run_metadata
257 rows where technology = "bulk" and tissue_curation = "Heart"
This data as json, CSV (advanced)
| Link | rowid ▼ | run.accession | experiment.accession | sample.accession | study.accession | bioproject | study.title | study.alias | study.type | study.abstract | study.attributes | study.PMIDs | sample.description | sample.title | sample.alias | sample.centername | sample.attributes | GEOsample.title | GEOsample.dataprocessing | GEOsample.source | GEOsample.treatmentprotocol | GEOsample.extractprotocol | GEOsample.growthprotocol | GEOsample.characteristics | GEOsample.accession | experiment.title | experiment.alias | experiment.library_name | experiment.design_description | experiment.library_construction_protocol | experiment.attributes | experiment.library_strategy | experiment.library_source | experiment.library_selection | experiment.library_layout | experiment.platform | experiment.instrument_model | experiment.spot_descriptor | experiment.study_ref | run.title | run.attributes | run.filename | run.semantic_name | run.total_bases | run.total_spots | run.alias | run.read_lengths | run.base_counts | run.r1_length | run.r2_length | run.r3_length | run.r4_length | run.Acount | run.Ccount | run.Gcount | run.Tcount | run.Ncount | run.experiment | run.pool_member | submission.accession | submission.srasource | submission.bioprojectsource | seqdetective.n_mates | seqdetective.mapping_rate.mate1 | seqdetective.mapping_rate.mate2 | seqdetective.nofeature_rate.mate1 | seqdetective.nofeature_rate.mate2 | seqdetective.sparsity.mate1 | seqdetective.sparsity.mate2 | seqdetective.pos_strand_rate.mate1 | seqdetective.pos_strand_rate.mate2 | seqdetective.readlen.mate1 | seqdetective.readlen.mate2 | seqdetective.judgement.mate1 | seqdetective.judgement.mate2 | seqdetective.judgement.reason | platform_family | instrument_generation | read_bias | selection_class | prep_kit | sc_or_bulk | tech_class | technology | tech_variant | submission.bioprojectsource.country | earliest_date | devstage_curation | devstage_curation_coarse | tissue_curation | tissue_curation_coarse |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 10216 | 10216 | ERR6501834 | ERX6129007 | ERS7415871 | ERP131229 | PRJEB46994 | Bulk RNA seq dataset of uninjured vs injured larval zebrafish hearts at 48 xxx post injury on 5 dpf | E-MTAB-10860 | Transcriptome Analysis | This experiment sought to understand the transcriptomic changes that occur in the larval zebrafish heart following injury. 600 hearts were laser injured at 3 dpf extracted 48 hours later and pooled into three groups of 200. RNA was extracted from the whole hearts and sent for sequencing along with 3 groups of 200 uninjured hearts extracted and processed identically. RNA sequencing quality control and alignment was performed by the commercial company GENEWIZ. | ENA FIRST PUBLIC:2021 10 01|ENA LAST UPDATE:2021 10 01 | Protocols: Following laser injury at 72 hpf Tgmyl7:gal4::GFP;UAS:mRFP larvae were incubated at 28.5°C in conditioned media/water + 0.1% methylene blue w/v + 0.003% phenylthiourea. At 48 hpi uninjured and injured larvae were given an overdose of tricaine at 400 μg/ml following which hearts were extracted. We adapted the protocol of Burns and MacRae75 to increase the yield of heart retrieval from 50% to 70%. Briefly 30 larvae were placed in 2mL eppendorf tubes the conditioned water drained and replaced with ice cold Leibovitz's L 15 Medium supplemented with 10% FCS. A 19 gauge needle coupled to a 5mL syringe was used to shear the larvae by aspiration and therefore dissociate hearts from the rest of the larva. The lysate was then inspected by epifluorescence microscopy and mRFP+ hearts and collected to be kept on ice. Hearts were then digested for 10 minutes at 4°C in protease solution 5 mM CaCl2 10 mg/ml B. Licheniformis protease 125 U/mL DNase I in 1x PBS with occasional aspiration to aid digestion. Following laser injury at 72 hpf Tgmyl7:gal4::GFP;UAS:mRFP larvae were incubated at 28.5°C in conditioned media/water + 0.1% methylene blue w/v + 0.003% phenylthiourea. At 48 hpi uninjured and injured larvae were given an overdose of tricaine at 400 μg/ml following which hearts were extracted. RNA was then extracted using a RNeasy Plus Micro Kit Qiagen following direct lysis with RLT lysis buffer according to manufacturer's instructions. RNA concentration was measured by Qubit and integrity by Bioanalyser. RIN score for all samples ranged between 9.6 10. cDNA libraries were prepared following the standardised protocols of Illumina Novaseq 6000 the protocol is lengthy and available at https://support.illumina.com/content/dam/illumina support/documents/documentation/system documentation/novaseq/novaseq 6000 denature dilute libraries guide 1000000106351 03.pdf | Uninjured 3 | SAMEA9691614 | University Of Edinburgh | ENA first public:2021 10 01|ENA last update:2021 10 01|External Id:SAMEA9691614|INSDC center alias:UOE|INSDC center name:University Of Edinburgh|INSDC first public:2021 10 01T00:25:01Z|INSDC last update:2021 10 01T00:25:01Z|INSDC status:public|Submitter Id:E MTAB 10860:Uninjured 3|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval stage|genotype:wild type genotype|individual:pool 6 of 200 larvae|organism part:heart|sample name:E MTAB 10860:Uninjured 3|sex:not available|strain:AB | Illumina NovaSeq 6000 paired end sequencing; Bulk RNA seq dataset of uninjured vs injured larval zebrafish hearts at 48 xxx post injury on 5 dpf | E MTAB 10860:Uninjured 3 p | Uninjured 3 p | Bulk RNA seq dataset of uninjured vs injured larval zebrafish hearts at 48 xxx post injury on 5 dpf | Following laser injury at 72 hpf Tgmyl7:gal4::GFP;UAS:mRFP larvae were incubated at 28.5°C in conditioned media/water + 0.1% methylene blue w/v + 0.003% phenylthiourea. At 48 hpi uninjured and injured larvae were given an overdose of tricaine at 400 μg/ml following which hearts were extracted. We adapted the protocol of Burns and MacRae75 to increase the yield of heart retrieval from 50% to 70%. Briefly 30 larvae were placed in 2mL eppendorf tubes the conditioned water drained and replaced with ice cold Leibovitz's L 15 Medium supplemented with 10% FCS. A 19 gauge needle coupled to a 5mL syringe was used to shear the larvae by aspiration and therefore dissociate hearts from the rest of the larva. The lysate was then inspected by epifluorescence microscopy and mRFP+ hearts and collected to be kept on ice. Hearts were then digested for 10 minutes at 4°C in protease solution 5 mM CaCl2 10 mg/ml B. Licheniformis protease 125 U/mL DNase I in 1x PBS with occasional aspiration to aid digestion. Following laser injury at 72 hpf Tgmyl7:gal4::GFP;UAS:mRFP larvae were incubated at 28.5°C in conditioned media/water + 0.1% methylene blue w/v + 0.003% phenylthiourea. At 48 hpi uninjured and injured larvae were given an overdose of tricaine at 400 μg/ml following which hearts were extracted. RNA was then extracted using a RNeasy Plus Micro Kit Qiagen following direct lysis with RLT lysis buffer according to manufacturer's instructions. RNA concentration was measured by Qubit and integrity by Bioanalyser. RIN score for all samples ranged between 9.6 10. cDNA libraries were prepared following the standardised protocols of Illumina Novaseq 6000 the protocol is lengthy and available at https://support.illumina.com/content/dam/illumina support/documents/documentation/system documentation/novaseq/novaseq 6000 denature dilute libraries guide 1000000106351 03.pdf | Experimental Factor: injury:n1 | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | ERP131229 | Illumina NovaSeq 6000 paired end sequencing; Bulk RNA seq dataset of uninjured vs injured larval zebrafish hearts at 48 xxx post injury on 5 dpf | ENA FIRST PUBLIC:2021 10 01|ENA LAST UPDATE:2021 10 01 | un-3_R1_001.fastq.gz un-3_R2_001.fastq.gz | fastq fastq | 18723567013.0 | 65061888.0 | E MTAB 10860:un 3 R | 0:143.87 1:143.91 | A:4417527025;C:4932613578;G:4960694819;T:4412305366;N:426225 | 143 | 143 | 4417527025 | 4932613578 | 4960694819 | 4412305366 | 426225 | ERX6129007 | ERS7415871 | ERA5680505 | University Of Edinburgh|European Nucleotide Archive | University Of Edinburgh|European Nucleotide Archive | 2 | 0.96755 | 0.96744 | 0.18873 | 0.18936 | 0.72868 | 0.73235 | 0.632 | 0.6437 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | poly_a | unknown | bulk | bulk | bulk | United Kingdom | 2021-10-01 | Larval | Larval | Heart | Cardiovascular System | |||||||||||||
| 10217 | 10217 | ERR6501833 | ERX6129006 | ERS7415870 | ERP131229 | PRJEB46994 | Bulk RNA seq dataset of uninjured vs injured larval zebrafish hearts at 48 xxx post injury on 5 dpf | E-MTAB-10860 | Transcriptome Analysis | This experiment sought to understand the transcriptomic changes that occur in the larval zebrafish heart following injury. 600 hearts were laser injured at 3 dpf extracted 48 hours later and pooled into three groups of 200. RNA was extracted from the whole hearts and sent for sequencing along with 3 groups of 200 uninjured hearts extracted and processed identically. RNA sequencing quality control and alignment was performed by the commercial company GENEWIZ. | ENA FIRST PUBLIC:2021 10 01|ENA LAST UPDATE:2021 10 01 | Protocols: Following laser injury at 72 hpf Tgmyl7:gal4::GFP;UAS:mRFP larvae were incubated at 28.5°C in conditioned media/water + 0.1% methylene blue w/v + 0.003% phenylthiourea. At 48 hpi uninjured and injured larvae were given an overdose of tricaine at 400 μg/ml following which hearts were extracted. We adapted the protocol of Burns and MacRae75 to increase the yield of heart retrieval from 50% to 70%. Briefly 30 larvae were placed in 2mL eppendorf tubes the conditioned water drained and replaced with ice cold Leibovitz's L 15 Medium supplemented with 10% FCS. A 19 gauge needle coupled to a 5mL syringe was used to shear the larvae by aspiration and therefore dissociate hearts from the rest of the larva. The lysate was then inspected by epifluorescence microscopy and mRFP+ hearts and collected to be kept on ice. Hearts were then digested for 10 minutes at 4°C in protease solution 5 mM CaCl2 10 mg/ml B. Licheniformis protease 125 U/mL DNase I in 1x PBS with occasional aspiration to aid digestion. Following laser injury at 72 hpf Tgmyl7:gal4::GFP;UAS:mRFP larvae were incubated at 28.5°C in conditioned media/water + 0.1% methylene blue w/v + 0.003% phenylthiourea. At 48 hpi uninjured and injured larvae were given an overdose of tricaine at 400 μg/ml following which hearts were extracted. RNA was then extracted using a RNeasy Plus Micro Kit Qiagen following direct lysis with RLT lysis buffer according to manufacturer's instructions. RNA concentration was measured by Qubit and integrity by Bioanalyser. RIN score for all samples ranged between 9.6 10. cDNA libraries were prepared following the standardised protocols of Illumina Novaseq 6000 the protocol is lengthy and available at https://support.illumina.com/content/dam/illumina support/documents/documentation/system documentation/novaseq/novaseq 6000 denature dilute libraries guide 1000000106351 03.pdf | Uninjured 2 | SAMEA9691613 | University Of Edinburgh | ENA first public:2021 10 01|ENA last update:2021 10 01|External Id:SAMEA9691613|INSDC center alias:UOE|INSDC center name:University Of Edinburgh|INSDC first public:2021 10 01T00:25:01Z|INSDC last update:2021 10 01T00:25:01Z|INSDC status:public|Submitter Id:E MTAB 10860:Uninjured 2|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval stage|genotype:wild type genotype|individual:pool 5 of 200 larvae|organism part:heart|sample name:E MTAB 10860:Uninjured 2|sex:not available|strain:AB | Illumina NovaSeq 6000 paired end sequencing; Bulk RNA seq dataset of uninjured vs injured larval zebrafish hearts at 48 xxx post injury on 5 dpf | E MTAB 10860:Uninjured 2 p | Uninjured 2 p | Bulk RNA seq dataset of uninjured vs injured larval zebrafish hearts at 48 xxx post injury on 5 dpf | Following laser injury at 72 hpf Tgmyl7:gal4::GFP;UAS:mRFP larvae were incubated at 28.5°C in conditioned media/water + 0.1% methylene blue w/v + 0.003% phenylthiourea. At 48 hpi uninjured and injured larvae were given an overdose of tricaine at 400 μg/ml following which hearts were extracted. We adapted the protocol of Burns and MacRae75 to increase the yield of heart retrieval from 50% to 70%. Briefly 30 larvae were placed in 2mL eppendorf tubes the conditioned water drained and replaced with ice cold Leibovitz's L 15 Medium supplemented with 10% FCS. A 19 gauge needle coupled to a 5mL syringe was used to shear the larvae by aspiration and therefore dissociate hearts from the rest of the larva. The lysate was then inspected by epifluorescence microscopy and mRFP+ hearts and collected to be kept on ice. Hearts were then digested for 10 minutes at 4°C in protease solution 5 mM CaCl2 10 mg/ml B. Licheniformis protease 125 U/mL DNase I in 1x PBS with occasional aspiration to aid digestion. Following laser injury at 72 hpf Tgmyl7:gal4::GFP;UAS:mRFP larvae were incubated at 28.5°C in conditioned media/water + 0.1% methylene blue w/v + 0.003% phenylthiourea. At 48 hpi uninjured and injured larvae were given an overdose of tricaine at 400 μg/ml following which hearts were extracted. RNA was then extracted using a RNeasy Plus Micro Kit Qiagen following direct lysis with RLT lysis buffer according to manufacturer's instructions. RNA concentration was measured by Qubit and integrity by Bioanalyser. RIN score for all samples ranged between 9.6 10. cDNA libraries were prepared following the standardised protocols of Illumina Novaseq 6000 the protocol is lengthy and available at https://support.illumina.com/content/dam/illumina support/documents/documentation/system documentation/novaseq/novaseq 6000 denature dilute libraries guide 1000000106351 03.pdf | Experimental Factor: injury:n1 | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | ERP131229 | Illumina NovaSeq 6000 paired end sequencing; Bulk RNA seq dataset of uninjured vs injured larval zebrafish hearts at 48 xxx post injury on 5 dpf | ENA FIRST PUBLIC:2021 10 01|ENA LAST UPDATE:2021 10 01 | un-2_R1_001.fastq.gz un-2_R2_001.fastq.gz | fastq fastq | 16871358399.0 | 59064661.0 | E MTAB 10860:un 2 R | 0:142.77 1:142.88 | A:4041490134;C:4380856328;G:4414614946;T:4033723935;N:673056 | 142 | 142 | 4041490134 | 4380856328 | 4414614946 | 4033723935 | 673056 | ERX6129006 | ERS7415870 | ERA5680505 | University Of Edinburgh|European Nucleotide Archive | University Of Edinburgh|European Nucleotide Archive | 2 | 0.96589 | 0.9656 | 0.15519 | 0.15447 | 0.70887 | 0.71062 | 0.60267 | 0.60735 | 150 | 147 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | poly_a | unknown | bulk | bulk | bulk | United Kingdom | 2021-10-01 | Larval | Larval | Heart | Cardiovascular System | |||||||||||||
| 10218 | 10218 | ERR6501832 | ERX6129005 | ERS7415869 | ERP131229 | PRJEB46994 | Bulk RNA seq dataset of uninjured vs injured larval zebrafish hearts at 48 xxx post injury on 5 dpf | E-MTAB-10860 | Transcriptome Analysis | This experiment sought to understand the transcriptomic changes that occur in the larval zebrafish heart following injury. 600 hearts were laser injured at 3 dpf extracted 48 hours later and pooled into three groups of 200. RNA was extracted from the whole hearts and sent for sequencing along with 3 groups of 200 uninjured hearts extracted and processed identically. RNA sequencing quality control and alignment was performed by the commercial company GENEWIZ. | ENA FIRST PUBLIC:2021 10 01|ENA LAST UPDATE:2021 10 01 | Protocols: Following laser injury at 72 hpf Tgmyl7:gal4::GFP;UAS:mRFP larvae were incubated at 28.5°C in conditioned media/water + 0.1% methylene blue w/v + 0.003% phenylthiourea. At 48 hpi uninjured and injured larvae were given an overdose of tricaine at 400 μg/ml following which hearts were extracted. We adapted the protocol of Burns and MacRae75 to increase the yield of heart retrieval from 50% to 70%. Briefly 30 larvae were placed in 2mL eppendorf tubes the conditioned water drained and replaced with ice cold Leibovitz's L 15 Medium supplemented with 10% FCS. A 19 gauge needle coupled to a 5mL syringe was used to shear the larvae by aspiration and therefore dissociate hearts from the rest of the larva. The lysate was then inspected by epifluorescence microscopy and mRFP+ hearts and collected to be kept on ice. Hearts were then digested for 10 minutes at 4°C in protease solution 5 mM CaCl2 10 mg/ml B. Licheniformis protease 125 U/mL DNase I in 1x PBS with occasional aspiration to aid digestion. Following laser injury at 72 hpf Tgmyl7:gal4::GFP;UAS:mRFP larvae were incubated at 28.5°C in conditioned media/water + 0.1% methylene blue w/v + 0.003% phenylthiourea. At 48 hpi uninjured and injured larvae were given an overdose of tricaine at 400 μg/ml following which hearts were extracted. RNA was then extracted using a RNeasy Plus Micro Kit Qiagen following direct lysis with RLT lysis buffer according to manufacturer's instructions. RNA concentration was measured by Qubit and integrity by Bioanalyser. RIN score for all samples ranged between 9.6 10. cDNA libraries were prepared following the standardised protocols of Illumina Novaseq 6000 the protocol is lengthy and available at https://support.illumina.com/content/dam/illumina support/documents/documentation/system documentation/novaseq/novaseq 6000 denature dilute libraries guide 1000000106351 03.pdf | Uninjured 1 | SAMEA9691612 | University Of Edinburgh | ENA first public:2021 10 01|ENA last update:2021 10 01|External Id:SAMEA9691612|INSDC center alias:UOE|INSDC center name:University Of Edinburgh|INSDC first public:2021 10 01T00:25:01Z|INSDC last update:2021 10 01T00:25:01Z|INSDC status:public|Submitter Id:E MTAB 10860:Uninjured 1|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval stage|genotype:wild type genotype|individual:pool 4 of 200 larvae|organism part:heart|sample name:E MTAB 10860:Uninjured 1|sex:not available|strain:AB | Illumina NovaSeq 6000 paired end sequencing; Bulk RNA seq dataset of uninjured vs injured larval zebrafish hearts at 48 xxx post injury on 5 dpf | E MTAB 10860:Uninjured 1 p | Uninjured 1 p | Bulk RNA seq dataset of uninjured vs injured larval zebrafish hearts at 48 xxx post injury on 5 dpf | Following laser injury at 72 hpf Tgmyl7:gal4::GFP;UAS:mRFP larvae were incubated at 28.5°C in conditioned media/water + 0.1% methylene blue w/v + 0.003% phenylthiourea. At 48 hpi uninjured and injured larvae were given an overdose of tricaine at 400 μg/ml following which hearts were extracted. We adapted the protocol of Burns and MacRae75 to increase the yield of heart retrieval from 50% to 70%. Briefly 30 larvae were placed in 2mL eppendorf tubes the conditioned water drained and replaced with ice cold Leibovitz's L 15 Medium supplemented with 10% FCS. A 19 gauge needle coupled to a 5mL syringe was used to shear the larvae by aspiration and therefore dissociate hearts from the rest of the larva. The lysate was then inspected by epifluorescence microscopy and mRFP+ hearts and collected to be kept on ice. Hearts were then digested for 10 minutes at 4°C in protease solution 5 mM CaCl2 10 mg/ml B. Licheniformis protease 125 U/mL DNase I in 1x PBS with occasional aspiration to aid digestion. Following laser injury at 72 hpf Tgmyl7:gal4::GFP;UAS:mRFP larvae were incubated at 28.5°C in conditioned media/water + 0.1% methylene blue w/v + 0.003% phenylthiourea. At 48 hpi uninjured and injured larvae were given an overdose of tricaine at 400 μg/ml following which hearts were extracted. RNA was then extracted using a RNeasy Plus Micro Kit Qiagen following direct lysis with RLT lysis buffer according to manufacturer's instructions. RNA concentration was measured by Qubit and integrity by Bioanalyser. RIN score for all samples ranged between 9.6 10. cDNA libraries were prepared following the standardised protocols of Illumina Novaseq 6000 the protocol is lengthy and available at https://support.illumina.com/content/dam/illumina support/documents/documentation/system documentation/novaseq/novaseq 6000 denature dilute libraries guide 1000000106351 03.pdf | Experimental Factor: injury:n1 | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | ERP131229 | Illumina NovaSeq 6000 paired end sequencing; Bulk RNA seq dataset of uninjured vs injured larval zebrafish hearts at 48 xxx post injury on 5 dpf | ENA FIRST PUBLIC:2021 10 01|ENA LAST UPDATE:2021 10 01 | un-1_R1_001.fastq.gz un-1_R2_001.fastq.gz | fastq fastq | 22029484310.0 | 76938931.0 | E MTAB 10860:un 1 R | 0:143.11 1:143.22 | A:5407867825;C:5589867496;G:5636111894;T:5394805343;N:831752 | 143 | 143 | 5407867825 | 5589867496 | 5636111894 | 5394805343 | 831752 | ERX6129005 | ERS7415869 | ERA5680505 | University Of Edinburgh|European Nucleotide Archive | University Of Edinburgh|European Nucleotide Archive | 2 | 0.9602 | 0.95957 | 0.14282 | 0.14408 | 0.69649 | 0.69954 | 0.56712 | 0.56916 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | poly_a | unknown | bulk | bulk | bulk | United Kingdom | 2021-10-01 | Larval | Larval | Heart | Cardiovascular System | |||||||||||||
| 10219 | 10219 | ERR6501831 | ERX6129004 | ERS7415868 | ERP131229 | PRJEB46994 | Bulk RNA seq dataset of uninjured vs injured larval zebrafish hearts at 48 xxx post injury on 5 dpf | E-MTAB-10860 | Transcriptome Analysis | This experiment sought to understand the transcriptomic changes that occur in the larval zebrafish heart following injury. 600 hearts were laser injured at 3 dpf extracted 48 hours later and pooled into three groups of 200. RNA was extracted from the whole hearts and sent for sequencing along with 3 groups of 200 uninjured hearts extracted and processed identically. RNA sequencing quality control and alignment was performed by the commercial company GENEWIZ. | ENA FIRST PUBLIC:2021 10 01|ENA LAST UPDATE:2021 10 01 | Protocols: Following laser injury at 72 hpf Tgmyl7:gal4::GFP;UAS:mRFP larvae were incubated at 28.5°C in conditioned media/water + 0.1% methylene blue w/v + 0.003% phenylthiourea. At 48 hpi uninjured and injured larvae were given an overdose of tricaine at 400 μg/ml following which hearts were extracted. We adapted the protocol of Burns and MacRae75 to increase the yield of heart retrieval from 50% to 70%. Briefly 30 larvae were placed in 2mL eppendorf tubes the conditioned water drained and replaced with ice cold Leibovitz's L 15 Medium supplemented with 10% FCS. A 19 gauge needle coupled to a 5mL syringe was used to shear the larvae by aspiration and therefore dissociate hearts from the rest of the larva. The lysate was then inspected by epifluorescence microscopy and mRFP+ hearts and collected to be kept on ice. Hearts were then digested for 10 minutes at 4°C in protease solution 5 mM CaCl2 10 mg/ml B. Licheniformis protease 125 U/mL DNase I in 1x PBS with occasional aspiration to aid digestion. Following laser injury at 72 hpf Tgmyl7:gal4::GFP;UAS:mRFP larvae were incubated at 28.5°C in conditioned media/water + 0.1% methylene blue w/v + 0.003% phenylthiourea. At 48 hpi uninjured and injured larvae were given an overdose of tricaine at 400 μg/ml following which hearts were extracted. RNA was then extracted using a RNeasy Plus Micro Kit Qiagen following direct lysis with RLT lysis buffer according to manufacturer's instructions. RNA concentration was measured by Qubit and integrity by Bioanalyser. RIN score for all samples ranged between 9.6 10. cDNA libraries were prepared following the standardised protocols of Illumina Novaseq 6000 the protocol is lengthy and available at https://support.illumina.com/content/dam/illumina support/documents/documentation/system documentation/novaseq/novaseq 6000 denature dilute libraries guide 1000000106351 03.pdf | Injured 3 | SAMEA9691611 | University Of Edinburgh | ENA first public:2021 10 01|ENA last update:2021 10 01|External Id:SAMEA9691611|INSDC center alias:UOE|INSDC center name:University Of Edinburgh|INSDC first public:2021 10 01T00:25:01Z|INSDC last update:2021 10 01T00:25:01Z|INSDC status:public|Submitter Id:E MTAB 10860:Injured 3|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval stage|genotype:wild type genotype|individual:pool 3 of 200 larvae|organism part:heart|sample name:E MTAB 10860:Injured 3|sex:not available|strain:AB | Illumina NovaSeq 6000 paired end sequencing; Bulk RNA seq dataset of uninjured vs injured larval zebrafish hearts at 48 xxx post injury on 5 dpf | E MTAB 10860:Injured 3 p | Injured 3 p | Bulk RNA seq dataset of uninjured vs injured larval zebrafish hearts at 48 xxx post injury on 5 dpf | Following laser injury at 72 hpf Tgmyl7:gal4::GFP;UAS:mRFP larvae were incubated at 28.5°C in conditioned media/water + 0.1% methylene blue w/v + 0.003% phenylthiourea. At 48 hpi uninjured and injured larvae were given an overdose of tricaine at 400 μg/ml following which hearts were extracted. We adapted the protocol of Burns and MacRae75 to increase the yield of heart retrieval from 50% to 70%. Briefly 30 larvae were placed in 2mL eppendorf tubes the conditioned water drained and replaced with ice cold Leibovitz's L 15 Medium supplemented with 10% FCS. A 19 gauge needle coupled to a 5mL syringe was used to shear the larvae by aspiration and therefore dissociate hearts from the rest of the larva. The lysate was then inspected by epifluorescence microscopy and mRFP+ hearts and collected to be kept on ice. Hearts were then digested for 10 minutes at 4°C in protease solution 5 mM CaCl2 10 mg/ml B. Licheniformis protease 125 U/mL DNase I in 1x PBS with occasional aspiration to aid digestion. Following laser injury at 72 hpf Tgmyl7:gal4::GFP;UAS:mRFP larvae were incubated at 28.5°C in conditioned media/water + 0.1% methylene blue w/v + 0.003% phenylthiourea. At 48 hpi uninjured and injured larvae were given an overdose of tricaine at 400 μg/ml following which hearts were extracted. RNA was then extracted using a RNeasy Plus Micro Kit Qiagen following direct lysis with RLT lysis buffer according to manufacturer's instructions. RNA concentration was measured by Qubit and integrity by Bioanalyser. RIN score for all samples ranged between 9.6 10. cDNA libraries were prepared following the standardised protocols of Illumina Novaseq 6000 the protocol is lengthy and available at https://support.illumina.com/content/dam/illumina support/documents/documentation/system documentation/novaseq/novaseq 6000 denature dilute libraries guide 1000000106351 03.pdf | Experimental Factor: injury:laser injury | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | ERP131229 | Illumina NovaSeq 6000 paired end sequencing; Bulk RNA seq dataset of uninjured vs injured larval zebrafish hearts at 48 xxx post injury on 5 dpf | ENA FIRST PUBLIC:2021 10 01|ENA LAST UPDATE:2021 10 01 | in-3_R1_001.fastq.gz in-3_R2_001.fastq.gz | fastq fastq | 7393087749.0 | 25640713.0 | E MTAB 10860:in 3 R | 0:144.14 1:144.20 | A:1776335117;C:1913125420;G:1928181998;T:1775255039;N:190175 | 144 | 144 | 1776335117 | 1913125420 | 1928181998 | 1775255039 | 190175 | ERX6129004 | ERS7415868 | ERA5680505 | University Of Edinburgh|European Nucleotide Archive | University Of Edinburgh|European Nucleotide Archive | 2 | 0.96032 | 0.96001 | 0.15921 | 0.15882 | 0.71417 | 0.71869 | 0.59876 | 0.595 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | poly_a | unknown | bulk | bulk | bulk | United Kingdom | 2021-10-01 | Larval | Larval | Heart | Cardiovascular System | |||||||||||||
| 10220 | 10220 | ERR6501830 | ERX6129003 | ERS7415867 | ERP131229 | PRJEB46994 | Bulk RNA seq dataset of uninjured vs injured larval zebrafish hearts at 48 xxx post injury on 5 dpf | E-MTAB-10860 | Transcriptome Analysis | This experiment sought to understand the transcriptomic changes that occur in the larval zebrafish heart following injury. 600 hearts were laser injured at 3 dpf extracted 48 hours later and pooled into three groups of 200. RNA was extracted from the whole hearts and sent for sequencing along with 3 groups of 200 uninjured hearts extracted and processed identically. RNA sequencing quality control and alignment was performed by the commercial company GENEWIZ. | ENA FIRST PUBLIC:2021 10 01|ENA LAST UPDATE:2021 10 01 | Protocols: Following laser injury at 72 hpf Tgmyl7:gal4::GFP;UAS:mRFP larvae were incubated at 28.5°C in conditioned media/water + 0.1% methylene blue w/v + 0.003% phenylthiourea. At 48 hpi uninjured and injured larvae were given an overdose of tricaine at 400 μg/ml following which hearts were extracted. We adapted the protocol of Burns and MacRae75 to increase the yield of heart retrieval from 50% to 70%. Briefly 30 larvae were placed in 2mL eppendorf tubes the conditioned water drained and replaced with ice cold Leibovitz's L 15 Medium supplemented with 10% FCS. A 19 gauge needle coupled to a 5mL syringe was used to shear the larvae by aspiration and therefore dissociate hearts from the rest of the larva. The lysate was then inspected by epifluorescence microscopy and mRFP+ hearts and collected to be kept on ice. Hearts were then digested for 10 minutes at 4°C in protease solution 5 mM CaCl2 10 mg/ml B. Licheniformis protease 125 U/mL DNase I in 1x PBS with occasional aspiration to aid digestion. Following laser injury at 72 hpf Tgmyl7:gal4::GFP;UAS:mRFP larvae were incubated at 28.5°C in conditioned media/water + 0.1% methylene blue w/v + 0.003% phenylthiourea. At 48 hpi uninjured and injured larvae were given an overdose of tricaine at 400 μg/ml following which hearts were extracted. RNA was then extracted using a RNeasy Plus Micro Kit Qiagen following direct lysis with RLT lysis buffer according to manufacturer's instructions. RNA concentration was measured by Qubit and integrity by Bioanalyser. RIN score for all samples ranged between 9.6 10. cDNA libraries were prepared following the standardised protocols of Illumina Novaseq 6000 the protocol is lengthy and available at https://support.illumina.com/content/dam/illumina support/documents/documentation/system documentation/novaseq/novaseq 6000 denature dilute libraries guide 1000000106351 03.pdf | Injured 2 | SAMEA9691610 | University Of Edinburgh | ENA first public:2021 10 01|ENA last update:2021 10 01|External Id:SAMEA9691610|INSDC center alias:UOE|INSDC center name:University Of Edinburgh|INSDC first public:2021 10 01T00:25:01Z|INSDC last update:2021 10 01T00:25:01Z|INSDC status:public|Submitter Id:E MTAB 10860:Injured 2|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval stage|genotype:wild type genotype|individual:pool 2 of 200 larvae|organism part:heart|sample name:E MTAB 10860:Injured 2|sex:not available|strain:AB | Illumina NovaSeq 6000 paired end sequencing; Bulk RNA seq dataset of uninjured vs injured larval zebrafish hearts at 48 xxx post injury on 5 dpf | E MTAB 10860:Injured 2 p | Injured 2 p | Bulk RNA seq dataset of uninjured vs injured larval zebrafish hearts at 48 xxx post injury on 5 dpf | Following laser injury at 72 hpf Tgmyl7:gal4::GFP;UAS:mRFP larvae were incubated at 28.5°C in conditioned media/water + 0.1% methylene blue w/v + 0.003% phenylthiourea. At 48 hpi uninjured and injured larvae were given an overdose of tricaine at 400 μg/ml following which hearts were extracted. We adapted the protocol of Burns and MacRae75 to increase the yield of heart retrieval from 50% to 70%. Briefly 30 larvae were placed in 2mL eppendorf tubes the conditioned water drained and replaced with ice cold Leibovitz's L 15 Medium supplemented with 10% FCS. A 19 gauge needle coupled to a 5mL syringe was used to shear the larvae by aspiration and therefore dissociate hearts from the rest of the larva. The lysate was then inspected by epifluorescence microscopy and mRFP+ hearts and collected to be kept on ice. Hearts were then digested for 10 minutes at 4°C in protease solution 5 mM CaCl2 10 mg/ml B. Licheniformis protease 125 U/mL DNase I in 1x PBS with occasional aspiration to aid digestion. Following laser injury at 72 hpf Tgmyl7:gal4::GFP;UAS:mRFP larvae were incubated at 28.5°C in conditioned media/water + 0.1% methylene blue w/v + 0.003% phenylthiourea. At 48 hpi uninjured and injured larvae were given an overdose of tricaine at 400 μg/ml following which hearts were extracted. RNA was then extracted using a RNeasy Plus Micro Kit Qiagen following direct lysis with RLT lysis buffer according to manufacturer's instructions. RNA concentration was measured by Qubit and integrity by Bioanalyser. RIN score for all samples ranged between 9.6 10. cDNA libraries were prepared following the standardised protocols of Illumina Novaseq 6000 the protocol is lengthy and available at https://support.illumina.com/content/dam/illumina support/documents/documentation/system documentation/novaseq/novaseq 6000 denature dilute libraries guide 1000000106351 03.pdf | Experimental Factor: injury:laser injury | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | ERP131229 | Illumina NovaSeq 6000 paired end sequencing; Bulk RNA seq dataset of uninjured vs injured larval zebrafish hearts at 48 xxx post injury on 5 dpf | ENA FIRST PUBLIC:2021 10 01|ENA LAST UPDATE:2021 10 01 | in-2_R1_001.fastq.gz in-2_R2_001.fastq.gz | fastq fastq | 9437508186.0 | 33059234.0 | E MTAB 10860:in 2 R | 0:142.70 1:142.77 | A:2291798254;C:2421252733;G:2436117818;T:2288107030;N:232351 | 142 | 142 | 2291798254 | 2421252733 | 2436117818 | 2288107030 | 232351 | ERX6129003 | ERS7415867 | ERA5680505 | University Of Edinburgh|European Nucleotide Archive | University Of Edinburgh|European Nucleotide Archive | 2 | 0.96099 | 0.96042 | 0.14616 | 0.14802 | 0.70331 | 0.70674 | 0.53288 | 0.54459 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | poly_a | unknown | bulk | bulk | bulk | United Kingdom | 2021-10-01 | Larval | Larval | Heart | Cardiovascular System | |||||||||||||
| 10221 | 10221 | ERR6501829 | ERX6129002 | ERS7415866 | ERP131229 | PRJEB46994 | Bulk RNA seq dataset of uninjured vs injured larval zebrafish hearts at 48 xxx post injury on 5 dpf | E-MTAB-10860 | Transcriptome Analysis | This experiment sought to understand the transcriptomic changes that occur in the larval zebrafish heart following injury. 600 hearts were laser injured at 3 dpf extracted 48 hours later and pooled into three groups of 200. RNA was extracted from the whole hearts and sent for sequencing along with 3 groups of 200 uninjured hearts extracted and processed identically. RNA sequencing quality control and alignment was performed by the commercial company GENEWIZ. | ENA FIRST PUBLIC:2021 10 01|ENA LAST UPDATE:2021 10 01 | Protocols: Following laser injury at 72 hpf Tgmyl7:gal4::GFP;UAS:mRFP larvae were incubated at 28.5°C in conditioned media/water + 0.1% methylene blue w/v + 0.003% phenylthiourea. At 48 hpi uninjured and injured larvae were given an overdose of tricaine at 400 μg/ml following which hearts were extracted. We adapted the protocol of Burns and MacRae75 to increase the yield of heart retrieval from 50% to 70%. Briefly 30 larvae were placed in 2mL eppendorf tubes the conditioned water drained and replaced with ice cold Leibovitz's L 15 Medium supplemented with 10% FCS. A 19 gauge needle coupled to a 5mL syringe was used to shear the larvae by aspiration and therefore dissociate hearts from the rest of the larva. The lysate was then inspected by epifluorescence microscopy and mRFP+ hearts and collected to be kept on ice. Hearts were then digested for 10 minutes at 4°C in protease solution 5 mM CaCl2 10 mg/ml B. Licheniformis protease 125 U/mL DNase I in 1x PBS with occasional aspiration to aid digestion. Following laser injury at 72 hpf Tgmyl7:gal4::GFP;UAS:mRFP larvae were incubated at 28.5°C in conditioned media/water + 0.1% methylene blue w/v + 0.003% phenylthiourea. At 48 hpi uninjured and injured larvae were given an overdose of tricaine at 400 μg/ml following which hearts were extracted. RNA was then extracted using a RNeasy Plus Micro Kit Qiagen following direct lysis with RLT lysis buffer according to manufacturer's instructions. RNA concentration was measured by Qubit and integrity by Bioanalyser. RIN score for all samples ranged between 9.6 10. cDNA libraries were prepared following the standardised protocols of Illumina Novaseq 6000 the protocol is lengthy and available at https://support.illumina.com/content/dam/illumina support/documents/documentation/system documentation/novaseq/novaseq 6000 denature dilute libraries guide 1000000106351 03.pdf | Injured 1 | SAMEA9691609 | University Of Edinburgh | ENA first public:2021 10 01|ENA last update:2021 10 01|External Id:SAMEA9691609|INSDC center alias:UOE|INSDC center name:University Of Edinburgh|INSDC first public:2021 10 01T00:25:01Z|INSDC last update:2021 10 01T00:25:01Z|INSDC status:public|Submitter Id:E MTAB 10860:Injured 1|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval stage|genotype:wild type genotype|individual:pool 1 of 200 larvae|organism part:heart|sample name:E MTAB 10860:Injured 1|sex:not available|strain:AB | Illumina NovaSeq 6000 paired end sequencing; Bulk RNA seq dataset of uninjured vs injured larval zebrafish hearts at 48 xxx post injury on 5 dpf | E MTAB 10860:Injured 1 p | Injured 1 p | Bulk RNA seq dataset of uninjured vs injured larval zebrafish hearts at 48 xxx post injury on 5 dpf | Following laser injury at 72 hpf Tgmyl7:gal4::GFP;UAS:mRFP larvae were incubated at 28.5°C in conditioned media/water + 0.1% methylene blue w/v + 0.003% phenylthiourea. At 48 hpi uninjured and injured larvae were given an overdose of tricaine at 400 μg/ml following which hearts were extracted. We adapted the protocol of Burns and MacRae75 to increase the yield of heart retrieval from 50% to 70%. Briefly 30 larvae were placed in 2mL eppendorf tubes the conditioned water drained and replaced with ice cold Leibovitz's L 15 Medium supplemented with 10% FCS. A 19 gauge needle coupled to a 5mL syringe was used to shear the larvae by aspiration and therefore dissociate hearts from the rest of the larva. The lysate was then inspected by epifluorescence microscopy and mRFP+ hearts and collected to be kept on ice. Hearts were then digested for 10 minutes at 4°C in protease solution 5 mM CaCl2 10 mg/ml B. Licheniformis protease 125 U/mL DNase I in 1x PBS with occasional aspiration to aid digestion. Following laser injury at 72 hpf Tgmyl7:gal4::GFP;UAS:mRFP larvae were incubated at 28.5°C in conditioned media/water + 0.1% methylene blue w/v + 0.003% phenylthiourea. At 48 hpi uninjured and injured larvae were given an overdose of tricaine at 400 μg/ml following which hearts were extracted. RNA was then extracted using a RNeasy Plus Micro Kit Qiagen following direct lysis with RLT lysis buffer according to manufacturer's instructions. RNA concentration was measured by Qubit and integrity by Bioanalyser. RIN score for all samples ranged between 9.6 10. cDNA libraries were prepared following the standardised protocols of Illumina Novaseq 6000 the protocol is lengthy and available at https://support.illumina.com/content/dam/illumina support/documents/documentation/system documentation/novaseq/novaseq 6000 denature dilute libraries guide 1000000106351 03.pdf | Experimental Factor: injury:laser injury | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | ERP131229 | Illumina NovaSeq 6000 paired end sequencing; Bulk RNA seq dataset of uninjured vs injured larval zebrafish hearts at 48 xxx post injury on 5 dpf | ENA FIRST PUBLIC:2021 10 01|ENA LAST UPDATE:2021 10 01 | in-1_R1_001.fastq.gz in-1_R2_001.fastq.gz | fastq fastq | 15465552702.0 | 54194727.0 | E MTAB 10860:in 1 R | 0:142.59 1:142.78 | A:3807777989;C:3911855097;G:3946385823;T:3798685145;N:848648 | 142 | 142 | 3807777989 | 3911855097 | 3946385823 | 3798685145 | 848648 | ERX6129002 | ERS7415866 | ERA5680505 | University Of Edinburgh|European Nucleotide Archive | University Of Edinburgh|European Nucleotide Archive | 2 | 0.95721 | 0.95688 | 0.14331 | 0.14374 | 0.70262 | 0.70445 | 0.5114 | 0.52855 | 140 | 140 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | poly_a | unknown | bulk | bulk | bulk | United Kingdom | 2021-10-01 | Larval | Larval | Heart | Cardiovascular System | |||||||||||||
