox::eGFP embryos\|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS	GSM7989705	GSM7989705: Zebrafish Lateral Ectoderm 7.5 hpf 1; Danio rerio; RNA Seq	GSM7989705 r1	GSM7989705	1	Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP479683			Lateral_Ectoderm_1.mate2.fastq.gz Lateral_Ectoderm_1.mate1.fastq.gz	fastq fastq	10106832046.0	43799441.0	GSM7989705 r1	0:80.75 1:150	A:3384386532;C:1698196797;G:2308026869;T:2706071735;N:10150113	80	150	3384386532	1698196797	2308026869	2706071735	10150113	SRX23006266	SRS19970079	SRA1774740	Heisenberg group, Institute of Science and Technology Austria (ISTA)	Heisenberg group, Institute of Science and Technology Austria (ISTA)	2	0.64457	0.42542	0.04802	0.01964	0.91541	0.93878	0.83455	0.83564	68	150	B	B	mate2-mate1 similar by mapping diff	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	Austria	2023-12-22	Gastrula	Embryo	Embryo Imprecise	All anatomical structures
29206	29206	SRR27329261	SRX23006265	SRS19970077	SRP479683	PRJNA1055904	BMP dependent patterning of ectoderm tissue material properties modulates lateral mesendoderm cell migration during early zebrafish gastrulation	GSE251904	Transcriptome Analysis	Cell migration is a fundamental process during embryonic development. Most studies in vivo have focussed on the migration of cells using the extracellular matrix ECM as their substrate for migration. In contrast much less is known about how cells migrate on other cells as found in early embryos when the ECM has not yet formed. Here we show that lateral mesendoderm LME cells in the early zebrafish gastrula use the ectoderm as their substrate for migration. We show that the lateral ectoderm is permissive for the animal pole directed migration of LME cells while the ectoderm at the animal pole halts it. These differences in the permissiveness depend on the lateral ectoderm being more cohesive than the animal ectoderm a property controlled by BMP signalling within the ectoderm. Collectively these findings identify ectoderm tissue cohesion as one critical factor regulating LME migration during zebrafish gastrulation. Overall design: To investigate the differences in gene expression between animal and lateral ectoderm causing the difference in material properties between the two ectodermal tissues.		pubmed:40057955		Zebrafish Animal Ectoderm 7.5 hpf 4	GSM7989704		source name:Animal Ectoderm\|tissue:Animal Ectoderm\|genotype:WT TgSebox::eGFP embryos\|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS\|geo loc name:missing\|collection date:missing	Zebrafish Animal Ectoderm 7.5 hpf 4	FastQC quality control Trimmomatic adapter & quality trimming; parameters: 2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:19 FastQC controlling trimming results salmon Alignment; used flags: seqBias qcBias R DESeq2 differential gene expression analysis; DESEq2 apeglm tximport genefilter GenomicRanges R EnhancedVolcano & biomaRt visualization Assembly: Danio rerio GRCz11 Supplementary files format and content: tab delimited text file with gene name gene length effective length tpm and number of reads for each sample	Animal Ectoderm	Embryo were injected with 125 pg of PAmCherry1 mRNA at xxx cell stage. At 6 hpf embryos were mounted for up right imaging and a 444 x 220 x 58.5 µm volume was photoactivated using a 405 nm laser either at the animal pole or on the lateral side. The photoactivation process was composed of 10 cycles of 28 sec per embryo in a time window of approximately 90 min. post photoactivation embryos were transferred in Ca2+ free Ringer solution and dissociated by gently pipetting using a P 1000 pipette to obtain a single cell suspension. 5000 PAmCherry1+ cells were sorted in 150 µl of RTL plus lysis buffer RNeasy Plus Micro Kit QIAGEN with 1% of 2 mercaptoethanol.	Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems.	Embryos were kept at 28.5 C until dissociation	tissue:Animal Ectoderm\|genotype:WT TgSebox::eGFP embryos\|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS	GSM7989704	GSM7989704: Zebrafish Animal Ectoderm 7.5 hpf 4; Danio rerio; RNA Seq	GSM7989704 r1	GSM7989704	1	Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP479683			Animal_Ectoderm_4.mate1.fastq.gz Animal_Ectoderm_4.mate2.fastq.gz	fastq fastq	5882974802.0	25612144.0	GSM7989704 r1	0:79.69 1:150.00	A:1784390197;C:1112846767;G:1392719296;T:1587227818;N:5790724	79	150	1784390197	1112846767	1392719296	1587227818	5790724	SRX23006265	SRS19970077	SRA1774740	Heisenberg group, Institute of Science and Technology Austria (ISTA)	Heisenberg group, Institute of Science and Technology Austria (ISTA)	2	0.72169	0.51947	0.04749	0.0244	0.89061	0.91007	0.76259	0.75355	90	150	B	B	mate2-mate1 similar by mapping diff	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	Austria	2023-12-22	Gastrula	Embryo	Embryo Imprecise	All anatomical structures
29207	29207	SRR27329262	SRX23006264	SRS19970076	SRP479683	PRJNA1055904	BMP dependent patterning of ectoderm tissue material properties modulates lateral mesendoderm cell migration during early zebrafish gastrulation	GSE251904	Transcriptome Analysis	Cell migration is a fundamental process during embryonic development. Most studies in vivo have focussed on the migration of cells using the extracellular matrix ECM as their substrate for migration. In contrast much less is known about how cells migrate on other cells as found in early embryos when the ECM has not yet formed. Here we show that lateral mesendoderm LME cells in the early zebrafish gastrula use the ectoderm as their substrate for migration. We show that the lateral ectoderm is permissive for the animal pole directed migration of LME cells while the ectoderm at the animal pole halts it. These differences in the permissiveness depend on the lateral ectoderm being more cohesive than the animal ectoderm a property controlled by BMP signalling within the ectoderm. Collectively these findings identify ectoderm tissue cohesion as one critical factor regulating LME migration during zebrafish gastrulation. Overall design: To investigate the differences in gene expression between animal and lateral ectoderm causing the difference in material properties between the two ectodermal tissues.		pubmed:40057955		Zebrafish Animal Ectoderm 7.5 hpf 3	GSM7989703		source name:Animal Ectoderm\|tissue:Animal Ectoderm\|genotype:WT TgSebox::eGFP embryos\|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS\|geo loc name:missing\|collection date:missing	Zebrafish Animal Ectoderm 7.5 hpf 3	FastQC quality control Trimmomatic adapter & quality trimming; parameters: 2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:19 FastQC controlling trimming results salmon Alignment; used flags: seqBias qcBias R DESeq2 differential gene expression analysis; DESEq2 apeglm tximport genefilter GenomicRanges R EnhancedVolcano & biomaRt visualization Assembly: Danio rerio GRCz11 Supplementary files format and content: tab delimited text file with gene name gene length effective length tpm and number of reads for each sample	Animal Ectoderm	Embryo were injected with 125 pg of PAmCherry1 mRNA at xxx cell stage. At 6 hpf embryos were mounted for up right imaging and a 444 x 220 x 58.5 µm volume was photoactivated using a 405 nm laser either at the animal pole or on the lateral side. The photoactivation process was composed of 10 cycles of 28 sec per embryo in a time window of approximately 90 min. post photoactivation embryos were transferred in Ca2+ free Ringer solution and dissociated by gently pipetting using a P 1000 pipette to obtain a single cell suspension. 5000 PAmCherry1+ cells were sorted in 150 µl of RTL plus lysis buffer RNeasy Plus Micro Kit QIAGEN with 1% of 2 mercaptoethanol.	Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems.	Embryos were kept at 28.5 C until dissociation	tissue:Animal Ectoderm\|genotype:WT TgSebox::eGFP embryos\|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS	GSM7989703	GSM7989703: Zebrafish Animal Ectoderm 7.5 hpf 3; Danio rerio; RNA Seq	GSM7989703 r1	GSM7989703	1	Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP479683			Animal_Ectoderm_3.mate1.fastq.gz Animal_Ectoderm_3.mate2.fastq.gz	fastq fastq	6802628678.0	29741168.0	GSM7989703 r1	0:78.73 1:150	A:1935418861;C:1362666541;G:1651315180;T:1846520380;N:6707716	78	150	1935418861	1362666541	1651315180	1846520380	6707716	SRX23006264	SRS19970076	SRA1774740	Heisenberg group, Institute of Science and Technology Austria (ISTA)	Heisenberg group, Institute of Science and Technology Austria (ISTA)	2	0.74265	0.48713	0.04983	0.02636	0.87771	0.90335	0.72388	0.71557	68	150	B	B	mate2-mate1 similar by mapping diff	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	Austria	2023-12-22	Gastrula	Embryo	Embryo Imprecise	All anatomical structures
