run_metadata
17 rows where technology = "generic-scrnaseq-only" and tissue_curation = "Gonad"
This data as json, CSV (advanced)
| Link | rowid ▼ | run.accession | experiment.accession | sample.accession | study.accession | bioproject | study.title | study.alias | study.type | study.abstract | study.attributes | study.PMIDs | sample.description | sample.title | sample.alias | sample.centername | sample.attributes | GEOsample.title | GEOsample.dataprocessing | GEOsample.source | GEOsample.treatmentprotocol | GEOsample.extractprotocol | GEOsample.growthprotocol | GEOsample.characteristics | GEOsample.accession | experiment.title | experiment.alias | experiment.library_name | experiment.design_description | experiment.library_construction_protocol | experiment.attributes | experiment.library_strategy | experiment.library_source | experiment.library_selection | experiment.library_layout | experiment.platform | experiment.instrument_model | experiment.spot_descriptor | experiment.study_ref | run.title | run.attributes | run.filename | run.semantic_name | run.total_bases | run.total_spots | run.alias | run.read_lengths | run.base_counts | run.r1_length | run.r2_length | run.r3_length | run.r4_length | run.Acount | run.Ccount | run.Gcount | run.Tcount | run.Ncount | run.experiment | run.pool_member | submission.accession | submission.srasource | submission.bioprojectsource | seqdetective.n_mates | seqdetective.mapping_rate.mate1 | seqdetective.mapping_rate.mate2 | seqdetective.nofeature_rate.mate1 | seqdetective.nofeature_rate.mate2 | seqdetective.sparsity.mate1 | seqdetective.sparsity.mate2 | seqdetective.pos_strand_rate.mate1 | seqdetective.pos_strand_rate.mate2 | seqdetective.readlen.mate1 | seqdetective.readlen.mate2 | seqdetective.judgement.mate1 | seqdetective.judgement.mate2 | seqdetective.judgement.reason | platform_family | instrument_generation | read_bias | selection_class | prep_kit | sc_or_bulk | tech_class | technology | tech_variant | submission.bioprojectsource.country | earliest_date | devstage_curation | devstage_curation_coarse | tissue_curation | tissue_curation_coarse |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 44967 | 44967 | SRR6345660 | SRX3442976 | SRS2733636 | SRP126106 | PRJNA421016 | Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA] | GSE107682 | Transcriptome Analysis | Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish. | parent bioproject:PRJNA315403 | pubmed:30086300 | smRNA seq library of ovary from tdrd6a mut fish | GSM2875719 | source name:Ovary from tdrd6a mut fish|tissue:whole ovary|genotype:tdrd6a mutant | smRNA seq library of ovary from tdrd6a mut fish | 1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15 6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities. 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to. Supplementary files format and content: Files ending in .bw are bigwig tracks. | Ovary from tdrd6a mut fish | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | tissue:whole ovary|genotype:tdrd6a mutant | GSM2875719 | GSM2875719: smRNA seq library of ovary from tdrd6a mut fish; Danio rerio; ncRNA Seq | GSM2875719 | 1 | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | GEO Accession:GSM2875719 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP126106 | Tdrd6a-mut-ovary-input-Adult.fastq.gz | fastq | 817885062.0 | 16036962.0 | GSM2875719 r1 | 0:51 | A:212456064;C:163491733;G:233627239;T:208262707;N:47319 | 51 | 212456064 | 163491733 | 233627239 | 208262707 | 47319 | SRX3442976 | SRS2733636 | SRA636010 | GEO | Rene Ketting, RNA silencing, IMB | 1 | 0.46308 | 0.13668 | 0.83587 | 0.79104 | 51 | B | usable mapping rate | illumina | hiseq_era | 5prime | size_fractionation | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2017-12-04 | Undetermined | Undetermined | Gonad | Reproductive System | ||||||||||||||||||
| 44968 | 44968 | SRR6345659 | SRX3442975 | SRS2733637 | SRP126106 | PRJNA421016 | Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA] | GSE107682 | Transcriptome Analysis | Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish. | parent bioproject:PRJNA315403 | pubmed:30086300 | smRNA seq library of ovary from tdrd6a het fish | GSM2875718 | source name:Ovary from tdrd6a het fish|tissue:whole ovary|genotype:tdrd6a heterozygous | smRNA seq library of ovary from tdrd6a het fish | 1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15 6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities. 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to. Supplementary files format and content: Files ending in .bw are bigwig tracks. | Ovary from tdrd6a het fish | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | tissue:whole ovary|genotype:tdrd6a heterozygous | GSM2875718 | GSM2875718: smRNA seq library of ovary from tdrd6a het fish; Danio rerio; ncRNA Seq | GSM2875718 | 1 | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | GEO Accession:GSM2875718 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP126106 | Tdrd6a-het-ovary-input-Adult.fastq.gz | fastq | 1452353571.0 | 28477521.0 | GSM2875718 r1 | 0:51 | A:397993735;C:284194126;G:396142390;T:373939235;N:84085 | 51 | 397993735 | 284194126 | 396142390 | 373939235 | 84085 | SRX3442975 | SRS2733637 | SRA636010 | GEO | Rene Ketting, RNA silencing, IMB | 1 | 0.3869 | 0.1369 | 0.86397 | 0.77165 | 51 | B | usable mapping rate | illumina | hiseq_era | 5prime | size_fractionation | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2017-12-04 | Undetermined | Undetermined | Gonad | Reproductive System | ||||||||||||||||||