| 25196 | 25196 | SRR25685540 | SRX21410747 | SRS18649229 | SRP455779 | PRJNA1006658 | Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE] | GSE241157 | Transcriptome Analysis | The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin. | parent bioproject:PRJNA1006653 | pubmed:39747457 | Hmga1a overexpression sample 4 | GSM7717538 | source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing | Hmga1a overexpression sample 4 | FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts | adult heart | zebrafish were treated with tamoxifen to induce Hmga1a overexpression | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen | GSM7717538 | GSM7717538: Hmga1a overexpression sample 4; Danio rerio; RNA Seq | GSM7717538 r1 | GSM7717538 | 1 | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP455779 | HUB-PN-b004_HHHK2BGXN_S1_L001_OE4_cbc.fastq.gz | fastq | 373009260.0 | 6216821.0 | GSM7717538 r1 | 0:60 | A:154344754;C:67291339;G:55785796;T:95519920;N:67451 | 60 | 154344754 | 67291339 | 55785796 | 95519920 | 67451 | SRX21410747 | SRS18649229 | SRA1695358 | Jeroen Bakkers, Hubrecht Institute | Jeroen Bakkers, Hubrecht Institute | 1 | 0.89552 | 0.06993 | 0.9276 | 0.58138 | 60 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc_generic | bulk | bulk | Netherlands | 2023-08-18 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 25197 | 25197 | SRR25685541 | SRX21410747 | SRS18649229 | SRP455779 | PRJNA1006658 | Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE] | GSE241157 | Transcriptome Analysis | The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin. | parent bioproject:PRJNA1006653 | pubmed:39747457 | Hmga1a overexpression sample 4 | GSM7717538 | source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing | Hmga1a overexpression sample 4 | FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts | adult heart | zebrafish were treated with tamoxifen to induce Hmga1a overexpression | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen | GSM7717538 | GSM7717538: Hmga1a overexpression sample 4; Danio rerio; RNA Seq | GSM7717538 r1 | GSM7717538 | 1 | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP455779 | HUB-PN-b004_HHHK2BGXN_S1_L002_OE4_cbc.fastq.gz | fastq | 362301060.0 | 6038351.0 | GSM7717538 r2 | 0:60 | A:106180158;C:75387781;G:73886850;T:106761396;N:84875 | 60 | 106180158 | 75387781 | 73886850 | 106761396 | 84875 | SRX21410747 | SRS18649229 | SRA1695358 | Jeroen Bakkers, Hubrecht Institute | Jeroen Bakkers, Hubrecht Institute | 1 | 0.89159 | 0.06701 | 0.87081 | 0.62237 | 60 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc_generic | bulk | bulk | Netherlands | 2023-08-18 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 25198 | 25198 | SRR25685542 | SRX21410747 | SRS18649229 | SRP455779 | PRJNA1006658 | Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE] | GSE241157 | Transcriptome Analysis | The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin. | parent bioproject:PRJNA1006653 | pubmed:39747457 | Hmga1a overexpression sample 4 | GSM7717538 | source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing | Hmga1a overexpression sample 4 | FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts | adult heart | zebrafish were treated with tamoxifen to induce Hmga1a overexpression | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen | GSM7717538 | GSM7717538: Hmga1a overexpression sample 4; Danio rerio; RNA Seq | GSM7717538 r1 | GSM7717538 | 1 | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP455779 | HUB-PN-b004_HHHK2BGXN_S1_L003_OE4_cbc.fastq.gz | fastq | 384538200.0 | 6408970.0 | GSM7717538 r3 | 0:60 | A:113163070;C:80510291;G:76775008;T:114062728;N:27103 | 60 | 113163070 | 80510291 | 76775008 | 114062728 | 27103 | SRX21410747 | SRS18649229 | SRA1695358 | Jeroen Bakkers, Hubrecht Institute | Jeroen Bakkers, Hubrecht Institute | 1 | 0.90032 | 0.06985 | 0.87008 | 0.61631 | 60 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc_generic | bulk | bulk | Netherlands | 2023-08-18 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 25199 | 25199 | SRR25685543 | SRX21410747 | SRS18649229 | SRP455779 | PRJNA1006658 | Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE] | GSE241157 | Transcriptome Analysis | The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin. | parent bioproject:PRJNA1006653 | pubmed:39747457 | Hmga1a overexpression sample 4 | GSM7717538 | source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing | Hmga1a overexpression sample 4 | FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts | adult heart | zebrafish were treated with tamoxifen to induce Hmga1a overexpression | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen | GSM7717538 | GSM7717538: Hmga1a overexpression sample 4; Danio rerio; RNA Seq | GSM7717538 r1 | GSM7717538 | 1 | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP455779 | HUB-PN-b004_HHHK2BGXN_S1_L004_OE4_cbc.fastq.gz | fastq | 369674700.0 | 6161245.0 | GSM7717538 r4 | 0:60 | A:108130666;C:76988468;G:75491768;T:109027980;N:35818 | 60 | 108130666 | 76988468 | 75491768 | 109027980 | 35818 | SRX21410747 | SRS18649229 | SRA1695358 | Jeroen Bakkers, Hubrecht Institute | Jeroen Bakkers, Hubrecht Institute | 1 | 0.89622 | 0.06895 | 0.86854 | 0.61464 | 60 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc_generic | bulk | bulk | Netherlands | 2023-08-18 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 25200 | 25200 | SRR25685544 | SRX21410746 | SRS18649228 | SRP455779 | PRJNA1006658 | Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE] | GSE241157 | Transcriptome Analysis | The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin. | parent bioproject:PRJNA1006653 | pubmed:39747457 | Hmga1a overexpression sample 3 | GSM7717537 | source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing | Hmga1a overexpression sample 3 | FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts | adult heart | zebrafish were treated with tamoxifen to induce Hmga1a overexpression | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen | GSM7717537 | GSM7717537: Hmga1a overexpression sample 3; Danio rerio; RNA Seq | GSM7717537 r1 | GSM7717537 | 1 | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP455779 | HUB-PN-b004_HHHK2BGXN_S1_L001_OE3_cbc.fastq.gz | fastq | 172977180.0 | 2882953.0 | GSM7717537 r1 | 0:60 | A:75387211;C:31808233;G:24071421;T:41679068;N:31247 | 60 | 75387211 | 31808233 | 24071421 | 41679068 | 31247 | SRX21410746 | SRS18649228 | SRA1695358 | Jeroen Bakkers, Hubrecht Institute | Jeroen Bakkers, Hubrecht Institute | 1 | 0.88458 | 0.06987 | 0.92788 | 0.58263 | 60 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc_generic | bulk | bulk | Netherlands | 2023-08-18 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 25201 | 25201 | SRR25685545 | SRX21410746 | SRS18649228 | SRP455779 | PRJNA1006658 | Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE] | GSE241157 | Transcriptome Analysis | The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin. | parent bioproject:PRJNA1006653 | pubmed:39747457 | Hmga1a overexpression sample 3 | GSM7717537 | source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing | Hmga1a overexpression sample 3 | FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts | adult heart | zebrafish were treated with tamoxifen to induce Hmga1a overexpression | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen | GSM7717537 | GSM7717537: Hmga1a overexpression sample 3; Danio rerio; RNA Seq | GSM7717537 r1 | GSM7717537 | 1 | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP455779 | HUB-PN-b004_HHHK2BGXN_S1_L002_OE3_cbc.fastq.gz | fastq | 168370020.0 | 2806167.0 | GSM7717537 r2 | 0:60 | A:49447288;C:35622124;G:34182575;T:49078813;N:39220 | 60 | 49447288 | 35622124 | 34182575 | 49078813 | 39220 | SRX21410746 | SRS18649228 | SRA1695358 | Jeroen Bakkers, Hubrecht Institute | Jeroen Bakkers, Hubrecht Institute | 1 | 0.88366 | 0.06639 | 0.87519 | 0.43134 | 60 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc_generic | bulk | bulk | Netherlands | 2023-08-18 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 25202 | 25202 | SRR25685546 | SRX21410746 | SRS18649228 | SRP455779 | PRJNA1006658 | Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE] | GSE241157 | Transcriptome Analysis | The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin. | parent bioproject:PRJNA1006653 | pubmed:39747457 | Hmga1a overexpression sample 3 | GSM7717537 | source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing | Hmga1a overexpression sample 3 | FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts | adult heart | zebrafish were treated with tamoxifen to induce Hmga1a overexpression | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen | GSM7717537 | GSM7717537: Hmga1a overexpression sample 3; Danio rerio; RNA Seq | GSM7717537 r1 | GSM7717537 | 1 | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP455779 | HUB-PN-b004_HHHK2BGXN_S1_L003_OE3_cbc.fastq.gz | fastq | 177341340.0 | 2955689.0 | GSM7717537 r3 | 0:60 | A:52304623;C:37759158;G:35264433;T:52000964;N:12162 | 60 | 52304623 | 37759158 | 35264433 | 52000964 | 12162 | SRX21410746 | SRS18649228 | SRA1695358 | Jeroen Bakkers, Hubrecht Institute | Jeroen Bakkers, Hubrecht Institute | 1 | 0.8907 | 0.06795 | 0.87405 | 0.57596 | 60 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc_generic | bulk | bulk | Netherlands | 2023-08-18 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 25203 | 25203 | SRR25685547 | SRX21410746 | SRS18649228 | SRP455779 | PRJNA1006658 | Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE] | GSE241157 | Transcriptome Analysis | The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin. | parent bioproject:PRJNA1006653 | pubmed:39747457 | Hmga1a overexpression sample 3 | GSM7717537 | source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing | Hmga1a overexpression sample 3 | FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts | adult heart | zebrafish were treated with tamoxifen to induce Hmga1a overexpression | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen | GSM7717537 | GSM7717537: Hmga1a overexpression sample 3; Danio rerio; RNA Seq | GSM7717537 r1 | GSM7717537 | 1 | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP455779 | HUB-PN-b004_HHHK2BGXN_S1_L004_OE3_cbc.fastq.gz | fastq | 172482600.0 | 2874710.0 | GSM7717537 r4 | 0:60 | A:50610545;C:36521080;G:35043934;T:50291237;N:15804 | 60 | 50610545 | 36521080 | 35043934 | 50291237 | 15804 | SRX21410746 | SRS18649228 | SRA1695358 | Jeroen Bakkers, Hubrecht Institute | Jeroen Bakkers, Hubrecht Institute | 1 | 0.88558 | 0.06686 | 0.87373 | 0.57425 | 60 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc_generic | bulk | bulk | Netherlands | 2023-08-18 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 25204 | 25204 | SRR25685548 | SRX21410745 | SRS18649227 | SRP455779 | PRJNA1006658 | Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE] | GSE241157 | Transcriptome Analysis | The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin. | parent bioproject:PRJNA1006653 | pubmed:39747457 | Hmga1a overexpression sample 2 | GSM7717536 | source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing | Hmga1a overexpression sample 2 | FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts | adult heart | zebrafish were treated with tamoxifen to induce Hmga1a overexpression | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen | GSM7717536 | GSM7717536: Hmga1a overexpression sample 2; Danio rerio; RNA Seq | GSM7717536 r1 | GSM7717536 | 1 | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP455779 | HUB-PN-b004_HHHK2BGXN_S1_L001_OE2_cbc.fastq.gz | fastq | 420273960.0 | 7004566.0 | GSM7717536 r1 | 0:60 | A:172608345;C:77102289;G:65053968;T:105434207;N:75151 | 60 | 172608345 | 77102289 | 65053968 | 105434207 | 75151 | SRX21410745 | SRS18649227 | SRA1695358 | Jeroen Bakkers, Hubrecht Institute | Jeroen Bakkers, Hubrecht Institute | 1 | 0.90654 | 0.06306 | 0.92904 | 0.38886 | 60 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc_generic | bulk | bulk | Netherlands | 2023-08-18 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 25205 | 25205 | SRR25685549 | SRX21410745 | SRS18649227 | SRP455779 | PRJNA1006658 | Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE] | GSE241157 | Transcriptome Analysis | The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin. | parent bioproject:PRJNA1006653 | pubmed:39747457 | Hmga1a overexpression sample 2 | GSM7717536 | source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing | Hmga1a overexpression sample 2 | FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts | adult heart | zebrafish were treated with tamoxifen to induce Hmga1a overexpression | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen | GSM7717536 | GSM7717536: Hmga1a overexpression sample 2; Danio rerio; RNA Seq | GSM7717536 r1 | GSM7717536 | 1 | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP455779 | HUB-PN-b004_HHHK2BGXN_S1_L002_OE2_cbc.fastq.gz | fastq | 408658800.0 | 6810980.0 | GSM7717536 r2 | 0:60 | A:118741152;C:85204554;G:86928543;T:117687807;N:96744 | 60 | 118741152 | 85204554 | 86928543 | 117687807 | 96744 | SRX21410745 | SRS18649227 | SRA1695358 | Jeroen Bakkers, Hubrecht Institute | Jeroen Bakkers, Hubrecht Institute | 1 | 0.90277 | 0.06298 | 0.87302 | 0.66727 | 60 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc_generic | bulk | bulk | Netherlands | 2023-08-18 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 25206 | 25206 | SRR25685550 | SRX21410745 | SRS18649227 | SRP455779 | PRJNA1006658 | Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE] | GSE241157 | Transcriptome Analysis | The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin. | parent bioproject:PRJNA1006653 | pubmed:39747457 | Hmga1a overexpression sample 2 | GSM7717536 | source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing | Hmga1a overexpression sample 2 | FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts | adult heart | zebrafish were treated with tamoxifen to induce Hmga1a overexpression | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen | GSM7717536 | GSM7717536: Hmga1a overexpression sample 2; Danio rerio; RNA Seq | GSM7717536 r1 | GSM7717536 | 1 | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP455779 | HUB-PN-b004_HHHK2BGXN_S1_L003_OE2_cbc.fastq.gz | fastq | 433893360.0 | 7231556.0 | GSM7717536 r3 | 0:60 | A:126666020;C:91068379;G:90449908;T:125677088;N:31965 | 60 | 126666020 | 91068379 | 90449908 | 125677088 | 31965 | SRX21410745 | SRS18649227 | SRA1695358 | Jeroen Bakkers, Hubrecht Institute | Jeroen Bakkers, Hubrecht Institute | 1 | 0.90833 | 0.06364 | 0.87351 | 0.66644 | 60 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc_generic | bulk | bulk | Netherlands | 2023-08-18 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 25207 | 25207 | SRR25685551 | SRX21410745 | SRS18649227 | SRP455779 | PRJNA1006658 | Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE] | GSE241157 | Transcriptome Analysis | The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin. | parent bioproject:PRJNA1006653 | pubmed:39747457 | Hmga1a overexpression sample 2 | GSM7717536 | source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing | Hmga1a overexpression sample 2 | FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts | adult heart | zebrafish were treated with tamoxifen to induce Hmga1a overexpression | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen | GSM7717536 | GSM7717536: Hmga1a overexpression sample 2; Danio rerio; RNA Seq | GSM7717536 r1 | GSM7717536 | 1 | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP455779 | HUB-PN-b004_HHHK2BGXN_S1_L004_OE2_cbc.fastq.gz | fastq | 418311900.0 | 6971865.0 | GSM7717536 r4 | 0:60 | A:121375806;C:87324728;G:89011817;T:120559021;N:40528 | 60 | 121375806 | 87324728 | 89011817 | 120559021 | 40528 | SRX21410745 | SRS18649227 | SRA1695358 | Jeroen Bakkers, Hubrecht Institute | Jeroen Bakkers, Hubrecht Institute | 1 | 0.90583 | 0.06349 | 0.87156 | 0.36876 | 60 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc_generic | bulk | bulk | Netherlands | 2023-08-18 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 25208 | 25208 | SRR25685552 | SRX21410744 | SRS18649226 | SRP455779 | PRJNA1006658 | Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE] | GSE241157 | Transcriptome Analysis | The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin. | parent bioproject:PRJNA1006653 | pubmed:39747457 | Hmga1a overexpression sample 1 | GSM7717535 | source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing | Hmga1a overexpression sample 1 | FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts | adult heart | zebrafish were treated with tamoxifen to induce Hmga1a overexpression | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen | GSM7717535 | GSM7717535: Hmga1a overexpression sample 1; Danio rerio; RNA Seq | GSM7717535 r1 | GSM7717535 | 1 | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP455779 | HUB-PN-b004_HHHK2BGXN_S1_L001_OE1_cbc.fastq.gz | fastq | 219019680.0 | 3650328.0 | GSM7717535 r1 | 0:60 | A:89205341;C:39777204;G:33514473;T:56486057;N:36605 | 60 | 89205341 | 39777204 | 33514473 | 56486057 | 36605 | SRX21410744 | SRS18649226 | SRA1695358 | Jeroen Bakkers, Hubrecht Institute | Jeroen Bakkers, Hubrecht Institute | 1 | 0.89316 | 0.08503 | 0.92125 | 0.51486 | 60 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc_generic | bulk | bulk | Netherlands | 2023-08-18 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 25209 | 25209 | SRR25685553 | SRX21410744 | SRS18649226 | SRP455779 | PRJNA1006658 | Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE] | GSE241157 | Transcriptome Analysis | The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin. | parent bioproject:PRJNA1006653 | pubmed:39747457 | Hmga1a overexpression sample 1 | GSM7717535 | source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing | Hmga1a overexpression sample 1 | FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts | adult heart | zebrafish were treated with tamoxifen to induce Hmga1a overexpression | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen | GSM7717535 | GSM7717535: Hmga1a overexpression sample 1; Danio rerio; RNA Seq | GSM7717535 r1 | GSM7717535 | 1 | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP455779 | HUB-PN-b004_HHHK2BGXN_S1_L002_OE1_cbc.fastq.gz | fastq | 213035040.0 | 3550584.0 | GSM7717535 r2 | 0:60 | A:60747442;C:44096249;G:44275929;T:63866231;N:49189 | 60 | 60747442 | 44096249 | 44275929 | 63866231 | 49189 | SRX21410744 | SRS18649226 | SRA1695358 | Jeroen Bakkers, Hubrecht Institute | Jeroen Bakkers, Hubrecht Institute | 1 | 0.89017 | 0.08631 | 0.86543 | 0.52632 | 60 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc_generic | bulk | bulk | Netherlands | 2023-08-18 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 25210 | 25210 | SRR25685554 | SRX21410744 | SRS18649226 | SRP455779 | PRJNA1006658 | Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE] | GSE241157 | Transcriptome Analysis | The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin. | parent bioproject:PRJNA1006653 | pubmed:39747457 | Hmga1a overexpression sample 1 | GSM7717535 | source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing | Hmga1a overexpression sample 1 | FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts | adult heart | zebrafish were treated with tamoxifen to induce Hmga1a overexpression | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen | GSM7717535 | GSM7717535: Hmga1a overexpression sample 1; Danio rerio; RNA Seq | GSM7717535 r1 | GSM7717535 | 1 | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP455779 | HUB-PN-b004_HHHK2BGXN_S1_L003_OE1_cbc.fastq.gz | fastq | 226019460.0 | 3766991.0 | GSM7717535 r3 | 0:60 | A:64732665;C:47081812;G:46018051;T:68171208;N:15724 | 60 | 64732665 | 47081812 | 46018051 | 68171208 | 15724 | SRX21410744 | SRS18649226 | SRA1695358 | Jeroen Bakkers, Hubrecht Institute | Jeroen Bakkers, Hubrecht Institute | 1 | 0.89632 | 0.08716 | 0.86661 | 0.54361 | 60 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc_generic | bulk | bulk | Netherlands | 2023-08-18 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 25211 | 25211 | SRR25685555 | SRX21410744 | SRS18649226 | SRP455779 | PRJNA1006658 | Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE] | GSE241157 | Transcriptome Analysis | The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin. | parent bioproject:PRJNA1006653 | pubmed:39747457 | Hmga1a overexpression sample 1 | GSM7717535 | source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing | Hmga1a overexpression sample 1 | FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts | adult heart | zebrafish were treated with tamoxifen to induce Hmga1a overexpression | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen | GSM7717535 | GSM7717535: Hmga1a overexpression sample 1; Danio rerio; RNA Seq | GSM7717535 r1 | GSM7717535 | 1 | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP455779 | HUB-PN-b004_HHHK2BGXN_S1_L004_OE1_cbc.fastq.gz | fastq | 217742460.0 | 3629041.0 | GSM7717535 r4 | 0:60 | A:61973072;C:45113665;G:45294805;T:65339336;N:21582 | 60 | 61973072 | 45113665 | 45294805 | 65339336 | 21582 | SRX21410744 | SRS18649226 | SRA1695358 | Jeroen Bakkers, Hubrecht Institute | Jeroen Bakkers, Hubrecht Institute | 1 | 0.89237 | 0.08517 | 0.86454 | 0.54639 | 60 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc_generic | bulk | bulk | Netherlands | 2023-08-18 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 25212 | 25212 | SRR25685556 | SRX21410743 | SRS18649225 | SRP455779 | PRJNA1006658 | Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE] | GSE241157 | Transcriptome Analysis | The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin. | parent bioproject:PRJNA1006653 | pubmed:39747457 | control sample 4 | GSM7717534 | source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing | control sample 4 | FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts | adult heart | zebrafish were treated with tamoxifen to induce Hmga1a overexpression | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen | GSM7717534 | GSM7717534: control sample 4; Danio rerio; RNA Seq | GSM7717534 r1 | GSM7717534 | 1 | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP455779 | HUB-PN-b004_HHHK2BGXN_S1_L001_Ctrl4_cbc.fastq.gz | fastq | 242809260.0 | 4046821.0 | GSM7717534 r1 | 0:60 | A:101286554;C:44368173;G:36112695;T:60997635;N:44203 | 60 | 101286554 | 44368173 | 36112695 | 60997635 | 44203 | SRX21410743 | SRS18649225 | SRA1695358 | Jeroen Bakkers, Hubrecht Institute | Jeroen Bakkers, Hubrecht Institute | 1 | 0.87519 | 0.14838 | 0.9362 | 0.79824 | 60 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc_generic | bulk | bulk | Netherlands | 2023-08-18 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 25213 | 25213 | SRR25685557 | SRX21410743 | SRS18649225 | SRP455779 | PRJNA1006658 | Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE] | GSE241157 | Transcriptome Analysis | The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin. | parent bioproject:PRJNA1006653 | pubmed:39747457 | control sample 4 | GSM7717534 | source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing | control sample 4 | FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts | adult heart | zebrafish were treated with tamoxifen to induce Hmga1a overexpression | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen | GSM7717534 | GSM7717534: control sample 4; Danio rerio; RNA Seq | GSM7717534 r1 | GSM7717534 | 1 | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP455779 | HUB-PN-b004_HHHK2BGXN_S1_L002_Ctrl4_cbc.fastq.gz | fastq | 235587720.0 | 3926462.0 | GSM7717534 r2 | 0:60 | A:71954218;C:50127333;G:45371371;T:68077780;N:57018 | 60 | 71954218 | 50127333 | 45371371 | 68077780 | 57018 | SRX21410743 | SRS18649225 | SRA1695358 | Jeroen Bakkers, Hubrecht Institute | Jeroen Bakkers, Hubrecht Institute | 1 | 0.8759 | 0.14468 | 0.88075 | 0.74532 | 60 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc_generic | bulk | bulk | Netherlands | 2023-08-18 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 25214 | 25214 | SRR25685558 | SRX21410743 | SRS18649225 | SRP455779 | PRJNA1006658 | Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE] | GSE241157 | Transcriptome Analysis | The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin. | parent bioproject:PRJNA1006653 | pubmed:39747457 | control sample 4 | GSM7717534 | source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing | control sample 4 | FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts | adult heart | zebrafish were treated with tamoxifen to induce Hmga1a overexpression | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen | GSM7717534 | GSM7717534: control sample 4; Danio rerio; RNA Seq | GSM7717534 r1 | GSM7717534 | 1 | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP455779 | HUB-PN-b004_HHHK2BGXN_S1_L003_Ctrl4_cbc.fastq.gz | fastq | 248320680.0 | 4138678.0 | GSM7717534 r3 | 0:60 | A:76188968;C:53138643;G:46699955;T:72274599;N:18515 | 60 | 76188968 | 53138643 | 46699955 | 72274599 | 18515 | SRX21410743 | SRS18649225 | SRA1695358 | Jeroen Bakkers, Hubrecht Institute | Jeroen Bakkers, Hubrecht Institute | 1 | 0.88396 | 0.1471 | 0.87864 | 0.74275 | 60 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc_generic | bulk | bulk | Netherlands | 2023-08-18 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 25215 | 25215 | SRR25685559 | SRX21410743 | SRS18649225 | SRP455779 | PRJNA1006658 | Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE] | GSE241157 | Transcriptome Analysis | The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin. | parent bioproject:PRJNA1006653 | pubmed:39747457 | control sample 4 | GSM7717534 | source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing | control sample 4 | FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts | adult heart | zebrafish were treated with tamoxifen to induce Hmga1a overexpression | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen | GSM7717534 | GSM7717534: control sample 4; Danio rerio; RNA Seq | GSM7717534 r1 | GSM7717534 | 1 | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP455779 | HUB-PN-b004_HHHK2BGXN_S1_L004_Ctrl4_cbc.fastq.gz | fastq | 239678820.0 | 3994647.0 | GSM7717534 r4 | 0:60 | A:73122694;C:51017089;G:46184519;T:69330703;N:23815 | 60 | 73122694 | 51017089 | 46184519 | 69330703 | 23815 | SRX21410743 | SRS18649225 | SRA1695358 | Jeroen Bakkers, Hubrecht Institute | Jeroen Bakkers, Hubrecht Institute | 1 | 0.88113 | 0.14666 | 0.88045 | 0.79921 | 60 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc_generic | bulk | bulk | Netherlands | 2023-08-18 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 25216 | 25216 | SRR25685560 | SRX21410742 | SRS18649224 | SRP455779 | PRJNA1006658 | Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE] | GSE241157 | Transcriptome Analysis | The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin. | parent bioproject:PRJNA1006653 | pubmed:39747457 | control sample 3 | GSM7717533 | source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing | control sample 3 | FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts | adult heart | zebrafish were treated with tamoxifen to induce Hmga1a overexpression | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen | GSM7717533 | GSM7717533: control sample 3; Danio rerio; RNA Seq | GSM7717533 r1 | GSM7717533 | 1 | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP455779 | HUB-PN-b004_HHHK2BGXN_S1_L001_Ctrl3_cbc.fastq.gz | fastq | 164862000.0 | 2747700.0 | GSM7717533 r1 | 0:60 | A:67317722;C:30175032;G:25320195;T:42019155;N:29896 | 60 | 67317722 | 30175032 | 25320195 | 42019155 | 29896 | SRX21410742 | SRS18649224 | SRA1695358 | Jeroen Bakkers, Hubrecht Institute | Jeroen Bakkers, Hubrecht Institute | 1 | 0.8874 | 0.16231 | 0.93513 | 0.45903 | 60 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc_generic | bulk | bulk | Netherlands | 2023-08-18 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 25217 | 25217 | SRR25685561 | SRX21410742 | SRS18649224 | SRP455779 | PRJNA1006658 | Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE] | GSE241157 | Transcriptome Analysis | The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin. | parent bioproject:PRJNA1006653 | pubmed:39747457 | control sample 3 | GSM7717533 | source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing | control sample 3 | FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts | adult heart | zebrafish were treated with tamoxifen to induce Hmga1a overexpression | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen | GSM7717533 | GSM7717533: control sample 3; Danio rerio; RNA Seq | GSM7717533 r1 | GSM7717533 | 1 | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP455779 | HUB-PN-b004_HHHK2BGXN_S1_L002_Ctrl3_cbc.fastq.gz | fastq | 159878880.0 | 2664648.0 | GSM7717533 r2 | 0:60 | A:48277840;C:33800190;G:31556276;T:46206979;N:37595 | 60 | 48277840 | 33800190 | 31556276 | 46206979 | 37595 | SRX21410742 | SRS18649224 | SRA1695358 | Jeroen Bakkers, Hubrecht Institute | Jeroen Bakkers, Hubrecht Institute | 1 | 0.8874 | 0.15941 | 0.88038 | 0.79589 | 60 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc_generic | bulk | bulk | Netherlands | 2023-08-18 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 25218 | 25218 | SRR25685562 | SRX21410742 | SRS18649224 | SRP455779 | PRJNA1006658 | Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE] | GSE241157 | Transcriptome Analysis | The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin. | parent bioproject:PRJNA1006653 | pubmed:39747457 | control sample 3 | GSM7717533 | source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing | control sample 3 | FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts | adult heart | zebrafish were treated with tamoxifen to induce Hmga1a overexpression | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen | GSM7717533 | GSM7717533: control sample 3; Danio rerio; RNA Seq | GSM7717533 r1 | GSM7717533 | 1 | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP455779 | HUB-PN-b004_HHHK2BGXN_S1_L003_Ctrl3_cbc.fastq.gz | fastq | 169506240.0 | 2825104.0 | GSM7717533 r3 | 0:60 | A:51435401;C:36027782;G:32684721;T:49346338;N:11998 | 60 | 51435401 | 36027782 | 32684721 | 49346338 | 11998 | SRX21410742 | SRS18649224 | SRA1695358 | Jeroen Bakkers, Hubrecht Institute | Jeroen Bakkers, Hubrecht Institute | 1 | 0.89554 | 0.16117 | 0.87947 | 0.795 | 60 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc_generic | bulk | bulk | Netherlands | 2023-08-18 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 25219 | 25219 | SRR25685563 | SRX21410742 | SRS18649224 | SRP455779 | PRJNA1006658 | Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE] | GSE241157 | Transcriptome Analysis | The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin. | parent bioproject:PRJNA1006653 | pubmed:39747457 | control sample 3 | GSM7717533 | source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing | control sample 3 | FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts | adult heart | zebrafish were treated with tamoxifen to induce Hmga1a overexpression | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen | GSM7717533 | GSM7717533: control sample 3; Danio rerio; RNA Seq | GSM7717533 r1 | GSM7717533 | 1 | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP455779 | HUB-PN-b004_HHHK2BGXN_S1_L004_Ctrl3_cbc.fastq.gz | fastq | 163347840.0 | 2722464.0 | GSM7717533 r4 | 0:60 | A:49253957;C:34538564;G:32268358;T:47272095;N:14866 | 60 | 49253957 | 34538564 | 32268358 | 47272095 | 14866 | SRX21410742 | SRS18649224 | SRA1695358 | Jeroen Bakkers, Hubrecht Institute | Jeroen Bakkers, Hubrecht Institute | 1 | 0.89252 | 0.15956 | 0.8784 | 0.79732 | 60 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc_generic | bulk | bulk | Netherlands | 2023-08-18 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 25220 | 25220 | SRR25685564 | SRX21410741 | SRS18649223 | SRP455779 | PRJNA1006658 | Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE] | GSE241157 | Transcriptome Analysis | The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin. | parent bioproject:PRJNA1006653 | pubmed:39747457 | control sample 2 | GSM7717532 | source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing | control sample 2 | FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts | adult heart | zebrafish were treated with tamoxifen to induce Hmga1a overexpression | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen | GSM7717532 | GSM7717532: control sample 2; Danio rerio; RNA Seq | GSM7717532 r1 | GSM7717532 | 1 | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP455779 | HUB-PN-b004_HHHK2BGXN_S1_L001_Ctrl2_cbc.fastq.gz | fastq | 19885560.0 | 331426.0 | GSM7717532 r1 | 0:60 | A:8615440;C:3592607;G:2886695;T:4787767;N:3051 | 60 | 8615440 | 3592607 | 2886695 | 4787767 | 3051 | SRX21410741 | SRS18649223 | SRA1695358 | Jeroen Bakkers, Hubrecht Institute | Jeroen Bakkers, Hubrecht Institute | 1 | 0.84848 | 0.13671 | 0.96136 | 0.84253 | 60 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc_generic | bulk | bulk | Netherlands | 2023-08-18 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 25221 | 25221 | SRR25685565 | SRX21410741 | SRS18649223 | SRP455779 | PRJNA1006658 | Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE] | GSE241157 | Transcriptome Analysis | The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin. | parent bioproject:PRJNA1006653 | pubmed:39747457 | control sample 2 | GSM7717532 | source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing | control sample 2 | FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts | adult heart | zebrafish were treated with tamoxifen to induce Hmga1a overexpression | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen | GSM7717532 | GSM7717532: control sample 2; Danio rerio; RNA Seq | GSM7717532 r1 | GSM7717532 | 1 | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP455779 | HUB-PN-b004_HHHK2BGXN_S1_L002_Ctrl2_cbc.fastq.gz | fastq | 19226760.0 | 320446.0 | GSM7717532 r2 | 0:60 | A:5898378;C:4022375;G:3854218;T:5447181;N:4608 | 60 | 5898378 | 4022375 | 3854218 | 5447181 | 4608 | SRX21410741 | SRS18649223 | SRA1695358 | Jeroen Bakkers, Hubrecht Institute | Jeroen Bakkers, Hubrecht Institute | 1 | 0.84542 | 0.13731 | 0.94004 | 0.38758 | 60 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc_generic | bulk | bulk | Netherlands | 2023-08-18 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 25222 | 25222 | SRR25685566 | SRX21410741 | SRS18649223 | SRP455779 | PRJNA1006658 | Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE] | GSE241157 | Transcriptome Analysis | The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin. | parent bioproject:PRJNA1006653 | pubmed:39747457 | control sample 2 | GSM7717532 | source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing | control sample 2 | FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts | adult heart | zebrafish were treated with tamoxifen to induce Hmga1a overexpression | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen | GSM7717532 | GSM7717532: control sample 2; Danio rerio; RNA Seq | GSM7717532 r1 | GSM7717532 | 1 | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP455779 | HUB-PN-b004_HHHK2BGXN_S1_L003_Ctrl2_cbc.fastq.gz | fastq | 20360520.0 | 339342.0 | GSM7717532 r3 | 0:60 | A:6273552;C:4289098;G:3982791;T:5813710;N:1369 | 60 | 