run_metadata
14 rows where technology = "generic-scrnaseq-only", tissue_curation = "Oocyte" and tissue_curation_coarse = "Reproductive System"
This data as json, CSV (advanced)
| Link | rowid ▼ | run.accession | experiment.accession | sample.accession | study.accession | bioproject | study.title | study.alias | study.type | study.abstract | study.attributes | study.PMIDs | sample.description | sample.title | sample.alias | sample.centername | sample.attributes | GEOsample.title | GEOsample.dataprocessing | GEOsample.source | GEOsample.treatmentprotocol | GEOsample.extractprotocol | GEOsample.growthprotocol | GEOsample.characteristics | GEOsample.accession | experiment.title | experiment.alias | experiment.library_name | experiment.design_description | experiment.library_construction_protocol | experiment.attributes | experiment.library_strategy | experiment.library_source | experiment.library_selection | experiment.library_layout | experiment.platform | experiment.instrument_model | experiment.spot_descriptor | experiment.study_ref | run.title | run.attributes | run.filename | run.semantic_name | run.total_bases | run.total_spots | run.alias | run.read_lengths | run.base_counts | run.r1_length | run.r2_length | run.r3_length | run.r4_length | run.Acount | run.Ccount | run.Gcount | run.Tcount | run.Ncount | run.experiment | run.pool_member | submission.accession | submission.srasource | submission.bioprojectsource | seqdetective.n_mates | seqdetective.mapping_rate.mate1 | seqdetective.mapping_rate.mate2 | seqdetective.nofeature_rate.mate1 | seqdetective.nofeature_rate.mate2 | seqdetective.sparsity.mate1 | seqdetective.sparsity.mate2 | seqdetective.pos_strand_rate.mate1 | seqdetective.pos_strand_rate.mate2 | seqdetective.readlen.mate1 | seqdetective.readlen.mate2 | seqdetective.judgement.mate1 | seqdetective.judgement.mate2 | seqdetective.judgement.reason | platform_family | instrument_generation | read_bias | selection_class | prep_kit | sc_or_bulk | tech_class | technology | tech_variant | submission.bioprojectsource.country | earliest_date | devstage_curation | devstage_curation_coarse | tissue_curation | tissue_curation_coarse |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 40701 | 40701 | SRR3231363 | SRX1637111 | SRS1342926 | SRP071849 | PRJNA315400 | Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [RIP Seq] | GSE79161 | Transcriptome Analysis | Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: RNA was extracted from ovary tissue or from RIP experiments by Trizol extraction. | parent bioproject:PRJNA315403 | pubmed:30086300 | Input 3 | GSM2087141 | tissue:Zebrafish Zygotes|fraction:Input | Input 3 | Reads were mapped to Zv9 using tophat trapnell et al 2009to the ENSEMBLE gene build and further processing of the read counts was performed using Deseq Anders et al 2009 Genome build: zv9 Supplementary files format and content: The mRNA counts.csv contains the DESeq normalized read counts per Ensemble gene as indicated. Headers indicate the sample name. | Zebrafish Zygotes | mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing. | Zebrafish were maintained under standard conditions. | fraction:Input | GSM2087141 | GSM2087141: Input 3; Danio rerio; RIP Seq | GSM2087141 | 1 | mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing. | GEO Accession:GSM2087141 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP071849 | WT_Input_3.fastq.gz | fastq | 1902296226.0 | 37299926.0 | GSM2087141 r1 | 0:51 | A:466290166;C:465344039;G:486942278;T:483240280;N:479463 | 51 | 466290166 | 465344039 | 486942278 | 483240280 | 479463 | SRX1637111 | SRS1342926 | SRA385813 | GEO | Rene Ketting, RNA silencing, IMB | 1 | 0.85793 | 0.14814 | 0.79941 | 0.55214 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2016-03-13 | Zygote | Embryo | Oocyte | Reproductive System | |||||||||||||||||
| 40702 | 40702 | SRR3231362 | SRX1637110 | SRS1342927 | SRP071849 | PRJNA315400 | Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [RIP Seq] | GSE79161 | Transcriptome Analysis | Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: RNA was extracted from ovary tissue or from RIP experiments by Trizol extraction. | parent bioproject:PRJNA315403 | pubmed:30086300 | Input 2 | GSM2087140 | tissue:Zebrafish Zygotes|fraction:Input | Input 2 | Reads were mapped to Zv9 using tophat trapnell et al 2009to the ENSEMBLE gene build and further processing of the read counts was performed using Deseq Anders et al 2009 Genome build: zv9 Supplementary files format and content: The mRNA counts.csv contains the DESeq normalized read counts per Ensemble gene as indicated. Headers indicate the sample name. | Zebrafish Zygotes | mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing. | Zebrafish were maintained under standard conditions. | fraction:Input | GSM2087140 | GSM2087140: Input 2; Danio rerio; RIP Seq | GSM2087140 | 1 | mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing. | GEO Accession:GSM2087140 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP071849 | WT_Input_2.fastq.gz | fastq | 1540737999.0 | 30210549.0 | GSM2087140 r1 | 0:51 | A:380481772;C:379741192;G:395453141;T:384675313;N:386581 | 51 | 380481772 | 379741192 | 395453141 | 384675313 | 386581 | SRX1637110 | SRS1342927 | SRA385813 | GEO | Rene Ketting, RNA silencing, IMB | 1 | 0.8787 | 0.14935 | 0.79202 | 0.54381 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2016-03-13 | Zygote | Embryo | Oocyte | Reproductive System | |||||||||||||||||
| 40703 | 40703 | SRR3231361 | SRX1637109 | SRS1342928 | SRP071849 | PRJNA315400 | Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [RIP Seq] | GSE79161 | Transcriptome Analysis | Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: RNA was extracted from ovary tissue or from RIP experiments by Trizol extraction. | parent bioproject:PRJNA315403 | pubmed:30086300 | Input 1 | GSM2087139 | tissue:Zebrafish Zygotes|fraction:Input | Input 1 | Reads were mapped to Zv9 using tophat trapnell et al 2009to the ENSEMBLE gene build and further processing of the read counts was performed using Deseq Anders et al 2009 Genome build: zv9 Supplementary files format and content: The mRNA counts.csv contains the DESeq normalized read counts per Ensemble gene as indicated. Headers indicate the sample name. | Zebrafish Zygotes | mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing. | Zebrafish were maintained under standard conditions. | fraction:Input | GSM2087139 | GSM2087139: Input 1; Danio rerio; RIP Seq | GSM2087139 | 1 | mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing. | GEO Accession:GSM2087139 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP071849 | WT_Input_1.fastq.gz | fastq | 1109818905.0 | 21761155.0 | GSM2087139 r1 | SRX1637109 | SRS1342928 | SRA385813 | GEO | Rene Ketting, RNA silencing, IMB | 1 | 0.87467 | 0.18794 | 0.79411 | 0.63378 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2016-03-13 | Zygote | Embryo | Oocyte | Reproductive System | |||||||||||||||||||||||||