| 64217 | 64217 | SRR14343411 | SRX10697276 | SRS8786690 | SRP316710 | PRJNA725806 | foxl2l regulates female meiotic entry during juvenile gonadal development in zebrafish | GSE173480 | Transcriptome Analysis | Sex determination is distinct from development of other organs for its diversity among species. In zebrafish the sex determination in juvenile stage could be hermaphroditic or gonochoristic. However the detail mechanism is still unclear. Here in this study we found that the transcription factor that belongs to forkhead box family Foxl2l is required for determination of female fate in zebrafish. Foxl2l was expressed from larva stage and became female bias in juvenile stage. The expression was restricted in pre meiotic germ cells. Disruption of Foxl2l function by CRISPR/Cas9 system resulted in all male phenotype in the mutant. Germ cells in foxl2l mutant were arrested in pre meiotic stage at 21 dpf the critical period for female meiotic entry. To further verify the downstream mechanism of Foxl2l on female sex determination wildtype or foxl2l mutant germ cells labeled by foxl2l:egfp at 21 dpf dpf and germ cells labeled by ziwi:egfp at 26 dpf were analyzed by RNA seq and single cell RNA seq respectively Overall design: Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. and RNA sequencing was performed by Illumina NextSeq 500. Each genotype contained triple samples. | HO 3 | GSM5268475 | tissue:gonad|strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l / |age:21 dpf | HO 3 | Sequenced data was analyzed by NextSeq Control Software 2.2.0 The de multiplexing adaptor removal and FASTQ file transformation were performed by bcl2fastq Conversion Software 2.17 Illumina Inc. The FASTQ files were imported into CLC Genomics Workbench v.11.0.1 QIAGEN to remove low quality reads including reads with lengths less than 30 nucleotides or with Phred quality score lower than 20 The trimmed reads were mapped to zebrafish genome GRCz11 and TPM were calculated by CLC Genomics Workbench v.11.0.1 QIAGEN Genome build: GRCz11 Supplementary files format and content: txt files contain expression data for all cells | gonad | Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols. | strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l / |age:21 dpf | GSM5268475 | GSM5268475: HO 3; Danio rerio; RNA Seq | GSM5268475 | 1 | Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols. | GEO Accession:GSM5268475 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP316710 | HO_3_run1.R1.fastq HO_3_run1.R2.fastq | fastq fastq | 3534673132.0 | 24300429.0 | GSM5268475 r1 | 0:72.72 1:72.74 | A:983413722;C:772614472;G:797390978;T:980739251;N:514709 | 72 | 72 | 983413722 | 772614472 | 797390978 | 980739251 | 514709 | SRX10697276 | SRS8786690 | SRA1224866 | GEO | Institute of Molecular Biology, Academia Sinica | 2 | 0.92009 | 0.92081 | 0.07189 | 0.07113 | 0.66176 | 0.66502 | 0.48304 | 0.4818 | 76 | 76 | B | B | biological fallback assumption | illumina | nextseq | unknown | cdna_unspecified | nextera | sc_generic | single_cell_generic | generic-scrnaseq-only | Taiwan | 2021-04-28 | Larval | Larval | Gonad | Reproductive System | |||||||||||||
| 64218 | 64218 | SRR14343412 | SRX10697276 | SRS8786690 | SRP316710 | PRJNA725806 | foxl2l regulates female meiotic entry during juvenile gonadal development in zebrafish | GSE173480 | Transcriptome Analysis | Sex determination is distinct from development of other organs for its diversity among species. In zebrafish the sex determination in juvenile stage could be hermaphroditic or gonochoristic. However the detail mechanism is still unclear. Here in this study we found that the transcription factor that belongs to forkhead box family Foxl2l is required for determination of female fate in zebrafish. Foxl2l was expressed from larva stage and became female bias in juvenile stage. The expression was restricted in pre meiotic germ cells. Disruption of Foxl2l function by CRISPR/Cas9 system resulted in all male phenotype in the mutant. Germ cells in foxl2l mutant were arrested in pre meiotic stage at 21 dpf the critical period for female meiotic entry. To further verify the downstream mechanism of Foxl2l on female sex determination wildtype or foxl2l mutant germ cells labeled by foxl2l:egfp at 21 dpf dpf and germ cells labeled by ziwi:egfp at 26 dpf were analyzed by RNA seq and single cell RNA seq respectively Overall design: Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. and RNA sequencing was performed by Illumina NextSeq 500. Each genotype contained triple samples. | HO 3 | GSM5268475 | tissue:gonad|strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l / |age:21 dpf | HO 3 | Sequenced data was analyzed by NextSeq Control Software 2.2.0 The de multiplexing adaptor removal and FASTQ file transformation were performed by bcl2fastq Conversion Software 2.17 Illumina Inc. The FASTQ files were imported into CLC Genomics Workbench v.11.0.1 QIAGEN to remove low quality reads including reads with lengths less than 30 nucleotides or with Phred quality score lower than 20 The trimmed reads were mapped to zebrafish genome GRCz11 and TPM were calculated by CLC Genomics Workbench v.11.0.1 QIAGEN Genome build: GRCz11 Supplementary files format and content: txt files contain expression data for all cells | gonad | Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols. | strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l / |age:21 dpf | GSM5268475 | GSM5268475: HO 3; Danio rerio; RNA Seq | GSM5268475 | 1 | Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols. | GEO Accession:GSM5268475 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP316710 | HO_3_run2.R1.fastq HO_3_run2.R2.fastq | fastq fastq | 3789665865.0 | 25970236.0 | GSM5268475 r2 | 0:72.95 1:72.97 | A:1055034390;C:825452326;G:851854221;T:1054834294;N:2490634 | 72 | 72 | 1055034390 | 825452326 | 851854221 | 1054834294 | 2490634 | SRX10697276 | SRS8786690 | SRA1224866 | GEO | Institute of Molecular Biology, Academia Sinica | 2 | 0.92122 | 0.92134 | 0.07291 | 0.07232 | 0.66346 | 0.66649 | 0.48355 | 0.48092 | 74 | 74 | B | B | biological fallback assumption | illumina | nextseq | unknown | cdna_unspecified | nextera | sc_generic | single_cell_generic | generic-scrnaseq-only | Taiwan | 2021-04-28 | Larval | Larval | Gonad | Reproductive System | |||||||||||||