6273552 | 4289098 | 3982791 | 5813710 | 1369 | SRX21410741 | SRS18649223 | SRA1695358 | Jeroen Bakkers, Hubrecht Institute | Jeroen Bakkers, Hubrecht Institute | 1 | 0.85213 | 0.13819 | 0.93929 | 0.83913 | 60 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc_generic | bulk | bulk | Netherlands | 2023-08-18 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 25223 | 25223 | SRR25685567 | SRX21410741 | SRS18649223 | SRP455779 | PRJNA1006658 | Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE] | GSE241157 | Transcriptome Analysis | The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin. | parent bioproject:PRJNA1006653 | pubmed:39747457 | control sample 2 | GSM7717532 | source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing | control sample 2 | FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts | adult heart | zebrafish were treated with tamoxifen to induce Hmga1a overexpression | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen | GSM7717532 | GSM7717532: control sample 2; Danio rerio; RNA Seq | GSM7717532 r1 | GSM7717532 | 1 | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP455779 | HUB-PN-b004_HHHK2BGXN_S1_L004_Ctrl2_cbc.fastq.gz | fastq | 19742340.0 | 329039.0 | GSM7717532 r4 | 0:60 | A:6042722;C:4140425;G:3955209;T:5601961;N:2023 | 60 | 6042722 | 4140425 | 3955209 | 5601961 | 2023 | SRX21410741 | SRS18649223 | SRA1695358 | Jeroen Bakkers, Hubrecht Institute | Jeroen Bakkers, Hubrecht Institute | 1 | 0.84722 | 0.13682 | 0.93933 | 0.83301 | 60 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc_generic | bulk | bulk | Netherlands | 2023-08-18 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 25224 | 25224 | SRR25685568 | SRX21410740 | SRS18649222 | SRP455779 | PRJNA1006658 | Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE] | GSE241157 | Transcriptome Analysis | The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin. | parent bioproject:PRJNA1006653 | pubmed:39747457 | control sample 1 | GSM7717531 | source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing | control sample 1 | FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts | adult heart | zebrafish were treated with tamoxifen to induce Hmga1a overexpression | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen | GSM7717531 | GSM7717531: control sample 1; Danio rerio; RNA Seq | GSM7717531 r1 | GSM7717531 | 1 | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP455779 | HUB-PN-b004_HHHK2BGXN_S1_L001_Ctrl1_cbc.fastq.gz | fastq | 296163420.0 | 4936057.0 | GSM7717531 r1 | 0:60 | A:121966307;C:53233433;G:44972413;T:75936522;N:54745 | 60 | 121966307 | 53233433 | 44972413 | 75936522 | 54745 | SRX21410740 | SRS18649222 | SRA1695358 | Jeroen Bakkers, Hubrecht Institute | Jeroen Bakkers, Hubrecht Institute | 1 | 0.88546 | 0.17055 | 0.92681 | 0.76028 | 60 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc_generic | bulk | bulk | Netherlands | 2023-08-18 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 25225 | 25225 | SRR25685569 | SRX21410740 | SRS18649222 | SRP455779 | PRJNA1006658 | Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE] | GSE241157 | Transcriptome Analysis | The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin. | parent bioproject:PRJNA1006653 | pubmed:39747457 | control sample 1 | GSM7717531 | source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing | control sample 1 | FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts | adult heart | zebrafish were treated with tamoxifen to induce Hmga1a overexpression | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen | GSM7717531 | GSM7717531: control sample 1; Danio rerio; RNA Seq | GSM7717531 r1 | GSM7717531 | 1 | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP455779 | HUB-PN-b004_HHHK2BGXN_S1_L002_Ctrl1_cbc.fastq.gz | fastq | 287707980.0 | 4795133.0 | GSM7717531 r2 | 0:60 | A:87738683;C:59468794;G:56448494;T:83984130;N:67879 | 60 | 87738683 | 59468794 | 56448494 | 83984130 | 67879 | SRX21410740 | SRS18649222 | SRA1695358 | Jeroen Bakkers, Hubrecht Institute | Jeroen Bakkers, Hubrecht Institute | 1 | 0.88284 | 0.16626 | 0.86561 | 0.74308 | 60 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc_generic | bulk | bulk | Netherlands | 2023-08-18 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 25226 | 25226 | SRR25685570 | SRX21410740 | SRS18649222 | SRP455779 | PRJNA1006658 | Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE] | GSE241157 | Transcriptome Analysis | The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin. | parent bioproject:PRJNA1006653 | pubmed:39747457 | control sample 1 | GSM7717531 | source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing | control sample 1 | FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts | adult heart | zebrafish were treated with tamoxifen to induce Hmga1a overexpression | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen | GSM7717531 | GSM7717531: control sample 1; Danio rerio; RNA Seq | GSM7717531 r1 | GSM7717531 | 1 | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP455779 | HUB-PN-b004_HHHK2BGXN_S1_L003_Ctrl1_cbc.fastq.gz | fastq | 303833460.0 | 5063891.0 | GSM7717531 r3 | 0:60 | A:93092013;C:63221167;G:58235370;T:89262119;N:22791 | 60 | 93092013 | 63221167 | 58235370 | 89262119 | 22791 | SRX21410740 | SRS18649222 | SRA1695358 | Jeroen Bakkers, Hubrecht Institute | Jeroen Bakkers, Hubrecht Institute | 1 | 0.89102 | 0.16657 | 0.86336 | 0.75396 | 60 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc_generic | bulk | bulk | Netherlands | 2023-08-18 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 25227 | 25227 | SRR25685571 | SRX21410740 | SRS18649222 | SRP455779 | PRJNA1006658 | Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE] | GSE241157 | Transcriptome Analysis | The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin. | parent bioproject:PRJNA1006653 | pubmed:39747457 | control sample 1 | GSM7717531 | source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing | control sample 1 | FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts | adult heart | zebrafish were treated with tamoxifen to induce Hmga1a overexpression | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen | GSM7717531 | GSM7717531: control sample 1; Danio rerio; RNA Seq | GSM7717531 r1 | GSM7717531 | 1 | Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP455779 | HUB-PN-b004_HHHK2BGXN_S1_L004_Ctrl1_cbc.fastq.gz | fastq | 293865840.0 | 4897764.0 | GSM7717531 r4 | 0:60 | A:89531768;C:60796725;G:57688758;T:85819485;N:29104 | 60 | 89531768 | 60796725 | 57688758 | 85819485 | 29104 | SRX21410740 | SRS18649222 | SRA1695358 | Jeroen Bakkers, Hubrecht Institute | Jeroen Bakkers, Hubrecht Institute | 1 | 0.88911 | 0.16498 | 0.86145 | 0.75653 | 60 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc_generic | bulk | bulk | Netherlands | 2023-08-18 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 31502 | 31502 | SRR28411462 | SRX24015869 | SRS20810998 | SRP497025 | PRJNA1090509 | The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst139 | GSE262169 | Transcriptome Analysis | The innate immune response is triggered xxx post injury and its spatiotemporal dynamics are critical for regeneration but many questions remain about its exact role. Here we show that MyD88 a key component of the innate immune response controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration. We find in cryoinjured myd88 / ventricles a significant reduction in neutrophil and macrophage numbers as well as the expansion of a collagen rich endocardial population. Further analyses reveal compromised PI3K/AKT pathway activation in the myd88 / endocardium and increased myofibroblasts and scarring. Notably endothelial specific overexpression of myd88 reverses these neutrophil fibrotic and scarring phenotypes. Mechanistically we identify the endocardial derived chemokine gene cxcl18b as a target of the MyD88 signaling pathway and using loss and gain of function tools show that it controls neutrophil recruitment. Altogether these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis during tissue regeneration. Overall design: RNA was isolated from myd88+/+ and myd88 / untouched ventricles and cryoinjured tissues at 1 and 24 hours post cryoinjury hpci and analyzed using bulk RNA sequencing | parent bioproject:PRJNA1090894 | pubmed:39271818 | injured tissue myd88+/+ 24 hpci 2 | GSM8159071 | source name:cardiac ventricles|tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88+/+|treatment:cardiac cryoinjury|geo loc name:missing|collection date:missing | injured tissue myd88+/+ 24 hpci 2 | Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 99 with STAR 2.7.3a Dobin et al. STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 2.21.7 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. The raw count matrix was normalized with DESeq2 version 1.26.0 Love et al. Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2. Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count > 5 multiple testing adjusted p value < 0.05 and 0.585 < log2FC > 0.585. Gene counts were established with featureCounts 1.6.5 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The Ensemble annotation was enriched with UniProt data Activities at the Universal Protein Resource UniProt. Assembly: DanRer11 Supplementary files format and content: library normilzed counts | cardiac ventricles | untouched ventricles or cardiac cryoinjury at 1 or 24 hours prior to heart extraction | RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture’s protocol Vazyme. | tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88+/+|treatment:cardiac cryoinjury | GSM8159071 | GSM8159071: injured tissue myd88+/+ 24 hpci 2; Danio rerio; RNA Seq | GSM8159071 r1 | GSM8159071 | 1 | RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture's protocol Vazyme. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP497025 | loader:fastq load.py | Pinelopi_WT2_24h_pci_R1.fastq.gz | fastq | 2454645976.0 | 33159360.0 | GSM8159071 r1 | 0:74.03 | A:660213492;C:527347733;G:572126573;T:694765347;N:192831 | 74 | 660213492 | 527347733 | 572126573 | 694765347 | 192831 | SRX24015869 | SRS20810998 | SRA1830778 | MPI for heart and lung research | MPI for heart and lung research | B | usable mapping rate | illumina | nextseq_v2 | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | Germany | 2024-03-21 | Undetermined | Undetermined | Heart | Cardiovascular System | ||||||||||||||||||||||
| 31503 | 31503 | SRR28411463 | SRX24015868 | SRS20810997 | SRP497025 | PRJNA1090509 | The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst139 | GSE262169 | Transcriptome Analysis | The innate immune response is triggered xxx post injury and its spatiotemporal dynamics are critical for regeneration but many questions remain about its exact role. Here we show that MyD88 a key component of the innate immune response controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration. We find in cryoinjured myd88 / ventricles a significant reduction in neutrophil and macrophage numbers as well as the expansion of a collagen rich endocardial population. Further analyses reveal compromised PI3K/AKT pathway activation in the myd88 / endocardium and increased myofibroblasts and scarring. Notably endothelial specific overexpression of myd88 reverses these neutrophil fibrotic and scarring phenotypes. Mechanistically we identify the endocardial derived chemokine gene cxcl18b as a target of the MyD88 signaling pathway and using loss and gain of function tools show that it controls neutrophil recruitment. Altogether these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis during tissue regeneration. Overall design: RNA was isolated from myd88+/+ and myd88 / untouched ventricles and cryoinjured tissues at 1 and 24 hours post cryoinjury hpci and analyzed using bulk RNA sequencing | parent bioproject:PRJNA1090894 | pubmed:39271818 | injured tissue myd88+/+ 1 hpci 2 | GSM8159070 | source name:cardiac ventricles|tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88+/+|treatment:cardiac cryoinjury|geo loc name:missing|collection date:missing | injured tissue myd88+/+ 1 hpci 2 | Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 99 with STAR 2.7.3a Dobin et al. STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 2.21.7 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. The raw count matrix was normalized with DESeq2 version 1.26.0 Love et al. Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2. Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count > 5 multiple testing adjusted p value < 0.05 and 0.585 < log2FC > 0.585. Gene counts were established with featureCounts 1.6.5 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The Ensemble annotation was enriched with UniProt data Activities at the Universal Protein Resource UniProt. Assembly: DanRer11 Supplementary files format and content: library normilzed counts | cardiac ventricles | untouched ventricles or cardiac cryoinjury at 1 or 24 hours prior to heart extraction | RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture’s protocol Vazyme. | tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88+/+|treatment:cardiac cryoinjury | GSM8159070 | GSM8159070: injured tissue myd88+/+ 1 hpci 2; Danio rerio; RNA Seq | GSM8159070 r1 | GSM8159070 | 1 | RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture's protocol Vazyme. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP497025 | loader:fastq load.py | Pinelopi_WT2_1h_pci_R1.fastq.gz | fastq | 2674654542.0 | 36003719.0 | GSM8159070 r1 | 0:74.29 | A:713621237;C:556223861;G:630990745;T:773686189;N:132510 | 74 | 713621237 | 556223861 | 630990745 | 773686189 | 132510 | SRX24015868 | SRS20810997 | SRA1830778 | MPI for heart and lung research | MPI for heart and lung research | B | usable mapping rate | illumina | nextseq_v2 | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | Germany | 2024-03-21 | Undetermined | Undetermined | Heart | Cardiovascular System | ||||||||||||||||||||||
| 31504 | 31504 | SRR28411464 | SRX24015867 | SRS20810996 | SRP497025 | PRJNA1090509 | The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst139 | GSE262169 | Transcriptome Analysis | The innate immune response is triggered xxx post injury and its spatiotemporal dynamics are critical for regeneration but many questions remain about its exact role. Here we show that MyD88 a key component of the innate immune response controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration. We find in cryoinjured myd88 / ventricles a significant reduction in neutrophil and macrophage numbers as well as the expansion of a collagen rich endocardial population. Further analyses reveal compromised PI3K/AKT pathway activation in the myd88 / endocardium and increased myofibroblasts and scarring. Notably endothelial specific overexpression of myd88 reverses these neutrophil fibrotic and scarring phenotypes. Mechanistically we identify the endocardial derived chemokine gene cxcl18b as a target of the MyD88 signaling pathway and using loss and gain of function tools show that it controls neutrophil recruitment. Altogether these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis during tissue regeneration. Overall design: RNA was isolated from myd88+/+ and myd88 / untouched ventricles and cryoinjured tissues at 1 and 24 hours post cryoinjury hpci and analyzed using bulk RNA sequencing | parent bioproject:PRJNA1090894 | pubmed:39271818 | ventricle myd88+/+ untouched 2 | GSM8159069 | source name:cardiac ventricles|tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88+/+|treatment: |geo loc name:missing|collection date:missing | ventricle myd88+/+ untouched 2 | Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 99 with STAR 2.7.3a Dobin et al. STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 2.21.7 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. The raw count matrix was normalized with DESeq2 version 1.26.0 Love et al. Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2. Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count > 5 multiple testing adjusted p value < 0.05 and 0.585 < log2FC > 0.585. Gene counts were established with featureCounts 1.6.5 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The Ensemble annotation was enriched with UniProt data Activities at the Universal Protein Resource UniProt. Assembly: DanRer11 Supplementary files format and content: library normilzed counts | cardiac ventricles | untouched ventricles or cardiac cryoinjury at 1 or 24 hours prior to heart extraction | RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture’s protocol Vazyme. | tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88+/+|treatment: | GSM8159069 | GSM8159069: ventricle myd88+/+ untouched 2; Danio rerio; RNA Seq | GSM8159069 r1 | GSM8159069 | 1 | RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture's protocol Vazyme. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP497025 | loader:fastq load.py | Pinelopi_WT2_0h_pci_R1.fastq.gz | fastq | 2092632406.0 | 28163739.0 | GSM8159069 r1 | 0:74.30 | A:560190602;C:446185315;G:485011548;T:601082958;N:161983 | 74 | 560190602 | 446185315 | 485011548 | 601082958 | 161983 | SRX24015867 | SRS20810996 | SRA1830778 | MPI for heart and lung research | MPI for heart and lung research | B | usable mapping rate | illumina | nextseq_v2 | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | Germany | 2024-03-21 | Undetermined | Undetermined | Heart | Cardiovascular System | ||||||||||||||||||||||
| 31505 | 31505 | SRR28411465 | SRX24015866 | SRS20810995 | SRP497025 | PRJNA1090509 | The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst139 | GSE262169 | Transcriptome Analysis | The innate immune response is triggered xxx post injury and its spatiotemporal dynamics are critical for regeneration but many questions remain about its exact role. Here we show that MyD88 a key component of the innate immune response controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration. We find in cryoinjured myd88 / ventricles a significant reduction in neutrophil and macrophage numbers as well as the expansion of a collagen rich endocardial population. Further analyses reveal compromised PI3K/AKT pathway activation in the myd88 / endocardium and increased myofibroblasts and scarring. Notably endothelial specific overexpression of myd88 reverses these neutrophil fibrotic and scarring phenotypes. Mechanistically we identify the endocardial derived chemokine gene cxcl18b as a target of the MyD88 signaling pathway and using loss and gain of function tools show that it controls neutrophil recruitment. Altogether these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis during tissue regeneration. Overall design: RNA was isolated from myd88+/+ and myd88 / untouched ventricles and cryoinjured tissues at 1 and 24 hours post cryoinjury hpci and analyzed using bulk RNA sequencing | parent bioproject:PRJNA1090894 | pubmed:39271818 | injured tissue myd88+/+ 24 hpci 1 | GSM8159068 | source name:cardiac ventricles|tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88+/+|treatment:cardiac cryoinjury|geo loc name:missing|collection date:missing | injured tissue myd88+/+ 24 hpci 1 | Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 99 with STAR 2.7.3a Dobin et al. STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 2.21.7 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. The raw count matrix was normalized with DESeq2 version 1.26.0 Love et al. Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2. Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count > 5 multiple testing adjusted p value < 0.05 and 0.585 < log2FC > 0.585. Gene counts were established with featureCounts 1.6.5 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The Ensemble annotation was enriched with UniProt data Activities at the Universal Protein Resource UniProt. Assembly: DanRer11 Supplementary files format and content: library normilzed counts | cardiac ventricles | untouched ventricles or cardiac cryoinjury at 1 or 24 hours prior to heart extraction | RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture’s protocol Vazyme. | tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88+/+|treatment:cardiac cryoinjury | GSM8159068 | GSM8159068: injured tissue myd88+/+ 24 hpci 1; Danio rerio; RNA Seq | GSM8159068 r1 | GSM8159068 | 1 | RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture's protocol Vazyme. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP497025 | loader:fastq load.py | Pinelopi_WT1_24h_pci_R1.fastq.gz | fastq | 1060148110.0 | 14341826.0 | GSM8159068 r1 | 0:73.92 | A:290655996;C:222128471;G:247491826;T:299784598;N:87219 | 73 | 290655996 | 222128471 | 247491826 | 299784598 | 87219 | SRX24015866 | SRS20810995 | SRA1830778 | MPI for heart and lung research | MPI for heart and lung research | B | usable mapping rate | illumina | nextseq_v2 | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | Germany | 2024-03-21 | Undetermined | Undetermined | Heart | Cardiovascular System | ||||||||||||||||||||||
| 31506 | 31506 | SRR28411466 | SRX24015865 | SRS20810994 | SRP497025 | PRJNA1090509 | The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst139 | GSE262169 | Transcriptome Analysis | The innate immune response is triggered xxx post injury and its spatiotemporal dynamics are critical for regeneration but many questions remain about its exact role. Here we show that MyD88 a key component of the innate immune response controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration. We find in cryoinjured myd88 / ventricles a significant reduction in neutrophil and macrophage numbers as well as the expansion of a collagen rich endocardial population. Further analyses reveal compromised PI3K/AKT pathway activation in the myd88 / endocardium and increased myofibroblasts and scarring. Notably endothelial specific overexpression of myd88 reverses these neutrophil fibrotic and scarring phenotypes. Mechanistically we identify the endocardial derived chemokine gene cxcl18b as a target of the MyD88 signaling pathway and using loss and gain of function tools show that it controls neutrophil recruitment. Altogether these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis during tissue regeneration. Overall design: RNA was isolated from myd88+/+ and myd88 / untouched ventricles and cryoinjured tissues at 1 and 24 hours post cryoinjury hpci and analyzed using bulk RNA sequencing | parent bioproject:PRJNA1090894 | pubmed:39271818 | injured tissue myd88+/+ 1 hpci 1 | GSM8159067 | source name:cardiac ventricles|tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88+/+|treatment:cardiac cryoinjury|geo loc name:missing|collection date:missing | injured tissue myd88+/+ 1 hpci 1 | Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 99 with STAR 2.7.3a Dobin et al. STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 2.21.7 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. The raw count matrix was normalized with DESeq2 version 1.26.0 Love et al. Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2. Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count > 5 multiple testing adjusted p value < 0.05 and 0.585 < log2FC > 0.585. Gene counts were established with featureCounts 1.6.5 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The Ensemble annotation was enriched with UniProt data Activities at the Universal Protein Resource UniProt. Assembly: DanRer11 Supplementary files format and content: library normilzed counts | cardiac ventricles | untouched ventricles or cardiac cryoinjury at 1 or 24 hours prior to heart extraction | RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture’s protocol Vazyme. | tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88+/+|treatment:cardiac cryoinjury | GSM8159067 | GSM8159067: injured tissue myd88+/+ 1 hpci 1; Danio rerio; RNA Seq | GSM8159067 r1 | GSM8159067 | 1 | RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture's protocol Vazyme. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP497025 | loader:fastq load.py | Pinelopi_WT1_1h_pci_R1.fastq.gz | fastq | 2594786024.0 | 34913792.0 | GSM8159067 r1 | 0:74.32 | A:689702458;C:551265040;G:603307580;T:750425733;N:85213 | 74 | 689702458 | 551265040 | 603307580 | 750425733 | 85213 | SRX24015865 | SRS20810994 | SRA1830778 | MPI for heart and lung research | MPI for heart and lung research | B | usable mapping rate | illumina | nextseq_v2 | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | Germany | 2024-03-21 | Undetermined | Undetermined | Heart | Cardiovascular System | ||||||||||||||||||||||
| 31507 | 31507 | SRR28411467 | SRX24015864 | SRS20810993 | SRP497025 | PRJNA1090509 | The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst139 | GSE262169 | Transcriptome Analysis | The innate immune response is triggered xxx post injury and its spatiotemporal dynamics are critical for regeneration but many questions remain about its exact role. Here we show that MyD88 a key component of the innate immune response controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration. We find in cryoinjured myd88 / ventricles a significant reduction in neutrophil and macrophage numbers as well as the expansion of a collagen rich endocardial population. Further analyses reveal compromised PI3K/AKT pathway activation in the myd88 / endocardium and increased myofibroblasts and scarring. Notably endothelial specific overexpression of myd88 reverses these neutrophil fibrotic and scarring phenotypes. Mechanistically we identify the endocardial derived chemokine gene cxcl18b as a target of the MyD88 signaling pathway and using loss and gain of function tools show that it controls neutrophil recruitment. Altogether these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis during tissue regeneration. Overall design: RNA was isolated from myd88+/+ and myd88 / untouched ventricles and cryoinjured tissues at 1 and 24 hours post cryoinjury hpci and analyzed using bulk RNA sequencing | parent bioproject:PRJNA1090894 | pubmed:39271818 | ventricle myd88+/+ untouched 1 | GSM8159066 | source name:cardiac ventricles|tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88+/+|treatment: |geo loc name:missing|collection date:missing | ventricle myd88+/+ untouched 1 | Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 99 with STAR 2.7.3a Dobin et al. STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 2.21.7 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. The raw count matrix was normalized with DESeq2 version 1.26.0 Love et al. Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2. Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count > 5 multiple testing adjusted p value < 0.05 and 0.585 < log2FC > 0.585. Gene counts were established with featureCounts 1.6.5 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The Ensemble annotation was enriched with UniProt data Activities at the Universal Protein Resource UniProt. Assembly: DanRer11 Supplementary files format and content: library normilzed counts | cardiac ventricles | untouched ventricles or cardiac cryoinjury at 1 or 24 hours prior to heart extraction | RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture’s protocol Vazyme. | tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88+/+|treatment: | GSM8159066 | GSM8159066: ventricle myd88+/+ untouched 1; Danio rerio; RNA Seq | GSM8159066 r1 | GSM8159066 | 1 | RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture's protocol Vazyme. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP497025 | loader:fastq load.py | Pinelopi_WT1_0h_pci_R1.fastq.gz | fastq | 2123516005.0 | 28595227.0 | GSM8159066 r1 | 0:74.26 | A:562046544;C:458761205;G:496224794;T:606313940;N:169522 | 74 | 562046544 | 458761205 | 496224794 | 606313940 | 169522 | SRX24015864 | SRS20810993 | SRA1830778 | MPI for heart and lung research | MPI for heart and lung research | B | usable mapping rate | illumina | nextseq_v2 | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | Germany | 2024-03-21 | Undetermined | Undetermined | Heart | Cardiovascular System | ||||||||||||||||||||||
| 31508 | 31508 | SRR28411468 | SRX24015863 | SRS20810992 | SRP497025 | PRJNA1090509 | The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst139 | GSE262169 | Transcriptome Analysis | The innate immune response is triggered xxx post injury and its spatiotemporal dynamics are critical for regeneration but many questions remain about its exact role. Here we show that MyD88 a key component of the innate immune response controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration. We find in cryoinjured myd88 / ventricles a significant reduction in neutrophil and macrophage numbers as well as the expansion of a collagen rich endocardial population. Further analyses reveal compromised PI3K/AKT pathway activation in the myd88 / endocardium and increased myofibroblasts and scarring. Notably endothelial specific overexpression of myd88 reverses these neutrophil fibrotic and scarring phenotypes. Mechanistically we identify the endocardial derived chemokine gene cxcl18b as a target of the MyD88 signaling pathway and using loss and gain of function tools show that it controls neutrophil recruitment. Altogether these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis during tissue regeneration. Overall design: RNA was isolated from myd88+/+ and myd88 / untouched ventricles and cryoinjured tissues at 1 and 24 hours post cryoinjury hpci and analyzed using bulk RNA sequencing | parent bioproject:PRJNA1090894 | pubmed:39271818 | injured tissue myd88 / 24 hpci 2 | GSM8159065 | source name:cardiac ventricles|tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88 / |treatment:cardiac cryoinjury|geo loc name:missing|collection date:missing | injured tissue myd88 / 24 hpci 2 | Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 99 with STAR 2.7.3a Dobin et al. STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 2.21.7 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. The raw count matrix was normalized with DESeq2 version 1.26.0 Love et al. Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2. Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count > 5 multiple testing adjusted p value < 0.05 and 0.585 < log2FC > 0.585. Gene counts were established with featureCounts 1.6.5 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The Ensemble annotation was enriched with UniProt data Activities at the Universal Protein Resource UniProt. Assembly: DanRer11 Supplementary files format and content: library normilzed counts | cardiac ventricles | untouched ventricles or cardiac cryoinjury at 1 or 24 hours prior to heart extraction | RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture’s protocol Vazyme. | tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88 / |treatment:cardiac cryoinjury | GSM8159065 | GSM8159065: injured tissue myd88 / 24 hpci 2; Danio rerio; RNA Seq | GSM8159065 r1 | GSM8159065 | 1 | RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture's protocol Vazyme. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP497025 | loader:fastq load.py | Pinelopi_Homo2_24h_pci_R1.fastq.gz | fastq | 2509143345.0 | 33915175.0 | GSM8159065 r1 | 0:73.98 | A:669128241;C:547606289;G:587771598;T:704439682;N:197535 | 73 | 669128241 | 547606289 | 587771598 | 704439682 | 197535 | SRX24015863 | SRS20810992 | SRA1830778 | MPI for heart and lung research | MPI for heart and lung research | B | usable mapping rate | illumina | nextseq_v2 | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | Germany | 2024-03-21 | Undetermined | Undetermined | Heart | Cardiovascular System | ||||||||||||||||||||||
| 31509 | 31509 | SRR28411469 | SRX24015862 | SRS20810991 | SRP497025 | PRJNA1090509 | The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst139 | GSE262169 | Transcriptome Analysis | The innate immune response is triggered xxx post injury and its spatiotemporal dynamics are critical for regeneration but many questions remain about its exact role. Here we show that MyD88 a key component of the innate immune response controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration. We find in cryoinjured myd88 / ventricles a significant reduction in neutrophil and macrophage numbers as well as the expansion of a collagen rich endocardial population. Further analyses reveal compromised PI3K/AKT pathway activation in the myd88 / endocardium and increased myofibroblasts and scarring. Notably endothelial specific overexpression of myd88 reverses these neutrophil fibrotic and scarring phenotypes. Mechanistically we identify the endocardial derived chemokine gene cxcl18b as a target of the MyD88 signaling pathway and using loss and gain of function tools show that it controls neutrophil recruitment. Altogether these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis during tissue regeneration. Overall design: RNA was isolated from myd88+/+ and myd88 / untouched ventricles and cryoinjured tissues at 1 and 24 hours post cryoinjury hpci and analyzed using bulk RNA sequencing | parent bioproject:PRJNA1090894 | pubmed:39271818 | injured tissue myd88 / 1 hpci 2 | GSM8159064 | source name:cardiac ventricles|tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88 / |treatment:cardiac cryoinjury|geo loc name:missing|collection date:missing | injured tissue myd88 / 1 hpci 2 | Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 99 with STAR 2.7.3a Dobin et al. STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 2.21.7 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. The raw count matrix was normalized with DESeq2 version 1.26.0 Love et al. Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2. Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count > 5 multiple testing adjusted p value < 0.05 and 0.585 < log2FC > 0.585. Gene counts were established with featureCounts 1.6.5 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The Ensemble annotation was enriched with UniProt data Activities at the Universal Protein Resource UniProt. Assembly: DanRer11 Supplementary files format and content: library normilzed counts | cardiac ventricles | untouched ventricles or cardiac cryoinjury at 1 or 24 hours prior to heart extraction | RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture’s protocol Vazyme. | tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88 / |treatment:cardiac cryoinjury | GSM8159064 | GSM8159064: injured tissue myd88 / 1 hpci 2; Danio rerio; RNA Seq | GSM8159064 r1 | GSM8159064 | 1 | RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture's protocol Vazyme. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP497025 | loader:fastq load.py | Pinelopi_Homo2_1h_pci_R1.fastq.gz | fastq | 2584847185.0 | 34784917.0 | GSM8159064 r1 | 0:74.31 | A:690941775;C:542509296;G:605002938;T:746301098;N:92078 | 74 | 690941775 | 542509296 | 605002938 | 746301098 | 92078 | SRX24015862 | SRS20810991 | SRA1830778 | MPI for heart and lung research | MPI for heart and lung research | B | usable mapping rate | illumina | nextseq_v2 | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | Germany | 2024-03-21 | Undetermined | Undetermined | Heart | Cardiovascular System | ||||||||||||||||||||||
| 31510 | 31510 | SRR28411470 | SRX24015861 | SRS20810990 | SRP497025 | PRJNA1090509 | The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst139 | GSE262169 | Transcriptome Analysis | The innate immune response is triggered xxx post injury and its spatiotemporal dynamics are critical for regeneration but many questions remain about its exact role. Here we show that MyD88 a key component of the innate immune response controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration. We find in cryoinjured myd88 / ventricles a significant reduction in neutrophil and macrophage numbers as well as the expansion of a collagen rich endocardial population. Further analyses reveal compromised PI3K/AKT pathway activation in the myd88 / endocardium and increased myofibroblasts and scarring. Notably endothelial specific overexpression of myd88 reverses these neutrophil fibrotic and scarring phenotypes. Mechanistically we identify the endocardial derived chemokine gene cxcl18b as a target of the MyD88 signaling pathway and using loss and gain of function tools show that it controls neutrophil recruitment. Altogether these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis during tissue regeneration. Overall design: RNA was isolated from myd88+/+ and myd88 / untouched ventricles and cryoinjured tissues at 1 and 24 hours post cryoinjury hpci and analyzed using bulk RNA sequencing | parent bioproject:PRJNA1090894 | pubmed:39271818 | ventricle myd88 / untouched 2 | GSM8159063 | source name:cardiac ventricles|tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88 / |treatment: |geo loc name:missing|collection date:missing | ventricle myd88 / untouched 2 | Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 99 with STAR 2.7.3a Dobin et al. STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 2.21.7 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. The raw count matrix was normalized with DESeq2 version 1.26.0 Love et al. Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2. Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count > 5 multiple testing adjusted p value < 0.05 and 0.585 < log2FC > 0.585. Gene counts were established with featureCounts 1.6.5 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The Ensemble annotation was enriched with UniProt data Activities at the Universal Protein Resource UniProt. Assembly: DanRer11 Supplementary files format and content: library normilzed counts | cardiac ventricles | untouched ventricles or cardiac cryoinjury at 1 or 24 hours prior to heart extraction | RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture’s protocol Vazyme. | tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88 / |treatment: | GSM8159063 | GSM8159063: ventricle myd88 / untouched 2; Danio rerio; RNA Seq | GSM8159063 r1 | GSM8159063 | 1 | RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture's protocol Vazyme. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP497025 | loader:fastq load.py | Pinelopi_Homo2_0h_pci_R1.fastq.gz | fastq | 2178164776.0 | 29313471.0 | GSM8159063 r1 | 0:74.31 | A:588370831;C:457110464;G:507924919;T:624586577;N:171985 | 74 | 588370831 | 457110464 | 507924919 | 624586577 | 171985 | SRX24015861 | SRS20810990 | SRA1830778 | MPI for heart and lung research | MPI for heart and lung research | B | usable mapping rate | illumina | nextseq_v2 | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | Germany | 2024-03-21 | Undetermined | Undetermined | Heart | Cardiovascular System | ||||||||||||||||||||||