29208	29208	SRR27329263	SRX23006263	SRS19970075	SRP479683	PRJNA1055904	BMP dependent patterning of ectoderm tissue material properties modulates lateral mesendoderm cell migration during early zebrafish gastrulation	GSE251904	Transcriptome Analysis	Cell migration is a fundamental process during embryonic development. Most studies in vivo have focussed on the migration of cells using the extracellular matrix ECM as their substrate for migration. In contrast much less is known about how cells migrate on other cells as found in early embryos when the ECM has not yet formed. Here we show that lateral mesendoderm LME cells in the early zebrafish gastrula use the ectoderm as their substrate for migration. We show that the lateral ectoderm is permissive for the animal pole directed migration of LME cells while the ectoderm at the animal pole halts it. These differences in the permissiveness depend on the lateral ectoderm being more cohesive than the animal ectoderm a property controlled by BMP signalling within the ectoderm. Collectively these findings identify ectoderm tissue cohesion as one critical factor regulating LME migration during zebrafish gastrulation. Overall design: To investigate the differences in gene expression between animal and lateral ectoderm causing the difference in material properties between the two ectodermal tissues.		pubmed:40057955		Zebrafish Animal Ectoderm 7.5 hpf 2	GSM7989702		source name:Animal Ectoderm\|tissue:Animal Ectoderm\|genotype:WT TgSebox::eGFP embryos\|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS\|geo loc name:missing\|collection date:missing	Zebrafish Animal Ectoderm 7.5 hpf 2	FastQC quality control Trimmomatic adapter & quality trimming; parameters: 2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:19 FastQC controlling trimming results salmon Alignment; used flags: seqBias qcBias R DESeq2 differential gene expression analysis; DESEq2 apeglm tximport genefilter GenomicRanges R EnhancedVolcano & biomaRt visualization Assembly: Danio rerio GRCz11 Supplementary files format and content: tab delimited text file with gene name gene length effective length tpm and number of reads for each sample	Animal Ectoderm	Embryo were injected with 125 pg of PAmCherry1 mRNA at xxx cell stage. At 6 hpf embryos were mounted for up right imaging and a 444 x 220 x 58.5 µm volume was photoactivated using a 405 nm laser either at the animal pole or on the lateral side. The photoactivation process was composed of 10 cycles of 28 sec per embryo in a time window of approximately 90 min. post photoactivation embryos were transferred in Ca2+ free Ringer solution and dissociated by gently pipetting using a P 1000 pipette to obtain a single cell suspension. 5000 PAmCherry1+ cells were sorted in 150 µl of RTL plus lysis buffer RNeasy Plus Micro Kit QIAGEN with 1% of 2 mercaptoethanol.	Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems.	Embryos were kept at 28.5 C until dissociation	tissue:Animal Ectoderm\|genotype:WT TgSebox::eGFP embryos\|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS	GSM7989702	GSM7989702: Zebrafish Animal Ectoderm 7.5 hpf 2; Danio rerio; RNA Seq	GSM7989702 r1	GSM7989702	1	Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP479683			Animal_Ectoderm_2.mate1.fastq.gz Animal_Ectoderm_2.mate2.fastq.gz	fastq fastq	6083410864.0	26183986.0	GSM7989702 r1	0:82.33 1:150	A:1976903262;C:1110974120;G:1376486325;T:1613990197;N:5056960	82	150	1976903262	1110974120	1376486325	1613990197	5056960	SRX23006263	SRS19970075	SRA1774740	Heisenberg group, Institute of Science and Technology Austria (ISTA)	Heisenberg group, Institute of Science and Technology Austria (ISTA)	2	0.73078	0.55778	0.04052	0.02684	0.89509	0.91106	0.77391	0.7649	68	150	B	B	biological fallback assumption	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	Austria	2023-12-22	Gastrula	Embryo	Embryo Imprecise	All anatomical structures
29209	29209	SRR27329264	SRX23006262	SRS19970074	SRP479683	PRJNA1055904	BMP dependent patterning of ectoderm tissue material properties modulates lateral mesendoderm cell migration during early zebrafish gastrulation	GSE251904	Transcriptome Analysis	Cell migration is a fundamental process during embryonic development. Most studies in vivo have focussed on the migration of cells using the extracellular matrix ECM as their substrate for migration. In contrast much less is known about how cells migrate on other cells as found in early embryos when the ECM has not yet formed. Here we show that lateral mesendoderm LME cells in the early zebrafish gastrula use the ectoderm as their substrate for migration. We show that the lateral ectoderm is permissive for the animal pole directed migration of LME cells while the ectoderm at the animal pole halts it. These differences in the permissiveness depend on the lateral ectoderm being more cohesive than the animal ectoderm a property controlled by BMP signalling within the ectoderm. Collectively these findings identify ectoderm tissue cohesion as one critical factor regulating LME migration during zebrafish gastrulation. Overall design: To investigate the differences in gene expression between animal and lateral ectoderm causing the difference in material properties between the two ectodermal tissues.		pubmed:40057955		Zebrafish Animal Ectoderm 7.5 hpf 1	GSM7989701		source name:Animal Ectoderm\|tissue:Animal Ectoderm\|genotype:WT TgSebox::eGFP embryos\|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS\|geo loc name:missing\|collection date:missing	Zebrafish Animal Ectoderm 7.5 hpf 1	FastQC quality control Trimmomatic adapter & quality trimming; parameters: 2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:19 FastQC controlling trimming results salmon Alignment; used flags: seqBias qcBias R DESeq2 differential gene expression analysis; DESEq2 apeglm tximport genefilter GenomicRanges R EnhancedVolcano & biomaRt visualization Assembly: Danio rerio GRCz11 Supplementary files format and content: tab delimited text file with gene name gene length effective length tpm and number of reads for each sample	Animal Ectoderm	Embryo were injected with 125 pg of PAmCherry1 mRNA at xxx cell stage. At 6 hpf embryos were mounted for up right imaging and a 444 x 220 x 58.5 µm volume was photoactivated using a 405 nm laser either at the animal pole or on the lateral side. The photoactivation process was composed of 10 cycles of 28 sec per embryo in a time window of approximately 90 min. post photoactivation embryos were transferred in Ca2+ free Ringer solution and dissociated by gently pipetting using a P 1000 pipette to obtain a single cell suspension. 5000 PAmCherry1+ cells were sorted in 150 µl of RTL plus lysis buffer RNeasy Plus Micro Kit QIAGEN with 1% of 2 mercaptoethanol.	Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems.	Embryos were kept at 28.5 C until dissociation	tissue:Animal Ectoderm\|genotype:WT TgSebox::eGFP embryos\|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS	GSM7989701	GSM7989701: Zebrafish Animal Ectoderm 7.5 hpf 1; Danio rerio; RNA Seq	GSM7989701 r1	GSM7989701	1	Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP479683			Animal_Ectoderm_1.mate1.fastq.gz Animal_Ectoderm_1.mate2.fastq.gz	fastq fastq	7195859200.0	31306406.0	GSM7989701 r1	0:79.85 1:150	A:2025250331;C:1450062111;G:1771726396;T:1941745747;N:7074615	79	150	2025250331	1450062111	1771726396	1941745747	7074615	SRX23006262	SRS19970074	SRA1774740	Heisenberg group, Institute of Science and Technology Austria (ISTA)	Heisenberg group, Institute of Science and Technology Austria (ISTA)	2	0.74201	0.52197	0.04312	0.02595	0.87941	0.9013	0.74298	0.71509	68	150	B	B	mate2-mate1 similar by mapping diff	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	Austria	2023-12-22	Gastrula	Embryo	Embryo Imprecise	All anatomical structures
31773	31773	SRR28590145	SRX24189497	SRS20963520	SRP500320	PRJNA1097627	GPI transamidase complex is required for primordial germ cell migration and development in zebrafish	GSE263481	Transcriptome Analysis	Proteins without xxx domains could be anchored to the cell surface for regulating various biological processes when covalently linked to glycosylphosphatidylinositol GPI molecules by the GPI transamidase GPIT complex. However it remains poorly understood whether and how the GPIT complex affects primordial germ cell PGC development. In this study we report the important roles of GPI transamidase in PGC migration and development in zebrafish embryos. Mutation of pigu or pigk both encoding essential GPIT complex subunits resulted in defective PGC migration with ectopically located PGCs and reduction of PGC counts. Notably a detailed analysis of filopodia in PGCs reveals the attenuated polarity of filopodia distribution along the migration direction in mutant embryos. PGC transplantation and PGC specific rescue experiments demonstrate that both PGC and somatic cell expressed Pigu are required for PGC migration. Furthermore expression levels of PGC specific genes are decreased in pigu mutant PGCs with the derepression of somatic cell genes. Hence we propose that the GPIT complex plays a critical role during PGC migration and development. Overall design: To reveal molecular mechanisms underlying GPI transamidase mediated PGC migration regulation we performed RNA seq of PGCs in wild type and pigu / embryos at the shield and bud stages. We manually picked GFP positive PGCs post cell dissociation of embryos at the shield and bud stages. Then post genotyping of rest somatic cells PGCs with the same genotypes were pooled together and lysed for Smart seq of two biological replicates.		pubmed:39741393		WT shield PGCs RNA rep2	GSM8193374		source name:embryo\|tissue:embryo\|cell line:germ cell\|cell type:PGCs\|genotype:Wile type\|geo loc name:missing\|collection date:missing	WT shield PGCs RNA rep2	RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer11 by STAR version: STAR 2.5.3a modified. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1. Assembly: danRer11 Supplementary files format and content: tab delimited ext file includes FPKM values for each samples	embryo	GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 214 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette.	Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer’s instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.	The wild type Tuebingen Tu and India strains were used throughout the experiments. The transgenic line Tgkop:EGFP nanos 3’UTR citation was described before. Unless stated all embryos were raised in Holtfreter’s solution at 28.5°C and staged as described previously.	tissue:embryo\|cell line:germ cell\|cell type:PGCs\|genotype:Wile type	GSM8193374	GSM8193374: WT shield PGCs RNA rep2; Danio rerio; RNA Seq	GSM8193374 r1	GSM8193374	1	Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer's instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP500320			WT_shield_PGCs_RNA_rep2_r1.fq.gz WT_shield_PGCs_RNA_rep2_r2.fq.gz	fastq fastq	1476298800.0	4920996.0	GSM8193374 r1	0:150 1:150	A:364072227;C:345274481;G:387289011;T:379660776;N:2305	150	150	364072227	345274481	387289011	379660776	2305	SRX24189497	SRS20963520	SRA1842063	Tsinghua University	Tsinghua University	2	0.9277	0.92845	0.26727	0.2672	0.86803	0.86969	0.75933	0.75985	150	150	B	B	biological fallback assumption	illumina	nextseq	unknown	poly_a	unknown	sc	single_cell_plate	smartseq	China	2024-04-08	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