| 64219 | 64219 | SRR14343409 | SRX10697275 | SRS8786689 | SRP316710 | PRJNA725806 | foxl2l regulates female meiotic entry during juvenile gonadal development in zebrafish | GSE173480 | Transcriptome Analysis | Sex determination is distinct from development of other organs for its diversity among species. In zebrafish the sex determination in juvenile stage could be hermaphroditic or gonochoristic. However the detail mechanism is still unclear. Here in this study we found that the transcription factor that belongs to forkhead box family Foxl2l is required for determination of female fate in zebrafish. Foxl2l was expressed from larva stage and became female bias in juvenile stage. The expression was restricted in pre meiotic germ cells. Disruption of Foxl2l function by CRISPR/Cas9 system resulted in all male phenotype in the mutant. Germ cells in foxl2l mutant were arrested in pre meiotic stage at 21 dpf the critical period for female meiotic entry. To further verify the downstream mechanism of Foxl2l on female sex determination wildtype or foxl2l mutant germ cells labeled by foxl2l:egfp at 21 dpf dpf and germ cells labeled by ziwi:egfp at 26 dpf were analyzed by RNA seq and single cell RNA seq respectively Overall design: Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. and RNA sequencing was performed by Illumina NextSeq 500. Each genotype contained triple samples. | HO 2 | GSM5268474 | tissue:gonad|strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l / |age:21 dpf | HO 2 | Sequenced data was analyzed by NextSeq Control Software 2.2.0 The de multiplexing adaptor removal and FASTQ file transformation were performed by bcl2fastq Conversion Software 2.17 Illumina Inc. The FASTQ files were imported into CLC Genomics Workbench v.11.0.1 QIAGEN to remove low quality reads including reads with lengths less than 30 nucleotides or with Phred quality score lower than 20 The trimmed reads were mapped to zebrafish genome GRCz11 and TPM were calculated by CLC Genomics Workbench v.11.0.1 QIAGEN Genome build: GRCz11 Supplementary files format and content: txt files contain expression data for all cells | gonad | Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols. | strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l / |age:21 dpf | GSM5268474 | GSM5268474: HO 2; Danio rerio; RNA Seq | GSM5268474 | 1 | Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols. | GEO Accession:GSM5268474 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP316710 | HO_2_run1.R1.fastq HO_2_run1.R2.fastq | fastq fastq | 3972958992.0 | 27776809.0 | GSM5268474 r1 | 0:71.50 1:71.53 | A:1124808892;C:846395118;G:875350364;T:1125141364;N:1263254 | 71 | 71 | 1124808892 | 846395118 | 875350364 | 1125141364 | 1263254 | SRX10697275 | SRS8786689 | SRA1224866 | GEO | Institute of Molecular Biology, Academia Sinica | 2 | 0.89819 | 0.89964 | 0.11368 | 0.11314 | 0.65052 | 0.65387 | 0.49509 | 0.49244 | 76 | 76 | B | B | biological fallback assumption | illumina | nextseq | unknown | cdna_unspecified | nextera | sc_generic | single_cell_generic | generic-scrnaseq-only | Taiwan | 2021-04-28 | Larval | Larval | Gonad | Reproductive System | |||||||||||||
| 64220 | 64220 | SRR14343410 | SRX10697275 | SRS8786689 | SRP316710 | PRJNA725806 | foxl2l regulates female meiotic entry during juvenile gonadal development in zebrafish | GSE173480 | Transcriptome Analysis | Sex determination is distinct from development of other organs for its diversity among species. In zebrafish the sex determination in juvenile stage could be hermaphroditic or gonochoristic. However the detail mechanism is still unclear. Here in this study we found that the transcription factor that belongs to forkhead box family Foxl2l is required for determination of female fate in zebrafish. Foxl2l was expressed from larva stage and became female bias in juvenile stage. The expression was restricted in pre meiotic germ cells. Disruption of Foxl2l function by CRISPR/Cas9 system resulted in all male phenotype in the mutant. Germ cells in foxl2l mutant were arrested in pre meiotic stage at 21 dpf the critical period for female meiotic entry. To further verify the downstream mechanism of Foxl2l on female sex determination wildtype or foxl2l mutant germ cells labeled by foxl2l:egfp at 21 dpf dpf and germ cells labeled by ziwi:egfp at 26 dpf were analyzed by RNA seq and single cell RNA seq respectively Overall design: Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. and RNA sequencing was performed by Illumina NextSeq 500. Each genotype contained triple samples. | HO 2 | GSM5268474 | tissue:gonad|strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l / |age:21 dpf | HO 2 | Sequenced data was analyzed by NextSeq Control Software 2.2.0 The de multiplexing adaptor removal and FASTQ file transformation were performed by bcl2fastq Conversion Software 2.17 Illumina Inc. The FASTQ files were imported into CLC Genomics Workbench v.11.0.1 QIAGEN to remove low quality reads including reads with lengths less than 30 nucleotides or with Phred quality score lower than 20 The trimmed reads were mapped to zebrafish genome GRCz11 and TPM were calculated by CLC Genomics Workbench v.11.0.1 QIAGEN Genome build: GRCz11 Supplementary files format and content: txt files contain expression data for all cells | gonad | Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols. | strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l / |age:21 dpf | GSM5268474 | GSM5268474: HO 2; Danio rerio; RNA Seq | GSM5268474 | 1 | Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols. | GEO Accession:GSM5268474 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP316710 | HO_2_run2.R2.fastq HO_2_run2.R1.fastq | fastq fastq | 4396792493.0 | 30653836.0 | GSM5268474 r2 | 0:71.70 1:71.73 | A:1244672283;C:933954952;G:965736051;T:1248628688;N:3800519 | 71 | 71 | 1244672283 | 933954952 | 965736051 | 1248628688 | 3800519 | SRX10697275 | SRS8786689 | SRA1224866 | GEO | Institute of Molecular Biology, Academia Sinica | 2 | 0.89957 | 0.90042 | 0.11576 | 0.11485 | 0.64985 | 0.65348 | 0.48847 | 0.48933 | 76 | 76 | B | B | biological fallback assumption | illumina | nextseq | unknown | cdna_unspecified | nextera | sc_generic | single_cell_generic | generic-scrnaseq-only | Taiwan | 2021-04-28 | Larval | Larval | Gonad | Reproductive System | |||||||||||||