| 31511 | 31511 | SRR28411471 | SRX24015860 | SRS20810989 | SRP497025 | PRJNA1090509 | The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst139 | GSE262169 | Transcriptome Analysis | The innate immune response is triggered xxx post injury and its spatiotemporal dynamics are critical for regeneration but many questions remain about its exact role. Here we show that MyD88 a key component of the innate immune response controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration. We find in cryoinjured myd88 / ventricles a significant reduction in neutrophil and macrophage numbers as well as the expansion of a collagen rich endocardial population. Further analyses reveal compromised PI3K/AKT pathway activation in the myd88 / endocardium and increased myofibroblasts and scarring. Notably endothelial specific overexpression of myd88 reverses these neutrophil fibrotic and scarring phenotypes. Mechanistically we identify the endocardial derived chemokine gene cxcl18b as a target of the MyD88 signaling pathway and using loss and gain of function tools show that it controls neutrophil recruitment. Altogether these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis during tissue regeneration. Overall design: RNA was isolated from myd88+/+ and myd88 / untouched ventricles and cryoinjured tissues at 1 and 24 hours post cryoinjury hpci and analyzed using bulk RNA sequencing | parent bioproject:PRJNA1090894 | pubmed:39271818 | injured tissue myd88 / 24 hpci 1 | GSM8159062 | source name:cardiac ventricles|tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88 / |treatment:cardiac cryoinjury|geo loc name:missing|collection date:missing | injured tissue myd88 / 24 hpci 1 | Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 99 with STAR 2.7.3a Dobin et al. STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 2.21.7 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. The raw count matrix was normalized with DESeq2 version 1.26.0 Love et al. Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2. Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count > 5 multiple testing adjusted p value < 0.05 and 0.585 < log2FC > 0.585. Gene counts were established with featureCounts 1.6.5 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The Ensemble annotation was enriched with UniProt data Activities at the Universal Protein Resource UniProt. Assembly: DanRer11 Supplementary files format and content: library normilzed counts | cardiac ventricles | untouched ventricles or cardiac cryoinjury at 1 or 24 hours prior to heart extraction | RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture’s protocol Vazyme. | tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88 / |treatment:cardiac cryoinjury | GSM8159062 | GSM8159062: injured tissue myd88 / 24 hpci 1; Danio rerio; RNA Seq | GSM8159062 r1 | GSM8159062 | 1 | RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture's protocol Vazyme. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP497025 | loader:fastq load.py | Pinelopi_Homo1_24h_pci_R1.fastq.gz | fastq | 2323298254.0 | 31332951.0 | GSM8159062 r1 | 0:74.15 | A:621931320;C:501998000;G:541224122;T:657957821;N:186991 | 74 | 621931320 | 501998000 | 541224122 | 657957821 | 186991 | SRX24015860 | SRS20810989 | SRA1830778 | MPI for heart and lung research | MPI for heart and lung research | B | usable mapping rate | illumina | nextseq_v2 | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | Germany | 2024-03-21 | Undetermined | Undetermined | Heart | Cardiovascular System | ||||||||||||||||||||||
| 31512 | 31512 | SRR28411472 | SRX24015859 | SRS20810988 | SRP497025 | PRJNA1090509 | The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst139 | GSE262169 | Transcriptome Analysis | The innate immune response is triggered xxx post injury and its spatiotemporal dynamics are critical for regeneration but many questions remain about its exact role. Here we show that MyD88 a key component of the innate immune response controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration. We find in cryoinjured myd88 / ventricles a significant reduction in neutrophil and macrophage numbers as well as the expansion of a collagen rich endocardial population. Further analyses reveal compromised PI3K/AKT pathway activation in the myd88 / endocardium and increased myofibroblasts and scarring. Notably endothelial specific overexpression of myd88 reverses these neutrophil fibrotic and scarring phenotypes. Mechanistically we identify the endocardial derived chemokine gene cxcl18b as a target of the MyD88 signaling pathway and using loss and gain of function tools show that it controls neutrophil recruitment. Altogether these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis during tissue regeneration. Overall design: RNA was isolated from myd88+/+ and myd88 / untouched ventricles and cryoinjured tissues at 1 and 24 hours post cryoinjury hpci and analyzed using bulk RNA sequencing | parent bioproject:PRJNA1090894 | pubmed:39271818 | injured tissue myd88 / 1 hpci 1 | GSM8159061 | source name:cardiac ventricles|tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88 / |treatment:cardiac cryoinjury|geo loc name:missing|collection date:missing | injured tissue myd88 / 1 hpci 1 | Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 99 with STAR 2.7.3a Dobin et al. STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 2.21.7 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. The raw count matrix was normalized with DESeq2 version 1.26.0 Love et al. Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2. Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count > 5 multiple testing adjusted p value < 0.05 and 0.585 < log2FC > 0.585. Gene counts were established with featureCounts 1.6.5 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The Ensemble annotation was enriched with UniProt data Activities at the Universal Protein Resource UniProt. Assembly: DanRer11 Supplementary files format and content: library normilzed counts | cardiac ventricles | untouched ventricles or cardiac cryoinjury at 1 or 24 hours prior to heart extraction | RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture’s protocol Vazyme. | tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88 / |treatment:cardiac cryoinjury | GSM8159061 | GSM8159061: injured tissue myd88 / 1 hpci 1; Danio rerio; RNA Seq | GSM8159061 r1 | GSM8159061 | 1 | RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture's protocol Vazyme. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP497025 | loader:fastq load.py | Pinelopi_Homo1_1h_pci_R1.fastq.gz | fastq | 2585736865.0 | 34790236.0 | GSM8159061 r1 | 0:74.32 | A:679380332;C:554919862;G:604907160;T:746451941;N:77570 | 74 | 679380332 | 554919862 | 604907160 | 746451941 | 77570 | SRX24015859 | SRS20810988 | SRA1830778 | MPI for heart and lung research | MPI for heart and lung research | B | usable mapping rate | illumina | nextseq_v2 | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | Germany | 2024-03-21 | Undetermined | Undetermined | Heart | Cardiovascular System | ||||||||||||||||||||||
| 31513 | 31513 | SRR28411473 | SRX24015858 | SRS20810987 | SRP497025 | PRJNA1090509 | The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst139 | GSE262169 | Transcriptome Analysis | The innate immune response is triggered xxx post injury and its spatiotemporal dynamics are critical for regeneration but many questions remain about its exact role. Here we show that MyD88 a key component of the innate immune response controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration. We find in cryoinjured myd88 / ventricles a significant reduction in neutrophil and macrophage numbers as well as the expansion of a collagen rich endocardial population. Further analyses reveal compromised PI3K/AKT pathway activation in the myd88 / endocardium and increased myofibroblasts and scarring. Notably endothelial specific overexpression of myd88 reverses these neutrophil fibrotic and scarring phenotypes. Mechanistically we identify the endocardial derived chemokine gene cxcl18b as a target of the MyD88 signaling pathway and using loss and gain of function tools show that it controls neutrophil recruitment. Altogether these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis during tissue regeneration. Overall design: RNA was isolated from myd88+/+ and myd88 / untouched ventricles and cryoinjured tissues at 1 and 24 hours post cryoinjury hpci and analyzed using bulk RNA sequencing | parent bioproject:PRJNA1090894 | pubmed:39271818 | ventricle myd88 / untouched 1 | GSM8159060 | source name:cardiac ventricles|tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88 / |treatment: |geo loc name:missing|collection date:missing | ventricle myd88 / untouched 1 | Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 99 with STAR 2.7.3a Dobin et al. STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 2.21.7 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. The raw count matrix was normalized with DESeq2 version 1.26.0 Love et al. Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2. Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count > 5 multiple testing adjusted p value < 0.05 and 0.585 < log2FC > 0.585. Gene counts were established with featureCounts 1.6.5 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The Ensemble annotation was enriched with UniProt data Activities at the Universal Protein Resource UniProt. Assembly: DanRer11 Supplementary files format and content: library normilzed counts | cardiac ventricles | untouched ventricles or cardiac cryoinjury at 1 or 24 hours prior to heart extraction | RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture’s protocol Vazyme. | tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88 / |treatment: | GSM8159060 | GSM8159060: ventricle myd88 / untouched 1; Danio rerio; RNA Seq | GSM8159060 r1 | GSM8159060 | 1 | RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture's protocol Vazyme. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP497025 | loader:fastq load.py | Pinelopi_Homo1_0h_pci_R1.fastq.gz | fastq | 2321007700.0 | 31228476.0 | GSM8159060 r1 | 0:74.32 | A:623574024;C:490503071;G:538918126;T:667825381;N:187098 | 74 | 623574024 | 490503071 | 538918126 | 667825381 | 187098 | SRX24015858 | SRS20810987 | SRA1830778 | MPI for heart and lung research | MPI for heart and lung research | B | usable mapping rate | illumina | nextseq_v2 | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | Germany | 2024-03-21 | Undetermined | Undetermined | Heart | Cardiovascular System | ||||||||||||||||||||||
| 33706 | 33706 | SRR30621736 | SRX26043972 | SRS22614948 | SRP531880 | PRJNA1159283 | Nr4a1 Modulates Inflammation and Heart Regeneration in Zebrafish | GSE276850 | Transcriptome Analysis | Recent findings have highlighted the complex role of inflammation in zebrafish heart regeneration demonstrating that while inflammation is essential for initiating transient fibrosis and tissue repair chronic inflammation and unresolved fibrosis could impede full regenerative recovery. In this study we identified the nuclear receptor Nr4a1 as a critical regulator of this regenerative process in zebrafish. Loss of Nr4a1 function led to a prolonged and excessive inflammatory response disrupted neutrophil migration delayed fibrin clearance and ultimately impaired heart regeneration. Transcriptome wide RNA seq analysis at different injury stages revealed molecular disruptions associated with dysregulated inflammation and fibrosis in Nr4a1 mutants. Notably partial inhibition of the pro inflammatory cytokine Tnf a rescued heart regeneration in the nr4a1 mutants highlighting the therapeutic potential of modulating inflammation. Our findings suggest that Nr4a1 plays a crucial role in orchestrating the immune response during heart regeneration and may serve as a valuable target for enhancing cardiac repair following injury. Overall design: To elucidate the molecular basis of the phenotypes observed in the nr4a1 mutant we performed transcriptome wide bulk RNA sequencing on the ventricles from both control and mutant hearts at several key time points. Baseline transcriptomic profiles were established from uninjured hearts to compare the cardiac transcriptomics of the wildtype control and nr4a1 mutant. Given the critical involvement of inflammation in heart regeneration samples were also collected at 2 and 7 dpci corresponding to stages marked by an active inflammatory response. Moreover to elucidate the prolonged fibrosis phenotype in the late injury stage we performed transcriptomic analysis on hearts collected at 21 dpci. | wild type 21 dpi sample 2 | GSM8506783 | source name:Heart ventricle|tissue:Heart ventricle|genotype:wild type|geo loc name:missing|collection date:missing | wild type 21 dpi sample 2 | RNA seq raw data quality was checked by FastQC https://www.bioinformatics.babraham.ac.uk/projects/fastqc/. RNA seq were aligned to the zebrafish reference genome using STARDobin et al. 2013. Gene expression was quantified as gene hit counts reads per gene using FeatureCountsLiao et al. 2014. Assembly: Danio rerio zebrafish genome assembly GRCz11 danRer11 Supplementary files format and content: txt data file include raw counts for each sample | Heart ventricle | Total RNA was isolated from zebrafish ventricles using Trizol Invitrogen. Reverse transcription was performed using SuperScript IV VILO Master Mix Invitrogen. For RNA seq library preparation and Illumina RNA seq were performed by Novogene. | tissue:Heart ventricle|genotype:wild type | GSM8506783 | GSM8506783: wild type 21 dpi sample 2; Danio rerio; RNA Seq | GSM8506783 r1 | GSM8506783 | 1 | Total RNA was isolated from zebrafish ventricles using Trizol Invitrogen. Reverse transcription was performed using SuperScript IV VILO Master Mix Invitrogen. For RNA seq library preparation and Illumina RNA seq were performed by Novogene. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq X Plus | SRP531880 | wt_21dpi_2_1.fq.gz wt_21dpi_2_2.fq.gz | fastq fastq | 7641378600.0 | 25471262.0 | GSM8506783 r1 | 0:150 1:150 | A:2079206538;C:1754420100;G:1752583773;T:2055108610;N:59579 | 150 | 150 | 2079206538 | 1754420100 | 1752583773 | 2055108610 | 59579 | SRX26043972 | SRS22614948 | SRA1968119 | The University of North Carolina | The University of North Carolina | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | United States | 2024-09-10 | Undetermined | Undetermined | Heart | Cardiovascular System | ||||||||||||||||||||||||
| 33707 | 33707 | SRR30621737 | SRX26043971 | SRS22614947 | SRP531880 | PRJNA1159283 | Nr4a1 Modulates Inflammation and Heart Regeneration in Zebrafish | GSE276850 | Transcriptome Analysis | Recent findings have highlighted the complex role of inflammation in zebrafish heart regeneration demonstrating that while inflammation is essential for initiating transient fibrosis and tissue repair chronic inflammation and unresolved fibrosis could impede full regenerative recovery. In this study we identified the nuclear receptor Nr4a1 as a critical regulator of this regenerative process in zebrafish. Loss of Nr4a1 function led to a prolonged and excessive inflammatory response disrupted neutrophil migration delayed fibrin clearance and ultimately impaired heart regeneration. Transcriptome wide RNA seq analysis at different injury stages revealed molecular disruptions associated with dysregulated inflammation and fibrosis in Nr4a1 mutants. Notably partial inhibition of the pro inflammatory cytokine Tnf a rescued heart regeneration in the nr4a1 mutants highlighting the therapeutic potential of modulating inflammation. Our findings suggest that Nr4a1 plays a crucial role in orchestrating the immune response during heart regeneration and may serve as a valuable target for enhancing cardiac repair following injury. Overall design: To elucidate the molecular basis of the phenotypes observed in the nr4a1 mutant we performed transcriptome wide bulk RNA sequencing on the ventricles from both control and mutant hearts at several key time points. Baseline transcriptomic profiles were established from uninjured hearts to compare the cardiac transcriptomics of the wildtype control and nr4a1 mutant. Given the critical involvement of inflammation in heart regeneration samples were also collected at 2 and 7 dpci corresponding to stages marked by an active inflammatory response. Moreover to elucidate the prolonged fibrosis phenotype in the late injury stage we performed transcriptomic analysis on hearts collected at 21 dpci. | wild type 21 dpi sample 1 | GSM8506782 | source name:Heart ventricle|tissue:Heart ventricle|genotype:wild type|geo loc name:missing|collection date:missing | wild type 21 dpi sample 1 | RNA seq raw data quality was checked by FastQC https://www.bioinformatics.babraham.ac.uk/projects/fastqc/. RNA seq were aligned to the zebrafish reference genome using STARDobin et al. 2013. Gene expression was quantified as gene hit counts reads per gene using FeatureCountsLiao et al. 2014. Assembly: Danio rerio zebrafish genome assembly GRCz11 danRer11 Supplementary files format and content: txt data file include raw counts for each sample | Heart ventricle | Total RNA was isolated from zebrafish ventricles using Trizol Invitrogen. Reverse transcription was performed using SuperScript IV VILO Master Mix Invitrogen. For RNA seq library preparation and Illumina RNA seq were performed by Novogene. | tissue:Heart ventricle|genotype:wild type | GSM8506782 | GSM8506782: wild type 21 dpi sample 1; Danio rerio; RNA Seq | GSM8506782 r1 | GSM8506782 | 1 | Total RNA was isolated from zebrafish ventricles using Trizol Invitrogen. Reverse transcription was performed using SuperScript IV VILO Master Mix Invitrogen. For RNA seq library preparation and Illumina RNA seq were performed by Novogene. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq X Plus | SRP531880 | wt_21dpi_1_1.fq.gz wt_21dpi_1_2.fq.gz | fastq fastq | 8663480400.0 | 28878268.0 | GSM8506782 r1 | 0:150 1:150 | A:2358947065;C:1986782909;G:1985349061;T:2332333991;N:67374 | 150 | 150 | 2358947065 | 1986782909 | 1985349061 | 2332333991 | 67374 | SRX26043971 | SRS22614947 | SRA1968119 | The University of North Carolina | The University of North Carolina | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | United States | 2024-09-10 | Undetermined | Undetermined | Heart | Cardiovascular System | ||||||||||||||||||||||||
| 33708 | 33708 | SRR30621738 | SRX26043970 | SRS22614946 | SRP531880 | PRJNA1159283 | Nr4a1 Modulates Inflammation and Heart Regeneration in Zebrafish | GSE276850 | Transcriptome Analysis | Recent findings have highlighted the complex role of inflammation in zebrafish heart regeneration demonstrating that while inflammation is essential for initiating transient fibrosis and tissue repair chronic inflammation and unresolved fibrosis could impede full regenerative recovery. In this study we identified the nuclear receptor Nr4a1 as a critical regulator of this regenerative process in zebrafish. Loss of Nr4a1 function led to a prolonged and excessive inflammatory response disrupted neutrophil migration delayed fibrin clearance and ultimately impaired heart regeneration. Transcriptome wide RNA seq analysis at different injury stages revealed molecular disruptions associated with dysregulated inflammation and fibrosis in Nr4a1 mutants. Notably partial inhibition of the pro inflammatory cytokine Tnf a rescued heart regeneration in the nr4a1 mutants highlighting the therapeutic potential of modulating inflammation. Our findings suggest that Nr4a1 plays a crucial role in orchestrating the immune response during heart regeneration and may serve as a valuable target for enhancing cardiac repair following injury. Overall design: To elucidate the molecular basis of the phenotypes observed in the nr4a1 mutant we performed transcriptome wide bulk RNA sequencing on the ventricles from both control and mutant hearts at several key time points. Baseline transcriptomic profiles were established from uninjured hearts to compare the cardiac transcriptomics of the wildtype control and nr4a1 mutant. Given the critical involvement of inflammation in heart regeneration samples were also collected at 2 and 7 dpci corresponding to stages marked by an active inflammatory response. Moreover to elucidate the prolonged fibrosis phenotype in the late injury stage we performed transcriptomic analysis on hearts collected at 21 dpci. | wild type 7 dpi sample 2 | GSM8506781 | source name:Heart ventricle|tissue:Heart ventricle|genotype:wild type|geo loc name:missing|collection date:missing | wild type 7 dpi sample 2 | RNA seq raw data quality was checked by FastQC https://www.bioinformatics.babraham.ac.uk/projects/fastqc/. RNA seq were aligned to the zebrafish reference genome using STARDobin et al. 2013. Gene expression was quantified as gene hit counts reads per gene using FeatureCountsLiao et al. 2014. Assembly: Danio rerio zebrafish genome assembly GRCz11 danRer11 Supplementary files format and content: txt data file include raw counts for each sample | Heart ventricle | Total RNA was isolated from zebrafish ventricles using Trizol Invitrogen. Reverse transcription was performed using SuperScript IV VILO Master Mix Invitrogen. For RNA seq library preparation and Illumina RNA seq were performed by Novogene. | tissue:Heart ventricle|genotype:wild type | GSM8506781 | GSM8506781: wild type 7 dpi sample 2; Danio rerio; RNA Seq | GSM8506781 r1 | GSM8506781 | 1 | Total RNA was isolated from zebrafish ventricles using Trizol Invitrogen. Reverse transcription was performed using SuperScript IV VILO Master Mix Invitrogen. For RNA seq library preparation and Illumina RNA seq were performed by Novogene. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq X Plus | SRP531880 | wt_7dpi_2_1.fq.gz wt_7dpi_2_2.fq.gz | fastq fastq | 8414243254.0 | 28200981.0 | GSM8506781 r1 | 0:149.18 1:149.19 | A:2273220495;C:1952762066;G:1928310101;T:2259829448;N:121144 | 149 | 149 | 2273220495 | 1952762066 | 1928310101 | 2259829448 | 121144 | SRX26043970 | SRS22614946 | SRA1968119 | The University of North Carolina | The University of North Carolina | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | United States | 2024-09-10 | Undetermined | Undetermined | Heart | Cardiovascular System | ||||||||||||||||||||||||
| 33709 | 33709 | SRR30621739 | SRX26043969 | SRS22614945 | SRP531880 | PRJNA1159283 | Nr4a1 Modulates Inflammation and Heart Regeneration in Zebrafish | GSE276850 | Transcriptome Analysis | Recent findings have highlighted the complex role of inflammation in zebrafish heart regeneration demonstrating that while inflammation is essential for initiating transient fibrosis and tissue repair chronic inflammation and unresolved fibrosis could impede full regenerative recovery. In this study we identified the nuclear receptor Nr4a1 as a critical regulator of this regenerative process in zebrafish. Loss of Nr4a1 function led to a prolonged and excessive inflammatory response disrupted neutrophil migration delayed fibrin clearance and ultimately impaired heart regeneration. Transcriptome wide RNA seq analysis at different injury stages revealed molecular disruptions associated with dysregulated inflammation and fibrosis in Nr4a1 mutants. Notably partial inhibition of the pro inflammatory cytokine Tnf a rescued heart regeneration in the nr4a1 mutants highlighting the therapeutic potential of modulating inflammation. Our findings suggest that Nr4a1 plays a crucial role in orchestrating the immune response during heart regeneration and may serve as a valuable target for enhancing cardiac repair following injury. Overall design: To elucidate the molecular basis of the phenotypes observed in the nr4a1 mutant we performed transcriptome wide bulk RNA sequencing on the ventricles from both control and mutant hearts at several key time points. Baseline transcriptomic profiles were established from uninjured hearts to compare the cardiac transcriptomics of the wildtype control and nr4a1 mutant. Given the critical involvement of inflammation in heart regeneration samples were also collected at 2 and 7 dpci corresponding to stages marked by an active inflammatory response. Moreover to elucidate the prolonged fibrosis phenotype in the late injury stage we performed transcriptomic analysis on hearts collected at 21 dpci. | wild type 7 dpi sample 1 | GSM8506780 | source name:Heart ventricle|tissue:Heart ventricle|genotype:wild type|geo loc name:missing|collection date:missing | wild type 7 dpi sample 1 | RNA seq raw data quality was checked by FastQC https://www.bioinformatics.babraham.ac.uk/projects/fastqc/. RNA seq were aligned to the zebrafish reference genome using STARDobin et al. 2013. Gene expression was quantified as gene hit counts reads per gene using FeatureCountsLiao et al. 2014. Assembly: Danio rerio zebrafish genome assembly GRCz11 danRer11 Supplementary files format and content: txt data file include raw counts for each sample | Heart ventricle | Total RNA was isolated from zebrafish ventricles using Trizol Invitrogen. Reverse transcription was performed using SuperScript IV VILO Master Mix Invitrogen. For RNA seq library preparation and Illumina RNA seq were performed by Novogene. | tissue:Heart ventricle|genotype:wild type | GSM8506780 | GSM8506780: wild type 7 dpi sample 1; Danio rerio; RNA Seq | GSM8506780 r1 | GSM8506780 | 1 | Total RNA was isolated from zebrafish ventricles using Trizol Invitrogen. Reverse transcription was performed using SuperScript IV VILO Master Mix Invitrogen. For RNA seq library preparation and Illumina RNA seq were performed by Novogene. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq X Plus | SRP531880 | wt_7dpi_1_1.fq.gz wt_7dpi_1_2.fq.gz | fastq fastq | 6047075346.0 | 20278990.0 | GSM8506780 r1 | 0:149.09 1:149.10 | A:1633289750;C:1403959505;G:1385683308;T:1624058844;N:83939 | 149 | 149 | 1633289750 | 1403959505 | 1385683308 | 1624058844 | 83939 | SRX26043969 | SRS22614945 | SRA1968119 | The University of North Carolina | The University of North Carolina | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | United States | 2024-09-10 | Undetermined | Undetermined | Heart | Cardiovascular System | ||||||||||||||||||||||||
| 33710 | 33710 | SRR30621740 | SRX26043968 | SRS22614944 | SRP531880 | PRJNA1159283 | Nr4a1 Modulates Inflammation and Heart Regeneration in Zebrafish | GSE276850 | Transcriptome Analysis | Recent findings have highlighted the complex role of inflammation in zebrafish heart regeneration demonstrating that while inflammation is essential for initiating transient fibrosis and tissue repair chronic inflammation and unresolved fibrosis could impede full regenerative recovery. In this study we identified the nuclear receptor Nr4a1 as a critical regulator of this regenerative process in zebrafish. Loss of Nr4a1 function led to a prolonged and excessive inflammatory response disrupted neutrophil migration delayed fibrin clearance and ultimately impaired heart regeneration. Transcriptome wide RNA seq analysis at different injury stages revealed molecular disruptions associated with dysregulated inflammation and fibrosis in Nr4a1 mutants. Notably partial inhibition of the pro inflammatory cytokine Tnf a rescued heart regeneration in the nr4a1 mutants highlighting the therapeutic potential of modulating inflammation. Our findings suggest that Nr4a1 plays a crucial role in orchestrating the immune response during heart regeneration and may serve as a valuable target for enhancing cardiac repair following injury. Overall design: To elucidate the molecular basis of the phenotypes observed in the nr4a1 mutant we performed transcriptome wide bulk RNA sequencing on the ventricles from both control and mutant hearts at several key time points. Baseline transcriptomic profiles were established from uninjured hearts to compare the cardiac transcriptomics of the wildtype control and nr4a1 mutant. Given the critical involvement of inflammation in heart regeneration samples were also collected at 2 and 7 dpci corresponding to stages marked by an active inflammatory response. Moreover to elucidate the prolonged fibrosis phenotype in the late injury stage we performed transcriptomic analysis on hearts collected at 21 dpci. | wild type 2 dpi sample 2 | GSM8506779 | source name:Heart ventricle|tissue:Heart ventricle|genotype:wild type|geo loc name:missing|collection date:missing | wild type 2 dpi sample 2 | RNA seq raw data quality was checked by FastQC https://www.bioinformatics.babraham.ac.uk/projects/fastqc/. RNA seq were aligned to the zebrafish reference genome using STARDobin et al. 2013. Gene expression was quantified as gene hit counts reads per gene using FeatureCountsLiao et al. 2014. Assembly: Danio rerio zebrafish genome assembly GRCz11 danRer11 Supplementary files format and content: txt data file include raw counts for each sample | Heart ventricle | Total RNA was isolated from zebrafish ventricles using Trizol Invitrogen. Reverse transcription was performed using SuperScript IV VILO Master Mix Invitrogen. For RNA seq library preparation and Illumina RNA seq were performed by Novogene. | tissue:Heart ventricle|genotype:wild type | GSM8506779 | GSM8506779: wild type 2 dpi sample 2; Danio rerio; RNA Seq | GSM8506779 r1 | GSM8506779 | 1 | Total RNA was isolated from zebrafish ventricles using Trizol Invitrogen. Reverse transcription was performed using SuperScript IV VILO Master Mix Invitrogen. For RNA seq library preparation and Illumina RNA seq were performed by Novogene. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq X Plus | SRP531880 | wt_2dpi_2_1.fq.gz wt_2dpi_2_2.fq.gz | fastq fastq | 6501507640.0 | 21847961.0 | GSM8506779 r1 | 0:148.79 1:148.79 | A:1751063874;C:1515880337;G:1494689364;T:1739782712;N:91353 | 148 | 148 | 1751063874 | 1515880337 | 1494689364 | 1739782712 | 91353 | SRX26043968 | SRS22614944 | SRA1968119 | The University of North Carolina | The University of North Carolina | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | United States | 2024-09-10 | Undetermined | Undetermined | Heart | Cardiovascular System | ||||||||||||||||||||||||
| 33711 | 33711 | SRR30621741 | SRX26043967 | SRS22614943 | SRP531880 | PRJNA1159283 | Nr4a1 Modulates Inflammation and Heart Regeneration in Zebrafish | GSE276850 | Transcriptome Analysis | Recent findings have highlighted the complex role of inflammation in zebrafish heart regeneration demonstrating that while inflammation is essential for initiating transient fibrosis and tissue repair chronic inflammation and unresolved fibrosis could impede full regenerative recovery. In this study we identified the nuclear receptor Nr4a1 as a critical regulator of this regenerative process in zebrafish. Loss of Nr4a1 function led to a prolonged and excessive inflammatory response disrupted neutrophil migration delayed fibrin clearance and ultimately impaired heart regeneration. Transcriptome wide RNA seq analysis at different injury stages revealed molecular disruptions associated with dysregulated inflammation and fibrosis in Nr4a1 mutants. Notably partial inhibition of the pro inflammatory cytokine Tnf a rescued heart regeneration in the nr4a1 mutants highlighting the therapeutic potential of modulating inflammation. Our findings suggest that Nr4a1 plays a crucial role in orchestrating the immune response during heart regeneration and may serve as a valuable target for enhancing cardiac repair following injury. Overall design: To elucidate the molecular basis of the phenotypes observed in the nr4a1 mutant we performed transcriptome wide bulk RNA sequencing on the ventricles from both control and mutant hearts at several key time points. Baseline transcriptomic profiles were established from uninjured hearts to compare the cardiac transcriptomics of the wildtype control and nr4a1 mutant. Given the critical involvement of inflammation in heart regeneration samples were also collected at 2 and 7 dpci corresponding to stages marked by an active inflammatory response. Moreover to elucidate the prolonged fibrosis phenotype in the late injury stage we performed transcriptomic analysis on hearts collected at 21 dpci. | wild type 2 dpi sample 1 | GSM8506778 | source name:Heart ventricle|tissue:Heart ventricle|genotype:wild type|geo loc name:missing|collection date:missing | wild type 2 dpi sample 1 | RNA seq raw data quality was checked by FastQC https://www.bioinformatics.babraham.ac.uk/projects/fastqc/. RNA seq were aligned to the zebrafish reference genome using STARDobin et al. 2013. Gene expression was quantified as gene hit counts reads per gene using FeatureCountsLiao et al. 2014. Assembly: Danio rerio zebrafish genome assembly GRCz11 danRer11 Supplementary files format and content: txt data file include raw counts for each sample | Heart ventricle | Total RNA was isolated from zebrafish ventricles using Trizol Invitrogen. Reverse transcription was performed using SuperScript IV VILO Master Mix Invitrogen. For RNA seq library preparation and Illumina RNA seq were performed by Novogene. | tissue:Heart ventricle|genotype:wild type | GSM8506778 | GSM8506778: wild type 2 dpi sample 1; Danio rerio; RNA Seq | GSM8506778 r1 | GSM8506778 | 1 | Total RNA was isolated from zebrafish ventricles using Trizol Invitrogen. Reverse transcription was performed using SuperScript IV VILO Master Mix Invitrogen. For RNA seq library preparation and Illumina RNA seq were performed by Novogene. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq X Plus | SRP531880 | wt_2dpi_1_1.fq.gz wt_2dpi_1_2.fq.gz | fastq fastq | 6367687936.0 | 21382594.0 | GSM8506778 r1 | 0:148.89 1:148.90 | A:1717644272;C:1482451492;G:1461128189;T:1706373727;N:90256 | 148 | 148 | 1717644272 | 1482451492 | 1461128189 | 1706373727 | 90256 | SRX26043967 | SRS22614943 | SRA1968119 | The University of North Carolina | The University of North Carolina | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | United States | 2024-09-10 | Undetermined | Undetermined | Heart | Cardiovascular System | ||||||||||||||||||||||||
| 33712 | 33712 | SRR30621742 | SRX26043966 | SRS22614942 | SRP531880 | PRJNA1159283 | Nr4a1 Modulates Inflammation and Heart Regeneration in Zebrafish | GSE276850 | Transcriptome Analysis | Recent findings have highlighted the complex role of inflammation in zebrafish heart regeneration demonstrating that while inflammation is essential for initiating transient fibrosis and tissue repair chronic inflammation and unresolved fibrosis could impede full regenerative recovery. In this study we identified the nuclear receptor Nr4a1 as a critical regulator of this regenerative process in zebrafish. Loss of Nr4a1 function led to a prolonged and excessive inflammatory response disrupted neutrophil migration delayed fibrin clearance and ultimately impaired heart regeneration. Transcriptome wide RNA seq analysis at different injury stages revealed molecular disruptions associated with dysregulated inflammation and fibrosis in Nr4a1 mutants. Notably partial inhibition of the pro inflammatory cytokine Tnf a rescued heart regeneration in the nr4a1 mutants highlighting the therapeutic potential of modulating inflammation. Our findings suggest that Nr4a1 plays a crucial role in orchestrating the immune response during heart regeneration and may serve as a valuable target for enhancing cardiac repair following injury. Overall design: To elucidate the molecular basis of the phenotypes observed in the nr4a1 mutant we performed transcriptome wide bulk RNA sequencing on the ventricles from both control and mutant hearts at several key time points. Baseline transcriptomic profiles were established from uninjured hearts to compare the cardiac transcriptomics of the wildtype control and nr4a1 mutant. Given the critical involvement of inflammation in heart regeneration samples were also collected at 2 and 7 dpci corresponding to stages marked by an active inflammatory response. Moreover to elucidate the prolonged fibrosis phenotype in the late injury stage we performed transcriptomic analysis on hearts collected at 21 dpci. | wild type 0 dpi sample 2 | GSM8506777 | source name:Heart ventricle|tissue:Heart ventricle|genotype:wild type|geo loc name:missing|collection date:missing | wild type 0 dpi sample 2 | RNA seq raw data quality was checked by FastQC https://www.bioinformatics.babraham.ac.uk/projects/fastqc/. RNA seq were aligned to the zebrafish reference genome using STARDobin et al. 2013. Gene expression was quantified as gene hit counts reads per gene using FeatureCountsLiao et al. 2014. Assembly: Danio rerio zebrafish genome assembly GRCz11 danRer11 Supplementary files format and content: txt data file include raw counts for each sample | Heart ventricle | Total RNA was isolated from zebrafish ventricles using Trizol Invitrogen. Reverse transcription was performed using SuperScript IV VILO Master Mix Invitrogen. For RNA seq library preparation and Illumina RNA seq were performed by Novogene. | tissue:Heart ventricle|genotype:wild type | GSM8506777 | GSM8506777: wild type 0 dpi sample 2; Danio rerio; RNA Seq | GSM8506777 r1 | GSM8506777 | 1 | Total RNA was isolated from zebrafish ventricles using Trizol Invitrogen. Reverse transcription was performed using SuperScript IV VILO Master Mix Invitrogen. For RNA seq library preparation and Illumina RNA seq were performed by Novogene. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq X Plus | SRP531880 | wt_0dpi_2_1.fq.gz wt_0dpi_2_2.fq.gz | fastq fastq | 10558249200.0 | 35194164.0 | GSM8506777 r1 | 0:150 1:150 | A:2893792627;C:2407838089;G:2396125046;T:2860411622;N:81816 | 150 | 150 | 2893792627 | 2407838089 | 2396125046 | 2860411622 | 81816 | SRX26043966 | SRS22614942 | SRA1968119 | The University of North Carolina | The University of North Carolina | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | United States | 2024-09-10 | Undetermined | Undetermined | Heart | Cardiovascular System | ||||||||||||||||||||||||