| 40704 | 40704 | SRR3231360 | SRX1637108 | SRS1342929 | SRP071849 | PRJNA315400 | Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [RIP Seq] | GSE79161 | Transcriptome Analysis | Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: RNA was extracted from ovary tissue or from RIP experiments by Trizol extraction. | parent bioproject:PRJNA315403 | pubmed:30086300 | Tdrd6a IP 3 | GSM2087138 | tissue:Zebrafish Zygotes|fraction:Tdrd6a IP | Tdrd6a IP 3 | Reads were mapped to Zv9 using tophat trapnell et al 2009to the ENSEMBLE gene build and further processing of the read counts was performed using Deseq Anders et al 2009 Genome build: zv9 Supplementary files format and content: The mRNA counts.csv contains the DESeq normalized read counts per Ensemble gene as indicated. Headers indicate the sample name. | Zebrafish Zygotes | mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing. | Zebrafish were maintained under standard conditions. | fraction:Tdrd6a IP | GSM2087138 | GSM2087138: Tdrd6a IP 3; Danio rerio; RIP Seq | GSM2087138 | 1 | mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing. | GEO Accession:GSM2087138 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP071849 | WT_Tdrd6a_IP_3.fastq.gz | fastq | 843641439.0 | 16541989.0 | GSM2087138 r1 | 0:51 | A:216465581;C:196892096;G:207722567;T:222361382;N:199813 | 51 | 216465581 | 196892096 | 207722567 | 222361382 | 199813 | SRX1637108 | SRS1342929 | SRA385813 | GEO | Rene Ketting, RNA silencing, IMB | 1 | 0.84615 | 0.08957 | 0.78768 | 0.50612 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2016-03-13 | Zygote | Embryo | Oocyte | Reproductive System | |||||||||||||||||
| 40705 | 40705 | SRR3231359 | SRX1637107 | SRS1342930 | SRP071849 | PRJNA315400 | Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [RIP Seq] | GSE79161 | Transcriptome Analysis | Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: RNA was extracted from ovary tissue or from RIP experiments by Trizol extraction. | parent bioproject:PRJNA315403 | pubmed:30086300 | Tdrd6a IP 2 | GSM2087137 | tissue:Zebrafish Zygotes|fraction:Tdrd6a IP | Tdrd6a IP 2 | Reads were mapped to Zv9 using tophat trapnell et al 2009to the ENSEMBLE gene build and further processing of the read counts was performed using Deseq Anders et al 2009 Genome build: zv9 Supplementary files format and content: The mRNA counts.csv contains the DESeq normalized read counts per Ensemble gene as indicated. Headers indicate the sample name. | Zebrafish Zygotes | mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing. | Zebrafish were maintained under standard conditions. | fraction:Tdrd6a IP | GSM2087137 | GSM2087137: Tdrd6a IP 2; Danio rerio; RIP Seq | GSM2087137 | 1 | mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing. | GEO Accession:GSM2087137 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP071849 | WT_Tdrd6a_IP_2.fastq.gz | fastq | 391198050.0 | 7670550.0 | GSM2087137 r1 | 0:51 | A:99015594;C:91525929;G:97155710;T:103371571;N:129246 | 51 | 99015594 | 91525929 | 97155710 | 103371571 | 129246 | SRX1637107 | SRS1342930 | SRA385813 | GEO | Rene Ketting, RNA silencing, IMB | 1 | 0.85778 | 0.12015 | 0.80515 | 0.47541 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2016-03-13 | Zygote | Embryo | Oocyte | Reproductive System | |||||||||||||||||
| 40706 | 40706 | SRR3231358 | SRX1637106 | SRS1342931 | SRP071849 | PRJNA315400 | Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [RIP Seq] | GSE79161 | Transcriptome Analysis | Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: RNA was extracted from ovary tissue or from RIP experiments by Trizol extraction. | parent bioproject:PRJNA315403 | pubmed:30086300 | Tdrd6a IP 1 | GSM2087136 | tissue:Zebrafish Zygotes|fraction:Tdrd6a IP | Tdrd6a IP 1 | Reads were mapped to Zv9 using tophat trapnell et al 2009to the ENSEMBLE gene build and further processing of the read counts was performed using Deseq Anders et al 2009 Genome build: zv9 Supplementary files format and content: The mRNA counts.csv contains the DESeq normalized read counts per Ensemble gene as indicated. Headers indicate the sample name. | Zebrafish Zygotes | mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing. | Zebrafish were maintained under standard conditions. | fraction:Tdrd6a IP | GSM2087136 | GSM2087136: Tdrd6a IP 1; Danio rerio; RIP Seq | GSM2087136 | 1 | mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing. | GEO Accession:GSM2087136 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP071849 | WT_Tdrd6a_IP_1.fastq.gz | fastq | 1927415052.0 | 37792452.0 | GSM2087136 r1 | 0:51 | A:498125298;C:444860381;G:468826607;T:515142356;N:460410 | 51 | 498125298 | 444860381 | 468826607 | 515142356 | 460410 | SRX1637106 | SRS1342931 | SRA385813 | GEO | Rene Ketting, RNA silencing, IMB | 1 | 0.86194 | 0.09753 | 0.80146 | 0.47808 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2016-03-13 | Zygote | Embryo | Oocyte | Reproductive System | |||||||||||||||||
| 44969 | 44969 | SRR6345658 | SRX3442974 | SRS2733632 | SRP126106 | PRJNA421016 | Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA] | GSE107682 | Transcriptome Analysis | Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish. | parent bioproject:PRJNA315403 | pubmed:30086300 | smRNA seq library of late oocytes from tdrd6a hett fish | GSM2875717 | source name:late oocytes from tdrd6a hett fish|tissue:late oocytes|genotype:tdrd6a heterozygous | smRNA seq library of late oocytes from tdrd6a hett fish | 1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15 6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities. 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to. Supplementary files format and content: Files ending in .bw are bigwig tracks. | late oocytes from tdrd6a hett fish | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | tissue:late oocytes|genotype:tdrd6a heterozygous | GSM2875717 | GSM2875717: smRNA seq library of late oocytes from tdrd6a hett fish; Danio rerio; ncRNA Seq | GSM2875717 | 1 | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | GEO Accession:GSM2875717 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP126106 | tdrd6a-het_oocytes-late-input.fastq.gz | fastq | 1884769630.0 | 28130890.0 | GSM2875717 r1 | 0:67 | A:519051884;C:437635381;G:510738306;T:417295309;N:48750 | 67 | 519051884 | 437635381 | 510738306 | 417295309 | 48750 | SRX3442974 | SRS2733632 | SRA636010 | GEO | Rene Ketting, RNA silencing, IMB | 1 | 0.17778 | 0.06655 | 0.95931 | 0.91529 | 67 | B | usable mapping rate | illumina | hiseq_era | 5prime | size_fractionation | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2017-12-04 | Zygote | Embryo | Oocyte | Reproductive System | ||||||||||||||||||
| 44970 | 44970 | SRR6345657 | SRX3442973 | SRS2733634 | SRP126106 | PRJNA421016 | Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA] | GSE107682 | Transcriptome Analysis | Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish. | parent bioproject:PRJNA315403 | pubmed:30086300 | smRNA seq library of early oocytes from tdrd6a mut fish | GSM2875716 | source name:early oocytes from tdrd6a mut fish|tissue:early oocytes|genotype:tdrd6a mutant | smRNA seq library of early oocytes from tdrd6a mut fish | 1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15 6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities. 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to. Supplementary files format and content: Files ending in .bw are bigwig tracks. | early oocytes from tdrd6a mut fish | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | tissue:early oocytes|genotype:tdrd6a mutant | GSM2875716 | GSM2875716: smRNA seq library of early oocytes from tdrd6a mut fish; Danio rerio; ncRNA Seq | GSM2875716 | 1 | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | GEO Accession:GSM2875716 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP126106 | tdrd6a-mut_oocytes-early-input.fastq.gz | fastq | 2102216723.0 | 31376369.0 | GSM2875716 r1 | 0:67 | A:592618102;C:472348913;G:550028898;T:487165955;N:54855 | 67 | 592618102 | 472348913 | 550028898 | 487165955 | 54855 | SRX3442973 | SRS2733634 | SRA636010 | GEO | Rene Ketting, RNA silencing, IMB | 1 | 0.08293 | 0.04595 | 0.96193 | 0.77321 | 67 | B | usable mapping rate | illumina | hiseq_era | 5prime | size_fractionation | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2017-12-04 | Zygote | Embryo | Oocyte | Reproductive System | ||||||||||||||||||