| 64221 | 64221 | SRR14343407 | SRX10697274 | SRS8786688 | SRP316710 | PRJNA725806 | foxl2l regulates female meiotic entry during juvenile gonadal development in zebrafish | GSE173480 | Transcriptome Analysis | Sex determination is distinct from development of other organs for its diversity among species. In zebrafish the sex determination in juvenile stage could be hermaphroditic or gonochoristic. However the detail mechanism is still unclear. Here in this study we found that the transcription factor that belongs to forkhead box family Foxl2l is required for determination of female fate in zebrafish. Foxl2l was expressed from larva stage and became female bias in juvenile stage. The expression was restricted in pre meiotic germ cells. Disruption of Foxl2l function by CRISPR/Cas9 system resulted in all male phenotype in the mutant. Germ cells in foxl2l mutant were arrested in pre meiotic stage at 21 dpf the critical period for female meiotic entry. To further verify the downstream mechanism of Foxl2l on female sex determination wildtype or foxl2l mutant germ cells labeled by foxl2l:egfp at 21 dpf dpf and germ cells labeled by ziwi:egfp at 26 dpf were analyzed by RNA seq and single cell RNA seq respectively Overall design: Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. and RNA sequencing was performed by Illumina NextSeq 500. Each genotype contained triple samples. | HO 1 | GSM5268473 | tissue:gonad|strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l / |age:21 dpf | HO 1 | Sequenced data was analyzed by NextSeq Control Software 2.2.0 The de multiplexing adaptor removal and FASTQ file transformation were performed by bcl2fastq Conversion Software 2.17 Illumina Inc. The FASTQ files were imported into CLC Genomics Workbench v.11.0.1 QIAGEN to remove low quality reads including reads with lengths less than 30 nucleotides or with Phred quality score lower than 20 The trimmed reads were mapped to zebrafish genome GRCz11 and TPM were calculated by CLC Genomics Workbench v.11.0.1 QIAGEN Genome build: GRCz11 Supplementary files format and content: txt files contain expression data for all cells | gonad | Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols. | strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l / |age:21 dpf | GSM5268473 | GSM5268473: HO 1; Danio rerio; RNA Seq | GSM5268473 | 1 | Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols. | GEO Accession:GSM5268473 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP316710 | HO_1_run1.R1.fastq HO_1_run1.R2.fastq | fastq fastq | 3833739891.0 | 26806927.0 | GSM5268473 r1 | 0:71.49 1:71.52 | A:1084861861;C:818381943;G:845191898;T:1084121864;N:1182325 | 71 | 71 | 1084861861 | 818381943 | 845191898 | 1084121864 | 1182325 | SRX10697274 | SRS8786688 | SRA1224866 | GEO | Institute of Molecular Biology, Academia Sinica | 2 | 0.90273 | 0.90247 | 0.09672 | 0.09556 | 0.6565 | 0.65932 | 0.48356 | 0.49197 | 74 | 75 | B | B | biological fallback assumption | illumina | nextseq | unknown | cdna_unspecified | nextera | sc_generic | single_cell_generic | generic-scrnaseq-only | Taiwan | 2021-04-28 | Larval | Larval | Gonad | Reproductive System | |||||||||||||
| 64222 | 64222 | SRR14343408 | SRX10697274 | SRS8786688 | SRP316710 | PRJNA725806 | foxl2l regulates female meiotic entry during juvenile gonadal development in zebrafish | GSE173480 | Transcriptome Analysis | Sex determination is distinct from development of other organs for its diversity among species. In zebrafish the sex determination in juvenile stage could be hermaphroditic or gonochoristic. However the detail mechanism is still unclear. Here in this study we found that the transcription factor that belongs to forkhead box family Foxl2l is required for determination of female fate in zebrafish. Foxl2l was expressed from larva stage and became female bias in juvenile stage. The expression was restricted in pre meiotic germ cells. Disruption of Foxl2l function by CRISPR/Cas9 system resulted in all male phenotype in the mutant. Germ cells in foxl2l mutant were arrested in pre meiotic stage at 21 dpf the critical period for female meiotic entry. To further verify the downstream mechanism of Foxl2l on female sex determination wildtype or foxl2l mutant germ cells labeled by foxl2l:egfp at 21 dpf dpf and germ cells labeled by ziwi:egfp at 26 dpf were analyzed by RNA seq and single cell RNA seq respectively Overall design: Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. and RNA sequencing was performed by Illumina NextSeq 500. Each genotype contained triple samples. | HO 1 | GSM5268473 | tissue:gonad|strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l / |age:21 dpf | HO 1 | Sequenced data was analyzed by NextSeq Control Software 2.2.0 The de multiplexing adaptor removal and FASTQ file transformation were performed by bcl2fastq Conversion Software 2.17 Illumina Inc. The FASTQ files were imported into CLC Genomics Workbench v.11.0.1 QIAGEN to remove low quality reads including reads with lengths less than 30 nucleotides or with Phred quality score lower than 20 The trimmed reads were mapped to zebrafish genome GRCz11 and TPM were calculated by CLC Genomics Workbench v.11.0.1 QIAGEN Genome build: GRCz11 Supplementary files format and content: txt files contain expression data for all cells | gonad | Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols. | strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l / |age:21 dpf | GSM5268473 | GSM5268473: HO 1; Danio rerio; RNA Seq | GSM5268473 | 1 | Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols. | GEO Accession:GSM5268473 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP316710 | HO_1_run2.R2.fastq HO_1_run2.R1.fastq | fastq fastq | 4251914417.0 | 29647144.0 | GSM5268473 r2 | 0:71.69 1:71.72 | A:1202985882;C:905068322;G:934722262;T:1205490290;N:3647661 | 71 | 71 | 1202985882 | 905068322 | 934722262 | 1205490290 | 3647661 | SRX10697274 | SRS8786688 | SRA1224866 | GEO | Institute of Molecular Biology, Academia Sinica | 2 | 0.90347 | 0.9046 | 0.09694 | 0.09634 | 0.65662 | 0.66131 | 0.49104 | 0.48825 | 76 | 76 | B | B | biological fallback assumption | illumina | nextseq | unknown | cdna_unspecified | nextera | sc_generic | single_cell_generic | generic-scrnaseq-only | Taiwan | 2021-04-28 | Larval | Larval | Gonad | Reproductive System | |||||||||||||