| 33713 | 33713 | SRR30621743 | SRX26043965 | SRS22614941 | SRP531880 | PRJNA1159283 | Nr4a1 Modulates Inflammation and Heart Regeneration in Zebrafish | GSE276850 | Transcriptome Analysis | Recent findings have highlighted the complex role of inflammation in zebrafish heart regeneration demonstrating that while inflammation is essential for initiating transient fibrosis and tissue repair chronic inflammation and unresolved fibrosis could impede full regenerative recovery. In this study we identified the nuclear receptor Nr4a1 as a critical regulator of this regenerative process in zebrafish. Loss of Nr4a1 function led to a prolonged and excessive inflammatory response disrupted neutrophil migration delayed fibrin clearance and ultimately impaired heart regeneration. Transcriptome wide RNA seq analysis at different injury stages revealed molecular disruptions associated with dysregulated inflammation and fibrosis in Nr4a1 mutants. Notably partial inhibition of the pro inflammatory cytokine Tnf a rescued heart regeneration in the nr4a1 mutants highlighting the therapeutic potential of modulating inflammation. Our findings suggest that Nr4a1 plays a crucial role in orchestrating the immune response during heart regeneration and may serve as a valuable target for enhancing cardiac repair following injury. Overall design: To elucidate the molecular basis of the phenotypes observed in the nr4a1 mutant we performed transcriptome wide bulk RNA sequencing on the ventricles from both control and mutant hearts at several key time points. Baseline transcriptomic profiles were established from uninjured hearts to compare the cardiac transcriptomics of the wildtype control and nr4a1 mutant. Given the critical involvement of inflammation in heart regeneration samples were also collected at 2 and 7 dpci corresponding to stages marked by an active inflammatory response. Moreover to elucidate the prolonged fibrosis phenotype in the late injury stage we performed transcriptomic analysis on hearts collected at 21 dpci. | wild type 0 dpi sample 1 | GSM8506776 | source name:Heart ventricle|tissue:Heart ventricle|genotype:wild type|geo loc name:missing|collection date:missing | wild type 0 dpi sample 1 | RNA seq raw data quality was checked by FastQC https://www.bioinformatics.babraham.ac.uk/projects/fastqc/. RNA seq were aligned to the zebrafish reference genome using STARDobin et al. 2013. Gene expression was quantified as gene hit counts reads per gene using FeatureCountsLiao et al. 2014. Assembly: Danio rerio zebrafish genome assembly GRCz11 danRer11 Supplementary files format and content: txt data file include raw counts for each sample | Heart ventricle | Total RNA was isolated from zebrafish ventricles using Trizol Invitrogen. Reverse transcription was performed using SuperScript IV VILO Master Mix Invitrogen. For RNA seq library preparation and Illumina RNA seq were performed by Novogene. | tissue:Heart ventricle|genotype:wild type | GSM8506776 | GSM8506776: wild type 0 dpi sample 1; Danio rerio; RNA Seq | GSM8506776 r1 | GSM8506776 | 1 | Total RNA was isolated from zebrafish ventricles using Trizol Invitrogen. Reverse transcription was performed using SuperScript IV VILO Master Mix Invitrogen. For RNA seq library preparation and Illumina RNA seq were performed by Novogene. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq X Plus | SRP531880 | wt_0dpi_1_1.fq.gz wt_0dpi_1_2.fq.gz | fastq fastq | 10931466600.0 | 36438222.0 | GSM8506776 r1 | 0:150 1:150 | A:2980386716;C:2504687323;G:2500279931;T:2946028049;N:84581 | 150 | 150 | 2980386716 | 2504687323 | 2500279931 | 2946028049 | 84581 | SRX26043965 | SRS22614941 | SRA1968119 | The University of North Carolina | The University of North Carolina | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | United States | 2024-09-10 | Undetermined | Undetermined | Heart | Cardiovascular System | ||||||||||||||||||||||||
| 33714 | 33714 | SRR30621744 | SRX26043964 | SRS22614940 | SRP531880 | PRJNA1159283 | Nr4a1 Modulates Inflammation and Heart Regeneration in Zebrafish | GSE276850 | Transcriptome Analysis | Recent findings have highlighted the complex role of inflammation in zebrafish heart regeneration demonstrating that while inflammation is essential for initiating transient fibrosis and tissue repair chronic inflammation and unresolved fibrosis could impede full regenerative recovery. In this study we identified the nuclear receptor Nr4a1 as a critical regulator of this regenerative process in zebrafish. Loss of Nr4a1 function led to a prolonged and excessive inflammatory response disrupted neutrophil migration delayed fibrin clearance and ultimately impaired heart regeneration. Transcriptome wide RNA seq analysis at different injury stages revealed molecular disruptions associated with dysregulated inflammation and fibrosis in Nr4a1 mutants. Notably partial inhibition of the pro inflammatory cytokine Tnf a rescued heart regeneration in the nr4a1 mutants highlighting the therapeutic potential of modulating inflammation. Our findings suggest that Nr4a1 plays a crucial role in orchestrating the immune response during heart regeneration and may serve as a valuable target for enhancing cardiac repair following injury. Overall design: To elucidate the molecular basis of the phenotypes observed in the nr4a1 mutant we performed transcriptome wide bulk RNA sequencing on the ventricles from both control and mutant hearts at several key time points. Baseline transcriptomic profiles were established from uninjured hearts to compare the cardiac transcriptomics of the wildtype control and nr4a1 mutant. Given the critical involvement of inflammation in heart regeneration samples were also collected at 2 and 7 dpci corresponding to stages marked by an active inflammatory response. Moreover to elucidate the prolonged fibrosis phenotype in the late injury stage we performed transcriptomic analysis on hearts collected at 21 dpci. | nr4a1 mutant 21 dpi sample 2 | GSM8506775 | source name:Heart ventricle|tissue:Heart ventricle|genotype:nr4a1 mutant|geo loc name:missing|collection date:missing | nr4a1 mutant 21 dpi sample 2 | RNA seq raw data quality was checked by FastQC https://www.bioinformatics.babraham.ac.uk/projects/fastqc/. RNA seq were aligned to the zebrafish reference genome using STARDobin et al. 2013. Gene expression was quantified as gene hit counts reads per gene using FeatureCountsLiao et al. 2014. Assembly: Danio rerio zebrafish genome assembly GRCz11 danRer11 Supplementary files format and content: txt data file include raw counts for each sample | Heart ventricle | Total RNA was isolated from zebrafish ventricles using Trizol Invitrogen. Reverse transcription was performed using SuperScript IV VILO Master Mix Invitrogen. For RNA seq library preparation and Illumina RNA seq were performed by Novogene. | tissue:Heart ventricle|genotype:nr4a1 mutant | GSM8506775 | GSM8506775: nr4a1 mutant 21 dpi sample 2; Danio rerio; RNA Seq | GSM8506775 r1 | GSM8506775 | 1 | Total RNA was isolated from zebrafish ventricles using Trizol Invitrogen. Reverse transcription was performed using SuperScript IV VILO Master Mix Invitrogen. For RNA seq library preparation and Illumina RNA seq were performed by Novogene. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq X Plus | SRP531880 | nr4a1_21_2_1.fq.gz nr4a1_21_2_2.fq.gz | fastq fastq | 8089743600.0 | 26965812.0 | GSM8506775 r1 | 0:150 1:150 | A:2204157080;C:1856260728;G:1849823127;T:2179439591;N:63074 | 150 | 150 | 2204157080 | 1856260728 | 1849823127 | 2179439591 | 63074 | SRX26043964 | SRS22614940 | SRA1968119 | The University of North Carolina | The University of North Carolina | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | United States | 2024-09-10 | Undetermined | Undetermined | Heart | Cardiovascular System | ||||||||||||||||||||||||
| 33715 | 33715 | SRR30621745 | SRX26043963 | SRS22614939 | SRP531880 | PRJNA1159283 | Nr4a1 Modulates Inflammation and Heart Regeneration in Zebrafish | GSE276850 | Transcriptome Analysis | Recent findings have highlighted the complex role of inflammation in zebrafish heart regeneration demonstrating that while inflammation is essential for initiating transient fibrosis and tissue repair chronic inflammation and unresolved fibrosis could impede full regenerative recovery. In this study we identified the nuclear receptor Nr4a1 as a critical regulator of this regenerative process in zebrafish. Loss of Nr4a1 function led to a prolonged and excessive inflammatory response disrupted neutrophil migration delayed fibrin clearance and ultimately impaired heart regeneration. Transcriptome wide RNA seq analysis at different injury stages revealed molecular disruptions associated with dysregulated inflammation and fibrosis in Nr4a1 mutants. Notably partial inhibition of the pro inflammatory cytokine Tnf a rescued heart regeneration in the nr4a1 mutants highlighting the therapeutic potential of modulating inflammation. Our findings suggest that Nr4a1 plays a crucial role in orchestrating the immune response during heart regeneration and may serve as a valuable target for enhancing cardiac repair following injury. Overall design: To elucidate the molecular basis of the phenotypes observed in the nr4a1 mutant we performed transcriptome wide bulk RNA sequencing on the ventricles from both control and mutant hearts at several key time points. Baseline transcriptomic profiles were established from uninjured hearts to compare the cardiac transcriptomics of the wildtype control and nr4a1 mutant. Given the critical involvement of inflammation in heart regeneration samples were also collected at 2 and 7 dpci corresponding to stages marked by an active inflammatory response. Moreover to elucidate the prolonged fibrosis phenotype in the late injury stage we performed transcriptomic analysis on hearts collected at 21 dpci. | nr4a1 mutant 21 dpi sample 1 | GSM8506774 | source name:Heart ventricle|tissue:Heart ventricle|genotype:nr4a1 mutant|geo loc name:missing|collection date:missing | nr4a1 mutant 21 dpi sample 1 | RNA seq raw data quality was checked by FastQC https://www.bioinformatics.babraham.ac.uk/projects/fastqc/. RNA seq were aligned to the zebrafish reference genome using STARDobin et al. 2013. Gene expression was quantified as gene hit counts reads per gene using FeatureCountsLiao et al. 2014. Assembly: Danio rerio zebrafish genome assembly GRCz11 danRer11 Supplementary files format and content: txt data file include raw counts for each sample | Heart ventricle | Total RNA was isolated from zebrafish ventricles using Trizol Invitrogen. Reverse transcription was performed using SuperScript IV VILO Master Mix Invitrogen. For RNA seq library preparation and Illumina RNA seq were performed by Novogene. | tissue:Heart ventricle|genotype:nr4a1 mutant | GSM8506774 | GSM8506774: nr4a1 mutant 21 dpi sample 1; Danio rerio; RNA Seq | GSM8506774 r1 | GSM8506774 | 1 | Total RNA was isolated from zebrafish ventricles using Trizol Invitrogen. Reverse transcription was performed using SuperScript IV VILO Master Mix Invitrogen. For RNA seq library preparation and Illumina RNA seq were performed by Novogene. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq X Plus | SRP531880 | nr4a1_21_1_1.fq.gz nr4a1_21_1_2.fq.gz | fastq fastq | 8268177900.0 | 27560593.0 | GSM8506774 r1 | 0:150 1:150 | A:2258410899;C:1890202189;G:1886482508;T:2233018477;N:63827 | 150 | 150 | 2258410899 | 1890202189 | 1886482508 | 2233018477 | 63827 | SRX26043963 | SRS22614939 | SRA1968119 | The University of North Carolina | The University of North Carolina | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | United States | 2024-09-10 | Undetermined | Undetermined | Heart | Cardiovascular System | ||||||||||||||||||||||||
| 33716 | 33716 | SRR30621746 | SRX26043962 | SRS22614938 | SRP531880 | PRJNA1159283 | Nr4a1 Modulates Inflammation and Heart Regeneration in Zebrafish | GSE276850 | Transcriptome Analysis | Recent findings have highlighted the complex role of inflammation in zebrafish heart regeneration demonstrating that while inflammation is essential for initiating transient fibrosis and tissue repair chronic inflammation and unresolved fibrosis could impede full regenerative recovery. In this study we identified the nuclear receptor Nr4a1 as a critical regulator of this regenerative process in zebrafish. Loss of Nr4a1 function led to a prolonged and excessive inflammatory response disrupted neutrophil migration delayed fibrin clearance and ultimately impaired heart regeneration. Transcriptome wide RNA seq analysis at different injury stages revealed molecular disruptions associated with dysregulated inflammation and fibrosis in Nr4a1 mutants. Notably partial inhibition of the pro inflammatory cytokine Tnf a rescued heart regeneration in the nr4a1 mutants highlighting the therapeutic potential of modulating inflammation. Our findings suggest that Nr4a1 plays a crucial role in orchestrating the immune response during heart regeneration and may serve as a valuable target for enhancing cardiac repair following injury. Overall design: To elucidate the molecular basis of the phenotypes observed in the nr4a1 mutant we performed transcriptome wide bulk RNA sequencing on the ventricles from both control and mutant hearts at several key time points. Baseline transcriptomic profiles were established from uninjured hearts to compare the cardiac transcriptomics of the wildtype control and nr4a1 mutant. Given the critical involvement of inflammation in heart regeneration samples were also collected at 2 and 7 dpci corresponding to stages marked by an active inflammatory response. Moreover to elucidate the prolonged fibrosis phenotype in the late injury stage we performed transcriptomic analysis on hearts collected at 21 dpci. | nr4a1 mutant 7 dpi sample 2 | GSM8506773 | source name:Heart ventricle|tissue:Heart ventricle|genotype:nr4a1 mutant|geo loc name:missing|collection date:missing | nr4a1 mutant 7 dpi sample 2 | RNA seq raw data quality was checked by FastQC https://www.bioinformatics.babraham.ac.uk/projects/fastqc/. RNA seq were aligned to the zebrafish reference genome using STARDobin et al. 2013. Gene expression was quantified as gene hit counts reads per gene using FeatureCountsLiao et al. 2014. Assembly: Danio rerio zebrafish genome assembly GRCz11 danRer11 Supplementary files format and content: txt data file include raw counts for each sample | Heart ventricle | Total RNA was isolated from zebrafish ventricles using Trizol Invitrogen. Reverse transcription was performed using SuperScript IV VILO Master Mix Invitrogen. For RNA seq library preparation and Illumina RNA seq were performed by Novogene. | tissue:Heart ventricle|genotype:nr4a1 mutant | GSM8506773 | GSM8506773: nr4a1 mutant 7 dpi sample 2; Danio rerio; RNA Seq | GSM8506773 r1 | GSM8506773 | 1 | Total RNA was isolated from zebrafish ventricles using Trizol Invitrogen. Reverse transcription was performed using SuperScript IV VILO Master Mix Invitrogen. For RNA seq library preparation and Illumina RNA seq were performed by Novogene. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq X Plus | SRP531880 | nr4a1_7dpi_2_1.fq.gz nr4a1_7dpi_2_2.fq.gz | fastq fastq | 5512600871.0 | 18517476.0 | GSM8506773 r1 | 0:148.84 1:148.85 | A:1483061100;C:1285068800;G:1269689220;T:1474711048;N:70703 | 148 | 148 | 1483061100 | 1285068800 | 1269689220 | 1474711048 | 70703 | SRX26043962 | SRS22614938 | SRA1968119 | The University of North Carolina | The University of North Carolina | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | United States | 2024-09-10 | Undetermined | Undetermined | Heart | Cardiovascular System | ||||||||||||||||||||||||
| 33717 | 33717 | SRR30621747 | SRX26043961 | SRS22614937 | SRP531880 | PRJNA1159283 | Nr4a1 Modulates Inflammation and Heart Regeneration in Zebrafish | GSE276850 | Transcriptome Analysis | Recent findings have highlighted the complex role of inflammation in zebrafish heart regeneration demonstrating that while inflammation is essential for initiating transient fibrosis and tissue repair chronic inflammation and unresolved fibrosis could impede full regenerative recovery. In this study we identified the nuclear receptor Nr4a1 as a critical regulator of this regenerative process in zebrafish. Loss of Nr4a1 function led to a prolonged and excessive inflammatory response disrupted neutrophil migration delayed fibrin clearance and ultimately impaired heart regeneration. Transcriptome wide RNA seq analysis at different injury stages revealed molecular disruptions associated with dysregulated inflammation and fibrosis in Nr4a1 mutants. Notably partial inhibition of the pro inflammatory cytokine Tnf a rescued heart regeneration in the nr4a1 mutants highlighting the therapeutic potential of modulating inflammation. Our findings suggest that Nr4a1 plays a crucial role in orchestrating the immune response during heart regeneration and may serve as a valuable target for enhancing cardiac repair following injury. Overall design: To elucidate the molecular basis of the phenotypes observed in the nr4a1 mutant we performed transcriptome wide bulk RNA sequencing on the ventricles from both control and mutant hearts at several key time points. Baseline transcriptomic profiles were established from uninjured hearts to compare the cardiac transcriptomics of the wildtype control and nr4a1 mutant. Given the critical involvement of inflammation in heart regeneration samples were also collected at 2 and 7 dpci corresponding to stages marked by an active inflammatory response. Moreover to elucidate the prolonged fibrosis phenotype in the late injury stage we performed transcriptomic analysis on hearts collected at 21 dpci. | nr4a1 mutant 7 dpi sample 1 | GSM8506772 | source name:Heart ventricle|tissue:Heart ventricle|genotype:nr4a1 mutant|geo loc name:missing|collection date:missing | nr4a1 mutant 7 dpi sample 1 | RNA seq raw data quality was checked by FastQC https://www.bioinformatics.babraham.ac.uk/projects/fastqc/. RNA seq were aligned to the zebrafish reference genome using STARDobin et al. 2013. Gene expression was quantified as gene hit counts reads per gene using FeatureCountsLiao et al. 2014. Assembly: Danio rerio zebrafish genome assembly GRCz11 danRer11 Supplementary files format and content: txt data file include raw counts for each sample | Heart ventricle | Total RNA was isolated from zebrafish ventricles using Trizol Invitrogen. Reverse transcription was performed using SuperScript IV VILO Master Mix Invitrogen. For RNA seq library preparation and Illumina RNA seq were performed by Novogene. | tissue:Heart ventricle|genotype:nr4a1 mutant | GSM8506772 | GSM8506772: nr4a1 mutant 7 dpi sample 1; Danio rerio; RNA Seq | GSM8506772 r1 | GSM8506772 | 1 | Total RNA was isolated from zebrafish ventricles using Trizol Invitrogen. Reverse transcription was performed using SuperScript IV VILO Master Mix Invitrogen. For RNA seq library preparation and Illumina RNA seq were performed by Novogene. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq X Plus | SRP531880 | nr4a1_7dpi_1_1.fq.gz nr4a1_7dpi_1_2.fq.gz | fastq fastq | 6780831475.0 | 22750295.0 | GSM8506772 r1 | 0:149.03 1:149.03 | A:1831140932;C:1575183518;G:1554676178;T:1819734347;N:96500 | 149 | 149 | 1831140932 | 1575183518 | 1554676178 | 1819734347 | 96500 | SRX26043961 | SRS22614937 | SRA1968119 | The University of North Carolina | The University of North Carolina | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | United States | 2024-09-10 | Undetermined | Undetermined | Heart | Cardiovascular System | ||||||||||||||||||||||||
| 33718 | 33718 | SRR30621748 | SRX26043960 | SRS22614936 | SRP531880 | PRJNA1159283 | Nr4a1 Modulates Inflammation and Heart Regeneration in Zebrafish | GSE276850 | Transcriptome Analysis | Recent findings have highlighted the complex role of inflammation in zebrafish heart regeneration demonstrating that while inflammation is essential for initiating transient fibrosis and tissue repair chronic inflammation and unresolved fibrosis could impede full regenerative recovery. In this study we identified the nuclear receptor Nr4a1 as a critical regulator of this regenerative process in zebrafish. Loss of Nr4a1 function led to a prolonged and excessive inflammatory response disrupted neutrophil migration delayed fibrin clearance and ultimately impaired heart regeneration. Transcriptome wide RNA seq analysis at different injury stages revealed molecular disruptions associated with dysregulated inflammation and fibrosis in Nr4a1 mutants. Notably partial inhibition of the pro inflammatory cytokine Tnf a rescued heart regeneration in the nr4a1 mutants highlighting the therapeutic potential of modulating inflammation. Our findings suggest that Nr4a1 plays a crucial role in orchestrating the immune response during heart regeneration and may serve as a valuable target for enhancing cardiac repair following injury. Overall design: To elucidate the molecular basis of the phenotypes observed in the nr4a1 mutant we performed transcriptome wide bulk RNA sequencing on the ventricles from both control and mutant hearts at several key time points. Baseline transcriptomic profiles were established from uninjured hearts to compare the cardiac transcriptomics of the wildtype control and nr4a1 mutant. Given the critical involvement of inflammation in heart regeneration samples were also collected at 2 and 7 dpci corresponding to stages marked by an active inflammatory response. Moreover to elucidate the prolonged fibrosis phenotype in the late injury stage we performed transcriptomic analysis on hearts collected at 21 dpci. | nr4a1 mutant 2 dpi sample 2 | GSM8506771 | source name:Heart ventricle|tissue:Heart ventricle|genotype:nr4a1 mutant|geo loc name:missing|collection date:missing | nr4a1 mutant 2 dpi sample 2 | RNA seq raw data quality was checked by FastQC https://www.bioinformatics.babraham.ac.uk/projects/fastqc/. RNA seq were aligned to the zebrafish reference genome using STARDobin et al. 2013. Gene expression was quantified as gene hit counts reads per gene using FeatureCountsLiao et al. 2014. Assembly: Danio rerio zebrafish genome assembly GRCz11 danRer11 Supplementary files format and content: txt data file include raw counts for each sample | Heart ventricle | Total RNA was isolated from zebrafish ventricles using Trizol Invitrogen. Reverse transcription was performed using SuperScript IV VILO Master Mix Invitrogen. For RNA seq library preparation and Illumina RNA seq were performed by Novogene. | tissue:Heart ventricle|genotype:nr4a1 mutant | GSM8506771 | GSM8506771: nr4a1 mutant 2 dpi sample 2; Danio rerio; RNA Seq | GSM8506771 r1 | GSM8506771 | 1 | Total RNA was isolated from zebrafish ventricles using Trizol Invitrogen. Reverse transcription was performed using SuperScript IV VILO Master Mix Invitrogen. For RNA seq library preparation and Illumina RNA seq were performed by Novogene. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq X Plus | SRP531880 | nr4a1_2dpi_2_1.fq.gz nr4a1_2dpi_2_2.fq.gz | fastq fastq | 6503531797.0 | 21834092.0 | GSM8506771 r1 | 0:148.93 1:148.93 | A:1739648368;C:1527224071;G:1508002505;T:1728567175;N:89678 | 148 | 148 | 1739648368 | 1527224071 | 1508002505 | 1728567175 | 89678 | SRX26043960 | SRS22614936 | SRA1968119 | The University of North Carolina | The University of North Carolina | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | United States | 2024-09-10 | Undetermined | Undetermined | Heart | Cardiovascular System | ||||||||||||||||||||||||
| 33719 | 33719 | SRR30621749 | SRX26043959 | SRS22614935 | SRP531880 | PRJNA1159283 | Nr4a1 Modulates Inflammation and Heart Regeneration in Zebrafish | GSE276850 | Transcriptome Analysis | Recent findings have highlighted the complex role of inflammation in zebrafish heart regeneration demonstrating that while inflammation is essential for initiating transient fibrosis and tissue repair chronic inflammation and unresolved fibrosis could impede full regenerative recovery. In this study we identified the nuclear receptor Nr4a1 as a critical regulator of this regenerative process in zebrafish. Loss of Nr4a1 function led to a prolonged and excessive inflammatory response disrupted neutrophil migration delayed fibrin clearance and ultimately impaired heart regeneration. Transcriptome wide RNA seq analysis at different injury stages revealed molecular disruptions associated with dysregulated inflammation and fibrosis in Nr4a1 mutants. Notably partial inhibition of the pro inflammatory cytokine Tnf a rescued heart regeneration in the nr4a1 mutants highlighting the therapeutic potential of modulating inflammation. Our findings suggest that Nr4a1 plays a crucial role in orchestrating the immune response during heart regeneration and may serve as a valuable target for enhancing cardiac repair following injury. Overall design: To elucidate the molecular basis of the phenotypes observed in the nr4a1 mutant we performed transcriptome wide bulk RNA sequencing on the ventricles from both control and mutant hearts at several key time points. Baseline transcriptomic profiles were established from uninjured hearts to compare the cardiac transcriptomics of the wildtype control and nr4a1 mutant. Given the critical involvement of inflammation in heart regeneration samples were also collected at 2 and 7 dpci corresponding to stages marked by an active inflammatory response. Moreover to elucidate the prolonged fibrosis phenotype in the late injury stage we performed transcriptomic analysis on hearts collected at 21 dpci. | nr4a1 mutant 2 dpi sample 1 | GSM8506770 | source name:Heart ventricle|tissue:Heart ventricle|genotype:nr4a1 mutant|geo loc name:missing|collection date:missing | nr4a1 mutant 2 dpi sample 1 | RNA seq raw data quality was checked by FastQC https://www.bioinformatics.babraham.ac.uk/projects/fastqc/. RNA seq were aligned to the zebrafish reference genome using STARDobin et al. 2013. Gene expression was quantified as gene hit counts reads per gene using FeatureCountsLiao et al. 2014. Assembly: Danio rerio zebrafish genome assembly GRCz11 danRer11 Supplementary files format and content: txt data file include raw counts for each sample | Heart ventricle | Total RNA was isolated from zebrafish ventricles using Trizol Invitrogen. Reverse transcription was performed using SuperScript IV VILO Master Mix Invitrogen. For RNA seq library preparation and Illumina RNA seq were performed by Novogene. | tissue:Heart ventricle|genotype:nr4a1 mutant | GSM8506770 | GSM8506770: nr4a1 mutant 2 dpi sample 1; Danio rerio; RNA Seq | GSM8506770 r1 | GSM8506770 | 1 | Total RNA was isolated from zebrafish ventricles using Trizol Invitrogen. Reverse transcription was performed using SuperScript IV VILO Master Mix Invitrogen. For RNA seq library preparation and Illumina RNA seq were performed by Novogene. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq X Plus | SRP531880 | nr4a1_2dpi_1_1.fq.gz nr4a1_2dpi_1_2.fq.gz | fastq fastq | 5645476838.0 | 18937309.0 | GSM8506770 r1 | 0:149.05 1:149.06 | A:1522889953;C:1312356884;G:1296118643;T:1514035483;N:75875 | 149 | 149 | 1522889953 | 1312356884 | 1296118643 | 1514035483 | 75875 | SRX26043959 | SRS22614935 | SRA1968119 | The University of North Carolina | The University of North Carolina | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | United States | 2024-09-10 | Undetermined | Undetermined | Heart | Cardiovascular System | ||||||||||||||||||||||||
| 33720 | 33720 | SRR30621750 | SRX26043958 | SRS22614934 | SRP531880 | PRJNA1159283 | Nr4a1 Modulates Inflammation and Heart Regeneration in Zebrafish | GSE276850 | Transcriptome Analysis | Recent findings have highlighted the complex role of inflammation in zebrafish heart regeneration demonstrating that while inflammation is essential for initiating transient fibrosis and tissue repair chronic inflammation and unresolved fibrosis could impede full regenerative recovery. In this study we identified the nuclear receptor Nr4a1 as a critical regulator of this regenerative process in zebrafish. Loss of Nr4a1 function led to a prolonged and excessive inflammatory response disrupted neutrophil migration delayed fibrin clearance and ultimately impaired heart regeneration. Transcriptome wide RNA seq analysis at different injury stages revealed molecular disruptions associated with dysregulated inflammation and fibrosis in Nr4a1 mutants. Notably partial inhibition of the pro inflammatory cytokine Tnf a rescued heart regeneration in the nr4a1 mutants highlighting the therapeutic potential of modulating inflammation. Our findings suggest that Nr4a1 plays a crucial role in orchestrating the immune response during heart regeneration and may serve as a valuable target for enhancing cardiac repair following injury. Overall design: To elucidate the molecular basis of the phenotypes observed in the nr4a1 mutant we performed transcriptome wide bulk RNA sequencing on the ventricles from both control and mutant hearts at several key time points. Baseline transcriptomic profiles were established from uninjured hearts to compare the cardiac transcriptomics of the wildtype control and nr4a1 mutant. Given the critical involvement of inflammation in heart regeneration samples were also collected at 2 and 7 dpci corresponding to stages marked by an active inflammatory response. Moreover to elucidate the prolonged fibrosis phenotype in the late injury stage we performed transcriptomic analysis on hearts collected at 21 dpci. | nr4a1 mutant 0 dpi sample 2 | GSM8506769 | source name:Heart ventricle|tissue:Heart ventricle|genotype:nr4a1 mutant|geo loc name:missing|collection date:missing | nr4a1 mutant 0 dpi sample 2 | RNA seq raw data quality was checked by FastQC https://www.bioinformatics.babraham.ac.uk/projects/fastqc/. RNA seq were aligned to the zebrafish reference genome using STARDobin et al. 2013. Gene expression was quantified as gene hit counts reads per gene using FeatureCountsLiao et al. 2014. Assembly: Danio rerio zebrafish genome assembly GRCz11 danRer11 Supplementary files format and content: txt data file include raw counts for each sample | Heart ventricle | Total RNA was isolated from zebrafish ventricles using Trizol Invitrogen. Reverse transcription was performed using SuperScript IV VILO Master Mix Invitrogen. For RNA seq library preparation and Illumina RNA seq were performed by Novogene. | tissue:Heart ventricle|genotype:nr4a1 mutant | GSM8506769 | GSM8506769: nr4a1 mutant 0 dpi sample 2; Danio rerio; RNA Seq | GSM8506769 r1 | GSM8506769 | 1 | Total RNA was isolated from zebrafish ventricles using Trizol Invitrogen. Reverse transcription was performed using SuperScript IV VILO Master Mix Invitrogen. For RNA seq library preparation and Illumina RNA seq were performed by Novogene. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq X Plus | SRP531880 | nr4a1_0dpi_2_1.fq.gz nr4a1_0dpi_2_2.fq.gz | fastq fastq | 9184630800.0 | 30615436.0 | GSM8506769 r1 | 0:150 1:150 | A:2514442400;C:2095585016;G:2092520078;T:2482011445;N:71861 | 150 | 150 | 2514442400 | 2095585016 | 2092520078 | 2482011445 | 71861 | SRX26043958 | SRS22614934 | SRA1968119 | The University of North Carolina | The University of North Carolina | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | United States | 2024-09-10 | Undetermined | Undetermined | Heart | Cardiovascular System | ||||||||||||||||||||||||
| 33721 | 33721 | SRR30621751 | SRX26043957 | SRS22614933 | SRP531880 | PRJNA1159283 | Nr4a1 Modulates Inflammation and Heart Regeneration in Zebrafish | GSE276850 | Transcriptome Analysis | Recent findings have highlighted the complex role of inflammation in zebrafish heart regeneration demonstrating that while inflammation is essential for initiating transient fibrosis and tissue repair chronic inflammation and unresolved fibrosis could impede full regenerative recovery. In this study we identified the nuclear receptor Nr4a1 as a critical regulator of this regenerative process in zebrafish. Loss of Nr4a1 function led to a prolonged and excessive inflammatory response disrupted neutrophil migration delayed fibrin clearance and ultimately impaired heart regeneration. Transcriptome wide RNA seq analysis at different injury stages revealed molecular disruptions associated with dysregulated inflammation and fibrosis in Nr4a1 mutants. Notably partial inhibition of the pro inflammatory cytokine Tnf a rescued heart regeneration in the nr4a1 mutants highlighting the therapeutic potential of modulating inflammation. Our findings suggest that Nr4a1 plays a crucial role in orchestrating the immune response during heart regeneration and may serve as a valuable target for enhancing cardiac repair following injury. Overall design: To elucidate the molecular basis of the phenotypes observed in the nr4a1 mutant we performed transcriptome wide bulk RNA sequencing on the ventricles from both control and mutant hearts at several key time points. Baseline transcriptomic profiles were established from uninjured hearts to compare the cardiac transcriptomics of the wildtype control and nr4a1 mutant. Given the critical involvement of inflammation in heart regeneration samples were also collected at 2 and 7 dpci corresponding to stages marked by an active inflammatory response. Moreover to elucidate the prolonged fibrosis phenotype in the late injury stage we performed transcriptomic analysis on hearts collected at 21 dpci. | nr4a1 mutant 0 dpi sample 1 | GSM8506768 | source name:Heart ventricle|tissue:Heart ventricle|genotype:nr4a1 mutant|geo loc name:missing|collection date:missing | nr4a1 mutant 0 dpi sample 1 | RNA seq raw data quality was checked by FastQC https://www.bioinformatics.babraham.ac.uk/projects/fastqc/. RNA seq were aligned to the zebrafish reference genome using STARDobin et al. 2013. Gene expression was quantified as gene hit counts reads per gene using FeatureCountsLiao et al. 2014. Assembly: Danio rerio zebrafish genome assembly GRCz11 danRer11 Supplementary files format and content: txt data file include raw counts for each sample | Heart ventricle | Total RNA was isolated from zebrafish ventricles using Trizol Invitrogen. Reverse transcription was performed using SuperScript IV VILO Master Mix Invitrogen. For RNA seq library preparation and Illumina RNA seq were performed by Novogene. | tissue:Heart ventricle|genotype:nr4a1 mutant | GSM8506768 | GSM8506768: nr4a1 mutant 0 dpi sample 1; Danio rerio; RNA Seq | GSM8506768 r1 | GSM8506768 | 1 | Total RNA was isolated from zebrafish ventricles using Trizol Invitrogen. Reverse transcription was performed using SuperScript IV VILO Master Mix Invitrogen. For RNA seq library preparation and Illumina RNA seq were performed by Novogene. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq X Plus | SRP531880 | nr4a1_0dpi_1_1.fq.gz nr4a1_0dpi_1_2.fq.gz | fastq fastq | 9290140800.0 | 30967136.0 | GSM8506768 r1 | 0:150 1:150 | A:2540516970;C:2120755706;G:2115163242;T:2513633143;N:71739 | 150 | 150 | 2540516970 | 2120755706 | 2115163242 | 2513633143 | 71739 | SRX26043957 | SRS22614933 | SRA1968119 | The University of North Carolina | The University of North Carolina | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | United States | 2024-09-10 | Undetermined | Undetermined | Heart | Cardiovascular System | ||||||||||||||||||||||||