31774	31774	SRR28590146	SRX24189496	SRS20963519	SRP500320	PRJNA1097627	GPI transamidase complex is required for primordial germ cell migration and development in zebrafish	GSE263481	Transcriptome Analysis	Proteins without xxx domains could be anchored to the cell surface for regulating various biological processes when covalently linked to glycosylphosphatidylinositol GPI molecules by the GPI transamidase GPIT complex. However it remains poorly understood whether and how the GPIT complex affects primordial germ cell PGC development. In this study we report the important roles of GPI transamidase in PGC migration and development in zebrafish embryos. Mutation of pigu or pigk both encoding essential GPIT complex subunits resulted in defective PGC migration with ectopically located PGCs and reduction of PGC counts. Notably a detailed analysis of filopodia in PGCs reveals the attenuated polarity of filopodia distribution along the migration direction in mutant embryos. PGC transplantation and PGC specific rescue experiments demonstrate that both PGC and somatic cell expressed Pigu are required for PGC migration. Furthermore expression levels of PGC specific genes are decreased in pigu mutant PGCs with the derepression of somatic cell genes. Hence we propose that the GPIT complex plays a critical role during PGC migration and development. Overall design: To reveal molecular mechanisms underlying GPI transamidase mediated PGC migration regulation we performed RNA seq of PGCs in wild type and pigu / embryos at the shield and bud stages. We manually picked GFP positive PGCs post cell dissociation of embryos at the shield and bud stages. Then post genotyping of rest somatic cells PGCs with the same genotypes were pooled together and lysed for Smart seq of two biological replicates.		pubmed:39741393		WT shield PGCs RNA rep1	GSM8193373		source name:embryo\|tissue:embryo\|cell line:germ cell\|cell type:PGCs\|genotype:Wile type\|geo loc name:missing\|collection date:missing	WT shield PGCs RNA rep1	RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer11 by STAR version: STAR 2.5.3a modified. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1. Assembly: danRer11 Supplementary files format and content: tab delimited ext file includes FPKM values for each samples	embryo	GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 212 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette.	Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer’s instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.	The wild type Tuebingen Tu and India strains were used throughout the experiments. The transgenic line Tgkop:EGFP nanos 3’UTR citation was described before. Unless stated all embryos were raised in Holtfreter’s solution at 28.5°C and staged as described previously.	tissue:embryo\|cell line:germ cell\|cell type:PGCs\|genotype:Wile type	GSM8193373	GSM8193373: WT shield PGCs RNA rep1; Danio rerio; RNA Seq	GSM8193373 r1	GSM8193373	1	Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer's instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP500320			WT_shield_PGCs_RNA_rep1_r2.fq.gz WT_shield_PGCs_RNA_rep1_r1.fq.gz	fastq fastq	2758778100.0	9195927.0	GSM8193373 r1	0:150 1:150	A:769058521;C:582931819;G:614181069;T:792602904;N:3787	150	150	769058521	582931819	614181069	792602904	3787	SRX24189496	SRS20963519	SRA1842063	Tsinghua University	Tsinghua University	2	0.93691	0.91581	0.06844	0.06665	0.7683	0.76995	0.53645	0.52363	150	150	B	B	biological fallback assumption	illumina	nextseq	unknown	poly_a	unknown	sc	single_cell_plate	smartseq	China	2024-04-08	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
31775	31775	SRR28590147	SRX24189495	SRS20963518	SRP500320	PRJNA1097627	GPI transamidase complex is required for primordial germ cell migration and development in zebrafish	GSE263481	Transcriptome Analysis	Proteins without xxx domains could be anchored to the cell surface for regulating various biological processes when covalently linked to glycosylphosphatidylinositol GPI molecules by the GPI transamidase GPIT complex. However it remains poorly understood whether and how the GPIT complex affects primordial germ cell PGC development. In this study we report the important roles of GPI transamidase in PGC migration and development in zebrafish embryos. Mutation of pigu or pigk both encoding essential GPIT complex subunits resulted in defective PGC migration with ectopically located PGCs and reduction of PGC counts. Notably a detailed analysis of filopodia in PGCs reveals the attenuated polarity of filopodia distribution along the migration direction in mutant embryos. PGC transplantation and PGC specific rescue experiments demonstrate that both PGC and somatic cell expressed Pigu are required for PGC migration. Furthermore expression levels of PGC specific genes are decreased in pigu mutant PGCs with the derepression of somatic cell genes. Hence we propose that the GPIT complex plays a critical role during PGC migration and development. Overall design: To reveal molecular mechanisms underlying GPI transamidase mediated PGC migration regulation we performed RNA seq of PGCs in wild type and pigu / embryos at the shield and bud stages. We manually picked GFP positive PGCs post cell dissociation of embryos at the shield and bud stages. Then post genotyping of rest somatic cells PGCs with the same genotypes were pooled together and lysed for Smart seq of two biological replicates.		pubmed:39741393		WT bud PGCs RNA rep2	GSM8193372		source name:embryo\|tissue:embryo\|cell line:germ cell\|cell type:PGCs\|genotype:Wile type\|geo loc name:missing\|collection date:missing	WT bud PGCs RNA rep2	RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer11 by STAR version: STAR 2.5.3a modified. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1. Assembly: danRer11 Supplementary files format and content: tab delimited ext file includes FPKM values for each samples	embryo	GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 210 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette.	Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer’s instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.	The wild type Tuebingen Tu and India strains were used throughout the experiments. The transgenic line Tgkop:EGFP nanos 3’UTR citation was described before. Unless stated all embryos were raised in Holtfreter’s solution at 28.5°C and staged as described previously.	tissue:embryo\|cell line:germ cell\|cell type:PGCs\|genotype:Wile type	GSM8193372	GSM8193372: WT bud PGCs RNA rep2; Danio rerio; RNA Seq	GSM8193372 r1	GSM8193372	1	Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer's instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP500320			WT_bud_PGCs_RNA_rep2_r1.fq.gz WT_bud_PGCs_RNA_rep2_r2.fq.gz	fastq fastq	3111261300.0	10370871.0	GSM8193372 r1	0:150 1:150	A:817262319;C:691724200;G:751270343;T:850999265;N:5173	150	150	817262319	691724200	751270343	850999265	5173	SRX24189495	SRS20963518	SRA1842063	Tsinghua University	Tsinghua University	2	0.90729	0.9053	0.11596	0.1166	0.79963	0.79981	0.60276	0.59912	150	150	B	B	biological fallback assumption	illumina	nextseq	unknown	poly_a	unknown	sc	single_cell_plate	smartseq	China	2024-04-08	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
31776	31776	SRR28590148	SRX24189494	SRS20963517	SRP500320	PRJNA1097627	GPI transamidase complex is required for primordial germ cell migration and development in zebrafish	GSE263481	Transcriptome Analysis	Proteins without xxx domains could be anchored to the cell surface for regulating various biological processes when covalently linked to glycosylphosphatidylinositol GPI molecules by the GPI transamidase GPIT complex. However it remains poorly understood whether and how the GPIT complex affects primordial germ cell PGC development. In this study we report the important roles of GPI transamidase in PGC migration and development in zebrafish embryos. Mutation of pigu or pigk both encoding essential GPIT complex subunits resulted in defective PGC migration with ectopically located PGCs and reduction of PGC counts. Notably a detailed analysis of filopodia in PGCs reveals the attenuated polarity of filopodia distribution along the migration direction in mutant embryos. PGC transplantation and PGC specific rescue experiments demonstrate that both PGC and somatic cell expressed Pigu are required for PGC migration. Furthermore expression levels of PGC specific genes are decreased in pigu mutant PGCs with the derepression of somatic cell genes. Hence we propose that the GPIT complex plays a critical role during PGC migration and development. Overall design: To reveal molecular mechanisms underlying GPI transamidase mediated PGC migration regulation we performed RNA seq of PGCs in wild type and pigu / embryos at the shield and bud stages. We manually picked GFP positive PGCs post cell dissociation of embryos at the shield and bud stages. Then post genotyping of rest somatic cells PGCs with the same genotypes were pooled together and lysed for Smart seq of two biological replicates.		pubmed:39741393		WT bud PGCs RNA rep1	GSM8193371		source name:embryo\|tissue:embryo\|cell line:germ cell\|cell type:PGCs\|genotype:Wile type\|geo loc name:missing\|collection date:missing	WT bud PGCs RNA rep1	RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer11 by STAR version: STAR 2.5.3a modified. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1. Assembly: danRer11 Supplementary files format and content: tab delimited ext file includes FPKM values for each samples	embryo	GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 208 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette.	Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer’s instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.	The wild type Tuebingen Tu and India strains were used throughout the experiments. The transgenic line Tgkop:EGFP nanos 3’UTR citation was described before. Unless stated all embryos were raised in Holtfreter’s solution at 28.5°C and staged as described previously.	tissue:embryo\|cell line:germ cell\|cell type:PGCs\|genotype:Wile type	GSM8193371	GSM8193371: WT bud PGCs RNA rep1; Danio rerio; RNA Seq	GSM8193371 r1	GSM8193371	1	Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer's instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP500320			WT_bud_PGCs_RNA_rep1_r1.fq.gz WT_bud_PGCs_RNA_rep1_r2.fq.gz	fastq fastq	3758269200.0	12527564.0	GSM8193371 r1	0:150 1:150	A:1041649283;C:801966468;G:845188264;T:1069459832;N:5353	150	150	1041649283	801966468	845188264	1069459832	5353	SRX24189494	SRS20963517	SRA1842063	Tsinghua University	Tsinghua University	2	0.93714	0.91161	0.07974	0.07673	0.75785	0.76037	0.52906	0.52822	150	150	B	B	biological fallback assumption	illumina	nextseq	unknown	poly_a	unknown	sc	single_cell_plate	smartseq	China	2024-04-08	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