| 64223 | 64223 | SRR14343405 | SRX10697273 | SRS8786687 | SRP316710 | PRJNA725806 | foxl2l regulates female meiotic entry during juvenile gonadal development in zebrafish | GSE173480 | Transcriptome Analysis | Sex determination is distinct from development of other organs for its diversity among species. In zebrafish the sex determination in juvenile stage could be hermaphroditic or gonochoristic. However the detail mechanism is still unclear. Here in this study we found that the transcription factor that belongs to forkhead box family Foxl2l is required for determination of female fate in zebrafish. Foxl2l was expressed from larva stage and became female bias in juvenile stage. The expression was restricted in pre meiotic germ cells. Disruption of Foxl2l function by CRISPR/Cas9 system resulted in all male phenotype in the mutant. Germ cells in foxl2l mutant were arrested in pre meiotic stage at 21 dpf the critical period for female meiotic entry. To further verify the downstream mechanism of Foxl2l on female sex determination wildtype or foxl2l mutant germ cells labeled by foxl2l:egfp at 21 dpf dpf and germ cells labeled by ziwi:egfp at 26 dpf were analyzed by RNA seq and single cell RNA seq respectively Overall design: Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. and RNA sequencing was performed by Illumina NextSeq 500. Each genotype contained triple samples. | WT 3 | GSM5268472 | tissue:gonad|strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l+/+|age:21 dpf | WT 3 | Sequenced data was analyzed by NextSeq Control Software 2.2.0 The de multiplexing adaptor removal and FASTQ file transformation were performed by bcl2fastq Conversion Software 2.17 Illumina Inc. The FASTQ files were imported into CLC Genomics Workbench v.11.0.1 QIAGEN to remove low quality reads including reads with lengths less than 30 nucleotides or with Phred quality score lower than 20 The trimmed reads were mapped to zebrafish genome GRCz11 and TPM were calculated by CLC Genomics Workbench v.11.0.1 QIAGEN Genome build: GRCz11 Supplementary files format and content: txt files contain expression data for all cells | gonad | Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols. | strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l+/+|age:21 dpf | GSM5268472 | GSM5268472: WT 3; Danio rerio; RNA Seq | GSM5268472 | 1 | Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols. | GEO Accession:GSM5268472 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP316710 | WT_3_run1.R1.fastq WT_3_run1.R2.fastq | fastq fastq | 3615402373.0 | 25312788.0 | GSM5268472 r1 | 0:71.39 1:71.44 | A:1078168256;C:699509937;G:739078497;T:1097303558;N:1342125 | 71 | 71 | 1078168256 | 699509937 | 739078497 | 1097303558 | 1342125 | SRX10697273 | SRS8786687 | SRA1224866 | GEO | Institute of Molecular Biology, Academia Sinica | 2 | 0.7144 | 0.71612 | 0.09852 | 0.09708 | 0.70027 | 0.70331 | 0.49157 | 0.49119 | 75 | 76 | B | B | biological fallback assumption | illumina | nextseq | unknown | cdna_unspecified | nextera | sc_generic | single_cell_generic | generic-scrnaseq-only | Taiwan | 2021-04-28 | Larval | Larval | Gonad | Reproductive System | |||||||||||||
| 64224 | 64224 | SRR14343406 | SRX10697273 | SRS8786687 | SRP316710 | PRJNA725806 | foxl2l regulates female meiotic entry during juvenile gonadal development in zebrafish | GSE173480 | Transcriptome Analysis | Sex determination is distinct from development of other organs for its diversity among species. In zebrafish the sex determination in juvenile stage could be hermaphroditic or gonochoristic. However the detail mechanism is still unclear. Here in this study we found that the transcription factor that belongs to forkhead box family Foxl2l is required for determination of female fate in zebrafish. Foxl2l was expressed from larva stage and became female bias in juvenile stage. The expression was restricted in pre meiotic germ cells. Disruption of Foxl2l function by CRISPR/Cas9 system resulted in all male phenotype in the mutant. Germ cells in foxl2l mutant were arrested in pre meiotic stage at 21 dpf the critical period for female meiotic entry. To further verify the downstream mechanism of Foxl2l on female sex determination wildtype or foxl2l mutant germ cells labeled by foxl2l:egfp at 21 dpf dpf and germ cells labeled by ziwi:egfp at 26 dpf were analyzed by RNA seq and single cell RNA seq respectively Overall design: Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. and RNA sequencing was performed by Illumina NextSeq 500. Each genotype contained triple samples. | WT 3 | GSM5268472 | tissue:gonad|strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l+/+|age:21 dpf | WT 3 | Sequenced data was analyzed by NextSeq Control Software 2.2.0 The de multiplexing adaptor removal and FASTQ file transformation were performed by bcl2fastq Conversion Software 2.17 Illumina Inc. The FASTQ files were imported into CLC Genomics Workbench v.11.0.1 QIAGEN to remove low quality reads including reads with lengths less than 30 nucleotides or with Phred quality score lower than 20 The trimmed reads were mapped to zebrafish genome GRCz11 and TPM were calculated by CLC Genomics Workbench v.11.0.1 QIAGEN Genome build: GRCz11 Supplementary files format and content: txt files contain expression data for all cells | gonad | Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols. | strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l+/+|age:21 dpf | GSM5268472 | GSM5268472: WT 3; Danio rerio; RNA Seq | GSM5268472 | 1 | Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols. | GEO Accession:GSM5268472 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP316710 | WT_3_run2.R1.fastq WT_3_run2.R2.fastq | fastq fastq | 4010245556.0 | 27994253.0 | GSM5268472 r2 | 0:71.60 1:71.65 | A:1193569082;C:773024546;G:816013849;T:1223955095;N:3682984 | 71 | 71 | 1193569082 | 773024546 | 816013849 | 1223955095 | 3682984 | SRX10697273 | SRS8786687 | SRA1224866 | GEO | Institute of Molecular Biology, Academia Sinica | 2 | 0.71057 | 0.71162 | 0.09984 | 0.09845 | 0.70102 | 0.70435 | 0.4941 | 0.48909 | 74 | 75 | B | B | biological fallback assumption | illumina | nextseq | unknown | cdna_unspecified | nextera | sc_generic | single_cell_generic | generic-scrnaseq-only | Taiwan | 2021-04-28 | Larval | Larval | Gonad | Reproductive System | |||||||||||||