| 33934 | 33934 | SRR30947094 | SRX26349630 | SRS22874784 | SRP537826 | PRJNA1171482 | TAK1 operates at the primary cilium in non canonical TGFB/BMP signaling to control heart development | GSE279246 | Transcriptome Analysis | Transforming Growth Factor Beta Activated Kinase 1 TAK1/MAP3K7 along with its upstream regulators TAK1 Binding Protein 2 TAB2 and the catalytic alpha subunit of Protein Kinase A PKA Ca/PRKACA has been identified as a pivotal player in regulation of developmental processes. Haploinsufficiency of TAB2 causes Congenital Heart Disease CHD and rare variants in PKA Ca and TAK1 cause cardioacrofacial dysplasia CAFD and Frontometaphyseal Dysplasia FMD and cardiospondylocarpofacial syndrome CSCFS respectively rare multisystem syndromes where CHD may appear in the clinical spectrum. We hypothesized that TAK1 plays a significant role in heart development and CHD and addressed this by genetic analysis in CHD patient cohorts and experiments in cell and animal models. Exome sequencing data from 1 471 CHD patients with extracardiac anomalies syndromic CHD sCHD 2 405 patients with nonsyndromic CHD nsCHD and 45 082 controls showed increased burden of rare TAB2 and TAK1 variants in sCHD but not in nsCHD. Detailed characterization of tak1 / and tab2 / zebrafish mutants revealed cardiac defects dilated atrium trabeculation defects tachycardia and reduced contractility as well as extracardiac developmental anomalies. RNA sequencing of tak1 / mutant hearts showed downregulation of genes encoding core cardiac transcription factors sarcomeric proteins and extracellular matrix proteins. Experiments with cell cultures and analysis of zebrafish larvae and gastruloids indicated that TAK1 via TAB2 and PKA Ca is activated at the primary cilium during cardiomyogenesis and that TAK1 activation at this site is enhanced by cardiomyogenic signaling molecules including ligands of the TGFB/BMP superfamily. Consistent with these findings CRISPR/Cas9 mediated editing of TAK1 or administration of small molecule inhibitors targeting TAK1 inhibited ciliary signaling and cardiomyocyte differentiation in vitro while FMD causing mutations in TAK1 reduced its ciliary localization. In conclusion our data establishes a central role for TAK1… | whole heart tak1+/+ wild type replicate #3 | GSM8565205 | source name:Whole heart 3 dpf|tissue:Whole heart 3 dpf|genotype:tak1+/+|geo loc name:missing|collection date:missing | whole heart tak1+/+ wild type replicate #3 | post quality filtering reads were aligned to reference sequence GCF 000002035.6 GRCz11 using HISAT and Bowtie 2. Average mapping ratio with reference genome was 88.50% average mapping ratio with genes was 74.56%. In total 23966 genes were identified. Assembly: GCF 000002035.6 GRCz11 Supplementary files format and content: Matrix txt file. Columns: gene id NCBI; gene symbol; tpm mut 1; tpm mut 2; tpm mut 3; tpm WT 1; tpm WT 2; tpm WT 3. Data is shown as transcripts per million TPM. | Whole heart 3 dpf | RNA isolation using Qiagen Rneasy micro kit Bulk RNAseq was performed as a service by BGI China. Samples were paired end sequenced using the DNBSEQ platform. | tissue:Whole heart 3 dpf|genotype:tak1+/+ | GSM8565205 | GSM8565205: whole heart tak1+/+ wild type replicate #3; Danio rerio; RNA Seq | GSM8565205 r1 | GSM8565205 | 1 | RNA isolation using Qiagen Rneasy micro kit Bulk RNAseq was performed as a service by BGI China. Samples were paired end sequenced using the DNBSEQ platform. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | DNBSEQ | DNBSEQ-G400 | SRP537826 | WT_3_1.fq.gz WT_3_2.fq.gz | fastq fastq | 4449566200.0 | 22247831.0 | GSM8565205 r1 | 0:100 1:100 | A:1179341017;C:1046638560;G:1046356098;T:1177230525;N:0 | 100 | 100 | 1179341017 | 1046638560 | 1046356098 | 1177230525 | 0 | SRX26349630 | SRS22874784 | SRA1990217 | Department of Cellular and Molecular Medicine, University of Copenhagen | Department of Cellular and Molecular Medicine, University of Copenhagen | B | B | biological fallback assumption | bgi | bgi | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | Denmark | 2024-10-10 | Larval | Larval | Heart | Cardiovascular System | ||||||||||||||||||||||||
| 33935 | 33935 | SRR30947095 | SRX26349629 | SRS22874783 | SRP537826 | PRJNA1171482 | TAK1 operates at the primary cilium in non canonical TGFB/BMP signaling to control heart development | GSE279246 | Transcriptome Analysis | Transforming Growth Factor Beta Activated Kinase 1 TAK1/MAP3K7 along with its upstream regulators TAK1 Binding Protein 2 TAB2 and the catalytic alpha subunit of Protein Kinase A PKA Ca/PRKACA has been identified as a pivotal player in regulation of developmental processes. Haploinsufficiency of TAB2 causes Congenital Heart Disease CHD and rare variants in PKA Ca and TAK1 cause cardioacrofacial dysplasia CAFD and Frontometaphyseal Dysplasia FMD and cardiospondylocarpofacial syndrome CSCFS respectively rare multisystem syndromes where CHD may appear in the clinical spectrum. We hypothesized that TAK1 plays a significant role in heart development and CHD and addressed this by genetic analysis in CHD patient cohorts and experiments in cell and animal models. Exome sequencing data from 1 471 CHD patients with extracardiac anomalies syndromic CHD sCHD 2 405 patients with nonsyndromic CHD nsCHD and 45 082 controls showed increased burden of rare TAB2 and TAK1 variants in sCHD but not in nsCHD. Detailed characterization of tak1 / and tab2 / zebrafish mutants revealed cardiac defects dilated atrium trabeculation defects tachycardia and reduced contractility as well as extracardiac developmental anomalies. RNA sequencing of tak1 / mutant hearts showed downregulation of genes encoding core cardiac transcription factors sarcomeric proteins and extracellular matrix proteins. Experiments with cell cultures and analysis of zebrafish larvae and gastruloids indicated that TAK1 via TAB2 and PKA Ca is activated at the primary cilium during cardiomyogenesis and that TAK1 activation at this site is enhanced by cardiomyogenic signaling molecules including ligands of the TGFB/BMP superfamily. Consistent with these findings CRISPR/Cas9 mediated editing of TAK1 or administration of small molecule inhibitors targeting TAK1 inhibited ciliary signaling and cardiomyocyte differentiation in vitro while FMD causing mutations in TAK1 reduced its ciliary localization. In conclusion our data establishes a central role for TAK1… | whole heart tak1+/+ wild type replicate #2 | GSM8565204 | source name:Whole heart 3 dpf|tissue:Whole heart 3 dpf|genotype:tak1+/+|geo loc name:missing|collection date:missing | whole heart tak1+/+ wild type replicate #2 | post quality filtering reads were aligned to reference sequence GCF 000002035.6 GRCz11 using HISAT and Bowtie 2. Average mapping ratio with reference genome was 88.50% average mapping ratio with genes was 74.56%. In total 23966 genes were identified. Assembly: GCF 000002035.6 GRCz11 Supplementary files format and content: Matrix txt file. Columns: gene id NCBI; gene symbol; tpm mut 1; tpm mut 2; tpm mut 3; tpm WT 1; tpm WT 2; tpm WT 3. Data is shown as transcripts per million TPM. | Whole heart 3 dpf | RNA isolation using Qiagen Rneasy micro kit Bulk RNAseq was performed as a service by BGI China. Samples were paired end sequenced using the DNBSEQ platform. | tissue:Whole heart 3 dpf|genotype:tak1+/+ | GSM8565204 | GSM8565204: whole heart tak1+/+ wild type replicate #2; Danio rerio; RNA Seq | GSM8565204 r1 | GSM8565204 | 1 | RNA isolation using Qiagen Rneasy micro kit Bulk RNAseq was performed as a service by BGI China. Samples were paired end sequenced using the DNBSEQ platform. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | DNBSEQ | DNBSEQ-G400 | SRP537826 | WT_2_1.fq.gz WT_2_2.fq.gz | fastq fastq | 4519627600.0 | 22598138.0 | GSM8565204 r1 | 0:100 1:100 | A:1207344552;C:1055139553;G:1056806709;T:1200336786;N:0 | 100 | 100 | 1207344552 | 1055139553 | 1056806709 | 1200336786 | 0 | SRX26349629 | SRS22874783 | SRA1990217 | Department of Cellular and Molecular Medicine, University of Copenhagen | Department of Cellular and Molecular Medicine, University of Copenhagen | B | B | biological fallback assumption | bgi | bgi | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | Denmark | 2024-10-10 | Larval | Larval | Heart | Cardiovascular System | ||||||||||||||||||||||||
| 33936 | 33936 | SRR30947096 | SRX26349628 | SRS22874781 | SRP537826 | PRJNA1171482 | TAK1 operates at the primary cilium in non canonical TGFB/BMP signaling to control heart development | GSE279246 | Transcriptome Analysis | Transforming Growth Factor Beta Activated Kinase 1 TAK1/MAP3K7 along with its upstream regulators TAK1 Binding Protein 2 TAB2 and the catalytic alpha subunit of Protein Kinase A PKA Ca/PRKACA has been identified as a pivotal player in regulation of developmental processes. Haploinsufficiency of TAB2 causes Congenital Heart Disease CHD and rare variants in PKA Ca and TAK1 cause cardioacrofacial dysplasia CAFD and Frontometaphyseal Dysplasia FMD and cardiospondylocarpofacial syndrome CSCFS respectively rare multisystem syndromes where CHD may appear in the clinical spectrum. We hypothesized that TAK1 plays a significant role in heart development and CHD and addressed this by genetic analysis in CHD patient cohorts and experiments in cell and animal models. Exome sequencing data from 1 471 CHD patients with extracardiac anomalies syndromic CHD sCHD 2 405 patients with nonsyndromic CHD nsCHD and 45 082 controls showed increased burden of rare TAB2 and TAK1 variants in sCHD but not in nsCHD. Detailed characterization of tak1 / and tab2 / zebrafish mutants revealed cardiac defects dilated atrium trabeculation defects tachycardia and reduced contractility as well as extracardiac developmental anomalies. RNA sequencing of tak1 / mutant hearts showed downregulation of genes encoding core cardiac transcription factors sarcomeric proteins and extracellular matrix proteins. Experiments with cell cultures and analysis of zebrafish larvae and gastruloids indicated that TAK1 via TAB2 and PKA Ca is activated at the primary cilium during cardiomyogenesis and that TAK1 activation at this site is enhanced by cardiomyogenic signaling molecules including ligands of the TGFB/BMP superfamily. Consistent with these findings CRISPR/Cas9 mediated editing of TAK1 or administration of small molecule inhibitors targeting TAK1 inhibited ciliary signaling and cardiomyocyte differentiation in vitro while FMD causing mutations in TAK1 reduced its ciliary localization. In conclusion our data establishes a central role for TAK1… | whole heart tak1+/+ wild type replicate #1 | GSM8565203 | source name:Whole heart 3 dpf|tissue:Whole heart 3 dpf|genotype:tak1+/+|geo loc name:missing|collection date:missing | whole heart tak1+/+ wild type replicate #1 | post quality filtering reads were aligned to reference sequence GCF 000002035.6 GRCz11 using HISAT and Bowtie 2. Average mapping ratio with reference genome was 88.50% average mapping ratio with genes was 74.56%. In total 23966 genes were identified. Assembly: GCF 000002035.6 GRCz11 Supplementary files format and content: Matrix txt file. Columns: gene id NCBI; gene symbol; tpm mut 1; tpm mut 2; tpm mut 3; tpm WT 1; tpm WT 2; tpm WT 3. Data is shown as transcripts per million TPM. | Whole heart 3 dpf | RNA isolation using Qiagen Rneasy micro kit Bulk RNAseq was performed as a service by BGI China. Samples were paired end sequenced using the DNBSEQ platform. | tissue:Whole heart 3 dpf|genotype:tak1+/+ | GSM8565203 | GSM8565203: whole heart tak1+/+ wild type replicate #1; Danio rerio; RNA Seq | GSM8565203 r1 | GSM8565203 | 1 | RNA isolation using Qiagen Rneasy micro kit Bulk RNAseq was performed as a service by BGI China. Samples were paired end sequenced using the DNBSEQ platform. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | DNBSEQ | DNBSEQ-G400 | SRP537826 | WT_1_1.fq.gz WT_1_2.fq.gz | fastq fastq | 4496601200.0 | 22483006.0 | GSM8565203 r1 | 0:100 1:100 | A:1201390946;C:1050348674;G:1051355386;T:1193506194;N:0 | 100 | 100 | 1201390946 | 1050348674 | 1051355386 | 1193506194 | 0 | SRX26349628 | SRS22874781 | SRA1990217 | Department of Cellular and Molecular Medicine, University of Copenhagen | Department of Cellular and Molecular Medicine, University of Copenhagen | B | B | biological fallback assumption | bgi | bgi | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | Denmark | 2024-10-10 | Larval | Larval | Heart | Cardiovascular System | ||||||||||||||||||||||||
| 33937 | 33937 | SRR30947097 | SRX26349627 | SRS22874780 | SRP537826 | PRJNA1171482 | TAK1 operates at the primary cilium in non canonical TGFB/BMP signaling to control heart development | GSE279246 | Transcriptome Analysis | Transforming Growth Factor Beta Activated Kinase 1 TAK1/MAP3K7 along with its upstream regulators TAK1 Binding Protein 2 TAB2 and the catalytic alpha subunit of Protein Kinase A PKA Ca/PRKACA has been identified as a pivotal player in regulation of developmental processes. Haploinsufficiency of TAB2 causes Congenital Heart Disease CHD and rare variants in PKA Ca and TAK1 cause cardioacrofacial dysplasia CAFD and Frontometaphyseal Dysplasia FMD and cardiospondylocarpofacial syndrome CSCFS respectively rare multisystem syndromes where CHD may appear in the clinical spectrum. We hypothesized that TAK1 plays a significant role in heart development and CHD and addressed this by genetic analysis in CHD patient cohorts and experiments in cell and animal models. Exome sequencing data from 1 471 CHD patients with extracardiac anomalies syndromic CHD sCHD 2 405 patients with nonsyndromic CHD nsCHD and 45 082 controls showed increased burden of rare TAB2 and TAK1 variants in sCHD but not in nsCHD. Detailed characterization of tak1 / and tab2 / zebrafish mutants revealed cardiac defects dilated atrium trabeculation defects tachycardia and reduced contractility as well as extracardiac developmental anomalies. RNA sequencing of tak1 / mutant hearts showed downregulation of genes encoding core cardiac transcription factors sarcomeric proteins and extracellular matrix proteins. Experiments with cell cultures and analysis of zebrafish larvae and gastruloids indicated that TAK1 via TAB2 and PKA Ca is activated at the primary cilium during cardiomyogenesis and that TAK1 activation at this site is enhanced by cardiomyogenic signaling molecules including ligands of the TGFB/BMP superfamily. Consistent with these findings CRISPR/Cas9 mediated editing of TAK1 or administration of small molecule inhibitors targeting TAK1 inhibited ciliary signaling and cardiomyocyte differentiation in vitro while FMD causing mutations in TAK1 reduced its ciliary localization. In conclusion our data establishes a central role for TAK1… | whole heart tak1 / mutant replicate #3 | GSM8565202 | source name:Whole heart 3 dpf|tissue:Whole heart 3 dpf|genotype:tak1 / |geo loc name:missing|collection date:missing | whole heart tak1 / mutant replicate #3 | post quality filtering reads were aligned to reference sequence GCF 000002035.6 GRCz11 using HISAT and Bowtie 2. Average mapping ratio with reference genome was 88.50% average mapping ratio with genes was 74.56%. In total 23966 genes were identified. Assembly: GCF 000002035.6 GRCz11 Supplementary files format and content: Matrix txt file. Columns: gene id NCBI; gene symbol; tpm mut 1; tpm mut 2; tpm mut 3; tpm WT 1; tpm WT 2; tpm WT 3. Data is shown as transcripts per million TPM. | Whole heart 3 dpf | RNA isolation using Qiagen Rneasy micro kit Bulk RNAseq was performed as a service by BGI China. Samples were paired end sequenced using the DNBSEQ platform. | tissue:Whole heart 3 dpf|genotype:tak1 / | GSM8565202 | GSM8565202: whole heart tak1 / mutant replicate #3; Danio rerio; RNA Seq | GSM8565202 r1 | GSM8565202 | 1 | RNA isolation using Qiagen Rneasy micro kit Bulk RNAseq was performed as a service by BGI China. Samples were paired end sequenced using the DNBSEQ platform. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | DNBSEQ | DNBSEQ-G400 | SRP537826 | mut_3_1.fq.gz mut_3_2.fq.gz | fastq fastq | 4451759600.0 | 22258798.0 | GSM8565202 r1 | 0:100 1:100 | A:1167798041;C:1064608876;G:1066460994;T:1152891689;N:0 | 100 | 100 | 1167798041 | 1064608876 | 1066460994 | 1152891689 | 0 | SRX26349627 | SRS22874780 | SRA1990217 | Department of Cellular and Molecular Medicine, University of Copenhagen | Department of Cellular and Molecular Medicine, University of Copenhagen | B | B | biological fallback assumption | bgi | bgi | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | Denmark | 2024-10-10 | Larval | Larval | Heart | Cardiovascular System | ||||||||||||||||||||||||
| 33938 | 33938 | SRR30947098 | SRX26349626 | SRS22874782 | SRP537826 | PRJNA1171482 | TAK1 operates at the primary cilium in non canonical TGFB/BMP signaling to control heart development | GSE279246 | Transcriptome Analysis | Transforming Growth Factor Beta Activated Kinase 1 TAK1/MAP3K7 along with its upstream regulators TAK1 Binding Protein 2 TAB2 and the catalytic alpha subunit of Protein Kinase A PKA Ca/PRKACA has been identified as a pivotal player in regulation of developmental processes. Haploinsufficiency of TAB2 causes Congenital Heart Disease CHD and rare variants in PKA Ca and TAK1 cause cardioacrofacial dysplasia CAFD and Frontometaphyseal Dysplasia FMD and cardiospondylocarpofacial syndrome CSCFS respectively rare multisystem syndromes where CHD may appear in the clinical spectrum. We hypothesized that TAK1 plays a significant role in heart development and CHD and addressed this by genetic analysis in CHD patient cohorts and experiments in cell and animal models. Exome sequencing data from 1 471 CHD patients with extracardiac anomalies syndromic CHD sCHD 2 405 patients with nonsyndromic CHD nsCHD and 45 082 controls showed increased burden of rare TAB2 and TAK1 variants in sCHD but not in nsCHD. Detailed characterization of tak1 / and tab2 / zebrafish mutants revealed cardiac defects dilated atrium trabeculation defects tachycardia and reduced contractility as well as extracardiac developmental anomalies. RNA sequencing of tak1 / mutant hearts showed downregulation of genes encoding core cardiac transcription factors sarcomeric proteins and extracellular matrix proteins. Experiments with cell cultures and analysis of zebrafish larvae and gastruloids indicated that TAK1 via TAB2 and PKA Ca is activated at the primary cilium during cardiomyogenesis and that TAK1 activation at this site is enhanced by cardiomyogenic signaling molecules including ligands of the TGFB/BMP superfamily. Consistent with these findings CRISPR/Cas9 mediated editing of TAK1 or administration of small molecule inhibitors targeting TAK1 inhibited ciliary signaling and cardiomyocyte differentiation in vitro while FMD causing mutations in TAK1 reduced its ciliary localization. In conclusion our data establishes a central role for TAK1… | whole heart tak1 / mutant replicate #2 | GSM8565201 | source name:Whole heart 3 dpf|tissue:Whole heart 3 dpf|genotype:tak1 / |geo loc name:missing|collection date:missing | whole heart tak1 / mutant replicate #2 | post quality filtering reads were aligned to reference sequence GCF 000002035.6 GRCz11 using HISAT and Bowtie 2. Average mapping ratio with reference genome was 88.50% average mapping ratio with genes was 74.56%. In total 23966 genes were identified. Assembly: GCF 000002035.6 GRCz11 Supplementary files format and content: Matrix txt file. Columns: gene id NCBI; gene symbol; tpm mut 1; tpm mut 2; tpm mut 3; tpm WT 1; tpm WT 2; tpm WT 3. Data is shown as transcripts per million TPM. | Whole heart 3 dpf | RNA isolation using Qiagen Rneasy micro kit Bulk RNAseq was performed as a service by BGI China. Samples were paired end sequenced using the DNBSEQ platform. | tissue:Whole heart 3 dpf|genotype:tak1 / | GSM8565201 | GSM8565201: whole heart tak1 / mutant replicate #2; Danio rerio; RNA Seq | GSM8565201 r1 | GSM8565201 | 1 | RNA isolation using Qiagen Rneasy micro kit Bulk RNAseq was performed as a service by BGI China. Samples were paired end sequenced using the DNBSEQ platform. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | DNBSEQ | DNBSEQ-G400 | SRP537826 | mut_2_1.fq.gz mut_2_2.fq.gz | fastq fastq | 4534495200.0 | 22672476.0 | GSM8565201 r1 | SRX26349626 | SRS22874782 | SRA1990217 | Department of Cellular and Molecular Medicine, University of Copenhagen | Department of Cellular and Molecular Medicine, University of Copenhagen | B | B | biological fallback assumption | bgi | bgi | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | Denmark | 2024-10-10 | Larval | Larval | Heart | Cardiovascular System | |||||||||||||||||||||||||||||||||
| 33939 | 33939 | SRR30947099 | SRX26349625 | SRS22874779 | SRP537826 | PRJNA1171482 | TAK1 operates at the primary cilium in non canonical TGFB/BMP signaling to control heart development | GSE279246 | Transcriptome Analysis | Transforming Growth Factor Beta Activated Kinase 1 TAK1/MAP3K7 along with its upstream regulators TAK1 Binding Protein 2 TAB2 and the catalytic alpha subunit of Protein Kinase A PKA Ca/PRKACA has been identified as a pivotal player in regulation of developmental processes. Haploinsufficiency of TAB2 causes Congenital Heart Disease CHD and rare variants in PKA Ca and TAK1 cause cardioacrofacial dysplasia CAFD and Frontometaphyseal Dysplasia FMD and cardiospondylocarpofacial syndrome CSCFS respectively rare multisystem syndromes where CHD may appear in the clinical spectrum. We hypothesized that TAK1 plays a significant role in heart development and CHD and addressed this by genetic analysis in CHD patient cohorts and experiments in cell and animal models. Exome sequencing data from 1 471 CHD patients with extracardiac anomalies syndromic CHD sCHD 2 405 patients with nonsyndromic CHD nsCHD and 45 082 controls showed increased burden of rare TAB2 and TAK1 variants in sCHD but not in nsCHD. Detailed characterization of tak1 / and tab2 / zebrafish mutants revealed cardiac defects dilated atrium trabeculation defects tachycardia and reduced contractility as well as extracardiac developmental anomalies. RNA sequencing of tak1 / mutant hearts showed downregulation of genes encoding core cardiac transcription factors sarcomeric proteins and extracellular matrix proteins. Experiments with cell cultures and analysis of zebrafish larvae and gastruloids indicated that TAK1 via TAB2 and PKA Ca is activated at the primary cilium during cardiomyogenesis and that TAK1 activation at this site is enhanced by cardiomyogenic signaling molecules including ligands of the TGFB/BMP superfamily. Consistent with these findings CRISPR/Cas9 mediated editing of TAK1 or administration of small molecule inhibitors targeting TAK1 inhibited ciliary signaling and cardiomyocyte differentiation in vitro while FMD causing mutations in TAK1 reduced its ciliary localization. In conclusion our data establishes a central role for TAK1… | whole heart tak1 / mutant replicate #1 | GSM8565200 | source name:Whole heart 3 dpf|tissue:Whole heart 3 dpf|genotype:tak1 / |geo loc name:missing|collection date:missing | whole heart tak1 / mutant replicate #1 | post quality filtering reads were aligned to reference sequence GCF 000002035.6 GRCz11 using HISAT and Bowtie 2. Average mapping ratio with reference genome was 88.50% average mapping ratio with genes was 74.56%. In total 23966 genes were identified. Assembly: GCF 000002035.6 GRCz11 Supplementary files format and content: Matrix txt file. Columns: gene id NCBI; gene symbol; tpm mut 1; tpm mut 2; tpm mut 3; tpm WT 1; tpm WT 2; tpm WT 3. Data is shown as transcripts per million TPM. | Whole heart 3 dpf | RNA isolation using Qiagen Rneasy micro kit Bulk RNAseq was performed as a service by BGI China. Samples were paired end sequenced using the DNBSEQ platform. | tissue:Whole heart 3 dpf|genotype:tak1 / | GSM8565200 | GSM8565200: whole heart tak1 / mutant replicate #1; Danio rerio; RNA Seq | GSM8565200 r1 | GSM8565200 | 1 | RNA isolation using Qiagen Rneasy micro kit Bulk RNAseq was performed as a service by BGI China. Samples were paired end sequenced using the DNBSEQ platform. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | DNBSEQ | DNBSEQ-G400 | SRP537826 | mut_1_1.fq.gz mut_1_2.fq.gz | fastq fastq | 4425052600.0 | 22125263.0 | GSM8565200 r1 | 0:100 1:100 | A:1161989932;C:1055452567;G:1055912540;T:1151697561;N:0 | 100 | 100 | 1161989932 | 1055452567 | 1055912540 | 1151697561 | 0 | SRX26349625 | SRS22874779 | SRA1990217 | Department of Cellular and Molecular Medicine, University of Copenhagen | Department of Cellular and Molecular Medicine, University of Copenhagen | B | B | biological fallback assumption | bgi | bgi | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | Denmark | 2024-10-10 | Larval | Larval | Heart | Cardiovascular System | ||||||||||||||||||||||||
| 33940 | 33940 | SRR31020091 | SRX26407233 | SRS22927356 | SRP538990 | PRJNA1173772 | Cardiac Transcriptional Enhancer is Repurposed During Regeneration to Activate an Anti proliferative Program | GSE279653 | Transcriptome Analysis | Zebrafish have a high capacity to regenerate their xxx post injury.Several studies have surveyed transcriptional enhancers to understand how the dynamics of gene expression are controlled during heart regeneration. We have identified a cardiac transcriptional enhancer that is activated at the site of injury called the runx1 enhancer or REN since it regulates the expression of nearby gene runx1. REN is usually active in cardiomyocytes CMs and epicardial tissues surrounding the cardiac valves of uninjured zebrafish hearts. However when REN is activated in regenerating CM and epicardial tissues at the injury site it is concurrently downregulated around the distal heart valve. Deletion of REN ?REN results in excess Collagen around uninjured zebrafish cardiac valves. This ?REN Collagen phenotype is rescued with a runx1 deletion ?runx1 suggesting that REN and runx1 function in different genetic pathways in uninjured hearts. A different nearby gene that does change expression around valves in ?REN mutant hearts is adamts1 which encodes a metalloproteinase that degrades Collagen. Taken together this suggests that in uninjured hearts REN regulates adamts1 independently of runx1. However during regeneration CM proliferation at the site of injury is enhanced in both ?REN and ?runx1 mutants suggesting that REN is rewired to runx1 to stimulate its transcription. There are two previous descriptions for how enhancers are activated during regeneration. First cis regulatory sequences are reactivated from embryogenesis and second that active adult enhancers are further invigorated during regeneration. Our data point to a third and previously unappreciated mechanism for gene control during zebrafish heart regeneration. We report that an enhancer is repurposed both from one gene and cardiac domain to activate a different nearby gene in regenerating cardiac tissue. Overall design: Comparitive gene expression analysis of REN mutant and Wildtype hearts under uninjured and regenerating 7dpi conditions using bulk RNA se… | pubmed:39803985 | Zebrafish heart REN +/+ regenerating 7dpi replicate 3 | GSM8577528 | source name:Heart|tissue:Heart|genotype:delta REN +/ |treatment:Regenerating 7dpi|geo loc name:missing|collection date:missing | Zebrafish heart REN +/+ regenerating 7dpi replicate 3 | Demultiplexed and quality filtered reads were aligned to the Danio rerio reference genome GRCz10 using Hierarchical Indexing for Spliced Alignment of Transcripts 2 HISAT2 Read counts for each gene were quantified using featureCounts software Assembly: Danio rerio reference genome GRCz10 Supplementary files format and content: tab separated feature counts output text file | Heart | Total RNA was extracted using Trizol method Messenger RNA was purified from total RNA using poly T oligo attached magnetic beads. post fragmentation the first strand cDNA was synthesized using random hexamer primers followed by the second strand cDNA synthesis using either dUTP for directional library or dTTP for non directional library. For the non directional library it was ready post end repair A tailing adapter ligation size selection amplification and purification. For the directional library it was ready post end repair A tailing adapter ligation size selection USER enzyme digestion amplification and purification. The library was checked with Qubit and real time PCR for quantification and bioanalyzer for size distribution detection. Quantified libraries were pooled and sequenced on Illumina platforms according to effective library concentration and data amount. Bulk RNA sequencing | Adults less than 1 year old were used for all the experiments. Males and females were mixed in similar proportions in each of the conditions. | tissue:Heart|genotype:delta REN +/ |treatment:Regenerating 7dpi | GSM8577528 | GSM8577528: Zebrafish heart REN +/+ regenerating 7dpi replicate 3; Danio rerio; RNA Seq | GSM8577528 r1 | GSM8577528 | 1 | Total RNA was extracted using Trizol method Messenger RNA was purified from total RNA using poly T oligo attached magnetic beads. post fragmentation the first strand cDNA was synthesized using random hexamer primers followed by the second strand cDNA synthesis using either dUTP for directional library or dTTP for non directional library. For the non directional library it was ready post end repair A tailing adapter ligation size selection amplification and purification. For the directional library it was ready post end repair A tailing adapter ligation size selection USER enzyme digestion amplification and purification. The library was checked with Qubit and real time PCR for quantification and bioanalyzer for size distribution detection. Quantified libraries were pooled and sequenced on Illumina platforms according to effective library concentration and data amount. Bulk RNA sequencing | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP538990 | RENWT_7dpi_Rep3_1.fq.gz RENWT_7dpi_Rep3_2.fq.gz | fastq fastq | 13931436300.0 | 46438121.0 | GSM8577528 r1 | 0:150 1:150 | A:3567416261;C:3376571671;G:3539618547;T:3445632600;N:2197221 | 150 | 150 | 3567416261 | 3376571671 | 3539618547 | 3445632600 | 2197221 | SRX26407233 | SRS22927356 | SRA1992688 | Department of Biomedical Informatics College of Medicine, Ohio State University | Department of Biomedical Informatics College of Medicine, Ohio State University | B | B | biological fallback assumption | illumina | novaseq_era | unknown | random_priming | unknown | bulk | bulk | bulk | United States | 2024-10-16 | Adult | Adult | Heart | Cardiovascular System | ||||||||||||||||||||||
| 33941 | 33941 | SRR31020092 | SRX26407232 | SRS22927353 | SRP538990 | PRJNA1173772 | Cardiac Transcriptional Enhancer is Repurposed During Regeneration to Activate an Anti proliferative Program | GSE279653 | Transcriptome Analysis | Zebrafish have a high capacity to regenerate their xxx post injury.Several studies have surveyed transcriptional enhancers to understand how the dynamics of gene expression are controlled during heart regeneration. We have identified a cardiac transcriptional enhancer that is activated at the site of injury called the runx1 enhancer or REN since it regulates the expression of nearby gene runx1. REN is usually active in cardiomyocytes CMs and epicardial tissues surrounding the cardiac valves of uninjured zebrafish hearts. However when REN is activated in regenerating CM and epicardial tissues at the injury site it is concurrently downregulated around the distal heart valve. Deletion of REN ?REN results in excess Collagen around uninjured zebrafish cardiac valves. This ?REN Collagen phenotype is rescued with a runx1 deletion ?runx1 suggesting that REN and runx1 function in different genetic pathways in uninjured hearts. A different nearby gene that does change expression around valves in ?REN mutant hearts is adamts1 which encodes a metalloproteinase that degrades Collagen. Taken together this suggests that in uninjured hearts REN regulates adamts1 independently of runx1. However during regeneration CM proliferation at the site of injury is enhanced in both ?REN and ?runx1 mutants suggesting that REN is rewired to runx1 to stimulate its transcription. There are two previous descriptions for how enhancers are activated during regeneration. First cis regulatory sequences are reactivated from embryogenesis and second that active adult enhancers are further invigorated during regeneration. Our data point to a third and previously unappreciated mechanism for gene control during zebrafish heart regeneration. We report that an enhancer is repurposed both from one gene and cardiac domain to activate a different nearby gene in regenerating cardiac tissue. Overall design: Comparitive gene expression analysis of REN mutant and Wildtype hearts under uninjured and regenerating 7dpi conditions using bulk RNA se… | pubmed:39803985 | Zebrafish heart REN +/+ regenerating 7dpi replicate 2 | GSM8577527 | source name:Heart|tissue:Heart|genotype:delta REN +/ |treatment:Regenerating 7dpi|geo loc name:missing|collection date:missing | Zebrafish heart REN +/+ regenerating 7dpi replicate 2 | Demultiplexed and quality filtered reads were aligned to the Danio rerio reference genome GRCz10 using Hierarchical Indexing for Spliced Alignment of Transcripts 2 HISAT2 Read counts for each gene were quantified using featureCounts software Assembly: Danio rerio reference genome GRCz10 Supplementary files format and content: tab separated feature counts output text file | Heart | Total RNA was extracted using Trizol method Messenger RNA was purified from total RNA using poly T oligo attached magnetic beads. post fragmentation the first strand cDNA was synthesized using random hexamer primers followed by the second strand cDNA synthesis using either dUTP for directional library or dTTP for non directional library. For the non directional library it was ready post end repair A tailing adapter ligation size selection amplification and purification. For the directional library it was ready post end repair A tailing adapter ligation size selection USER enzyme digestion amplification and purification. The library was checked with Qubit and real time PCR for quantification and bioanalyzer for size distribution detection. Quantified libraries were pooled and sequenced on Illumina platforms according to effective library concentration and data amount. Bulk RNA sequencing | Adults less than 1 year old were used for all the experiments. Males and females were mixed in similar proportions in each of the conditions. | tissue:Heart|genotype:delta REN +/ |treatment:Regenerating 7dpi | GSM8577527 | GSM8577527: Zebrafish heart REN +/+ regenerating 7dpi replicate 2; Danio rerio; RNA Seq | GSM8577527 r1 | GSM8577527 | 1 | Total RNA was extracted using Trizol method Messenger RNA was purified from total RNA using poly T oligo attached magnetic beads. post fragmentation the first strand cDNA was synthesized using random hexamer primers followed by the second strand cDNA synthesis using either dUTP for directional library or dTTP for non directional library. For the non directional library it was ready post end repair A tailing adapter ligation size selection amplification and purification. For the directional library it was ready post end repair A tailing adapter ligation size selection USER enzyme digestion amplification and purification. The library was checked with Qubit and real time PCR for quantification and bioanalyzer for size distribution detection. Quantified libraries were pooled and sequenced on Illumina platforms according to effective library concentration and data amount. Bulk RNA sequencing | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP538990 | RENWT_7dpi_Rep2_1.fq.gz RENWT_7dpi_Rep2_2.fq.gz | fastq fastq | 15375644400.0 | 51252148.0 | GSM8577527 r1 | 0:150 1:150 | A:3443885116;C:4245128403;G:4416639918;T:3267584161;N:2406802 | 150 | 150 | 3443885116 | 4245128403 | 4416639918 | 3267584161 | 2406802 | SRX26407232 | SRS22927353 | SRA1992688 | Department of Biomedical Informatics College of Medicine, Ohio State University | Department of Biomedical Informatics College of Medicine, Ohio State University | B | B | biological fallback assumption | illumina | novaseq_era | unknown | random_priming | unknown | bulk | bulk | bulk | United States | 2024-10-16 | Adult | Adult | Heart | Cardiovascular System | ||||||||||||||||||||||