31777	31777	SRR28590149	SRX24189493	SRS20963516	SRP500320	PRJNA1097627	GPI transamidase complex is required for primordial germ cell migration and development in zebrafish	GSE263481	Transcriptome Analysis	Proteins without xxx domains could be anchored to the cell surface for regulating various biological processes when covalently linked to glycosylphosphatidylinositol GPI molecules by the GPI transamidase GPIT complex. However it remains poorly understood whether and how the GPIT complex affects primordial germ cell PGC development. In this study we report the important roles of GPI transamidase in PGC migration and development in zebrafish embryos. Mutation of pigu or pigk both encoding essential GPIT complex subunits resulted in defective PGC migration with ectopically located PGCs and reduction of PGC counts. Notably a detailed analysis of filopodia in PGCs reveals the attenuated polarity of filopodia distribution along the migration direction in mutant embryos. PGC transplantation and PGC specific rescue experiments demonstrate that both PGC and somatic cell expressed Pigu are required for PGC migration. Furthermore expression levels of PGC specific genes are decreased in pigu mutant PGCs with the derepression of somatic cell genes. Hence we propose that the GPIT complex plays a critical role during PGC migration and development. Overall design: To reveal molecular mechanisms underlying GPI transamidase mediated PGC migration regulation we performed RNA seq of PGCs in wild type and pigu / embryos at the shield and bud stages. We manually picked GFP positive PGCs post cell dissociation of embryos at the shield and bud stages. Then post genotyping of rest somatic cells PGCs with the same genotypes were pooled together and lysed for Smart seq of two biological replicates.		pubmed:39741393		pigu homo shield PGCs RNA rep2	GSM8193370		source name:embryo\|tissue:embryo\|cell line:germ cell\|cell type:PGCs\|genotype:pigu homo\|geo loc name:missing\|collection date:missing	pigu homo shield PGCs RNA rep2	RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer11 by STAR version: STAR 2.5.3a modified. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1. Assembly: danRer11 Supplementary files format and content: tab delimited ext file includes FPKM values for each samples	embryo	GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 206 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette.	Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer’s instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.	The wild type Tuebingen Tu and India strains were used throughout the experiments. The transgenic line Tgkop:EGFP nanos 3’UTR citation was described before. Unless stated all embryos were raised in Holtfreter’s solution at 28.5°C and staged as described previously.	tissue:embryo\|cell line:germ cell\|cell type:PGCs\|genotype:pigu homo	GSM8193370	GSM8193370: pigu homo shield PGCs RNA rep2; Danio rerio; RNA Seq	GSM8193370 r1	GSM8193370	1	Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer's instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP500320			pigu_homo_shield_PGCs_RNA_rep2_r2.fq.gz pigu_homo_shield_PGCs_RNA_rep2_r1.fq.gz	fastq fastq	875630700.0	2918769.0	GSM8193370 r1	0:150 1:150	A:229625544;C:190227589;G:217096984;T:238679075;N:1508	150	150	229625544	190227589	217096984	238679075	1508	SRX24189493	SRS20963516	SRA1842063	Tsinghua University	Tsinghua University	2	0.81852	0.81643	0.19346	0.19329	0.89852	0.89897	0.83525	0.83082	150	150	B	B	biological fallback assumption	illumina	nextseq	unknown	poly_a	unknown	sc	single_cell_plate	smartseq	China	2024-04-08	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
31778	31778	SRR28590150	SRX24189492	SRS20963515	SRP500320	PRJNA1097627	GPI transamidase complex is required for primordial germ cell migration and development in zebrafish	GSE263481	Transcriptome Analysis	Proteins without xxx domains could be anchored to the cell surface for regulating various biological processes when covalently linked to glycosylphosphatidylinositol GPI molecules by the GPI transamidase GPIT complex. However it remains poorly understood whether and how the GPIT complex affects primordial germ cell PGC development. In this study we report the important roles of GPI transamidase in PGC migration and development in zebrafish embryos. Mutation of pigu or pigk both encoding essential GPIT complex subunits resulted in defective PGC migration with ectopically located PGCs and reduction of PGC counts. Notably a detailed analysis of filopodia in PGCs reveals the attenuated polarity of filopodia distribution along the migration direction in mutant embryos. PGC transplantation and PGC specific rescue experiments demonstrate that both PGC and somatic cell expressed Pigu are required for PGC migration. Furthermore expression levels of PGC specific genes are decreased in pigu mutant PGCs with the derepression of somatic cell genes. Hence we propose that the GPIT complex plays a critical role during PGC migration and development. Overall design: To reveal molecular mechanisms underlying GPI transamidase mediated PGC migration regulation we performed RNA seq of PGCs in wild type and pigu / embryos at the shield and bud stages. We manually picked GFP positive PGCs post cell dissociation of embryos at the shield and bud stages. Then post genotyping of rest somatic cells PGCs with the same genotypes were pooled together and lysed for Smart seq of two biological replicates.		pubmed:39741393		pigu homo shield PGCs RNA rep1	GSM8193369		source name:embryo\|tissue:embryo\|cell line:germ cell\|cell type:PGCs\|genotype:pigu homo\|geo loc name:missing\|collection date:missing	pigu homo shield PGCs RNA rep1	RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer11 by STAR version: STAR 2.5.3a modified. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1. Assembly: danRer11 Supplementary files format and content: tab delimited ext file includes FPKM values for each samples	embryo	GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 204 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette.	Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer’s instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.	The wild type Tuebingen Tu and India strains were used throughout the experiments. The transgenic line Tgkop:EGFP nanos 3’UTR citation was described before. Unless stated all embryos were raised in Holtfreter’s solution at 28.5°C and staged as described previously.	tissue:embryo\|cell line:germ cell\|cell type:PGCs\|genotype:pigu homo	GSM8193369	GSM8193369: pigu homo shield PGCs RNA rep1; Danio rerio; RNA Seq	GSM8193369 r1	GSM8193369	1	Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer's instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP500320			pigu_homo_shield_PGCs_RNA_rep1_r2.fq.gz pigu_homo_shield_PGCs_RNA_rep1_r1.fq.gz	fastq fastq	2204383800.0	7347946.0	GSM8193369 r1	0:150 1:150	A:618947181;C:459789570;G:491705141;T:633938869;N:3039	150	150	618947181	459789570	491705141	633938869	3039	SRX24189492	SRS20963515	SRA1842063	Tsinghua University	Tsinghua University	2	0.91971	0.9203	0.0732	0.07256	0.77512	0.77516	0.53347	0.53419	150	150	B	B	biological fallback assumption	illumina	nextseq	unknown	poly_a	unknown	sc	single_cell_plate	smartseq	China	2024-04-08	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
31779	31779	SRR28590151	SRX24189491	SRS20963514	SRP500320	PRJNA1097627	GPI transamidase complex is required for primordial germ cell migration and development in zebrafish	GSE263481	Transcriptome Analysis	Proteins without xxx domains could be anchored to the cell surface for regulating various biological processes when covalently linked to glycosylphosphatidylinositol GPI molecules by the GPI transamidase GPIT complex. However it remains poorly understood whether and how the GPIT complex affects primordial germ cell PGC development. In this study we report the important roles of GPI transamidase in PGC migration and development in zebrafish embryos. Mutation of pigu or pigk both encoding essential GPIT complex subunits resulted in defective PGC migration with ectopically located PGCs and reduction of PGC counts. Notably a detailed analysis of filopodia in PGCs reveals the attenuated polarity of filopodia distribution along the migration direction in mutant embryos. PGC transplantation and PGC specific rescue experiments demonstrate that both PGC and somatic cell expressed Pigu are required for PGC migration. Furthermore expression levels of PGC specific genes are decreased in pigu mutant PGCs with the derepression of somatic cell genes. Hence we propose that the GPIT complex plays a critical role during PGC migration and development. Overall design: To reveal molecular mechanisms underlying GPI transamidase mediated PGC migration regulation we performed RNA seq of PGCs in wild type and pigu / embryos at the shield and bud stages. We manually picked GFP positive PGCs post cell dissociation of embryos at the shield and bud stages. Then post genotyping of rest somatic cells PGCs with the same genotypes were pooled together and lysed for Smart seq of two biological replicates.		