| 64225 | 64225 | SRR14343403 | SRX10697272 | SRS8786686 | SRP316710 | PRJNA725806 | foxl2l regulates female meiotic entry during juvenile gonadal development in zebrafish | GSE173480 | Transcriptome Analysis | Sex determination is distinct from development of other organs for its diversity among species. In zebrafish the sex determination in juvenile stage could be hermaphroditic or gonochoristic. However the detail mechanism is still unclear. Here in this study we found that the transcription factor that belongs to forkhead box family Foxl2l is required for determination of female fate in zebrafish. Foxl2l was expressed from larva stage and became female bias in juvenile stage. The expression was restricted in pre meiotic germ cells. Disruption of Foxl2l function by CRISPR/Cas9 system resulted in all male phenotype in the mutant. Germ cells in foxl2l mutant were arrested in pre meiotic stage at 21 dpf the critical period for female meiotic entry. To further verify the downstream mechanism of Foxl2l on female sex determination wildtype or foxl2l mutant germ cells labeled by foxl2l:egfp at 21 dpf dpf and germ cells labeled by ziwi:egfp at 26 dpf were analyzed by RNA seq and single cell RNA seq respectively Overall design: Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. and RNA sequencing was performed by Illumina NextSeq 500. Each genotype contained triple samples. | WT 2 | GSM5268471 | tissue:gonad|strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l+/+|age:21 dpf | WT 2 | Sequenced data was analyzed by NextSeq Control Software 2.2.0 The de multiplexing adaptor removal and FASTQ file transformation were performed by bcl2fastq Conversion Software 2.17 Illumina Inc. The FASTQ files were imported into CLC Genomics Workbench v.11.0.1 QIAGEN to remove low quality reads including reads with lengths less than 30 nucleotides or with Phred quality score lower than 20 The trimmed reads were mapped to zebrafish genome GRCz11 and TPM were calculated by CLC Genomics Workbench v.11.0.1 QIAGEN Genome build: GRCz11 Supplementary files format and content: txt files contain expression data for all cells | gonad | Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols. | strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l+/+|age:21 dpf | GSM5268471 | GSM5268471: WT 2; Danio rerio; RNA Seq | GSM5268471 | 1 | Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols. | GEO Accession:GSM5268471 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP316710 | WT_2_run1.R1.fastq WT_2_run1.R2.fastq | fastq fastq | 4242860973.0 | 29911182.0 | GSM5268471 r1 | 0:70.91 1:70.94 | A:1225861906;C:877846427;G:910477747;T:1227170958;N:1503935 | 70 | 70 | 1225861906 | 877846427 | 910477747 | 1227170958 | 1503935 | SRX10697272 | SRS8786686 | SRA1224866 | GEO | Institute of Molecular Biology, Academia Sinica | 2 | 0.88249 | 0.8846 | 0.12426 | 0.12254 | 0.67568 | 0.67777 | 0.49104 | 0.49087 | 76 | 76 | B | B | biological fallback assumption | illumina | nextseq | unknown | cdna_unspecified | nextera | sc_generic | single_cell_generic | generic-scrnaseq-only | Taiwan | 2021-04-28 | Larval | Larval | Gonad | Reproductive System | |||||||||||||
| 64226 | 64226 | SRR14343404 | SRX10697272 | SRS8786686 | SRP316710 | PRJNA725806 | foxl2l regulates female meiotic entry during juvenile gonadal development in zebrafish | GSE173480 | Transcriptome Analysis | Sex determination is distinct from development of other organs for its diversity among species. In zebrafish the sex determination in juvenile stage could be hermaphroditic or gonochoristic. However the detail mechanism is still unclear. Here in this study we found that the transcription factor that belongs to forkhead box family Foxl2l is required for determination of female fate in zebrafish. Foxl2l was expressed from larva stage and became female bias in juvenile stage. The expression was restricted in pre meiotic germ cells. Disruption of Foxl2l function by CRISPR/Cas9 system resulted in all male phenotype in the mutant. Germ cells in foxl2l mutant were arrested in pre meiotic stage at 21 dpf the critical period for female meiotic entry. To further verify the downstream mechanism of Foxl2l on female sex determination wildtype or foxl2l mutant germ cells labeled by foxl2l:egfp at 21 dpf dpf and germ cells labeled by ziwi:egfp at 26 dpf were analyzed by RNA seq and single cell RNA seq respectively Overall design: Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. and RNA sequencing was performed by Illumina NextSeq 500. Each genotype contained triple samples. | WT 2 | GSM5268471 | tissue:gonad|strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l+/+|age:21 dpf | WT 2 | Sequenced data was analyzed by NextSeq Control Software 2.2.0 The de multiplexing adaptor removal and FASTQ file transformation were performed by bcl2fastq Conversion Software 2.17 Illumina Inc. The FASTQ files were imported into CLC Genomics Workbench v.11.0.1 QIAGEN to remove low quality reads including reads with lengths less than 30 nucleotides or with Phred quality score lower than 20 The trimmed reads were mapped to zebrafish genome GRCz11 and TPM were calculated by CLC Genomics Workbench v.11.0.1 QIAGEN Genome build: GRCz11 Supplementary files format and content: txt files contain expression data for all cells | gonad | Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols. | strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l+/+|age:21 dpf | GSM5268471 | GSM5268471: WT 2; Danio rerio; RNA Seq | GSM5268471 | 1 | Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols. | GEO Accession:GSM5268471 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP316710 | WT_2_run2.R2.fastq WT_2_run2.R1.fastq | fastq fastq | 4702850600.0 | 33040042.0 | GSM5268471 r2 | 0:71.15 1:71.19 | A:1357977487;C:969603630;G:1005776160;T:1365277602;N:4215721 | 71 | 71 | 1357977487 | 969603630 | 1005776160 | 1365277602 | 4215721 | SRX10697272 | SRS8786686 | SRA1224866 | GEO | Institute of Molecular Biology, Academia Sinica | 2 | 0.88141 | 0.88412 | 0.12385 | 0.12227 | 0.67805 | 0.68156 | 0.48576 | 0.49354 | 76 | 76 | B | B | biological fallback assumption | illumina | nextseq | unknown | cdna_unspecified | nextera | sc_generic | single_cell_generic | generic-scrnaseq-only | Taiwan | 2021-04-28 | Larval | Larval | Gonad | Reproductive System | |||||||||||||