| 33942 | 33942 | SRR31020093 | SRX26407231 | SRS22927355 | SRP538990 | PRJNA1173772 | Cardiac Transcriptional Enhancer is Repurposed During Regeneration to Activate an Anti proliferative Program | GSE279653 | Transcriptome Analysis | Zebrafish have a high capacity to regenerate their xxx post injury.Several studies have surveyed transcriptional enhancers to understand how the dynamics of gene expression are controlled during heart regeneration. We have identified a cardiac transcriptional enhancer that is activated at the site of injury called the runx1 enhancer or REN since it regulates the expression of nearby gene runx1. REN is usually active in cardiomyocytes CMs and epicardial tissues surrounding the cardiac valves of uninjured zebrafish hearts. However when REN is activated in regenerating CM and epicardial tissues at the injury site it is concurrently downregulated around the distal heart valve. Deletion of REN ?REN results in excess Collagen around uninjured zebrafish cardiac valves. This ?REN Collagen phenotype is rescued with a runx1 deletion ?runx1 suggesting that REN and runx1 function in different genetic pathways in uninjured hearts. A different nearby gene that does change expression around valves in ?REN mutant hearts is adamts1 which encodes a metalloproteinase that degrades Collagen. Taken together this suggests that in uninjured hearts REN regulates adamts1 independently of runx1. However during regeneration CM proliferation at the site of injury is enhanced in both ?REN and ?runx1 mutants suggesting that REN is rewired to runx1 to stimulate its transcription. There are two previous descriptions for how enhancers are activated during regeneration. First cis regulatory sequences are reactivated from embryogenesis and second that active adult enhancers are further invigorated during regeneration. Our data point to a third and previously unappreciated mechanism for gene control during zebrafish heart regeneration. We report that an enhancer is repurposed both from one gene and cardiac domain to activate a different nearby gene in regenerating cardiac tissue. Overall design: Comparitive gene expression analysis of REN mutant and Wildtype hearts under uninjured and regenerating 7dpi conditions using bulk RNA se… | pubmed:39803985 | Zebrafish heart REN +/+ regenerating 7dpi replicate 1 | GSM8577526 | source name:Heart|tissue:Heart|genotype:delta REN +/ |treatment:Regenerating 7dpi|geo loc name:missing|collection date:missing | Zebrafish heart REN +/+ regenerating 7dpi replicate 1 | Demultiplexed and quality filtered reads were aligned to the Danio rerio reference genome GRCz10 using Hierarchical Indexing for Spliced Alignment of Transcripts 2 HISAT2 Read counts for each gene were quantified using featureCounts software Assembly: Danio rerio reference genome GRCz10 Supplementary files format and content: tab separated feature counts output text file | Heart | Total RNA was extracted using Trizol method Messenger RNA was purified from total RNA using poly T oligo attached magnetic beads. post fragmentation the first strand cDNA was synthesized using random hexamer primers followed by the second strand cDNA synthesis using either dUTP for directional library or dTTP for non directional library. For the non directional library it was ready post end repair A tailing adapter ligation size selection amplification and purification. For the directional library it was ready post end repair A tailing adapter ligation size selection USER enzyme digestion amplification and purification. The library was checked with Qubit and real time PCR for quantification and bioanalyzer for size distribution detection. Quantified libraries were pooled and sequenced on Illumina platforms according to effective library concentration and data amount. Bulk RNA sequencing | Adults less than 1 year old were used for all the experiments. Males and females were mixed in similar proportions in each of the conditions. | tissue:Heart|genotype:delta REN +/ |treatment:Regenerating 7dpi | GSM8577526 | GSM8577526: Zebrafish heart REN +/+ regenerating 7dpi replicate 1; Danio rerio; RNA Seq | GSM8577526 r1 | GSM8577526 | 1 | Total RNA was extracted using Trizol method Messenger RNA was purified from total RNA using poly T oligo attached magnetic beads. post fragmentation the first strand cDNA was synthesized using random hexamer primers followed by the second strand cDNA synthesis using either dUTP for directional library or dTTP for non directional library. For the non directional library it was ready post end repair A tailing adapter ligation size selection amplification and purification. For the directional library it was ready post end repair A tailing adapter ligation size selection USER enzyme digestion amplification and purification. The library was checked with Qubit and real time PCR for quantification and bioanalyzer for size distribution detection. Quantified libraries were pooled and sequenced on Illumina platforms according to effective library concentration and data amount. Bulk RNA sequencing | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP538990 | RENWT_7dpi_Rep1_1.fq.gz RENWT_7dpi_Rep1_2.fq.gz | fastq fastq | 16081746600.0 | 53605822.0 | GSM8577526 r1 | 0:150 1:150 | A:3627778422;C:4412746186;G:4540450594;T:3498261965;N:2509433 | 150 | 150 | 3627778422 | 4412746186 | 4540450594 | 3498261965 | 2509433 | SRX26407231 | SRS22927355 | SRA1992688 | Department of Biomedical Informatics College of Medicine, Ohio State University | Department of Biomedical Informatics College of Medicine, Ohio State University | B | B | biological fallback assumption | illumina | novaseq_era | unknown | random_priming | unknown | bulk | bulk | bulk | United States | 2024-10-16 | Adult | Adult | Heart | Cardiovascular System | ||||||||||||||||||||||
| 33943 | 33943 | SRR31020094 | SRX26407230 | SRS22927354 | SRP538990 | PRJNA1173772 | Cardiac Transcriptional Enhancer is Repurposed During Regeneration to Activate an Anti proliferative Program | GSE279653 | Transcriptome Analysis | Zebrafish have a high capacity to regenerate their xxx post injury.Several studies have surveyed transcriptional enhancers to understand how the dynamics of gene expression are controlled during heart regeneration. We have identified a cardiac transcriptional enhancer that is activated at the site of injury called the runx1 enhancer or REN since it regulates the expression of nearby gene runx1. REN is usually active in cardiomyocytes CMs and epicardial tissues surrounding the cardiac valves of uninjured zebrafish hearts. However when REN is activated in regenerating CM and epicardial tissues at the injury site it is concurrently downregulated around the distal heart valve. Deletion of REN ?REN results in excess Collagen around uninjured zebrafish cardiac valves. This ?REN Collagen phenotype is rescued with a runx1 deletion ?runx1 suggesting that REN and runx1 function in different genetic pathways in uninjured hearts. A different nearby gene that does change expression around valves in ?REN mutant hearts is adamts1 which encodes a metalloproteinase that degrades Collagen. Taken together this suggests that in uninjured hearts REN regulates adamts1 independently of runx1. However during regeneration CM proliferation at the site of injury is enhanced in both ?REN and ?runx1 mutants suggesting that REN is rewired to runx1 to stimulate its transcription. There are two previous descriptions for how enhancers are activated during regeneration. First cis regulatory sequences are reactivated from embryogenesis and second that active adult enhancers are further invigorated during regeneration. Our data point to a third and previously unappreciated mechanism for gene control during zebrafish heart regeneration. We report that an enhancer is repurposed both from one gene and cardiac domain to activate a different nearby gene in regenerating cardiac tissue. Overall design: Comparitive gene expression analysis of REN mutant and Wildtype hearts under uninjured and regenerating 7dpi conditions using bulk RNA se… | pubmed:39803985 | Zebrafish heart REN +/+ uninjured replicate 3 | GSM8577525 | source name:Heart|tissue:Heart|genotype:delta REN +/ |treatment:Untreated uninjured|geo loc name:missing|collection date:missing | Zebrafish heart REN +/+ uninjured replicate 3 | Demultiplexed and quality filtered reads were aligned to the Danio rerio reference genome GRCz10 using Hierarchical Indexing for Spliced Alignment of Transcripts 2 HISAT2 Read counts for each gene were quantified using featureCounts software Assembly: Danio rerio reference genome GRCz10 Supplementary files format and content: tab separated feature counts output text file | Heart | Total RNA was extracted using Trizol method Messenger RNA was purified from total RNA using poly T oligo attached magnetic beads. post fragmentation the first strand cDNA was synthesized using random hexamer primers followed by the second strand cDNA synthesis using either dUTP for directional library or dTTP for non directional library. For the non directional library it was ready post end repair A tailing adapter ligation size selection amplification and purification. For the directional library it was ready post end repair A tailing adapter ligation size selection USER enzyme digestion amplification and purification. The library was checked with Qubit and real time PCR for quantification and bioanalyzer for size distribution detection. Quantified libraries were pooled and sequenced on Illumina platforms according to effective library concentration and data amount. Bulk RNA sequencing | Adults less than 1 year old were used for all the experiments. Males and females were mixed in similar proportions in each of the conditions. | tissue:Heart|genotype:delta REN +/ |treatment:Untreated uninjured | GSM8577525 | GSM8577525: Zebrafish heart REN +/+ uninjured replicate 3; Danio rerio; RNA Seq | GSM8577525 r1 | GSM8577525 | 1 | Total RNA was extracted using Trizol method Messenger RNA was purified from total RNA using poly T oligo attached magnetic beads. post fragmentation the first strand cDNA was synthesized using random hexamer primers followed by the second strand cDNA synthesis using either dUTP for directional library or dTTP for non directional library. For the non directional library it was ready post end repair A tailing adapter ligation size selection amplification and purification. For the directional library it was ready post end repair A tailing adapter ligation size selection USER enzyme digestion amplification and purification. The library was checked with Qubit and real time PCR for quantification and bioanalyzer for size distribution detection. Quantified libraries were pooled and sequenced on Illumina platforms according to effective library concentration and data amount. Bulk RNA sequencing | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP538990 | RENWT_Uninj_Rep3_1.fq.gz RENWT_Uninj_Rep3_2.fq.gz | fastq fastq | 7955942400.0 | 26519808.0 | GSM8577525 r1 | 0:150 1:150 | A:1807152456;C:2177654736;G:2249016767;T:1722027592;N:90849 | 150 | 150 | 1807152456 | 2177654736 | 2249016767 | 1722027592 | 90849 | SRX26407230 | SRS22927354 | SRA1992688 | Department of Biomedical Informatics College of Medicine, Ohio State University | Department of Biomedical Informatics College of Medicine, Ohio State University | B | B | biological fallback assumption | illumina | novaseq_era | unknown | random_priming | unknown | bulk | bulk | bulk | United States | 2024-10-16 | Adult | Adult | Heart | Cardiovascular System | ||||||||||||||||||||||
| 33944 | 33944 | SRR31020095 | SRX26407229 | SRS22927350 | SRP538990 | PRJNA1173772 | Cardiac Transcriptional Enhancer is Repurposed During Regeneration to Activate an Anti proliferative Program | GSE279653 | Transcriptome Analysis | Zebrafish have a high capacity to regenerate their xxx post injury.Several studies have surveyed transcriptional enhancers to understand how the dynamics of gene expression are controlled during heart regeneration. We have identified a cardiac transcriptional enhancer that is activated at the site of injury called the runx1 enhancer or REN since it regulates the expression of nearby gene runx1. REN is usually active in cardiomyocytes CMs and epicardial tissues surrounding the cardiac valves of uninjured zebrafish hearts. However when REN is activated in regenerating CM and epicardial tissues at the injury site it is concurrently downregulated around the distal heart valve. Deletion of REN ?REN results in excess Collagen around uninjured zebrafish cardiac valves. This ?REN Collagen phenotype is rescued with a runx1 deletion ?runx1 suggesting that REN and runx1 function in different genetic pathways in uninjured hearts. A different nearby gene that does change expression around valves in ?REN mutant hearts is adamts1 which encodes a metalloproteinase that degrades Collagen. Taken together this suggests that in uninjured hearts REN regulates adamts1 independently of runx1. However during regeneration CM proliferation at the site of injury is enhanced in both ?REN and ?runx1 mutants suggesting that REN is rewired to runx1 to stimulate its transcription. There are two previous descriptions for how enhancers are activated during regeneration. First cis regulatory sequences are reactivated from embryogenesis and second that active adult enhancers are further invigorated during regeneration. Our data point to a third and previously unappreciated mechanism for gene control during zebrafish heart regeneration. We report that an enhancer is repurposed both from one gene and cardiac domain to activate a different nearby gene in regenerating cardiac tissue. Overall design: Comparitive gene expression analysis of REN mutant and Wildtype hearts under uninjured and regenerating 7dpi conditions using bulk RNA se… | pubmed:39803985 | Zebrafish heart REN +/+ uninjured replicate 2 | GSM8577524 | source name:Heart|tissue:Heart|genotype:delta REN +/ |treatment:Untreated uninjured|geo loc name:missing|collection date:missing | Zebrafish heart REN +/+ uninjured replicate 2 | Demultiplexed and quality filtered reads were aligned to the Danio rerio reference genome GRCz10 using Hierarchical Indexing for Spliced Alignment of Transcripts 2 HISAT2 Read counts for each gene were quantified using featureCounts software Assembly: Danio rerio reference genome GRCz10 Supplementary files format and content: tab separated feature counts output text file | Heart | Total RNA was extracted using Trizol method Messenger RNA was purified from total RNA using poly T oligo attached magnetic beads. post fragmentation the first strand cDNA was synthesized using random hexamer primers followed by the second strand cDNA synthesis using either dUTP for directional library or dTTP for non directional library. For the non directional library it was ready post end repair A tailing adapter ligation size selection amplification and purification. For the directional library it was ready post end repair A tailing adapter ligation size selection USER enzyme digestion amplification and purification. The library was checked with Qubit and real time PCR for quantification and bioanalyzer for size distribution detection. Quantified libraries were pooled and sequenced on Illumina platforms according to effective library concentration and data amount. Bulk RNA sequencing | Adults less than 1 year old were used for all the experiments. Males and females were mixed in similar proportions in each of the conditions. | tissue:Heart|genotype:delta REN +/ |treatment:Untreated uninjured | GSM8577524 | GSM8577524: Zebrafish heart REN +/+ uninjured replicate 2; Danio rerio; RNA Seq | GSM8577524 r1 | GSM8577524 | 1 | Total RNA was extracted using Trizol method Messenger RNA was purified from total RNA using poly T oligo attached magnetic beads. post fragmentation the first strand cDNA was synthesized using random hexamer primers followed by the second strand cDNA synthesis using either dUTP for directional library or dTTP for non directional library. For the non directional library it was ready post end repair A tailing adapter ligation size selection amplification and purification. For the directional library it was ready post end repair A tailing adapter ligation size selection USER enzyme digestion amplification and purification. The library was checked with Qubit and real time PCR for quantification and bioanalyzer for size distribution detection. Quantified libraries were pooled and sequenced on Illumina platforms according to effective library concentration and data amount. Bulk RNA sequencing | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP538990 | RENWT_Uninj_Rep2_1.fq.gz RENWT_Uninj_Rep2_2.fq.gz | fastq fastq | 11956089900.0 | 39853633.0 | GSM8577524 r1 | 0:150 1:150 | A:2662728381;C:3323563436;G:3404000084;T:2563922915;N:1875084 | 150 | 150 | 2662728381 | 3323563436 | 3404000084 | 2563922915 | 1875084 | SRX26407229 | SRS22927350 | SRA1992688 | Department of Biomedical Informatics College of Medicine, Ohio State University | Department of Biomedical Informatics College of Medicine, Ohio State University | B | B | biological fallback assumption | illumina | novaseq_era | unknown | random_priming | unknown | bulk | bulk | bulk | United States | 2024-10-16 | Adult | Adult | Heart | Cardiovascular System | ||||||||||||||||||||||
| 33945 | 33945 | SRR31020096 | SRX26407228 | SRS22927352 | SRP538990 | PRJNA1173772 | Cardiac Transcriptional Enhancer is Repurposed During Regeneration to Activate an Anti proliferative Program | GSE279653 | Transcriptome Analysis | Zebrafish have a high capacity to regenerate their xxx post injury.Several studies have surveyed transcriptional enhancers to understand how the dynamics of gene expression are controlled during heart regeneration. We have identified a cardiac transcriptional enhancer that is activated at the site of injury called the runx1 enhancer or REN since it regulates the expression of nearby gene runx1. REN is usually active in cardiomyocytes CMs and epicardial tissues surrounding the cardiac valves of uninjured zebrafish hearts. However when REN is activated in regenerating CM and epicardial tissues at the injury site it is concurrently downregulated around the distal heart valve. Deletion of REN ?REN results in excess Collagen around uninjured zebrafish cardiac valves. This ?REN Collagen phenotype is rescued with a runx1 deletion ?runx1 suggesting that REN and runx1 function in different genetic pathways in uninjured hearts. A different nearby gene that does change expression around valves in ?REN mutant hearts is adamts1 which encodes a metalloproteinase that degrades Collagen. Taken together this suggests that in uninjured hearts REN regulates adamts1 independently of runx1. However during regeneration CM proliferation at the site of injury is enhanced in both ?REN and ?runx1 mutants suggesting that REN is rewired to runx1 to stimulate its transcription. There are two previous descriptions for how enhancers are activated during regeneration. First cis regulatory sequences are reactivated from embryogenesis and second that active adult enhancers are further invigorated during regeneration. Our data point to a third and previously unappreciated mechanism for gene control during zebrafish heart regeneration. We report that an enhancer is repurposed both from one gene and cardiac domain to activate a different nearby gene in regenerating cardiac tissue. Overall design: Comparitive gene expression analysis of REN mutant and Wildtype hearts under uninjured and regenerating 7dpi conditions using bulk RNA se… | pubmed:39803985 | Zebrafish heart REN +/+ uninjured replicate 1 | GSM8577523 | source name:Heart|tissue:Heart|genotype:delta REN +/ |treatment:Untreated uninjured|geo loc name:missing|collection date:missing | Zebrafish heart REN +/+ uninjured replicate 1 | Demultiplexed and quality filtered reads were aligned to the Danio rerio reference genome GRCz10 using Hierarchical Indexing for Spliced Alignment of Transcripts 2 HISAT2 Read counts for each gene were quantified using featureCounts software Assembly: Danio rerio reference genome GRCz10 Supplementary files format and content: tab separated feature counts output text file | Heart | Total RNA was extracted using Trizol method Messenger RNA was purified from total RNA using poly T oligo attached magnetic beads. post fragmentation the first strand cDNA was synthesized using random hexamer primers followed by the second strand cDNA synthesis using either dUTP for directional library or dTTP for non directional library. For the non directional library it was ready post end repair A tailing adapter ligation size selection amplification and purification. For the directional library it was ready post end repair A tailing adapter ligation size selection USER enzyme digestion amplification and purification. The library was checked with Qubit and real time PCR for quantification and bioanalyzer for size distribution detection. Quantified libraries were pooled and sequenced on Illumina platforms according to effective library concentration and data amount. Bulk RNA sequencing | Adults less than 1 year old were used for all the experiments. Males and females were mixed in similar proportions in each of the conditions. | tissue:Heart|genotype:delta REN +/ |treatment:Untreated uninjured | GSM8577523 | GSM8577523: Zebrafish heart REN +/+ uninjured replicate 1; Danio rerio; RNA Seq | GSM8577523 r1 | GSM8577523 | 1 | Total RNA was extracted using Trizol method Messenger RNA was purified from total RNA using poly T oligo attached magnetic beads. post fragmentation the first strand cDNA was synthesized using random hexamer primers followed by the second strand cDNA synthesis using either dUTP for directional library or dTTP for non directional library. For the non directional library it was ready post end repair A tailing adapter ligation size selection amplification and purification. For the directional library it was ready post end repair A tailing adapter ligation size selection USER enzyme digestion amplification and purification. The library was checked with Qubit and real time PCR for quantification and bioanalyzer for size distribution detection. Quantified libraries were pooled and sequenced on Illumina platforms according to effective library concentration and data amount. Bulk RNA sequencing | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP538990 | RENWT_Uninj_Rep1_1.fq.gz RENWT_Uninj_Rep1_2.fq.gz | fastq fastq | 13769743800.0 | 45899146.0 | GSM8577523 r1 | 0:150 1:150 | A:3054419475;C:3842326551;G:3936228779;T:2936583687;N:185308 | 150 | 150 | 3054419475 | 3842326551 | 3936228779 | 2936583687 | 185308 | SRX26407228 | SRS22927352 | SRA1992688 | Department of Biomedical Informatics College of Medicine, Ohio State University | Department of Biomedical Informatics College of Medicine, Ohio State University | B | B | biological fallback assumption | illumina | novaseq_era | unknown | random_priming | unknown | bulk | bulk | bulk | United States | 2024-10-16 | Adult | Adult | Heart | Cardiovascular System | ||||||||||||||||||||||
| 33946 | 33946 | SRR31020097 | SRX26407227 | SRS22927351 | SRP538990 | PRJNA1173772 | Cardiac Transcriptional Enhancer is Repurposed During Regeneration to Activate an Anti proliferative Program | GSE279653 | Transcriptome Analysis | Zebrafish have a high capacity to regenerate their xxx post injury.Several studies have surveyed transcriptional enhancers to understand how the dynamics of gene expression are controlled during heart regeneration. We have identified a cardiac transcriptional enhancer that is activated at the site of injury called the runx1 enhancer or REN since it regulates the expression of nearby gene runx1. REN is usually active in cardiomyocytes CMs and epicardial tissues surrounding the cardiac valves of uninjured zebrafish hearts. However when REN is activated in regenerating CM and epicardial tissues at the injury site it is concurrently downregulated around the distal heart valve. Deletion of REN ?REN results in excess Collagen around uninjured zebrafish cardiac valves. This ?REN Collagen phenotype is rescued with a runx1 deletion ?runx1 suggesting that REN and runx1 function in different genetic pathways in uninjured hearts. A different nearby gene that does change expression around valves in ?REN mutant hearts is adamts1 which encodes a metalloproteinase that degrades Collagen. Taken together this suggests that in uninjured hearts REN regulates adamts1 independently of runx1. However during regeneration CM proliferation at the site of injury is enhanced in both ?REN and ?runx1 mutants suggesting that REN is rewired to runx1 to stimulate its transcription. There are two previous descriptions for how enhancers are activated during regeneration. First cis regulatory sequences are reactivated from embryogenesis and second that active adult enhancers are further invigorated during regeneration. Our data point to a third and previously unappreciated mechanism for gene control during zebrafish heart regeneration. We report that an enhancer is repurposed both from one gene and cardiac domain to activate a different nearby gene in regenerating cardiac tissue. Overall design: Comparitive gene expression analysis of REN mutant and Wildtype hearts under uninjured and regenerating 7dpi conditions using bulk RNA se… | pubmed:39803985 | Zebrafish heart REN / regenerating 7dpi replicate 3 | GSM8577522 | source name:Heart|tissue:Heart|genotype:delta REN / |treatment:Regenerating 7dpi|geo loc name:missing|collection date:missing | Zebrafish heart REN / regenerating 7dpi replicate 3 | Demultiplexed and quality filtered reads were aligned to the Danio rerio reference genome GRCz10 using Hierarchical Indexing for Spliced Alignment of Transcripts 2 HISAT2 Read counts for each gene were quantified using featureCounts software Assembly: Danio rerio reference genome GRCz10 Supplementary files format and content: tab separated feature counts output text file | Heart | Total RNA was extracted using Trizol method Messenger RNA was purified from total RNA using poly T oligo attached magnetic beads. post fragmentation the first strand cDNA was synthesized using random hexamer primers followed by the second strand cDNA synthesis using either dUTP for directional library or dTTP for non directional library. For the non directional library it was ready post end repair A tailing adapter ligation size selection amplification and purification. For the directional library it was ready post end repair A tailing adapter ligation size selection USER enzyme digestion amplification and purification. The library was checked with Qubit and real time PCR for quantification and bioanalyzer for size distribution detection. Quantified libraries were pooled and sequenced on Illumina platforms according to effective library concentration and data amount. Bulk RNA sequencing | Adults less than 1 year old were used for all the experiments. Males and females were mixed in similar proportions in each of the conditions. | tissue:Heart|genotype:delta REN / |treatment:Regenerating 7dpi | GSM8577522 | GSM8577522: Zebrafish heart REN / regenerating 7dpi replicate 3; Danio rerio; RNA Seq | GSM8577522 r1 | GSM8577522 | 1 | Total RNA was extracted using Trizol method Messenger RNA was purified from total RNA using poly T oligo attached magnetic beads. post fragmentation the first strand cDNA was synthesized using random hexamer primers followed by the second strand cDNA synthesis using either dUTP for directional library or dTTP for non directional library. For the non directional library it was ready post end repair A tailing adapter ligation size selection amplification and purification. For the directional library it was ready post end repair A tailing adapter ligation size selection USER enzyme digestion amplification and purification. The library was checked with Qubit and real time PCR for quantification and bioanalyzer for size distribution detection. Quantified libraries were pooled and sequenced on Illumina platforms according to effective library concentration and data amount. Bulk RNA sequencing | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP538990 | RENmut_7dpi_Rep3_1.fq.gz RENmut_7dpi_Rep3_2.fq.gz | fastq fastq | 5352493500.0 | 17841645.0 | GSM8577522 r1 | 0:150 1:150 | A:1436076468;C:1242204736;G:1309484406;T:1363881999;N:845891 | 150 | 150 | 1436076468 | 1242204736 | 1309484406 | 1363881999 | 845891 | SRX26407227 | SRS22927351 | SRA1992688 | Department of Biomedical Informatics College of Medicine, Ohio State University | Department of Biomedical Informatics College of Medicine, Ohio State University | B | B | biological fallback assumption | illumina | novaseq_era | unknown | random_priming | unknown | bulk | bulk | bulk | United States | 2024-10-16 | Adult | Adult | Heart | Cardiovascular System | ||||||||||||||||||||||
| 33947 | 33947 | SRR31020098 | SRX26407226 | SRS22927347 | SRP538990 | PRJNA1173772 | Cardiac Transcriptional Enhancer is Repurposed During Regeneration to Activate an Anti proliferative Program | GSE279653 | Transcriptome Analysis | Zebrafish have a high capacity to regenerate their xxx post injury.Several studies have surveyed transcriptional enhancers to understand how the dynamics of gene expression are controlled during heart regeneration. We have identified a cardiac transcriptional enhancer that is activated at the site of injury called the runx1 enhancer or REN since it regulates the expression of nearby gene runx1. REN is usually active in cardiomyocytes CMs and epicardial tissues surrounding the cardiac valves of uninjured zebrafish hearts. However when REN is activated in regenerating CM and epicardial tissues at the injury site it is concurrently downregulated around the distal heart valve. Deletion of REN ?REN results in excess Collagen around uninjured zebrafish cardiac valves. This ?REN Collagen phenotype is rescued with a runx1 deletion ?runx1 suggesting that REN and runx1 function in different genetic pathways in uninjured hearts. A different nearby gene that does change expression around valves in ?REN mutant hearts is adamts1 which encodes a metalloproteinase that degrades Collagen. Taken together this suggests that in uninjured hearts REN regulates adamts1 independently of runx1. However during regeneration CM proliferation at the site of injury is enhanced in both ?REN and ?runx1 mutants suggesting that REN is rewired to runx1 to stimulate its transcription. There are two previous descriptions for how enhancers are activated during regeneration. First cis regulatory sequences are reactivated from embryogenesis and second that active adult enhancers are further invigorated during regeneration. Our data point to a third and previously unappreciated mechanism for gene control during zebrafish heart regeneration. We report that an enhancer is repurposed both from one gene and cardiac domain to activate a different nearby gene in regenerating cardiac tissue. Overall design: Comparitive gene expression analysis of REN mutant and Wildtype hearts under uninjured and regenerating 7dpi conditions using bulk RNA se… | pubmed:39803985 | Zebrafish heart REN / regenerating 7dpi replicate 2 | GSM8577521 | source name:Heart|tissue:Heart|genotype:delta REN / |treatment:Regenerating 7dpi|geo loc name:missing|collection date:missing | Zebrafish heart REN / regenerating 7dpi replicate 2 | Demultiplexed and quality filtered reads were aligned to the Danio rerio reference genome GRCz10 using Hierarchical Indexing for Spliced Alignment of Transcripts 2 HISAT2 Read counts for each gene were quantified using featureCounts software Assembly: Danio rerio reference genome GRCz10 Supplementary files format and content: tab separated feature counts output text file | Heart | Total RNA was extracted using Trizol method Messenger RNA was purified from total RNA using poly T oligo attached magnetic beads. post fragmentation the first strand cDNA was synthesized using random hexamer primers followed by the second strand cDNA synthesis using either dUTP for directional library or dTTP for non directional library. For the non directional library it was ready post end repair A tailing adapter ligation size selection amplification and purification. For the directional library it was ready post end repair A tailing adapter ligation size selection USER enzyme digestion amplification and purification. The library was checked with Qubit and real time PCR for quantification and bioanalyzer for size distribution detection. Quantified libraries were pooled and sequenced on Illumina platforms according to effective library concentration and data amount. Bulk RNA sequencing | Adults less than 1 year old were used for all the experiments. Males and females were mixed in similar proportions in each of the conditions. | tissue:Heart|genotype:delta REN / |treatment:Regenerating 7dpi | GSM8577521 | GSM8577521: Zebrafish heart REN / regenerating 7dpi replicate 2; Danio rerio; RNA Seq | GSM8577521 r1 | GSM8577521 | 1 | Total RNA was extracted using Trizol method Messenger RNA was purified from total RNA using poly T oligo attached magnetic beads. post fragmentation the first strand cDNA was synthesized using random hexamer primers followed by the second strand cDNA synthesis using either dUTP for directional library or dTTP for non directional library. For the non directional library it was ready post end repair A tailing adapter ligation size selection amplification and purification. For the directional library it was ready post end repair A tailing adapter ligation size selection USER enzyme digestion amplification and purification. The library was checked with Qubit and real time PCR for quantification and bioanalyzer for size distribution detection. Quantified libraries were pooled and sequenced on Illumina platforms according to effective library concentration and data amount. Bulk RNA sequencing | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP538990 | RENmut_7dpi_Rep2_1.fq.gz RENmut_7dpi_Rep2_2.fq.gz | fastq fastq | 13955721000.0 | 46519070.0 | GSM8577521 r1 | 0:150 1:150 | A:3217814296;C:3758561612;G:3907502717;T:3069654484;N:2187891 | 150 | 150 | 3217814296 | 3758561612 | 3907502717 | 3069654484 | 2187891 | SRX26407226 | SRS22927347 | SRA1992688 | Department of Biomedical Informatics College of Medicine, Ohio State University | Department of Biomedical Informatics College of Medicine, Ohio State University | B | B | biological fallback assumption | illumina | novaseq_era | unknown | random_priming | unknown | bulk | bulk | bulk | United States | 2024-10-16 | Adult | Adult | Heart | Cardiovascular System | ||||||||||||||||||||||
| 33948 | 33948 | SRR31020099 | SRX26407225 | SRS22927348 | SRP538990 | PRJNA1173772 | Cardiac Transcriptional Enhancer is Repurposed During Regeneration to Activate an Anti proliferative Program | GSE279653 | Transcriptome Analysis | Zebrafish have a high capacity to regenerate their xxx post injury.Several studies have surveyed transcriptional enhancers to understand how the dynamics of gene expression are controlled during heart regeneration. We have identified a cardiac transcriptional enhancer that is activated at the site of injury called the runx1 enhancer or REN since it regulates the expression of nearby gene runx1. REN is usually active in cardiomyocytes CMs and epicardial tissues surrounding the cardiac valves of uninjured zebrafish hearts. However when REN is activated in regenerating CM and epicardial tissues at the injury site it is concurrently downregulated around the distal heart valve. Deletion of REN ?REN results in excess Collagen around uninjured zebrafish cardiac valves. This ?REN Collagen phenotype is rescued with a runx1 deletion ?runx1 suggesting that REN and runx1 function in different genetic pathways in uninjured hearts. A different nearby gene that does change expression around valves in ?REN mutant hearts is adamts1 which encodes a metalloproteinase that degrades Collagen. Taken together this suggests that in uninjured hearts REN regulates adamts1 independently of runx1. However during regeneration CM proliferation at the site of injury is enhanced in both ?REN and ?runx1 mutants suggesting that REN is rewired to runx1 to stimulate its transcription. There are two previous descriptions for how enhancers are activated during regeneration. First cis regulatory sequences are reactivated from embryogenesis and second that active adult enhancers are further invigorated during regeneration. Our data point to a third and previously unappreciated mechanism for gene control during zebrafish heart regeneration. We report that an enhancer is repurposed both from one gene and cardiac domain to activate a different nearby gene in regenerating cardiac tissue. Overall design: Comparitive gene expression analysis of REN mutant and Wildtype hearts under uninjured and regenerating 7dpi conditions using bulk RNA se… | pubmed:39803985 | Zebrafish heart REN / regenerating 7dpi replicate 1 | GSM8577520 | source name:Heart|tissue:Heart|genotype:delta REN / |treatment:Regenerating 7dpi|geo loc name:missing|collection date:missing | Zebrafish heart REN / regenerating 7dpi replicate 1 | Demultiplexed and quality filtered reads were aligned to the Danio rerio reference genome GRCz10 using Hierarchical Indexing for Spliced Alignment of Transcripts 2 HISAT2 Read counts for each gene were quantified using featureCounts software Assembly: Danio rerio reference genome GRCz10 Supplementary files format and content: tab separated feature counts output text file | Heart | Total RNA was extracted using Trizol method Messenger RNA was purified from total RNA using poly T oligo attached magnetic beads. post fragmentation the first strand cDNA was synthesized using random hexamer primers followed by the second strand cDNA synthesis using either dUTP for directional library or dTTP for non directional library. For the non directional library it was ready post end repair A tailing adapter ligation size selection amplification and purification. For the directional library it was ready post end repair A tailing adapter ligation size selection USER enzyme digestion amplification and purification. The library was checked with Qubit and real time PCR for quantification and bioanalyzer for size distribution detection. Quantified libraries were pooled and sequenced on Illumina platforms according to effective library concentration and data amount. Bulk RNA sequencing | Adults less than 1 year old were used for all the experiments. Males and females were mixed in similar proportions in each of the conditions. | tissue:Heart|genotype:delta REN / |treatment:Regenerating 7dpi | GSM8577520 | GSM8577520: Zebrafish heart REN / regenerating 7dpi replicate 1; Danio rerio; RNA Seq | GSM8577520 r1 | GSM8577520 | 1 | Total RNA was extracted using Trizol method Messenger RNA was purified from total RNA using poly T oligo attached magnetic beads. post fragmentation the first strand cDNA was synthesized using random hexamer primers followed by the second strand cDNA synthesis using either dUTP for directional library or dTTP for non directional library. For the non directional library it was ready post end repair A tailing adapter ligation size selection amplification and purification. For the directional library it was ready post end repair A tailing adapter ligation size selection USER enzyme digestion amplification and purification. The library was checked with Qubit and real time PCR for quantification and bioanalyzer for size distribution detection. Quantified libraries were pooled and sequenced on Illumina platforms according to effective library concentration and data amount. Bulk RNA sequencing | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP538990 | RENmut_7dpi_Rep1_1.fq.gz RENmut_7dpi_Rep1_2.fq.gz | fastq fastq | 17097266700.0 | 56990889.0 | GSM8577520 r1 | 0:150 1:150 | A:4048171687;C:4507369631;G:4677599728;T:3861443302;N:2682352 | 150 | 150 | 4048171687 | 4507369631 | 4677599728 | 3861443302 | 2682352 | SRX26407225 | SRS22927348 | SRA1992688 | Department of Biomedical Informatics College of Medicine, Ohio State University | Department of Biomedical Informatics College of Medicine, Ohio State University | B | B | biological fallback assumption | illumina | novaseq_era | unknown | random_priming | unknown | bulk | bulk | bulk | United States | 2024-10-16 | Adult | Adult | Heart | Cardiovascular System | ||||||||||||||||||||||