pubmed:39741393		pigu homo bud PGCs RNA rep2	GSM8193368		source name:embryo\|tissue:embryo\|cell line:germ cell\|cell type:PGCs\|genotype:pigu homo\|geo loc name:missing\|collection date:missing	pigu homo bud PGCs RNA rep2	RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer11 by STAR version: STAR 2.5.3a modified. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1. Assembly: danRer11 Supplementary files format and content: tab delimited ext file includes FPKM values for each samples	embryo	GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 202 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette.	Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer’s instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.	The wild type Tuebingen Tu and India strains were used throughout the experiments. The transgenic line Tgkop:EGFP nanos 3’UTR citation was described before. Unless stated all embryos were raised in Holtfreter’s solution at 28.5°C and staged as described previously.	tissue:embryo\|cell line:germ cell\|cell type:PGCs\|genotype:pigu homo	GSM8193368	GSM8193368: pigu homo bud PGCs RNA rep2; Danio rerio; RNA Seq	GSM8193368 r1	GSM8193368	1	Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer's instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP500320			pigu_homo_bud_PGCs_RNA_rep2_r1.fq.gz pigu_homo_bud_PGCs_RNA_rep2_r2.fq.gz	fastq fastq	2137638000.0	7125460.0	GSM8193368 r1	0:150 1:150	A:588045273;C:460739300;G:496293927;T:592556088;N:3412	150	150	588045273	460739300	496293927	592556088	3412	SRX24189491	SRS20963514	SRA1842063	Tsinghua University	Tsinghua University	2	0.36533	0.36278	0.05703	0.057	0.87754	0.87811	0.60206	0.59677	150	150	B	B	biological fallback assumption	illumina	nextseq	unknown	poly_a	unknown	sc	single_cell_plate	smartseq	China	2024-04-08	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
31780	31780	SRR28590152	SRX24189490	SRS20963513	SRP500320	PRJNA1097627	GPI transamidase complex is required for primordial germ cell migration and development in zebrafish	GSE263481	Transcriptome Analysis	Proteins without xxx domains could be anchored to the cell surface for regulating various biological processes when covalently linked to glycosylphosphatidylinositol GPI molecules by the GPI transamidase GPIT complex. However it remains poorly understood whether and how the GPIT complex affects primordial germ cell PGC development. In this study we report the important roles of GPI transamidase in PGC migration and development in zebrafish embryos. Mutation of pigu or pigk both encoding essential GPIT complex subunits resulted in defective PGC migration with ectopically located PGCs and reduction of PGC counts. Notably a detailed analysis of filopodia in PGCs reveals the attenuated polarity of filopodia distribution along the migration direction in mutant embryos. PGC transplantation and PGC specific rescue experiments demonstrate that both PGC and somatic cell expressed Pigu are required for PGC migration. Furthermore expression levels of PGC specific genes are decreased in pigu mutant PGCs with the derepression of somatic cell genes. Hence we propose that the GPIT complex plays a critical role during PGC migration and development. Overall design: To reveal molecular mechanisms underlying GPI transamidase mediated PGC migration regulation we performed RNA seq of PGCs in wild type and pigu / embryos at the shield and bud stages. We manually picked GFP positive PGCs post cell dissociation of embryos at the shield and bud stages. Then post genotyping of rest somatic cells PGCs with the same genotypes were pooled together and lysed for Smart seq of two biological replicates.		pubmed:39741393		pigu homo bud PGCs RNA rep1	GSM8193367		source name:embryo\|tissue:embryo\|cell line:germ cell\|cell type:PGCs\|genotype:pigu homo\|geo loc name:missing\|collection date:missing	pigu homo bud PGCs RNA rep1	RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer11 by STAR version: STAR 2.5.3a modified. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1. Assembly: danRer11 Supplementary files format and content: tab delimited ext file includes FPKM values for each samples	embryo	GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette.	Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer’s instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.	The wild type Tuebingen Tu and India strains were used throughout the experiments. The transgenic line Tgkop:EGFP nanos 3’UTR citation was described before. Unless stated all embryos were raised in Holtfreter’s solution at 28.5°C and staged as described previously.	tissue:embryo\|cell line:germ cell\|cell type:PGCs\|genotype:pigu homo	GSM8193367	GSM8193367: pigu homo bud PGCs RNA rep1; Danio rerio; RNA Seq	GSM8193367 r1	GSM8193367	1	Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer's instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP500320			pigu_homo_bud_PGCs_RNA_rep1_r1.fq.gz pigu_homo_bud_PGCs_RNA_rep1_r2.fq.gz	fastq fastq	2734187100.0	9113957.0	GSM8193367 r1	0:150 1:150	A:729072634;C:614811431;G:644751435;T:745548063;N:3537	150	150	729072634	614811431	644751435	745548063	3537	SRX24189490	SRS20963513	SRA1842063	Tsinghua University	Tsinghua University	2	0.94018	0.93763	0.11685	0.1143	0.77749	0.78204	0.50988	0.50832	150	150	B	B	biological fallback assumption	illumina	nextseq	unknown	poly_a	unknown	sc	single_cell_plate	smartseq	China	2024-04-08	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
35474	35474	SRR32818793	SRX28102226	SRS24458273	SRP572438	PRJNA1240805	Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset	GSE292682	Transcriptome Analysis	Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.		pubmed:40145570		sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 4	GSM8863184		source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf\|geo loc name:missing\|collection date:missing	sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 4	Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples	FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos		36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf	GSM8863184	GSM8863184: sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 4; Danio rerio; RNA Seq	GSM8863184 r1	GSM8863184	1	36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 4000	SRP572438			p48-4-READ1-Sequences.txt p48-4-READ2-Sequences.txt	fastq fastq	6624217400.0	33121087.0	GSM8863184 r1	0:100 1:100	A:1723006485;C:1604147349;G:1556891221;T:1739763662;N:408683	100	100	1723006485	1604147349	1556891221	1739763662	408683	SRX28102226	SRS24458273	SRA2098458	UC Irvine	UC Irvine												B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	United States	2025-03-23	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
35475	35475	SRR32818794	SRX28102225	SRS24458272	SRP572438	PRJNA1240805	Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset	GSE292682	Transcriptome Analysis	Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.		pubmed:40145570		sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 3	GSM8863183		source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf\|geo loc name:missing\|collection date:missing	sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 3	Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples	FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos		36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf	GSM8863183	GSM8863183: sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 3; Danio rerio; RNA Seq	GSM8863183 r1	GSM8863183	1	36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 4000	SRP572438			p48-3-READ1-Sequences.txt p48-3-READ2-Sequences.txt	fastq fastq	5127128400.0	25635642.0	GSM8863183 r1	0:100 1:100	A:1321647066;C:1250868808;G:1210591826;T:1343703952;N:316748	100	100	1321647066	1250868808	1210591826	1343703952	316748	SRX28102225	SRS24458272	SRA2098458	UC Irvine	UC Irvine												B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	United States	2025-03-23	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
35476	35476	SRR32818795	SRX28102224	SRS24458271	SRP572438	PRJNA1240805	Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset	GSE292682	Transcriptome Analysis	Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.		pubmed:40145570		sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 2	GSM8863182		source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf\|geo loc name:missing\|collection date:missing	sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 2	Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples	FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos		36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf	GSM8863182	GSM8863182: sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 2; Danio rerio; RNA Seq	GSM8863182 r1	GSM8863182	1	36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 4000	SRP572438			p48-2-READ1-Sequences.txt p48-2-READ2-Sequences.txt	fastq fastq	6832644200.0	34163221.0	GSM8863182 r1	0:100 1:100	A:1762283242;C:1668293067;G:1612470421;T:1789177247;N:420223	100	100	1762283242	1668293067	1612470421	1789177247	420223	SRX28102224	SRS24458271	SRA2098458	UC Irvine	UC Irvine												B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	United States	2025-03-23	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
35477	35477	SRR32818796	SRX28102223	SRS24458270	SRP572438	PRJNA1240805	Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset	GSE292682	Transcriptome Analysis	Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.		pubmed:40145570		sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 1	GSM8863181		source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf\|geo loc name:missing\|collection date:missing	sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 1	Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples	FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos		36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf	GSM8863181	GSM8863181: sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 1; Danio rerio; RNA Seq	GSM8863181 r1	GSM8863181	1	36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 4000	SRP572438			p48-1-READ1-Sequences.txt p48-1-READ2-Sequences.txt	fastq fastq	6861200200.0	34306001.0	GSM8863181 r1	0:100 1:100	A:1765390165;C:1682522416;G:1623224185;T:1789639564;N:423870	100	100	1765390165	1682522416	1623224185	1789639564	423870	SRX28102223	SRS24458270	SRA2098458	UC Irvine	UC Irvine												B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	United States	2025-03-23	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