| 44971 | 44971 | SRR6345656 | SRX3442972 | SRS2733635 | SRP126106 | PRJNA421016 | Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA] | GSE107682 | Transcriptome Analysis | Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish. | parent bioproject:PRJNA315403 | pubmed:30086300 | smRNA seq library of late oocytes from tdrd6a mut fish | GSM2875715 | source name:late oocytes from tdrd6a mut fish|tissue:late oocytes|genotype:tdrd6a mutant | smRNA seq library of late oocytes from tdrd6a mut fish | 1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15 6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities. 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to. Supplementary files format and content: Files ending in .bw are bigwig tracks. | late oocytes from tdrd6a mut fish | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | tissue:late oocytes|genotype:tdrd6a mutant | GSM2875715 | GSM2875715: smRNA seq library of late oocytes from tdrd6a mut fish; Danio rerio; ncRNA Seq | GSM2875715 | 1 | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | GEO Accession:GSM2875715 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP126106 | tdrd6a-mut_oocytes-late-input.fastq.gz | fastq | 2110760295.0 | 31503885.0 | GSM2875715 r1 | 0:67 | A:582021495;C:486821539;G:582933348;T:458929133;N:54780 | 67 | 582021495 | 486821539 | 582933348 | 458929133 | 54780 | SRX3442972 | SRS2733635 | SRA636010 | GEO | Rene Ketting, RNA silencing, IMB | 1 | 0.17064 | 0.06728 | 0.96173 | 0.9114 | 67 | B | usable mapping rate | illumina | hiseq_era | 5prime | size_fractionation | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2017-12-04 | Zygote | Embryo | Oocyte | Reproductive System | ||||||||||||||||||
| 44972 | 44972 | SRR6345655 | SRX3442971 | SRS2733633 | SRP126106 | PRJNA421016 | Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA] | GSE107682 | Transcriptome Analysis | Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish. | parent bioproject:PRJNA315403 | pubmed:30086300 | smRNA seq library of early oocytes from tdrd6a het fish | GSM2875714 | source name:early oocytes from tdrd6a het fish|tissue:Early oocytes|genotype:tdrd6a heterozygous | smRNA seq library of early oocytes from tdrd6a het fish | 1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15 6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities. 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to. Supplementary files format and content: Files ending in .bw are bigwig tracks. | early oocytes from tdrd6a het fish | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | tissue:Early oocytes|genotype:tdrd6a heterozygous | GSM2875714 | GSM2875714: smRNA seq library of early oocytes from tdrd6a het fish; Danio rerio; ncRNA Seq | GSM2875714 | 1 | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | GEO Accession:GSM2875714 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP126106 | tdrd6a-het_oocytes-early-input.fastq.gz | fastq | 2243425655.0 | 33483965.0 | GSM2875714 r1 | 0:67 | A:633468129;C:503239215;G:592089295;T:514571679;N:57337 | 67 | 633468129 | 503239215 | 592089295 | 514571679 | 57337 | SRX3442971 | SRS2733633 | SRA636010 | GEO | Rene Ketting, RNA silencing, IMB | 1 | 0.06641 | 0.04254 | 0.96806 | 0.58509 | 67 | B | usable mapping rate | illumina | hiseq_era | 5prime | size_fractionation | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2017-12-04 | Zygote | Embryo | Oocyte | Reproductive System | ||||||||||||||||||
| 64467 | 64467 | SRR14703424 | SRX11041446 | SRS9110374 | SRP322195 | PRJNA734348 | Methylome inheritance and enhancer dememorization construct an epigenetic gate safeguarding embryonic programs | GSE175951 | Other | Unlike that of mammals the total DNA methylome of many cold blooded vertebrates is globally inherited from gametes to early embryos. In zebrafish this is however accompanied by sweeping “dememorization” of enhancers prior to fertilization for sperm and just post fertilization for oocyte as they undergo full methylation and are not demethylated again until phylotypic stage. The significance of both global methylome inheritance and enhancer dememorization in early embryos remains largely unknown. Adding to the puzzles the zygotic mutant zebrafish of dnmt1 the major DNA methylation maintenance methyltransferase surprisingly can develop to term. To solve the role of DNA methylation in early development we generated zebrafish embryos derived from dnmt1 knocking down oocytes using a recently developed method OMIS microinjection in situ which successfully eliminated DNA methylation before zygotic genome activation. dnmt1 deficient embryos failed to initiate epiboly and died around gastrulation. This is in part caused by activation of immune response and p53 regulated apoptosis likely triggered by the derepression of transposable elements. Single cell RNA seq further revealed defective differentiation in these mutants. DNA methylation is also required for the establishment of repressive histone marks H3K27me3 and H2AK119ub. Strikingly the loss of DNA methylation leads to extensive derepression of somatic genes and enhancers which acquire ectopic H3K27ac accessible chromatin and H3K4me3. These somatic enhancers are preferentially CG rich and are bound by CG containing TFs. By contrast embryonic enhancers are generally CG poor methylation insensitive and are bound by CG less TFs. Hence the global DNA methylome inheritance is essential for vertebrate early development and enhancer dememorization resets an epigenetic gate that separates embryonic and somatic programs. Overall design: By employing MethylC seq total RNA seq scRNA seq CUT&RUN ChIP seq and ATAC seq in control and dnmt1 mKD embryos at oocyt… | pubmed:34936444 | Oocyte dnmt1 mKD total RNA seq rep2 | GSM5351801 | source name:oocyte|strain:AB|genotype:WT|developmental stage:Oocyte|tissue:oocyte|treatment:microinjection with Rhodamine B and dnmt1 MO at oogenesis III stage GV | Oocyte dnmt1 mKD total RNA seq rep2 | All STEM seq datasets were mapped to the danRer7 reference genome by Bismark Krueger and Andrews 2011. Reads were trimmed with cutadaptor Martin 2011 using parameters: minimum length 20 pair filter=any. Alignments were performed with the following parameters: N 1 X 600 score min L 0 0.6. Multi mapped reads and PCR duplicates were removed. bismark methylation extractor was used to calculate the DNA methylation level. Total RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer7 by STAR version: STAR 2.5.3a modified Dobin et al. 2013 with the following parameters: outSAMstrandField intronMotif outSAMattributes All outSAMunmapped Within outSAMattrIHstart 0 outWigStrand Stranded outFilterMultimapNmax 20 twopassMode Basic. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1 Trapnell et al. 2012. The scRNA seq data were processed with Cell Ranger 3.1 for genome alignment danRer10 transcript counting and gene cell barcode matrix generation. Before the downstream analysis cells with unique detected genes lower than <2 000 and higher than 6 000 genes were discarded and cells with high percentage of mitochondrial genes >5% were removed too. Subtypes of cells were identified with Seurat 3.0 through the integrating of control and mKD embryos at dome and shield stages with setting control embryos as reference. To make the data comparable samples we performed SCTransform normalization separately for each dataset. To further reduce the bais caused by sequencing depth of scRNA seq and percentage of mitochondrial genes UMI variance and percent.mt were regressed out from SCTransform normalized data matrix by linear model with negative binomial distribution. All ChIP seq reads were aligned to the zebrafish reference genome danRer7 using Bowtie2 version 2.2.2 L… | oocyte | Briefly on the first day of OMIS Wu et al. 2018b adult females at 5 mpf 12 mpf were anesthetized in 550 µg/ml tricaine Sigma Cat A5040 in a petri dish. Then the fish was placed on a damp sponge with specific buffer 5.4 mM KCl 136.8 mM NaCl 4.2 mM NaHCO3 0.44 mM KH2PO4 0.25 mM Na2HPO4 and 0.5% wt/vol BSA. A cut was made on one side of belly to expose the ovary. The diluted MOs were microinjected into each oocyte. Rhodamine B Sigma Cat R8881 was co injected with MOs as a dye. post injection the wound on the belly was sewed with a surgical sewing needle carefully and quickly. Once the operation was done the female was transferred into fish water supplemented with 32 µg/ml tricaine 10 unit/ml penicillin and 10 µg/ml streptomycin HyClone Cat SV30010. Then the fish was transferred to fish water containing gradually reduced concentrations of tricaine. In the evening of the second day the female was paired with a wild type male. In the morning of the third day the pair started to chase and lay fertilized eggs naturally. The injected oocyte derived embryos were identified by co injected dye rhodamine B at very early developmental stages. The injection doses of dnmt1 MO were 5 ng per oocyte in the same assay. MOs were dissolved in RNase free water and heated to 65°C for 11 min before microinjection. | The oocytes were dechorionated manually by tweezers and transferred into 750 µl Trizol Invitrogen Cat 15596018. About 10 fresh embryos were transferred into Trizol and vortexed until no visible particles. 150 µl chloroform Amresco Cat 0757 was added and mixed thoroughly. The mixture was then transferred into phasemaker tube Invitrogen Cat A33248 and spun at 14 000 rpm for 15 min. Next the top phase was taken out from the tube added 1 µl LPA Sigma Cat 56575 and mixed well using pipettes. Then RNA was precipitated by adding 750 µl isopropanol Sigma Cat 59304 at 20℃ overnight. At next day the tube was spun at 14 000 rpm for 30 min and supernatant was removed. The pellet was washed with freshly 70% ethanol re suspend in 20 µl RNase free water and stored at 80℃ for later usage. NEBNext rRNA Depletion Kit NEB Cat E6310S was used to deplete ribosomal RNA according to the manufacture’s instruction. Briefly rRNA were hybridized with probes and digested with RNase H then excess probes were digested with DNase I. post that NEBNext RNA sample purification beads were used to purify rRNA depleted RNA. Purified RNA was fragmented before cDNA synthesis at 95℃ for 8 min. Double stranded cDNA was synthesized with NEB Next first strand NEB Cat E7771S and second strand synthesis modules NEB Cat E7550S then purified with Ampure XP beads Beckman Cat A63882. Synthesized cDNA was subjected to library preparation with NEBNext Ultr II DNA Library Prep Kit NEB Cat E7645S. DNA was end repaired adenylated and ligated to TruSeq sequencing adaptors. DNA were amplified using KAPA HF HotStart ReadyMix KAPABiosystem Cat RR2602. The amplified DNA was size selected using Ampure XP beads for 200 500 bp DNA fragments. All libraries were sequenced by Illumina Hi Seq 1500 or 2500 or XTen platform according to manufacturer’s instruction. | The wild type AB strain was used in the experiments. The females post OMIS were fed with live adult brine shrimp thrice a day. All embryos were raised in Holtfreter’s solution at 28.5C and staged as described previously Kimmel et al. 1995. | strain:AB|genotype:WT|developmental stage:Oocyte|tissue:oocyte|treatment:microinjection with Rhodamine B and dnmt1 MO at oogenesis III stage GV | GSM5351801 | GSM5351801: Oocyte dnmt1 mKD total RNA seq rep2; Danio rerio; RNA Seq | GSM5351801 | 1 | The oocytes were dechorionated manually by tweezers and transferred into 750 µl Trizol Invitrogen Cat 15596018. About 10 fresh embryos were transferred into Trizol and vortexed until no visible particles. 150 µl chloroform Amresco Cat 0757 was added and mixed thoroughly. The mixture was then transferred into phasemaker tube Invitrogen Cat A33248 and spun at 14 000 rpm for 15 min. Next the top phase was taken out from the tube added 1 µl LPA Sigma Cat 56575 and mixed well using pipettes. Then RNA was precipitated by adding 750 µl isopropanol Sigma Cat 59304 at 20℃ overnight. At next day the tube was spun at 14 000 rpm for 30 min and supernatant was removed. The pellet was washed with freshly 70% ethanol re suspend in 20 µl RNase free water and stored at 80℃ for later usage. NEBNext rRNA Depletion Kit NEB Cat E6310S was used to deplete ribosomal RNA according to the manufacture's instruction. Briefly rRNA were hybridized with probes and digested with RNase H then excess probes were digested with DNase I. post that NEBNext RNA sample purification beads were used to purify rRNA depleted RNA. Purified RNA was fragmented before cDNA synthesis at 95℃ for 8 min. Double stranded cDNA was synthesized with NEB Next first strand NEB Cat E7771S and second strand synthesis modules NEB Cat E7550S then purified with Ampure XP beads Beckman Cat A63882. Synthesized cDNA was subjected to library preparation with NEBNext Ultr II DNA Library Prep Kit NEB Cat E7645S. DNA was end repaired adenylated and ligated to TruSeq sequencing adaptors. DNA were amplified using KAPA HF HotStart ReadyMix KAPABiosystem Cat RR2602. The amplified DNA was size selected using Ampure XP beads for 200 500 bp DNA fragments. All libraries were sequenced by Illumina Hi Seq 1500 or 2500 or XTen platform according to manufacturer's instruction. | GEO Accession:GSM5351801 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 1500 | SRP322195 | loader:fastq load.py | Oocyte_dnmt1_mKD_total_RNA_seq_rep2_r1.fq.gz Oocyte_dnmt1_mKD_total_RNA_seq_rep2_r2.fq.gz | fastq fastq | 16439504400.0 | 54798348.0 | GSM5351801 r1 | 0:150 1:150 | A:3396011593;C:4802098205;G:4970368429;T:3267104077;N:3922096 | 150 | 150 | 3396011593 | 4802098205 | 4970368429 | 3267104077 | 3922096 | SRX11041446 | SRS9110374 | SRA1239365 | GEO | THU-PKU Center for Life Sciences, Tsinghua University | 2 | 0.88579 | 0.90816 | 0.11025 | 0.11298 | 0.80095 | 0.80501 | 0.71771 | 0.73597 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | rrna_depletion | nebnext | sc_generic | single_cell_generic | generic-scrnaseq-only | China | 2021-06-01 | Zygote | Embryo | Oocyte | Reproductive System | |||||||||
| 64468 | 64468 | SRR14703423 | SRX11041445 | SRS9110373 | SRP322195 | PRJNA734348 | Methylome inheritance and enhancer dememorization construct an epigenetic gate safeguarding embryonic programs | GSE175951 | Other | Unlike that of mammals the total DNA methylome of many cold blooded vertebrates is globally inherited from gametes to early embryos. In zebrafish this is however accompanied by sweeping “dememorization” of enhancers prior to fertilization for sperm and just post fertilization for oocyte as they undergo full methylation and are not demethylated again until phylotypic stage. The significance of both global methylome inheritance and enhancer dememorization in early embryos remains largely unknown. Adding to the puzzles the zygotic mutant zebrafish of dnmt1 the major DNA methylation maintenance methyltransferase surprisingly can develop to term. To solve the role of DNA methylation in early development we generated zebrafish embryos derived from dnmt1 knocking down oocytes using a recently developed method OMIS microinjection in situ which successfully eliminated DNA methylation before zygotic genome activation. dnmt1 deficient embryos failed to initiate epiboly and