| 64227 | 64227 | SRR14343401 | SRX10697271 | SRS8786685 | SRP316710 | PRJNA725806 | foxl2l regulates female meiotic entry during juvenile gonadal development in zebrafish | GSE173480 | Transcriptome Analysis | Sex determination is distinct from development of other organs for its diversity among species. In zebrafish the sex determination in juvenile stage could be hermaphroditic or gonochoristic. However the detail mechanism is still unclear. Here in this study we found that the transcription factor that belongs to forkhead box family Foxl2l is required for determination of female fate in zebrafish. Foxl2l was expressed from larva stage and became female bias in juvenile stage. The expression was restricted in pre meiotic germ cells. Disruption of Foxl2l function by CRISPR/Cas9 system resulted in all male phenotype in the mutant. Germ cells in foxl2l mutant were arrested in pre meiotic stage at 21 dpf the critical period for female meiotic entry. To further verify the downstream mechanism of Foxl2l on female sex determination wildtype or foxl2l mutant germ cells labeled by foxl2l:egfp at 21 dpf dpf and germ cells labeled by ziwi:egfp at 26 dpf were analyzed by RNA seq and single cell RNA seq respectively Overall design: Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. and RNA sequencing was performed by Illumina NextSeq 500. Each genotype contained triple samples. | WT 1 | GSM5268470 | tissue:gonad|strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l+/+|age:21 dpf | WT 1 | Sequenced data was analyzed by NextSeq Control Software 2.2.0 The de multiplexing adaptor removal and FASTQ file transformation were performed by bcl2fastq Conversion Software 2.17 Illumina Inc. The FASTQ files were imported into CLC Genomics Workbench v.11.0.1 QIAGEN to remove low quality reads including reads with lengths less than 30 nucleotides or with Phred quality score lower than 20 The trimmed reads were mapped to zebrafish genome GRCz11 and TPM were calculated by CLC Genomics Workbench v.11.0.1 QIAGEN Genome build: GRCz11 Supplementary files format and content: txt files contain expression data for all cells | gonad | Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols. | strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l+/+|age:21 dpf | GSM5268470 | GSM5268470: WT 1; Danio rerio; RNA Seq | GSM5268470 | 1 | Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols. | GEO Accession:GSM5268470 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP316710 | WT_1_run1.R2.fastq WT_1_run1.R1.fastq | fastq fastq | 3768759279.0 | 26193297.0 | GSM5268470 r1 | 0:71.93 1:71.95 | A:1068721513;C:803440242;G:829244956;T:1066480466;N:872102 | 71 | 71 | 1068721513 | 803440242 | 829244956 | 1066480466 | 872102 | SRX10697271 | SRS8786685 | SRA1224866 | GEO | Institute of Molecular Biology, Academia Sinica | 2 | 0.90907 | 0.91124 | 0.10338 | 0.1029 | 0.67054 | 0.67343 | 0.48963 | 0.49025 | 75 | 75 | B | B | biological fallback assumption | illumina | nextseq | unknown | cdna_unspecified | nextera | sc_generic | single_cell_generic | generic-scrnaseq-only | Taiwan | 2021-04-28 | Larval | Larval | Gonad | Reproductive System | |||||||||||||
| 64228 | 64228 | SRR14343402 | SRX10697271 | SRS8786685 | SRP316710 | PRJNA725806 | foxl2l regulates female meiotic entry during juvenile gonadal development in zebrafish | GSE173480 | Transcriptome Analysis | Sex determination is distinct from development of other organs for its diversity among species. In zebrafish the sex determination in juvenile stage could be hermaphroditic or gonochoristic. However the detail mechanism is still unclear. Here in this study we found that the transcription factor that belongs to forkhead box family Foxl2l is required for determination of female fate in zebrafish. Foxl2l was expressed from larva stage and became female bias in juvenile stage. The expression was restricted in pre meiotic germ cells. Disruption of Foxl2l function by CRISPR/Cas9 system resulted in all male phenotype in the mutant. Germ cells in foxl2l mutant were arrested in pre meiotic stage at 21 dpf the critical period for female meiotic entry. To further verify the downstream mechanism of Foxl2l on female sex determination wildtype or foxl2l mutant germ cells labeled by foxl2l:egfp at 21 dpf dpf and germ cells labeled by ziwi:egfp at 26 dpf were analyzed by RNA seq and single cell RNA seq respectively Overall design: Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. and RNA sequencing was performed by Illumina NextSeq 500. Each genotype contained triple samples. | WT 1 | GSM5268470 | tissue:gonad|strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l+/+|age:21 dpf | WT 1 | Sequenced data was analyzed by NextSeq Control Software 2.2.0 The de multiplexing adaptor removal and FASTQ file transformation were performed by bcl2fastq Conversion Software 2.17 Illumina Inc. The FASTQ files were imported into CLC Genomics Workbench v.11.0.1 QIAGEN to remove low quality reads including reads with lengths less than 30 nucleotides or with Phred quality score lower than 20 The trimmed reads were mapped to zebrafish genome GRCz11 and TPM were calculated by CLC