35478	35478	SRR32818797	SRX28102222	SRS24458269	SRP572438	PRJNA1240805	Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset	GSE292682	Transcriptome Analysis	Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.		pubmed:40145570		sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 7	GSM8863180		source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:36 hpf\|geo loc name:missing\|collection date:missing	sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 7	Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples	FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos		36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:36 hpf	GSM8863180	GSM8863180: sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 7; Danio rerio; RNA Seq	GSM8863180 r1	GSM8863180	1	36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 4000	SRP572438			p36-7-READ1-Sequences.txt p36-7-READ2-Sequences.txt	fastq fastq	5620392000.0	28101960.0	GSM8863180 r1	0:100 1:100	A:1445709762;C:1377367138;G:1310017425;T:1486952834;N:344841	100	100	1445709762	1377367138	1310017425	1486952834	344841	SRX28102222	SRS24458269	SRA2098458	UC Irvine	UC Irvine												B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	United States	2025-03-23	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
35479	35479	SRR32818798	SRX28102221	SRS24458268	SRP572438	PRJNA1240805	Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset	GSE292682	Transcriptome Analysis	Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.		pubmed:40145570		sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 6	GSM8863179		source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:36 hpf\|geo loc name:missing\|collection date:missing	sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 6	Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples	FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos		36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:36 hpf	GSM8863179	GSM8863179: sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 6; Danio rerio; RNA Seq	GSM8863179 r1	GSM8863179	1	36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 4000	SRP572438			p36-6-READ1-Sequences.txt p36-6-READ2-Sequences.txt	fastq fastq	7568489000.0	37842445.0	GSM8863179 r1	0:100 1:100	A:1969395695;C:1827574975;G:1754405241;T:2016644374;N:468715	100	100	1969395695	1827574975	1754405241	2016644374	468715	SRX28102221	SRS24458268	SRA2098458	UC Irvine	UC Irvine												B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	United States	2025-03-23	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
35480	35480	SRR32818799	SRX28102220	SRS24458267	SRP572438	PRJNA1240805	Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset	GSE292682	Transcriptome Analysis	Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.		pubmed:40145570		sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 5	GSM8863178		source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:36 hpf\|geo loc name:missing\|collection date:missing	sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 5	Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples	FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos		36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:36 hpf	GSM8863178	GSM8863178: sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 5; Danio rerio; RNA Seq	GSM8863178 r1	GSM8863178	1	36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 4000	SRP572438			p36-5-READ1-Sequences.txt p36-5-READ2-Sequences.txt	fastq fastq	6657832800.0	33289164.0	GSM8863178 r1	0:100 1:100	A:1726677355;C:1613449895;G:1548951675;T:1768343661;N:410214	100	100	1726677355	1613449895	1548951675	1768343661	410214	SRX28102220	SRS24458267	SRA2098458	UC Irvine	UC Irvine												B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	United States	2025-03-23	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
35481	35481	SRR32818800	SRX28102219	SRS24458266	SRP572438	PRJNA1240805	Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset	GSE292682	Transcriptome Analysis	Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.		pubmed:40145570		sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 4	GSM8863177		source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:36 hpf\|geo loc name:missing\|collection date:missing	sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 4	Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples	FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos		36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:36 hpf	GSM8863177	GSM8863177: sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 4; Danio rerio; RNA Seq	GSM8863177 r1	GSM8863177	1	36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 4000	SRP572438			p36-4-READ1-Sequences.txt p36-4-READ2-Sequences.txt	fastq fastq	5153263800.0	25766319.0	GSM8863177 r1	0:100 1:100	A:1334474056;C:1251026482;G:1191417010;T:1376027996;N:318256	100	100	1334474056	1251026482	1191417010	1376027996	318256	SRX28102219	SRS24458266	SRA2098458	UC Irvine	UC Irvine												B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	United States	2025-03-23	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
35482	35482	SRR32818801	SRX28102218	SRS24458265	SRP572438	PRJNA1240805	Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset	GSE292682	Transcriptome Analysis	Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.		pubmed:40145570		sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 3	GSM8863176		source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:36 hpf\|geo loc name:missing\|collection date:missing	sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 3	Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples	FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos		36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:36 hpf	GSM8863176	GSM8863176: sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 3; Danio rerio; RNA Seq	GSM8863176 r1	GSM8863176	1	36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 4000	SRP572438			p36-3-READ1-Sequences.txt p36-3-READ2-Sequences.txt	fastq fastq	6089823000.0	30449115.0	GSM8863176 r1	0:100 1:100	A:1565216204;C:1493655703;G:1438012972;T:1592561753;N:376368	100	100	1565216204	1493655703	1438012972	1592561753	376368	SRX28102218	SRS24458265	SRA2098458	UC Irvine	UC Irvine												B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	United States	2025-03-23	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
35483	35483	SRR32818802	SRX28102217	SRS24458264	SRP572438	PRJNA1240805	Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset	GSE292682	Transcriptome Analysis	Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.		pubmed:40145570		sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 2	GSM8863175		source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:36 hpf\|geo loc name:missing\|collection date:missing	sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 2	Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples	FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos		36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:36 hpf	GSM8863175	GSM8863175: sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 2; Danio rerio; RNA Seq	GSM8863175 r1	GSM8863175	1	36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 4000	SRP572438			p36-2-READ1-Sequences.txt p36-2-READ2-Sequences.txt	fastq fastq	5575798600.0	27878993.0	GSM8863175 r1	0:100 1:100	A:1443367045;C:1355595610;G:1298738880;T:1477753374;N:343691	100	100	1443367045	1355595610	1298738880	1477753374	343691	SRX28102217	SRS24458264	SRA2098458	UC Irvine	UC Irvine												B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	United States	2025-03-23	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
35484	35484	SRR32818803	SRX28102216	SRS24458263	SRP572438	PRJNA1240805	Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset	GSE292682	Transcriptome Analysis	Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.		