died around gastrulation. This is in part caused by activation of immune response and p53 regulated apoptosis likely triggered by the derepression of transposable elements. Single cell RNA seq further revealed defective differentiation in these mutants. DNA methylation is also required for the establishment of repressive histone marks H3K27me3 and H2AK119ub. Strikingly the loss of DNA methylation leads to extensive derepression of somatic genes and enhancers which acquire ectopic H3K27ac accessible chromatin and H3K4me3. These somatic enhancers are preferentially CG rich and are bound by CG containing TFs. By contrast embryonic enhancers are generally CG poor methylation insensitive and are bound by CG less TFs. Hence the global DNA methylome inheritance is essential for vertebrate early development and enhancer dememorization resets an epigenetic gate that separates embryonic and somatic programs. Overall design: By employing MethylC seq total RNA seq scRNA seq CUT&RUN ChIP seq and ATAC seq in control and dnmt1 mKD embryos at oocyt… | pubmed:34936444 | Oocyte dnmt1 mKD total RNA seq rep1 | GSM5351800 | source name:oocyte|strain:AB|genotype:WT|developmental stage:Oocyte|tissue:oocyte|treatment:microinjection with Rhodamine B and dnmt1 MO at oogenesis III stage GV | Oocyte dnmt1 mKD total RNA seq rep1 | All STEM seq datasets were mapped to the danRer7 reference genome by Bismark Krueger and Andrews 2011. Reads were trimmed with cutadaptor Martin 2011 using parameters: minimum length 20 pair filter=any. Alignments were performed with the following parameters: N 1 X 600 score min L 0 0.6. Multi mapped reads and PCR duplicates were removed. bismark methylation extractor was used to calculate the DNA methylation level. Total RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer7 by STAR version: STAR 2.5.3a modified Dobin et al. 2013 with the following parameters: outSAMstrandField intronMotif outSAMattributes All outSAMunmapped Within outSAMattrIHstart 0 outWigStrand Stranded outFilterMultimapNmax 20 twopassMode Basic. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1 Trapnell et al. 2012. The scRNA seq data were processed with Cell Ranger 3.1 for genome alignment danRer10 transcript counting and gene cell barcode matrix generation. Before the downstream analysis cells with unique detected genes lower than <2 000 and higher than 6 000 genes were discarded and cells with high percentage of mitochondrial genes >5% were removed too. Subtypes of cells were identified with Seurat 3.0 through the integrating of control and mKD embryos at dome and shield stages with setting control embryos as reference. To make the data comparable samples we performed SCTransform normalization separately for each dataset. To further reduce the bais caused by sequencing depth of scRNA seq and percentage of mitochondrial genes UMI variance and percent.mt were regressed out from SCTransform normalized data matrix by linear model with negative binomial distribution. All ChIP seq reads were aligned to the zebrafish reference genome danRer7 using Bowtie2 version 2.2.2 L… | oocyte | Briefly on the first day of OMIS Wu et al. 2018b adult females at 5 mpf 12 mpf were anesthetized in 550 µg/ml tricaine Sigma Cat A5040 in a petri dish. Then the fish was placed on a damp sponge with specific buffer 5.4 mM KCl 136.8 mM NaCl 4.2 mM NaHCO3 0.44 mM KH2PO4 0.25 mM Na2HPO4 and 0.5% wt/vol BSA. A cut was made on one side of belly to expose the ovary. The diluted MOs were microinjected into each oocyte. Rhodamine B Sigma Cat R8881 was co injected with MOs as a dye. post injection the wound on the belly was sewed with a surgical sewing needle carefully and quickly. Once the operation was done the female was transferred into fish water supplemented with 32 µg/ml tricaine 10 unit/ml penicillin and 10 µg/ml streptomycin HyClone Cat SV30010. Then the fish was transferred to fish water containing gradually reduced concentrations of tricaine. In the evening of the second day the female was paired with a wild type male. In the morning of the third day the pair started to chase and lay fertilized eggs naturally. The injected oocyte derived embryos were identified by co injected dye rhodamine B at very early developmental stages. The injection doses of dnmt1 MO were 5 ng per oocyte in the same assay. MOs were dissolved in RNase free water and heated to 65°C for 11 min before microinjection. | The oocytes were dechorionated manually by tweezers and transferred into 750 µl Trizol Invitrogen Cat 15596018. About 10 fresh embryos were transferred into Trizol and vortexed until no visible particles. 150 µl chloroform Amresco Cat 0757 was added and mixed thoroughly. The mixture was then transferred into phasemaker tube Invitrogen Cat A33248 and spun at 14 000 rpm for 15 min. Next the top phase was taken out from the tube added 1 µl LPA Sigma Cat 56575 and mixed well using pipettes. Then RNA was precipitated by adding 750 µl isopropanol Sigma Cat 59304 at 20℃ overnight. At next day the tube was spun at 14 000 rpm for 30 min and supernatant was removed. The pellet was washed with freshly 70% ethanol re suspend in 20 µl RNase free water and stored at 80℃ for later usage. NEBNext rRNA Depletion Kit NEB Cat E6310S was used to deplete ribosomal RNA according to the manufacture’s instruction. Briefly rRNA were hybridized with probes and digested with RNase H then excess probes were digested with DNase I. post that NEBNext RNA sample purification beads were used to purify rRNA depleted RNA. Purified RNA was fragmented before cDNA synthesis at 95℃ for 8 min. Double stranded cDNA was synthesized with NEB Next first strand NEB Cat E7771S and second strand synthesis modules NEB Cat E7550S then purified with Ampure XP beads Beckman Cat A63882. Synthesized cDNA was subjected to library preparation with NEBNext Ultr II DNA Library Prep Kit NEB Cat E7645S. DNA was end repaired adenylated and ligated to TruSeq sequencing adaptors. DNA were amplified using KAPA HF HotStart ReadyMix KAPABiosystem Cat RR2602. The amplified DNA was size selected using Ampure XP beads for 200 500 bp DNA fragments. All libraries were sequenced by Illumina Hi Seq 1500 or 2500 or XTen platform according to manufacturer’s instruction. | The wild type AB strain was used in the experiments. The females post OMIS were fed with live adult brine shrimp thrice a day. All embryos were raised in Holtfreter’s solution at 28.5C and staged as described previously Kimmel et al. 1995. | strain:AB|genotype:WT|developmental stage:Oocyte|tissue:oocyte|treatment:microinjection with Rhodamine B and dnmt1 MO at oogenesis III stage GV | GSM5351800 | GSM5351800: Oocyte dnmt1 mKD total RNA seq rep1; Danio rerio; RNA Seq | GSM5351800 | 1 | The oocytes were dechorionated manually by tweezers and transferred into 750 µl Trizol Invitrogen Cat 15596018. About 10 fresh embryos were transferred into Trizol and vortexed until no visible particles. 