Genomics Workbench v.11.0.1 QIAGEN Genome build: GRCz11 Supplementary files format and content: txt files contain expression data for all cells | gonad | Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols. | strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l+/+|age:21 dpf | GSM5268470 | GSM5268470: WT 1; Danio rerio; RNA Seq | GSM5268470 | 1 | Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols. | GEO Accession:GSM5268470 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP316710 | WT_1_run2.R2.fastq WT_1_run2.R1.fastq | fastq fastq | 4100200544.0 | 28410131.0 | GSM5268470 r2 | 0:72.15 1:72.17 | A:1163123243;C:871020431;G:898995203;T:1163892058;N:3169609 | 72 | 72 | 1163123243 | 871020431 | 898995203 | 1163892058 | 3169609 | SRX10697271 | SRS8786685 | SRA1224866 | GEO | Institute of Molecular Biology, Academia Sinica | 2 | 0.90943 | 0.91044 | 0.10346 | 0.103 | 0.66914 | 0.67004 | 0.48705 | 0.49202 | 76 | 76 | B | B | biological fallback assumption | illumina | nextseq | unknown | cdna_unspecified | nextera | sc_generic | single_cell_generic | generic-scrnaseq-only | Taiwan | 2021-04-28 | Larval | Larval | Gonad | Reproductive System | |||||||||||||
| 68777 | 68777 | SRR18188990 | SRX14335888 | SRS12150682 | SRP362100 | PRJNA811725 | Single cell sequencing of zebra fish primordial germ cell | PRJNA811725 | Other | Based on the transcriptome we constructed long non coding RNA lncRNA profile of zebrafish primordial germ cells PGCs to further discern functional lncRNA that might play role in PGCs development. | GC9 | strain:kop:EGFP 3 primeUTR nanos primordial germ cell transgenic line|isolate:Based on green fluorescence single PGC was distinctively identified and picked out using a capillary tube|age:5hpf|dev stage:30% 50% epiboly|sex:not applicable|tissue:primordial germ cell|cell type:primordial germ cell|replicate:replicate3|BioSampleModel:Model organism or animal | 3pgc | 3 3pgc | 3 3pgc | primordial germ cell from 5 hpf zebrafish embryos | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | RANDOM | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP362100 | GC9_R1.fq.gz GC9_R2.fq.gz | fastq fastq | 16392678600.0 | 54642262.0 | GC9 R1.fq.gz | 0:150 1:150 | A:4548403510;C:3786937912;G:3801036342;T:4255236177;N:1064659 | 150 | 150 | 4548403510 | 3786937912 | 3801036342 | 4255236177 | 1064659 | SRX14335888 | SRS12150682 | SRA1379556 | Sun-Yat sen University|School of Marine Science | Sun-Yat sen University | 2 | 0.92711 | 0.93044 | 0.08622 | 0.08652 | 0.79693 | 0.80306 | 0.58096 | 0.58168 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | random_priming | unknown | sc | single_cell_generic | generic-scrnaseq-only | China | 2022-03-02 | Multi-stage | Embryo | Gonad | Reproductive System | |||||||||||||||||||||
| 68778 | 68778 | SRR18188991 | SRX14335887 | SRS12150683 | SRP362100 | PRJNA811725 | Single cell sequencing of zebra fish primordial germ cell | PRJNA811725 | Other | Based on the transcriptome we constructed long non coding RNA lncRNA profile of zebrafish primordial germ cells PGCs to further discern functional lncRNA that might play role in PGCs development. | GC4 | strain:kop:EGFP 3 primeUTR nanos primordial germ cell transgenic line|isolate:Based on green fluorescence single PGC was distinctively identified and picked out using a capillary tube|age:5hpf|dev stage:30% 50% epiboly|sex:not applicable|tissue:primordial germ cell|cell type:primordial germ cell|replicate:replicate2|BioSampleModel:Model organism or animal | 2pgc | 2 2pgc | 2 2pgc | primordial germ cell from 5 hpf zebrafish embryos | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | RANDOM | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP362100 | GC4_R1.fq.gz GC4_R2.fq.gz | fastq fastq | 14471348700.0 | 48237829.0 | GC4 R1.fq.gz | 0:150 1:150 | A:4127039158;C:3211803959;G:3224340004;T:3907215356;N:950223 | 150 | 150 | 4127039158 | 3211803959 | 3224340004 | 3907215356 | 950223 | SRX14335887 | SRS12150683 | SRA1379556 | Sun-Yat sen University|School of Marine Science | Sun-Yat sen University | 2 | 0.91951 | 0.91886 | 0.14001 | 0.14043 | 0.75777 | 0.76605 | 0.55643 | 0.55313 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | random_priming | unknown | sc | single_cell_generic | generic-scrnaseq-only | China | 2022-03-02 | Multi-stage | Embryo | Gonad | Reproductive System | |||||||||||||||||||||
| 68779 | 68779 | SRR18188992 | SRX14335886 | SRS12150681 | SRP362100 | PRJNA811725 | Single cell sequencing of zebra fish primordial germ cell | PRJNA811725 | Other | Based on the transcriptome we constructed long non coding RNA lncRNA profile of zebrafish primordial germ cells PGCs to further discern functional lncRNA that might play role in PGCs development. | GC1 | strain:kop:EGFP 3 primeUTR nanos primordial germ cell transgenic line|isolate:Based on green fluorescence single PGC was distinctively identified and picked out using a capillary tube|age:5hpf|dev stage:30% 50% epiboly|sex:not applicable|tissue:primordial germ cell|cell type:primordial germ cell|replicate:replicate1|BioSampleModel:Model organism or animal | 1pgc | 1 1pgc | 1 1pgc | primordial germ cell from 5 hpf zebrafish embryos | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | RANDOM | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP362100 | GC1_R1.fq.gz GC1_R2.fq.gz | fastq fastq | 18801698100.0 | 62672327.0 | GC1 R1.fq.gz | 0:150 1:150 | A:5242992703;C:4310290517;G:4334163362;T:4913025193;N:1226325 | 150 | 150 | 5242992703 | 4310290517 | 4334163362 | 4913025193 | 1226325 | SRX14335886 | SRS12150681 | SRA1379556 | Sun-Yat sen University|School of Marine Science | Sun-Yat sen University | 2 | 0.93192 | 0.93277 | 0.09532 | 0.09559 | 0.78358 | 0.7906 | 0.5661 | 0.56344 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | random_priming | unknown | sc | single_cell_generic | generic-scrnaseq-only | China | 2022-03-02 | Multi-stage | Embryo | Gonad | Reproductive System |
Advanced export
JSON shape: default, array, newline-delimited
CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;