pubmed:40145570		sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 1	GSM8863174		source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:36 hpf\|geo loc name:missing\|collection date:missing	sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 1	Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples	FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos		36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:36 hpf	GSM8863174	GSM8863174: sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 1; Danio rerio; RNA Seq	GSM8863174 r1	GSM8863174	1	36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 4000	SRP572438			p36-1-READ1-Sequences.txt p36-1-READ2-Sequences.txt	fastq fastq	6686065200.0	33430326.0	GSM8863174 r1	0:100 1:100	A:1705825267;C:1656952667;G:1564381164;T:1758493189;N:412913	100	100	1705825267	1656952667	1564381164	1758493189	412913	SRX28102216	SRS24458263	SRA2098458	UC Irvine	UC Irvine												B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	United States	2025-03-23	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38457	38457	SRR1873001	SRX914893	SRS869409	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923		zf3 dis S366	GSM1629126		tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S366	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629126	GSM1629126: zf3 dis S366; Danio rerio; RNA Seq	GSM1629126		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629126	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996		loader:fastq load.py	zf3_dis_S366.R2.fq zf3_dis_S366.R1.fq	fastq fastq	13953150.0	279063.0	GSM1629126 r1	0:25 1:25	A:3638478;C:3221565;G:3250022;T:3754586;N:88499	25	25	3638478	3221565	3250022	3754586	88499	SRX914893	SRS869409	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.68547	0.72347	0.17435	0.1776	0.89883	0.87645	0.78642	0.70697	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38458	38458	SRR1873000	SRX914892	SRS869415	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923		zf3 dis S365	GSM1629125		tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S365	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629125	GSM1629125: zf3 dis S365; Danio rerio; RNA Seq	GSM1629125		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629125	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996		loader:fastq load.py	zf3_dis_S365.R1.fq zf3_dis_S365.R2.fq	fastq fastq	18319750.0	366395.0	GSM1629125 r1	0:25 1:25	A:4713431;C:4306960;G:4405843;T:4784636;N:108880	25	25	4713431	4306960	4405843	4784636	108880	SRX914892	SRS869415	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.45031	0.41097	0.17574	0.16675	0.91098	0.92383	0.57619	0.61898	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38459	38459	SRR1872999	SRX914891	SRS869411	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923		zf3 dis S364	GSM1629124		tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S364	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629124	GSM1629124: zf3 dis S364; Danio rerio; RNA Seq	GSM1629124		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629124	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996		loader:fastq load.py	zf3_dis_S364.R1.fq zf3_dis_S364.R2.fq	fastq fastq	16291400.0	325828.0	GSM1629124 r1	0:25 1:25	A:4127905;C:3884549;G:3934831;T:4281925;N:62190	25	25	4127905	3884549	3934831	4281925	62190	SRX914891	SRS869411	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.64233	0.58456	0.18268	0.16828	0.89079	0.91056	0.69046	0.76873	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38460	38460	SRR1872998	SRX914890	SRS869413	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923		zf3 dis S363	GSM1629123		tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S363	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629123	GSM1629123: zf3 dis S363; Danio rerio; RNA Seq	GSM1629123		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629123	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996		loader:fastq load.py	zf3_dis_S363.R1.fq zf3_dis_S363.R2.fq	fastq fastq	24979500.0	499590.0	GSM1629123 r1	0:25 1:25	A:6522125;C:5838067;G:5906327;T:6630372;N:82609	25	25	6522125	5838067	5906327	6630372	82609	SRX914890	SRS869413	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.78356	0.7193	0.35183	0.32737	0.85096	0.86953	0.65229	0.72787	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38461	38461	SRR1872997	SRX914889	SRS869410	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923		zf3 dis S362	GSM1629122		tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S362	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629122	GSM1629122: zf3 dis S362; Danio rerio; RNA Seq	GSM1629122		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629122	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996		loader:fastq load.py	zf3_dis_S362.R1.fq zf3_dis_S362.R2.fq	fastq fastq	25961150.0	519223.0	GSM1629122 r1	0:25 1:25	A:6513860;C:6274276;G:6330224;T:6742925;N:99865	25	25	6513860	6274276	6330224	6742925	99865	SRX914889	SRS869410	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.64392	0.70212	0.20822	0.2179	0.90449	0.88544	0.7447	0.66953	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38462	38462	SRR1872996	SRX914888	SRS869414	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923		zf3 dis S361	GSM1629121		tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S361	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629121	GSM1629121: zf3 dis S361; Danio rerio; RNA Seq	GSM1629121		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629121	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996		loader:fastq load.py	zf3_dis_S361.R1.fq zf3_dis_S361.R2.fq	fastq fastq	31158400.0	623168.0	GSM1629121 r1	0:25 1:25	A:8003929;C:7345167;G:7419409;T:8283464;N:106431	25	25	8003929	7345167	7419409	8283464	106431	SRX914888	SRS869414	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.69021	0.64535	0.18688	0.18054	0.86624	0.88789	0.69784	0.78517	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38463	38463	SRR1872995	SRX914887	SRS869416	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923		zf3 dis S360	GSM1629120		tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S360	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629120	GSM1629120: zf3 dis S360; Danio rerio; RNA Seq	GSM1629120		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629120	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996		loader:fastq load.py	zf3_dis_S360.R1.fq zf3_dis_S360.R2.fq	fastq fastq	65650.0	1313.0	GSM1629120 r1	0:25 1:25	A:16756;C:15635;G:13912;T:19083;N:264	25	25	16756	15635	13912	19083	264	SRX914887	SRS869416	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.6792	0.7566	0.21098	0.22718	0.99823	0.99667	0.76729	0.68093	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38464	38464	SRR1872994	SRX914886	SRS869408	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923		zf3 dis S359	GSM1629119		tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S359	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629119	GSM1629119: zf3 dis S359; Danio rerio; RNA Seq	GSM1629119		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629119	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996		loader:fastq load.py	zf3_dis_S359.R1.fq zf3_dis_S359.R2.fq	fastq fastq	11699050.0	233981.0	GSM1629119 r1	0:25 1:25	A:3029078;C:2720012;G:2748834;T:3147149;N:53977	25	25	3029078	2720012	2748834	3147149	53977	SRX914886	SRS869408	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.73706	0.69089	0.16704	0.16123	0.88795	0.90696	0.71161	0.78714	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38465	38465	SRR1872993	SRX914885	SRS869417	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923		zf3 dis S358	GSM1629118		tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S358	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629118	GSM1629118: zf3 dis S358; Danio rerio; RNA Seq	GSM1629118		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629118	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996		loader:fastq load.py	zf3_dis_S358.R2.fq zf3_dis_S358.R1.fq	fastq fastq	9555800.0	191116.0	GSM1629118 r1	0:25 1:25	A:2455617;C:2236174;G:2275012;T:2547459;N:41538	25	25	2455617	2236174	2275012	2547459	41538	SRX914885	SRS869417	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.71513	0.67049	0.20389	0.18909	0.90289	0.91758	0.72281	0.78587	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38466	38466	SRR1872992	SRX914884	SRS869420	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923		zf3 dis S357	GSM1629117		tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S357	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629117	GSM1629117: zf3 dis S357; Danio rerio; RNA Seq	GSM1629117		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629117	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996		loader:fastq load.py	zf3_dis_S357.R1.fq zf3_dis_S357.R2.fq	fastq fastq	6685400.0	133708.0	GSM1629117 r1	0:25 1:25	A:1794401;C:1506998;G:1499676;T:1830754;N:53571	25	25	1794401	1506998	1499676	1830754	53571	SRX914884	SRS869420	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.51579	0.51107	0.13925	0.12582	0.95089	0.95828	0.33071	0.8304	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38467	38467	SRR1872991	SRX914883	SRS869418	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923		zf3 dis S356	GSM1629116		tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S356	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629116	GSM1629116: zf3 dis S356; Danio rerio; RNA Seq	GSM1629116		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629116	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996		loader:fastq load.py	zf3_dis_S356.R2.fq zf3_dis_S356.R1.fq	fastq fastq	11637750.0	232755.0	GSM1629116 r1	0:25 1:25	A:2892151;C:2796777;G:2856920;T:3041989;N:49913	25	25	2892151	2796777	2856920	3041989	49913	SRX914883	SRS869418	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.78167	0.71632	0.23745	0.21955	0.89262	0.91054	0.67329	0.74109	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38468	38468	SRR1872990	SRX914882	SRS869419	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923		zf3 dis S355	GSM1629115		tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S355	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629115	GSM1629115: zf3 dis S355; Danio rerio; RNA Seq	GSM1629115		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629115	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996		loader:fastq load.py	zf3_dis_S355.R2.fq zf3_dis_S355.R1.fq	fastq fastq	16269550.0	325391.0	GSM1629115 r1	0:25 1:25	A:4085539;C:3887330;G:3971738;T:4261948;N:62995	25	25	4085539	3887330	3971738	4261948	62995	SRX914882	SRS869419	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.67445	0.74201	0.22487	0.24114	0.90473	0.88637	0.73772	0.66677	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38469	38469	SRR1872989	SRX914881	SRS869421	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923		zf3 dis S354	GSM1629114		tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S354	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629114	GSM1629114: zf3 dis S354; Danio rerio; RNA Seq	GSM1629114		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629114	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996		loader:fastq load.py	zf3_dis_S354.R1.fq zf3_dis_S354.R2.fq	fastq fastq	17585450.0	351709.0	GSM1629114 r1	0:25 1:25	A:4659589;C:4039300;G:4045812;T:4733042;N:107707	25	25	4659589	4039300	4045812	4733042	107707	SRX914881	SRS869421	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.4878	