150 µl chloroform Amresco Cat 0757 was added and mixed thoroughly. The mixture was then transferred into phasemaker tube Invitrogen Cat A33248 and spun at 14 000 rpm for 15 min. Next the top phase was taken out from the tube added 1 µl LPA Sigma Cat 56575 and mixed well using pipettes. Then RNA was precipitated by adding 750 µl isopropanol Sigma Cat 59304 at 20℃ overnight. At next day the tube was spun at 14 000 rpm for 30 min and supernatant was removed. The pellet was washed with freshly 70% ethanol re suspend in 20 µl RNase free water and stored at 80℃ for later usage. NEBNext rRNA Depletion Kit NEB Cat E6310S was used to deplete ribosomal RNA according to the manufacture's instruction. Briefly rRNA were hybridized with probes and digested with RNase H then excess probes were digested with DNase I. post that NEBNext RNA sample purification beads were used to purify rRNA depleted RNA. Purified RNA was fragmented before cDNA synthesis at 95℃ for 8 min. Double stranded cDNA was synthesized with NEB Next first strand NEB Cat E7771S and second strand synthesis modules NEB Cat E7550S then purified with Ampure XP beads Beckman Cat A63882. Synthesized cDNA was subjected to library preparation with NEBNext Ultr II DNA Library Prep Kit NEB Cat E7645S. DNA was end repaired adenylated and ligated to TruSeq sequencing adaptors. DNA were amplified using KAPA HF HotStart ReadyMix KAPABiosystem Cat RR2602. The amplified DNA was size selected using Ampure XP beads for 200 500 bp DNA fragments. All libraries were sequenced by Illumina Hi Seq 1500 or 2500 or XTen platform according to manufacturer's instruction. | GEO Accession:GSM5351800 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 1500 | SRP322195 | loader:fastq load.py | Oocyte_dnmt1_mKD_total_RNA_seq_rep1_r1.fq.gz Oocyte_dnmt1_mKD_total_RNA_seq_rep1_r2.fq.gz | fastq fastq | 14688433500.0 | 48961445.0 | GSM5351800 r1 | 0:150 1:150 | A:2682067386;C:4656142899;G:4847089762;T:2502503972;N:629481 | 150 | 150 | 2682067386 | 4656142899 | 4847089762 | 2502503972 | 629481 | SRX11041445 | SRS9110373 | SRA1239365 | GEO | THU-PKU Center for Life Sciences, Tsinghua University | 2 | 0.96866 | 0.97013 | 0.06205 | 0.06149 | 0.81138 | 0.81475 | 0.85317 | 0.85364 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | rrna_depletion | nebnext | sc_generic | single_cell_generic | generic-scrnaseq-only | China | 2021-06-01 | Zygote | Embryo | Oocyte | Reproductive System | |||||||||
| 64469 | 64469 | SRR14703422 | SRX11041444 | SRS9110371 | SRP322195 | PRJNA734348 | Methylome inheritance and enhancer dememorization construct an epigenetic gate safeguarding embryonic programs | GSE175951 | Other | Unlike that of mammals the total DNA methylome of many cold blooded vertebrates is globally inherited from gametes to early embryos. In zebrafish this is however accompanied by sweeping “dememorization” of enhancers prior to fertilization for sperm and just post fertilization for oocyte as they undergo full methylation and are not demethylated again until phylotypic stage. The significance of both global methylome inheritance and enhancer dememorization in early embryos remains largely unknown. Adding to the puzzles the zygotic mutant zebrafish of dnmt1 the major DNA methylation maintenance methyltransferase surprisingly can develop to term. To solve the role of DNA methylation in early development we generated zebrafish embryos derived from dnmt1 knocking down oocytes using a recently developed method OMIS microinjection in situ which successfully eliminated DNA methylation before zygotic genome activation. dnmt1 deficient embryos failed to initiate epiboly and died around gastrulation. This is in part caused by activation of immune response and p53 regulated apoptosis likely triggered by the derepression of transposable elements. Single cell RNA seq further revealed defective differentiation in these mutants. DNA methylation is also required for the establishment of repressive histone marks H3K27me3 and H2AK119ub. Strikingly the loss of DNA methylation leads to extensive derepression of somatic genes and enhancers which acquire ectopic H3K27ac accessible chromatin and H3K4me3. These somatic enhancers are preferentially CG rich and are bound by CG containing TFs. By contrast embryonic enhancers are generally CG poor methylation insensitive and are bound by CG less TFs. Hence the global DNA methylome inheritance is essential for vertebrate early development and enhancer dememorization resets an epigenetic gate that separates embryonic and somatic programs. Overall design: By employing MethylC seq total RNA seq scRNA seq CUT&RUN ChIP seq and ATAC seq in control and dnmt1 mKD embryos at oocyt… | pubmed:34936444 | Oocyte ctrl total RNA seq rep2 | GSM5351799 | source name:oocyte|strain:AB|genotype:WT|developmental stage:Oocyte|tissue:oocyte|treatment:microinjection with Rhodamine B and control MO at oogenesis III stage GV | Oocyte ctrl total RNA seq rep2 | All STEM seq datasets were mapped to the danRer7 reference genome by Bismark Krueger and Andrews 2011. Reads were trimmed with cutadaptor Martin 2011 using parameters: minimum length 20 pair filter=any. Alignments were performed with the following parameters: N 1 X 600 score min L 0 0.6. Multi mapped reads and PCR duplicates were removed. bismark methylation extractor was used to calculate the DNA methylation level. Total RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer7 by STAR version: STAR 2.5.3a modified Dobin et al. 2013 with the following parameters: outSAMstrandField intronMotif outSAMattributes All outSAMunmapped Within outSAMattrIHstart 0 outWigStrand Stranded outFilterMultimapNmax 20 twopassMode Basic. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1 Trapnell et al. 2012. The scRNA seq data were processed with Cell Ranger 3.1 for genome alignment danRer10 transcript counting and gene cell barcode matrix generation. Before the downstream analysis cells with unique detected genes lower than <2 000 and higher than 6 000 genes were discarded and cells with high percentage of mitochondrial genes >5% were removed too. Subtypes of cells were identified with Seurat 3.0 through the integrating of control and mKD embryos at dome and shield stages with setting control embryos as reference. To make the data comparable samples we performed SCTransform normalization separately for each dataset. To further reduce the bais caused by sequencing depth of scRNA seq and percentage of mitochondrial genes UMI variance and percent.mt were regressed out from SCTransform normalized data matrix by linear model with negative binomial distribution. All ChIP seq reads were aligned to the zebrafish reference genome danRer7 using Bowtie2 version 2.2.2 L… | oocyte | Briefly on the first day of OMIS Wu et al. 2018b adult females at 5 mpf 12 mpf were anesthetized in 550 µg/ml tricaine Sigma Cat A5040 in a petri dish. Then the fish was placed on a damp sponge with specific buffer 5.4 mM KCl 136.8 mM NaCl 4.2 mM NaHCO3 0.44 mM KH2PO4 0.25 mM Na2HPO4 and 0.5% wt/vol BSA. A cut was made on one side of belly to expose the ovary. The diluted MOs were microinjected into each oocyte. Rhodamine B Sigma Cat R8881 was co injected with MOs as a dye. post injection the wound on the belly was sewed with a surgical sewing needle carefully and quickly. Once the operation was done the female was transferred into fish water supplemented with 32 µg/ml tricaine 10 unit/ml penicillin and 10 µg/ml streptomycin HyClone Cat SV30010. Then the fish was transferred to fish water containing gradually reduced concentrations of tricaine. In the evening of the second day the female was paired with a wild type male. In the morning of the third day the pair started to chase and lay fertilized eggs naturally. The injected oocyte derived embryos were identified by co injected dye rhodamine B at very early developmental stages. The injection doses of standard control MO cMO were 5 ng per oocyte in the same assay. MOs were dissolved in RNase free water and heated to 65°C for 10 min before microinjection. | The oocytes were dechorionated manually by tweezers and transferred into 750 µl Trizol Invitrogen Cat 15596018. About 10 fresh embryos were transferred into Trizol and vortexed until no visible particles. 150 µl chloroform Amresco Cat 0757 was added and mixed thoroughly. The mixture was then transferred into phasemaker tube Invitrogen Cat A33248 and spun at 14 000 rpm for 15 min. Next the top phase was taken out from the tube added 1 µl LPA Sigma Cat 56575 and mixed well using pipettes. Then RNA was precipitated by adding 750 µl isopropanol Sigma Cat 59304 at 20℃ overnight. At next day the tube was spun at 14 000 rpm for 30 min and supernatant was removed. The pellet was washed with freshly 70% ethanol re suspend in 20 µl RNase free water and stored at 80℃ for later usage. NEBNext rRNA Depletion Kit NEB Cat E6310S was used to deplete ribosomal RNA according to the manufacture’s instruction. Briefly rRNA were hybridized with probes and digested with RNase H then excess probes were digested with DNase I. post that NEBNext RNA sample purification beads were used to purify rRNA depleted RNA. Purified RNA was fragmented before cDNA synthesis at 95℃ for 8 min. Double stranded cDNA was synthesized with NEB Next first strand NEB Cat E7771S and second strand synthesis modules NEB Cat E7550S then purified with Ampure XP beads Beckman Cat A63882. Synthesized cDNA was subjected to library preparation with NEBNext Ultr II DNA Library Prep Kit NEB Cat E7645S. DNA was end repaired adenylated and ligated to TruSeq sequencing adaptors. DNA were amplified using KAPA HF HotStart ReadyMix KAPABiosystem Cat RR2602. The amplified DNA was size selected using Ampure XP beads for 200 500 bp DNA fragments. All libraries were sequenced by Illumina Hi Seq 1500 or 2500 or XTen platform according to manufacturer’s instruction. | The wild type AB strain was used in the experiments. The females post OMIS were fed with live adult brine shrimp thrice a day. All embryos were raised in Holtfreter’s solution at 28.5C and staged as described previously Kimmel et al. 1995. | strain:AB|genotype:WT|developmental stage:Oocyte|tissue:oocyte|treatment:microinjection with Rhodamine B and control MO at oogenesis III stage GV | GSM5351799 | GSM5351799: Oocyte ctrl total RNA seq rep2; Danio rerio; RNA Seq | GSM5351799 | 1 | The oocytes were dechorionated manually by tweezers and transferred into 750 µl Trizol Invitrogen Cat 15596018. About 10 fresh embryos were transferred into Trizol and vortexed until no visible particles. 150 µl chloroform Amresco Cat 0757 was added and mixed thoroughly. The mixture was then transferred into phasemaker tube Invitrogen Cat A33248 and spun at 14 000 rpm for 15 min. Next the top phase was taken out from the tube added 1 µl LPA Sigma Cat 56575 and mixed well using pipettes. Then RNA was precipitated by adding 750 µl isopropanol Sigma Cat 59304 at 20℃ overnight. At next day the tube was spun at 14 000 rpm for 30 min and supernatant was removed. The pellet was washed with freshly 70% ethanol re suspend in 20 µl RNase free water and stored at 80℃ for later usage. NEBNext rRNA Depletion Kit NEB Cat E6310S was used to deplete ribosomal RNA according to the manufacture's instruction. Briefly rRNA were hybridized with probes and digested with RNase H then excess probes were digested with DNase I. post that NEBNext RNA sample purification beads were used to purify rRNA depleted RNA. Purified RNA was fragmented before cDNA synthesis at 95℃ for 8 min. Double stranded cDNA was synthesized with NEB Next first strand NEB Cat E7771S and second strand synthesis modules NEB Cat E7550S then purified with Ampure XP beads Beckman Cat A63882. Synthesized cDNA was subjected to library preparation with NEBNext Ultr II DNA Library Prep Kit NEB Cat E7645S. DNA was end repaired adenylated and ligated to TruSeq sequencing adaptors. DNA were amplified using KAPA HF HotStart ReadyMix KAPABiosystem Cat RR2602. The amplified DNA was size selected using Ampure XP beads for 200 500 bp DNA fragments. All libraries were sequenced by Illumina Hi Seq 1500 or 2500 or XTen platform according to manufacturer's instruction. | GEO Accession:GSM5351799 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 1500 | SRP322195 | loader:fastq load.py | Oocyte_ctrl_total_RNA_seq_rep2_r1.fq.gz Oocyte_ctrl_total_RNA_seq_rep2_r2.fq.gz | fastq fastq | 8180427000.0 | 27268090.0 | GSM5351799 r1 | 0:150 1:150 | A:1694775525;C:2388512701;G:2446021403;T:1649171179;N:1946192 | 150 | 150 | 1694775525 | 2388512701 | 2446021403 | 1649171179 | 1946192 | SRX11041444 | SRS9110371 | SRA1239365 | GEO | THU-PKU Center for Life Sciences, Tsinghua University | 2 | 0.95217 | 0.95176 | 0.08629 | 0.08619 | 0.79387 | 0.79778 | 0.76806 | 0.80396 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | rrna_depletion | nebnext | sc_generic | single_cell_generic | generic-scrnaseq-only | China | 2021-06-01 | Zygote | Embryo | Oocyte | Reproductive System | |||||||||
| 64470 | 64470 | SRR14703421 | SRX11041443 | SRS9110372 | SRP322195 | PRJNA734348 | Methylome inheritance and enhancer dememorization construct an epigenetic gate safeguarding embryonic programs | GSE175951 | Other | Unlike that of mammals the total DNA methylome of many cold blooded vertebrates is globally inherited from gametes to early embryos. In zebrafish this is however accompanied by sweeping “dememorization” of enhancers prior to fertilization for sperm and just post fertilization for oocyte as they undergo full methylation and are not demethylated again until phylotypic stage. The significance of both global methylome inheritance and enhancer dememorization in early embryos remains largely unknown. Adding to the puzzles the zygotic mutant zebrafish of dnmt1 the major DNA methylation maintenance methyltransferase surprisingly can develop to term. To solve the role of DNA methylation in early development we generated zebrafish embryos derived from dnmt1 knocking down oocytes using a recently developed method OMIS microinjection in situ which successfully eliminated DNA methylation before zygotic genome activation. dnmt1 deficient embryos failed to initiate epiboly and died around gastrulation. This is in part caused by activation of immune response and p53 regulated apoptosis likely triggered by the derepression of transposable elements. Single cell RNA seq further revealed defective differentiation in these mutants. DNA methylation is also required for the establishment of repressive histone marks H3K27me3 and H2AK119ub. Strikingly the loss of DNA methylation leads to extensive derepression of somatic genes and enhancers which acquire ectopic H3K27ac accessible chromatin and H3K4me3. These somatic enhancers are preferentially CG rich and are bound by CG containing TFs. By contrast embryonic enhancers are generally CG poor methylation insensitive and are bound by CG less TFs. Hence the global DNA methylome inheritance is essential for vertebrate early development and enhancer dememorization resets an epigenetic gate that separates embryonic and somatic programs. Overall design: By employing MethylC seq total RNA seq scRNA seq CUT&RUN ChIP seq and ATAC seq in control and dnmt1 mKD embryos at oocyt… | pubmed:34936444 | Oocyte ctrl total RNA seq rep1 | GSM5351798 | source name:oocyte|strain:AB|genotype:WT|developmental stage:Oocyte|tissue:oocyte|treatment:microinjection with Rhodamine B and control MO at oogenesis III stage GV | Oocyte ctrl total RNA seq rep1 | All STEM seq datasets were mapped to the danRer7 reference genome by Bismark Krueger and Andrews 2011. Reads were trimmed with cutadaptor Martin 2011 using parameters: minimum length 20 pair filter=any. Alignments were performed with the following parameters: N 1 X 600 score min L 0 0.6. Multi mapped reads and PCR duplicates were removed. bismark methylation extractor was used to calculate the DNA methylation level. Total RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer7 by STAR version: STAR 2.5.3a modified Dobin et al. 2013 with the following parameters: outSAMstrandField intronMotif outSAMattributes All outSAMunmapped Within outSAMattrIHstart 0 outWigStrand Stranded outFilterMultimapNmax 20 twopassMode Basic. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1 Trapnell et al. 2012. The scRNA seq data were processed with Cell Ranger 3.1 for genome alignment danRer10 transcript counting and gene cell barcode matrix generation. Before the downstream analysis cells with unique detected genes lower than <2 000 and higher than 6 000 genes were discarded and cells with high percentage of mitochondrial genes >5% were removed too. Subtypes of cells were identified with Seurat 3.0 through the integrating of control and mKD embryos at dome and shield stages with setting control embryos as reference. To make the data comparable samples we performed SCTransform normalization separately for each dataset. To further reduce the bais caused by sequencing depth of scRNA seq and percentage of mitochondrial genes UMI variance and percent.mt were regressed out from SCTransform normalized data matrix by linear model with negative binomial distribution. All ChIP seq reads were aligned to the zebrafish reference genome danRer7 using Bowtie2 version 2.2.2 L… | oocyte | Briefly on the first day of OMIS Wu et al. 2018b adult females at 5 mpf 12 mpf were anesthetized in 550 µg/ml tricaine Sigma Cat A5040 in a petri dish. Then the fish was placed on a damp sponge with specific buffer 5.4 mM KCl 136.8 mM NaCl 4.2 mM NaHCO3 0.44 mM KH2PO4 0.25 mM Na2HPO4 and 0.5% wt/vol BSA. A cut was made on one side of belly to expose the ovary. The diluted MOs were microinjected into each oocyte. Rhodamine B Sigma Cat R8881 was co injected with MOs as a dye. post injection the wound on the belly was sewed with a surgical sewing needle carefully and quickly. Once the operation was done the female was transferred into fish water supplemented with 32 µg/ml tricaine 10 unit/ml penicillin and 10 µg/ml streptomycin HyClone Cat SV30010. Then the fish was transferred to fish water containing gradually reduced concentrations of tricaine. In the evening of the second day the female was paired with a wild type male. In the morning of the third day the pair started to chase and lay fertilized eggs naturally. The injected oocyte derived embryos were identified by co injected dye rhodamine B at very early developmental stages. The injection doses of standard control MO cMO were 5 ng per oocyte in the same assay. MOs were dissolved in RNase free water and heated to 65°C for 10 min before microinjection. | The oocytes were dechorionated manually by tweezers and transferred into 750 µl Trizol Invitrogen Cat 15596018. About 10 fresh embryos were transferred into Trizol and vortexed until no visible particles. 150 µl chloroform Amresco Cat 0757 was added and mixed thoroughly. The mixture was then transferred into phasemaker tube Invitrogen Cat A33248 and spun at 14 000 rpm for 15 min. Next the top phase was taken out from the tube added 1 µl LPA Sigma Cat 56575 and mixed well using pipettes. Then RNA was precipitated by adding 750 µl isopropanol Sigma Cat 59304 at 20℃ overnight. At next day the tube was spun at 14 000 rpm for 30 min and supernatant was removed. The pellet was washed with freshly 70% ethanol re suspend in 20 µl RNase free water and stored at 80℃ for later usage. NEBNext rRNA Depletion Kit NEB Cat E6310S was used to deplete ribosomal RNA according to the manufacture’s instruction. Briefly rRNA were hybridized with probes and digested with RNase H then excess probes were digested with DNase I. post that NEBNext RNA sample purification beads were used to purify rRNA depleted RNA. Purified RNA was fragmented before cDNA synthesis at 95℃ for 8 min. Double stranded cDNA was synthesized with NEB Next first strand NEB Cat E7771S and second strand synthesis modules NEB Cat E7550S then purified with Ampure XP beads Beckman Cat A63882. Synthesized cDNA was subjected to library preparation with NEBNext Ultr II DNA Library Prep Kit NEB Cat E7645S. DNA was end repaired adenylated and ligated to TruSeq sequencing adaptors. DNA were amplified using KAPA HF HotStart ReadyMix KAPABiosystem Cat RR2602. The amplified DNA was size selected using Ampure XP beads for 200 500 bp DNA fragments. All libraries were sequenced by Illumina Hi Seq 1500 or 2500 or XTen platform according to manufacturer’s instruction. | The wild type AB strain was used in the experiments. The females post OMIS were fed with live adult brine shrimp thrice a day. All embryos were raised in Holtfreter’s solution at 28.5C and staged as described previously Kimmel et al. 1995. | strain:AB|genotype:WT|developmental stage:Oocyte|tissue:oocyte|treatment:microinjection with Rhodamine B and control MO at oogenesis III stage GV | GSM5351798 | GSM5351798: Oocyte ctrl total RNA seq rep1; Danio rerio; RNA Seq | GSM5351798 | 1 | The oocytes were dechorionated manually by tweezers and transferred into 750 µl Trizol Invitrogen Cat 15596018. About 10 fresh embryos were transferred into Trizol and vortexed until no visible particles. 150 µl chloroform Amresco Cat 0757 was added and mixed thoroughly. The mixture was then transferred into phasemaker tube Invitrogen Cat A33248 and spun at 14 000 rpm for 15 min. Next the top phase was taken out from the tube added 1 µl LPA Sigma Cat 56575 and mixed well using pipettes. Then RNA was precipitated by adding 750 µl isopropanol Sigma Cat 59304 at 20℃ overnight. At next day the tube was spun at 14 000 rpm for 30 min and supernatant was removed. The pellet was washed with freshly 70% ethanol re suspend in 20 µl RNase free water and stored at 80℃ for later usage. NEBNext rRNA Depletion Kit NEB Cat E6310S was used to deplete ribosomal RNA according to the manufacture's instruction. Briefly rRNA were hybridized with probes and digested with RNase H then excess probes were digested with DNase I. post that NEBNext RNA sample purification beads were used to purify rRNA depleted RNA. Purified RNA was fragmented before cDNA synthesis at 95℃ for 8 min. Double stranded cDNA was synthesized with NEB Next first strand NEB Cat E7771S and second strand synthesis modules NEB Cat E7550S then purified with Ampure XP beads Beckman Cat A63882. Synthesized cDNA was subjected to library preparation with NEBNext Ultr II DNA Library Prep Kit NEB Cat E7645S. DNA was end repaired adenylated and ligated to TruSeq sequencing adaptors. DNA were amplified using KAPA HF HotStart ReadyMix KAPABiosystem Cat RR2602. The amplified DNA was size selected using Ampure XP beads for 200 500 bp DNA fragments. All libraries were sequenced by Illumina Hi Seq 1500 or 2500 or XTen platform according to manufacturer's instruction. | GEO Accession:GSM5351798 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 1500 | SRP322195 | loader:fastq load.py | Oocyte_ctrl_total_RNA_seq_rep1_r1.fq.gz Oocyte_ctrl_total_RNA_seq_rep1_r2.fq.gz | fastq fastq | 14857394100.0 | 49524647.0 | GSM5351798 r1 | 0:150 1:150 | A:2831227396;C:4590477521;G:4795177217;T:2639889839;N:622127 | 150 | 150 | 2831227396 | 4590477521 | 4795177217 | 2639889839 | 622127 | SRX11041443 | SRS9110372 | SRA1239365 | GEO | THU-PKU Center for Life Sciences, Tsinghua University | 2 | 0.96771 | 0.96848 | 0.26114 | 0.26288 | 0.83968 | 0.84356 | 0.80056 | 0.84647 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | rrna_depletion | nebnext | sc_generic | single_cell_generic | generic-scrnaseq-only | China | 2021-06-01 | Zygote | Embryo | Oocyte | Reproductive System |
Advanced export
JSON shape: default, array, newline-delimited
CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;