0.45754	0.15743	0.15052	0.91849	0.9321	0.70142	0.77697	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38470	38470	SRR1872988	SRX914880	SRS869422	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923		zf3 dis S353	GSM1629113		tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S353	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629113	GSM1629113: zf3 dis S353; Danio rerio; RNA Seq	GSM1629113		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629113	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996		loader:fastq load.py	zf3_dis_S353.R2.fq zf3_dis_S353.R1.fq	fastq fastq	14485550.0	289711.0	GSM1629113 r1	0:25 1:25	A:3738800;C:3399635;G:3435347;T:3844352;N:67416	25	25	3738800	3399635	3435347	3844352	67416	SRX914880	SRS869422	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.62055	0.56082	0.17925	0.17361	0.88698	0.90761	0.63705	0.72713	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38471	38471	SRR1872987	SRX914879	SRS869427	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923		zf3 dis S352	GSM1629112		tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S352	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629112	GSM1629112: zf3 dis S352; Danio rerio; RNA Seq	GSM1629112		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629112	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996		loader:fastq load.py	zf3_dis_S352.R1.fq zf3_dis_S352.R2.fq	fastq fastq	20656250.0	413125.0	GSM1629112 r1	0:25 1:25	A:5409278;C:4778324;G:4823018;T:5565607;N:80023	25	25	5409278	4778324	4823018	5565607	80023	SRX914879	SRS869427	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.7596	0.69086	0.29648	0.27453	0.84843	0.87265	0.65665	0.73501	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38472	38472	SRR1872986	SRX914878	SRS869407	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923		zf3 dis S351	GSM1629111		tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S351	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629111	GSM1629111: zf3 dis S351; Danio rerio; RNA Seq	GSM1629111		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629111	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996		loader:fastq load.py	zf3_dis_S351.R2.fq zf3_dis_S351.R1.fq	fastq fastq	18878500.0	377570.0	GSM1629111 r1	0:25 1:25	A:4794224;C:4526355;G:4554783;T:4925799;N:77339	25	25	4794224	4526355	4554783	4925799	77339	SRX914878	SRS869407	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.59735	0.65152	0.17597	0.18275	0.91204	0.89367	0.73252	0.66132	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38473	38473	SRR1872985	SRX914877	SRS869426	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923		zf3 dis S350	GSM1629110		tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S350	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629110	GSM1629110: zf3 dis S350; Danio rerio; RNA Seq	GSM1629110		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629110	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996		loader:fastq load.py	zf3_dis_S350.R2.fq zf3_dis_S350.R1.fq	fastq fastq	18015150.0	360303.0	GSM1629110 r1	0:25 1:25	A:4757233;C:4120910;G:4152471;T:4865140;N:119396	25	25	4757233	4120910	4152471	4865140	119396	SRX914877	SRS869426	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.59623	0.55628	0.16688	0.15933	0.89016	0.90946	0.68088	0.39729	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38474	38474	SRR1872984	SRX914876	SRS869425	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923		zf3 dis S349	GSM1629109		tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S349	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629109	GSM1629109: zf3 dis S349; Danio rerio; RNA Seq	GSM1629109		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629109	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996		loader:fastq load.py	zf3_dis_S349.R1.fq zf3_dis_S349.R2.fq	fastq fastq	18552750.0	371055.0	GSM1629109 r1	0:25 1:25	A:4713675;C:4414123;G:4487632;T:4865002;N:72318	25	25	4713675	4414123	4487632	4865002	72318	SRX914876	SRS869425	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.73956	0.66864	0.29185	0.26915	0.8728	0.89185	0.64518	0.71455	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38475	38475	SRR1872983	SRX914875	SRS869424	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923		zf3 dis S348	GSM1629108		tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S348	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629108	GSM1629108: zf3 dis S348; Danio rerio; RNA Seq	GSM1629108		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629108	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996		loader:fastq load.py	zf3_dis_S348.R1.fq zf3_dis_S348.R2.fq	fastq fastq	18364000.0	367280.0	GSM1629108 r1	0:25 1:25	A:4467688;C:4489708;G:4651022;T:4688256;N:67326	25	25	4467688	4489708	4651022	4688256	67326	SRX914875	SRS869424	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.82371	0.74488	0.27118	0.25268	0.86758	0.8886	0.65639	0.72281	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38476	38476	SRR1872982	SRX914874	SRS869429	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923		zf3 dis S347	GSM1629107		tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S347	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629107	GSM1629107: zf3 dis S347; Danio rerio; RNA Seq	GSM1629107		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629107	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996		loader:fastq load.py	zf3_dis_S347.R1.fq zf3_dis_S347.R2.fq	fastq fastq	21064200.0	421284.0	GSM1629107 r1	0:25 1:25	A:5412410;C:4977004;G:4997675;T:5572725;N:104386	25	25	5412410	4977004	4997675	5572725	104386	SRX914874	SRS869429	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.5825	0.54487	0.15602	0.14912	0.89053	0.91094	0.71218	0.79095	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38477	38477	SRR1872981	SRX914873	SRS869428	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923		zf3 dis S346	GSM1629106		tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S346	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629106	GSM1629106: zf3 dis S346; Danio rerio; RNA Seq	GSM1629106		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629106	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996		loader:fastq load.py	zf3_dis_S346.R1.fq zf3_dis_S346.R2.fq	fastq fastq	14579650.0	291593.0	GSM1629106 r1	0:25 1:25	A:3652547;C:3477071;G:3552653;T:3844470;N:52909	25	25	3652547	3477071	3552653	3844470	52909	SRX914873	SRS869428	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.84569	0.77715	0.24465	0.23283	0.87651	0.89706	0.69586	0.77338	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38478	38478	SRR1872980	SRX914872	SRS869430	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923		zf3 dis S345	GSM1629105		tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S345	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629105	GSM1629105: zf3 dis S345; Danio rerio; RNA Seq	GSM1629105		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629105	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996		loader:fastq load.py	zf3_dis_S345.R1.fq zf3_dis_S345.R2.fq	fastq fastq	19894100.0	397882.0	GSM1629105 r1	0:25 1:25	A:4978487;C:4785641;G:4877454;T:5178846;N:73672	25	25	4978487	4785641	4877454	5178846	73672	SRX914872	SRS869430	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.80074	0.73644	0.28821	0.27089	0.87452	0.89213	0.68194	0.75059	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38479	38479	SRR1872979	SRX914871	SRS869433	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923		zf3 dis S344	GSM1629104		tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S344	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629104	GSM1629104: zf3 dis S344; Danio rerio; RNA Seq	GSM1629104		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629104	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996		loader:fastq load.py	zf3_dis_S344.R2.fq zf3_dis_S344.R1.fq	fastq fastq	21335200.0	426704.0	GSM1629104 r1	0:25 1:25	A:5277911;C:5144153;G:5264908;T:5565367;N:82861	25	25	5277911	5144153	5264908	5565367	82861	SRX914871	SRS869433	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.72171	0.80382	0.21052	0.21995	0.89061	0.86695	0.72932	0.64495	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38480	38480	SRR1872978	SRX914870	SRS869431	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923		zf3 dis S343	GSM1629103		tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S343	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629103	GSM1629103: zf3 dis S343; Danio rerio; RNA Seq	GSM1629103		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629103	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996		loader:fastq load.py	zf3_dis_S343.R1.fq zf3_dis_S343.R2.fq	fastq fastq	19911000.0	398220.0	GSM1629103 r1	0:25 1:25	A:4923353;C:4815086;G:4933744;T:5166820;N:71997	25	25	4923353	4815086	4933744	5166820	71997	SRX914870	SRS869431	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.79232	0.71735	0.23984	0.22867	0.88943	0.91074	0.64925	0.73421	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38481	38481	SRR1872977	SRX914869	SRS869432	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923		zf3 dis S1800	GSM1629102		tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S1800	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629102	GSM1629102: zf3 dis S1800; Danio rerio; RNA Seq	GSM1629102		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629102	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996		loader:fastq load.py	zf3_dis_S1800.R1.fq zf3_dis_S1800.R2.fq	fastq fastq	10790700.0	215814.0	GSM1629102 r1	0:25 1:25	A:2721576;C:2556263;G:2606994;T:2865815;N:40052	25	25	2721576	2556263	2606994	2865815	40052	SRX914869	SRS869432	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.76882	0.8569	0.22815	0.24284	0.90851	0.88925	0.73921	0.67204	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures

Advanced export

JSON shape: default, array, newline-delimited

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;