| 33949 | 33949 | SRR31020100 | SRX26407224 | SRS22927346 | SRP538990 | PRJNA1173772 | Cardiac Transcriptional Enhancer is Repurposed During Regeneration to Activate an Anti proliferative Program | GSE279653 | Transcriptome Analysis | Zebrafish have a high capacity to regenerate their xxx post injury.Several studies have surveyed transcriptional enhancers to understand how the dynamics of gene expression are controlled during heart regeneration. We have identified a cardiac transcriptional enhancer that is activated at the site of injury called the runx1 enhancer or REN since it regulates the expression of nearby gene runx1. REN is usually active in cardiomyocytes CMs and epicardial tissues surrounding the cardiac valves of uninjured zebrafish hearts. However when REN is activated in regenerating CM and epicardial tissues at the injury site it is concurrently downregulated around the distal heart valve. Deletion of REN ?REN results in excess Collagen around uninjured zebrafish cardiac valves. This ?REN Collagen phenotype is rescued with a runx1 deletion ?runx1 suggesting that REN and runx1 function in different genetic pathways in uninjured hearts. A different nearby gene that does change expression around valves in ?REN mutant hearts is adamts1 which encodes a metalloproteinase that degrades Collagen. Taken together this suggests that in uninjured hearts REN regulates adamts1 independently of runx1. However during regeneration CM proliferation at the site of injury is enhanced in both ?REN and ?runx1 mutants suggesting that REN is rewired to runx1 to stimulate its transcription. There are two previous descriptions for how enhancers are activated during regeneration. First cis regulatory sequences are reactivated from embryogenesis and second that active adult enhancers are further invigorated during regeneration. Our data point to a third and previously unappreciated mechanism for gene control during zebrafish heart regeneration. We report that an enhancer is repurposed both from one gene and cardiac domain to activate a different nearby gene in regenerating cardiac tissue. Overall design: Comparitive gene expression analysis of REN mutant and Wildtype hearts under uninjured and regenerating 7dpi conditions using bulk RNA se… | pubmed:39803985 | Zebrafish heart REN / uninjured replicate 3 | GSM8577519 | source name:Heart|tissue:Heart|genotype:delta REN / |treatment:Untreated uninjured|geo loc name:missing|collection date:missing | Zebrafish heart REN / uninjured replicate 3 | Demultiplexed and quality filtered reads were aligned to the Danio rerio reference genome GRCz10 using Hierarchical Indexing for Spliced Alignment of Transcripts 2 HISAT2 Read counts for each gene were quantified using featureCounts software Assembly: Danio rerio reference genome GRCz10 Supplementary files format and content: tab separated feature counts output text file | Heart | Total RNA was extracted using Trizol method Messenger RNA was purified from total RNA using poly T oligo attached magnetic beads. post fragmentation the first strand cDNA was synthesized using random hexamer primers followed by the second strand cDNA synthesis using either dUTP for directional library or dTTP for non directional library. For the non directional library it was ready post end repair A tailing adapter ligation size selection amplification and purification. For the directional library it was ready post end repair A tailing adapter ligation size selection USER enzyme digestion amplification and purification. The library was checked with Qubit and real time PCR for quantification and bioanalyzer for size distribution detection. Quantified libraries were pooled and sequenced on Illumina platforms according to effective library concentration and data amount. Bulk RNA sequencing | Adults less than 1 year old were used for all the experiments. Males and females were mixed in similar proportions in each of the conditions. | tissue:Heart|genotype:delta REN / |treatment:Untreated uninjured | GSM8577519 | GSM8577519: Zebrafish heart REN / uninjured replicate 3; Danio rerio; RNA Seq | GSM8577519 r1 | GSM8577519 | 1 | Total RNA was extracted using Trizol method Messenger RNA was purified from total RNA using poly T oligo attached magnetic beads. post fragmentation the first strand cDNA was synthesized using random hexamer primers followed by the second strand cDNA synthesis using either dUTP for directional library or dTTP for non directional library. For the non directional library it was ready post end repair A tailing adapter ligation size selection amplification and purification. For the directional library it was ready post end repair A tailing adapter ligation size selection USER enzyme digestion amplification and purification. The library was checked with Qubit and real time PCR for quantification and bioanalyzer for size distribution detection. Quantified libraries were pooled and sequenced on Illumina platforms according to effective library concentration and data amount. Bulk RNA sequencing | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP538990 | RENmut_uninjured_Rep3_1.fq.gz RENmut_uninjured_Rep3_2.fq.gz | fastq fastq | 11762346900.0 | 39207823.0 | GSM8577519 r1 | 0:150 1:150 | A:2773828457;C:3099252190;G:3239412318;T:2648002480;N:1851455 | 150 | 150 | 2773828457 | 3099252190 | 3239412318 | 2648002480 | 1851455 | SRX26407224 | SRS22927346 | SRA1992688 | Department of Biomedical Informatics College of Medicine, Ohio State University | Department of Biomedical Informatics College of Medicine, Ohio State University | B | B | biological fallback assumption | illumina | novaseq_era | unknown | random_priming | unknown | bulk | bulk | bulk | United States | 2024-10-16 | Adult | Adult | Heart | Cardiovascular System | ||||||||||||||||||||||
| 33950 | 33950 | SRR31020101 | SRX26407223 | SRS22927345 | SRP538990 | PRJNA1173772 | Cardiac Transcriptional Enhancer is Repurposed During Regeneration to Activate an Anti proliferative Program | GSE279653 | Transcriptome Analysis | Zebrafish have a high capacity to regenerate their xxx post injury.Several studies have surveyed transcriptional enhancers to understand how the dynamics of gene expression are controlled during heart regeneration. We have identified a cardiac transcriptional enhancer that is activated at the site of injury called the runx1 enhancer or REN since it regulates the expression of nearby gene runx1. REN is usually active in cardiomyocytes CMs and epicardial tissues surrounding the cardiac valves of uninjured zebrafish hearts. However when REN is activated in regenerating CM and epicardial tissues at the injury site it is concurrently downregulated around the distal heart valve. Deletion of REN ?REN results in excess Collagen around uninjured zebrafish cardiac valves. This ?REN Collagen phenotype is rescued with a runx1 deletion ?runx1 suggesting that REN and runx1 function in different genetic pathways in uninjured hearts. A different nearby gene that does change expression around valves in ?REN mutant hearts is adamts1 which encodes a metalloproteinase that degrades Collagen. Taken together this suggests that in uninjured hearts REN regulates adamts1 independently of runx1. However during regeneration CM proliferation at the site of injury is enhanced in both ?REN and ?runx1 mutants suggesting that REN is rewired to runx1 to stimulate its transcription. There are two previous descriptions for how enhancers are activated during regeneration. First cis regulatory sequences are reactivated from embryogenesis and second that active adult enhancers are further invigorated during regeneration. Our data point to a third and previously unappreciated mechanism for gene control during zebrafish heart regeneration. We report that an enhancer is repurposed both from one gene and cardiac domain to activate a different nearby gene in regenerating cardiac tissue. Overall design: Comparitive gene expression analysis of REN mutant and Wildtype hearts under uninjured and regenerating 7dpi conditions using bulk RNA se… | pubmed:39803985 | Zebrafish heart REN / uninjured replicate 2 | GSM8577518 | source name:Heart|tissue:Heart|genotype:delta REN / |treatment:Untreated uninjured|geo loc name:missing|collection date:missing | Zebrafish heart REN / uninjured replicate 2 | Demultiplexed and quality filtered reads were aligned to the Danio rerio reference genome GRCz10 using Hierarchical Indexing for Spliced Alignment of Transcripts 2 HISAT2 Read counts for each gene were quantified using featureCounts software Assembly: Danio rerio reference genome GRCz10 Supplementary files format and content: tab separated feature counts output text file | Heart | Total RNA was extracted using Trizol method Messenger RNA was purified from total RNA using poly T oligo attached magnetic beads. post fragmentation the first strand cDNA was synthesized using random hexamer primers followed by the second strand cDNA synthesis using either dUTP for directional library or dTTP for non directional library. For the non directional library it was ready post end repair A tailing adapter ligation size selection amplification and purification. For the directional library it was ready post end repair A tailing adapter ligation size selection USER enzyme digestion amplification and purification. The library was checked with Qubit and real time PCR for quantification and bioanalyzer for size distribution detection. Quantified libraries were pooled and sequenced on Illumina platforms according to effective library concentration and data amount. Bulk RNA sequencing | Adults less than 1 year old were used for all the experiments. Males and females were mixed in similar proportions in each of the conditions. | tissue:Heart|genotype:delta REN / |treatment:Untreated uninjured | GSM8577518 | GSM8577518: Zebrafish heart REN / uninjured replicate 2; Danio rerio; RNA Seq | GSM8577518 r1 | GSM8577518 | 1 | Total RNA was extracted using Trizol method Messenger RNA was purified from total RNA using poly T oligo attached magnetic beads. post fragmentation the first strand cDNA was synthesized using random hexamer primers followed by the second strand cDNA synthesis using either dUTP for directional library or dTTP for non directional library. For the non directional library it was ready post end repair A tailing adapter ligation size selection amplification and purification. For the directional library it was ready post end repair A tailing adapter ligation size selection USER enzyme digestion amplification and purification. The library was checked with Qubit and real time PCR for quantification and bioanalyzer for size distribution detection. Quantified libraries were pooled and sequenced on Illumina platforms according to effective library concentration and data amount. Bulk RNA sequencing | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP538990 | RENmut_uninjured_Rep2_1.fq.gz RENmut_uninjured_Rep2_2.fq.gz | fastq fastq | 10751934900.0 | 35839783.0 | GSM8577518 r1 | 0:150 1:150 | A:2562901095;C:2798627885;G:2982256765;T:2406451374;N:1697781 | 150 | 150 | 2562901095 | 2798627885 | 2982256765 | 2406451374 | 1697781 | SRX26407223 | SRS22927345 | SRA1992688 | Department of Biomedical Informatics College of Medicine, Ohio State University | Department of Biomedical Informatics College of Medicine, Ohio State University | B | B | biological fallback assumption | illumina | novaseq_era | unknown | random_priming | unknown | bulk | bulk | bulk | United States | 2024-10-16 | Adult | Adult | Heart | Cardiovascular System | ||||||||||||||||||||||
| 33951 | 33951 | SRR31020102 | SRX26407222 | SRS22927349 | SRP538990 | PRJNA1173772 | Cardiac Transcriptional Enhancer is Repurposed During Regeneration to Activate an Anti proliferative Program | GSE279653 | Transcriptome Analysis | Zebrafish have a high capacity to regenerate their xxx post injury.Several studies have surveyed transcriptional enhancers to understand how the dynamics of gene expression are controlled during heart regeneration. We have identified a cardiac transcriptional enhancer that is activated at the site of injury called the runx1 enhancer or REN since it regulates the expression of nearby gene runx1. REN is usually active in cardiomyocytes CMs and epicardial tissues surrounding the cardiac valves of uninjured zebrafish hearts. However when REN is activated in regenerating CM and epicardial tissues at the injury site it is concurrently downregulated around the distal heart valve. Deletion of REN ?REN results in excess Collagen around uninjured zebrafish cardiac valves. This ?REN Collagen phenotype is rescued with a runx1 deletion ?runx1 suggesting that REN and runx1 function in different genetic pathways in uninjured hearts. A different nearby gene that does change expression around valves in ?REN mutant hearts is adamts1 which encodes a metalloproteinase that degrades Collagen. Taken together this suggests that in uninjured hearts REN regulates adamts1 independently of runx1. However during regeneration CM proliferation at the site of injury is enhanced in both ?REN and ?runx1 mutants suggesting that REN is rewired to runx1 to stimulate its transcription. There are two previous descriptions for how enhancers are activated during regeneration. First cis regulatory sequences are reactivated from embryogenesis and second that active adult enhancers are further invigorated during regeneration. Our data point to a third and previously unappreciated mechanism for gene control during zebrafish heart regeneration. We report that an enhancer is repurposed both from one gene and cardiac domain to activate a different nearby gene in regenerating cardiac tissue. Overall design: Comparitive gene expression analysis of REN mutant and Wildtype hearts under uninjured and regenerating 7dpi conditions using bulk RNA se… | pubmed:39803985 | Zebrafish heart REN / uninjured replicate 1 | GSM8577517 | source name:Heart|tissue:Heart|genotype:delta REN / |treatment:Untreated uninjured|geo loc name:missing|collection date:missing | Zebrafish heart REN / uninjured replicate 1 | Demultiplexed and quality filtered reads were aligned to the Danio rerio reference genome GRCz10 using Hierarchical Indexing for Spliced Alignment of Transcripts 2 HISAT2 Read counts for each gene were quantified using featureCounts software Assembly: Danio rerio reference genome GRCz10 Supplementary files format and content: tab separated feature counts output text file | Heart | Total RNA was extracted using Trizol method Messenger RNA was purified from total RNA using poly T oligo attached magnetic beads. post fragmentation the first strand cDNA was synthesized using random hexamer primers followed by the second strand cDNA synthesis using either dUTP for directional library or dTTP for non directional library. For the non directional library it was ready post end repair A tailing adapter ligation size selection amplification and purification. For the directional library it was ready post end repair A tailing adapter ligation size selection USER enzyme digestion amplification and purification. The library was checked with Qubit and real time PCR for quantification and bioanalyzer for size distribution detection. Quantified libraries were pooled and sequenced on Illumina platforms according to effective library concentration and data amount. Bulk RNA sequencing | Adults less than 1 year old were used for all the experiments. Males and females were mixed in similar proportions in each of the conditions. | tissue:Heart|genotype:delta REN / |treatment:Untreated uninjured | GSM8577517 | GSM8577517: Zebrafish heart REN / uninjured replicate 1; Danio rerio; RNA Seq | GSM8577517 r1 | GSM8577517 | 1 | Total RNA was extracted using Trizol method Messenger RNA was purified from total RNA using poly T oligo attached magnetic beads. post fragmentation the first strand cDNA was synthesized using random hexamer primers followed by the second strand cDNA synthesis using either dUTP for directional library or dTTP for non directional library. For the non directional library it was ready post end repair A tailing adapter ligation size selection amplification and purification. For the directional library it was ready post end repair A tailing adapter ligation size selection USER enzyme digestion amplification and purification. The library was checked with Qubit and real time PCR for quantification and bioanalyzer for size distribution detection. Quantified libraries were pooled and sequenced on Illumina platforms according to effective library concentration and data amount. Bulk RNA sequencing | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP538990 | RENmut_uninjured_Rep1_1.fq.gz RENmut_uninjured_Rep1_2.fq.gz | fastq fastq | 12418459500.0 | 41394865.0 | GSM8577517 r1 | 0:150 1:150 | A:3236433689;C:2986942247;G:3133441820;T:3059675875;N:1965869 | 150 | 150 | 3236433689 | 2986942247 | 3133441820 | 3059675875 | 1965869 | SRX26407222 | SRS22927349 | SRA1992688 | Department of Biomedical Informatics College of Medicine, Ohio State University | Department of Biomedical Informatics College of Medicine, Ohio State University | B | B | biological fallback assumption | illumina | novaseq_era | unknown | random_priming | unknown | bulk | bulk | bulk | United States | 2024-10-16 | Adult | Adult | Heart | Cardiovascular System | ||||||||||||||||||||||
| 34062 | 34062 | SRR31040094 | SRX26425365 | SRS22944830 | SRP539398 | PRJNA1174770 | cited4a limits CM dedifferentiation and proliferation during zebrafish heart regeneration [Bulk RNA seq] | GSE279843 | Transcriptome Analysis | Cardiac regeneration involves interplay of complex interactions between many different cell types including cardiomyocytes. The exact mechanism that enables cardiomyocytes to undergo dedifferentiation and proliferation to replace lost cells has been under intense study. Here we report single nuclear RNA sequencing profile of the injured zebrafish heart and identified distinct cardiomyocyte populations in the injured heart. These cardiomyocyte populations indicate diverse functions that includes stress response myofibril assembly proliferation and contraction. The contracting cardiomyocyte population also involves activation of maturation pathways as an early response to injury. This intriguing finding suggests that constant maintenance of distinctive terminally differentiated cardiomyocyte population is important for cardiac function during regeneration. To test this we determined that cited4a a p300/CBP transcriptional co activator is xxx post injury in mature cardiomyocyte population. Moreover loss of cited4a mutants showed increased dedifferentiation proliferation and accelerated heart regeneration. Thus suppressing cardiomyocyte maturation pathway activity in injured hearts could be an approach to promote heart regeneration. Overall design: Wildtype and cited4a mutant adult heart regeneration study injured by ventricular amputation. Hearts were collected at 3 dy post amputation dpa. Total RNA was extracted from ventricles was used for RNA seq experiments. | pubmed:39713454 | cited4a 5 S10 | GSM8581867 | source name:heart ventricle|tissue:heart ventricle|genotype:cited4a pt38a/pt38a|treatment:3 dpa|geo loc name:missing|collection date:missing | cited4a 5 S10 | fastq files were processed with Cutadapt to remove adaptors Trimmed seq files were mapped to the zebrafish geneome using HiSat2 Mapped files were processed within featureCount for gene expression counts featureCount reads were imported into R package DeSeq2 for gene expression analysis. WT3 and cited4a 3 samples were omitted from the DeSeq2 analysis due to poor mapping. Normalized counts were calculated and log2 fold change and padj values were calculated using DeSeq2. Assembly: Danio rerio GRC.z11 Supplementary files format and content: RFR WTvsCited4aDeSeq2.xlsx Supplementary files format and content: .csv files are raw counts from featureCount processing post HiSat2 mapping. | heart ventricle | Adutls hearts were injured through ventricular resection and allowed to recover until 3 dy post amputation. Ventricles were removed flash frozen on dry ice and RNA was harvested using Trizol reagent and Quiagen RNeasy micro kit Cat# 74004. | Zebrafish adult at 6 month 1year of age | tissue:heart ventricle|genotype:cited4a pt38a/pt38a|treatment:3 dpa | GSM8581867 | GSM8581867: cited4a 5 S10; Danio rerio; RNA Seq | GSM8581867 r1 | GSM8581867 | 1 | Adutls hearts were injured through ventricular resection and allowed to recover until 3 dy post amputation. Ventricles were removed flash frozen on dry ice and RNA was harvested using Trizol reagent and Quiagen RNeasy micro kit Cat# 74004. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539398 | cited4a_5_S10_R1_001.fastq.gz cited4a_5_S10_R2_001.fastq.gz | fastq fastq | 9406981002.0 | 47541872.0 | GSM8581867 r1 | 0:98.92 1:98.95 | A:2544850290;C:2146373234;G:2187647121;T:2515525772;N:12584585 | 98 | 98 | 2544850290 | 2146373234 | 2187647121 | 2515525772 | 12584585 | SRX26425365 | SRS22944830 | SRA1993635 | Cell Biology, University of Pittsburgh | Cell Biology, University of Pittsburgh | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | United States | 2024-10-18 | Adult | Adult | Heart | Cardiovascular System | ||||||||||||||||||||||
| 34063 | 34063 | SRR31040095 | SRX26425364 | SRS22944829 | SRP539398 | PRJNA1174770 | cited4a limits CM dedifferentiation and proliferation during zebrafish heart regeneration [Bulk RNA seq] | GSE279843 | Transcriptome Analysis | Cardiac regeneration involves interplay of complex interactions between many different cell types including cardiomyocytes. The exact mechanism that enables cardiomyocytes to undergo dedifferentiation and proliferation to replace lost cells has been under intense study. Here we report single nuclear RNA sequencing profile of the injured zebrafish heart and identified distinct cardiomyocyte populations in the injured heart. These cardiomyocyte populations indicate diverse functions that includes stress response myofibril assembly proliferation and contraction. The contracting cardiomyocyte population also involves activation of maturation pathways as an early response to injury. This intriguing finding suggests that constant maintenance of distinctive terminally differentiated cardiomyocyte population is important for cardiac function during regeneration. To test this we determined that cited4a a p300/CBP transcriptional co activator is xxx post injury in mature cardiomyocyte population. Moreover loss of cited4a mutants showed increased dedifferentiation proliferation and accelerated heart regeneration. Thus suppressing cardiomyocyte maturation pathway activity in injured hearts could be an approach to promote heart regeneration. Overall design: Wildtype and cited4a mutant adult heart regeneration study injured by ventricular amputation. Hearts were collected at 3 dy post amputation dpa. Total RNA was extracted from ventricles was used for RNA seq experiments. | pubmed:39713454 | cited4a 4 S9 | GSM8581866 | source name:heart ventricle|tissue:heart ventricle|genotype:cited4a pt38a/pt38a|treatment:3 dpa|geo loc name:missing|collection date:missing | cited4a 4 S9 | fastq files were processed with Cutadapt to remove adaptors Trimmed seq files were mapped to the zebrafish geneome using HiSat2 Mapped files were processed within featureCount for gene expression counts featureCount reads were imported into R package DeSeq2 for gene expression analysis. WT3 and cited4a 3 samples were omitted from the DeSeq2 analysis due to poor mapping. Normalized counts were calculated and log2 fold change and padj values were calculated using DeSeq2. Assembly: Danio rerio GRC.z11 Supplementary files format and content: RFR WTvsCited4aDeSeq2.xlsx Supplementary files format and content: .csv files are raw counts from featureCount processing post HiSat2 mapping. | heart ventricle | Adutls hearts were injured through ventricular resection and allowed to recover until 3 dy post amputation. Ventricles were removed flash frozen on dry ice and RNA was harvested using Trizol reagent and Quiagen RNeasy micro kit Cat# 74004. | Zebrafish adult at 6 month 1year of age | tissue:heart ventricle|genotype:cited4a pt38a/pt38a|treatment:3 dpa | GSM8581866 | GSM8581866: cited4a 4 S9; Danio rerio; RNA Seq | GSM8581866 r1 | GSM8581866 | 1 | Adutls hearts were injured through ventricular resection and allowed to recover until 3 dy post amputation. Ventricles were removed flash frozen on dry ice and RNA was harvested using Trizol reagent and Quiagen RNeasy micro kit Cat# 74004. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539398 | cited4a_4_S9_R1_001.fastq.gz cited4a_4_S9_R2_001.fastq.gz | fastq fastq | 10327357614.0 | 52105259.0 | GSM8581866 r1 | 0:99.09 1:99.11 | A:2792243262;C:2361128395;G:2399579333;T:2763189826;N:11216798 | 99 | 99 | 2792243262 | 2361128395 | 2399579333 | 2763189826 | 11216798 | SRX26425364 | SRS22944829 | SRA1993635 | Cell Biology, University of Pittsburgh | Cell Biology, University of Pittsburgh | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | United States | 2024-10-18 | Adult | Adult | Heart | Cardiovascular System | ||||||||||||||||||||||
| 34064 | 34064 | SRR31040096 | SRX26425363 | SRS22944828 | SRP539398 | PRJNA1174770 | cited4a limits CM dedifferentiation and proliferation during zebrafish heart regeneration [Bulk RNA seq] | GSE279843 | Transcriptome Analysis | Cardiac regeneration involves interplay of complex interactions between many different cell types including cardiomyocytes. The exact mechanism that enables cardiomyocytes to undergo dedifferentiation and proliferation to replace lost cells has been under intense study. Here we report single nuclear RNA sequencing profile of the injured zebrafish heart and identified distinct cardiomyocyte populations in the injured heart. These cardiomyocyte populations indicate diverse functions that includes stress response myofibril assembly proliferation and contraction. The contracting cardiomyocyte population also involves activation of maturation pathways as an early response to injury. This intriguing finding suggests that constant maintenance of distinctive terminally differentiated cardiomyocyte population is important for cardiac function during regeneration. To test this we determined that cited4a a p300/CBP transcriptional co activator is xxx post injury in mature cardiomyocyte population. Moreover loss of cited4a mutants showed increased dedifferentiation proliferation and accelerated heart regeneration. Thus suppressing cardiomyocyte maturation pathway activity in injured hearts could be an approach to promote heart regeneration. Overall design: Wildtype and cited4a mutant adult heart regeneration study injured by ventricular amputation. Hearts were collected at 3 dy post amputation dpa. Total RNA was extracted from ventricles was used for RNA seq experiments. | pubmed:39713454 | cited4a 3 S8 | GSM8581865 | source name:heart ventricle|tissue:heart ventricle|genotype:cited4a pt38a/pt38a|treatment:3 dpa|geo loc name:missing|collection date:missing | cited4a 3 S8 | fastq files were processed with Cutadapt to remove adaptors Trimmed seq files were mapped to the zebrafish geneome using HiSat2 Mapped files were processed within featureCount for gene expression counts featureCount reads were imported into R package DeSeq2 for gene expression analysis. WT3 and cited4a 3 samples were omitted from the DeSeq2 analysis due to poor mapping. Normalized counts were calculated and log2 fold change and padj values were calculated using DeSeq2. Assembly: Danio rerio GRC.z11 Supplementary files format and content: RFR WTvsCited4aDeSeq2.xlsx Supplementary files format and content: .csv files are raw counts from featureCount processing post HiSat2 mapping. | heart ventricle | Adutls hearts were injured through ventricular resection and allowed to recover until 3 dy post amputation. Ventricles were removed flash frozen on dry ice and RNA was harvested using Trizol reagent and Quiagen RNeasy micro kit Cat# 74004. | Zebrafish adult at 6 month 1year of age | tissue:heart ventricle|genotype:cited4a pt38a/pt38a|treatment:3 dpa | GSM8581865 | GSM8581865: cited4a 3 S8; Danio rerio; RNA Seq | GSM8581865 r1 | GSM8581865 | 1 | Adutls hearts were injured through ventricular resection and allowed to recover until 3 dy post amputation. Ventricles were removed flash frozen on dry ice and RNA was harvested using Trizol reagent and Quiagen RNeasy micro kit Cat# 74004. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539398 | cited4a_3_S8_R1_001.fastq.gz cited4a_3_S8_R2_001.fastq.gz | fastq fastq | 7523591013.0 | 38378041.0 | GSM8581865 r1 | 0:98.01 1:98.03 | A:2064309409;C:1684048252;G:1712879772;T:2041731162;N:20622418 | 98 | 98 | 2064309409 | 1684048252 | 1712879772 | 2041731162 | 20622418 | SRX26425363 | SRS22944828 | SRA1993635 | Cell Biology, University of Pittsburgh | Cell Biology, University of Pittsburgh | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | United States | 2024-10-18 | Adult | Adult | Heart | Cardiovascular System | ||||||||||||||||||||||
| 34065 | 34065 | SRR31040097 | SRX26425362 | SRS22944827 | SRP539398 | PRJNA1174770 | cited4a limits CM dedifferentiation and proliferation during zebrafish heart regeneration [Bulk RNA seq] | GSE279843 | Transcriptome Analysis | Cardiac regeneration involves interplay of complex interactions between many different cell types including cardiomyocytes. The exact mechanism that enables cardiomyocytes to undergo dedifferentiation and proliferation to replace lost cells has been under intense study. Here we report single nuclear RNA sequencing profile of the injured zebrafish heart and identified distinct cardiomyocyte populations in the injured heart. These cardiomyocyte populations indicate diverse functions that includes stress response myofibril assembly proliferation and contraction. The contracting cardiomyocyte population also involves activation of maturation pathways as an early response to injury. This intriguing finding suggests that constant maintenance of distinctive terminally differentiated cardiomyocyte population is important for cardiac function during regeneration. To test this we determined that cited4a a p300/CBP transcriptional co activator is xxx post injury in mature cardiomyocyte population. Moreover loss of cited4a mutants showed increased dedifferentiation proliferation and accelerated heart regeneration. Thus suppressing cardiomyocyte maturation pathway activity in injured hearts could be an approach to promote heart regeneration. Overall design: Wildtype and cited4a mutant adult heart regeneration study injured by ventricular amputation. Hearts were collected at 3 dy post amputation dpa. Total RNA was extracted from ventricles was used for RNA seq experiments. | pubmed:39713454 | cited4a 2 S7 | GSM8581864 | source name:heart ventricle|tissue:heart ventricle|genotype:cited4a pt38a/pt38a|treatment:3 dpa|geo loc name:missing|collection date:missing | cited4a 2 S7 | fastq files were processed with Cutadapt to remove adaptors Trimmed seq files were mapped to the zebrafish geneome using HiSat2 Mapped files were processed within featureCount for gene expression counts featureCount reads were imported into R package DeSeq2 for gene expression analysis. WT3 and cited4a 3 samples were omitted from the DeSeq2 analysis due to poor mapping. Normalized counts were calculated and log2 fold change and padj values were calculated using DeSeq2. Assembly: Danio rerio GRC.z11 Supplementary files format and content: RFR WTvsCited4aDeSeq2.xlsx Supplementary files format and content: .csv files are raw counts from featureCount processing post HiSat2 mapping. | heart ventricle | Adutls hearts were injured through ventricular resection and allowed to recover until 3 dy post amputation. Ventricles were removed flash frozen on dry ice and RNA was harvested using Trizol reagent and Quiagen RNeasy micro kit Cat# 74004. | Zebrafish adult at 6 month 1year of age | tissue:heart ventricle|genotype:cited4a pt38a/pt38a|treatment:3 dpa | GSM8581864 | GSM8581864: cited4a 2 S7; Danio rerio; RNA Seq | GSM8581864 r1 | GSM8581864 | 1 | Adutls hearts were injured through ventricular resection and allowed to recover until 3 dy post amputation. Ventricles were removed flash frozen on dry ice and RNA was harvested using Trizol reagent and Quiagen RNeasy micro kit Cat# 74004. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539398 | cited4a_2_S7_R1_001.fastq.gz cited4a_2_S7_R2_001.fastq.gz | fastq fastq | 8918974871.0 | 45257542.0 | GSM8581864 r1 | 0:98.52 1:98.55 | A:2418106630;C:2024139848;G:2068607737;T:2389350414;N:18770242 | 98 | 98 | 2418106630 | 2024139848 | 2068607737 | 2389350414 | 18770242 | SRX26425362 | SRS22944827 | SRA1993635 | Cell Biology, University of Pittsburgh | Cell Biology, University of Pittsburgh | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | United States | 2024-10-18 | Adult | Adult | Heart | Cardiovascular System | ||||||||||||||||||||||
| 34066 | 34066 | SRR31040098 | SRX26425361 | SRS22944826 | SRP539398 | PRJNA1174770 | cited4a limits CM dedifferentiation and proliferation during zebrafish heart regeneration [Bulk RNA seq] | GSE279843 | Transcriptome Analysis | Cardiac regeneration involves interplay of complex interactions between many different cell types including cardiomyocytes. The exact mechanism that enables cardiomyocytes to undergo dedifferentiation and proliferation to replace lost cells has been under intense study. Here we report single nuclear RNA sequencing profile of the injured zebrafish heart and identified distinct cardiomyocyte populations in the injured heart. These cardiomyocyte populations indicate diverse functions that includes stress response myofibril assembly proliferation and contraction. The contracting cardiomyocyte population also involves activation of maturation pathways as an early response to injury. This intriguing finding suggests that constant maintenance of distinctive terminally differentiated cardiomyocyte population is important for cardiac function during regeneration. To test this we determined that cited4a a p300/CBP transcriptional co activator is xxx post injury in mature cardiomyocyte population. Moreover loss of cited4a mutants showed increased dedifferentiation proliferation and accelerated heart regeneration. Thus suppressing cardiomyocyte maturation pathway activity in injured hearts could be an approach to promote heart regeneration. Overall design: Wildtype and cited4a mutant adult heart regeneration study injured by ventricular amputation. Hearts were collected at 3 dy post amputation dpa. Total RNA was extracted from ventricles was used for RNA seq experiments. | pubmed:39713454 | cited4a 1 S6 | GSM8581863 | source name:heart ventricle|tissue:heart ventricle|genotype:cited4a pt38a/pt38a|treatment:3 dpa|geo loc name:missing|collection date:missing | cited4a 1 S6 | fastq files were processed with Cutadapt to remove adaptors Trimmed seq files were mapped to the zebrafish geneome using HiSat2 Mapped files were processed within featureCount for gene expression counts featureCount reads were imported into R package DeSeq2 for gene expression analysis. WT3 and cited4a 3 samples were omitted from the DeSeq2 analysis due to poor mapping. Normalized counts were calculated and log2 fold change and padj values were calculated using DeSeq2. Assembly: Danio rerio GRC.z11 Supplementary files format and content: RFR WTvsCited4aDeSeq2.xlsx Supplementary files format and content: .csv files are raw counts from featureCount processing post HiSat2 mapping. | heart ventricle | Adutls hearts were injured through ventricular resection and allowed to recover until 3 dy post amputation. Ventricles were removed flash frozen on dry ice and RNA was harvested using Trizol reagent and Quiagen RNeasy micro kit Cat# 74004. | Zebrafish adult at 6 month 1year of age | tissue:heart ventricle|genotype:cited4a pt38a/pt38a|treatment:3 dpa | GSM8581863 | GSM8581863: cited4a 1 S6; Danio rerio; RNA Seq | GSM8581863 r1 | GSM8581863 | 1 | Adutls hearts were injured through ventricular resection and allowed to recover until 3 dy post amputation. Ventricles were removed flash frozen on dry ice and RNA was harvested using Trizol reagent and Quiagen RNeasy micro kit Cat# 74004. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539398 | cited4a_1_S6_R1_001.fastq.gz cited4a_1_S6_R2_001.fastq.gz | fastq fastq | 8961787210.0 | 45306522.0 | GSM8581863 r1 | 0:98.89 1:98.91 | A:2421291921;C:2045522296;G:2085357785;T:2396024908;N:13590300 | 98 | 98 | 2421291921 | 2045522296 | 2085357785 | 2396024908 | 13590300 | SRX26425361 | SRS22944826 | SRA1993635 | Cell Biology, University of Pittsburgh | Cell Biology, University of Pittsburgh | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | United States | 2024-10-18 | Adult | Adult | Heart | Cardiovascular System | ||||||||||||||||||||||
| 34067 | 34067 | SRR31040099 | SRX26425360 | SRS22944825 | SRP539398 | PRJNA1174770 | cited4a limits CM dedifferentiation and proliferation during zebrafish heart regeneration [Bulk RNA seq] | GSE279843 | Transcriptome Analysis | Cardiac regeneration involves interplay of complex interactions between many different cell types including cardiomyocytes. The exact mechanism that enables cardiomyocytes to undergo dedifferentiation and proliferation to replace lost cells has been under intense study. Here we report single nuclear RNA sequencing profile of the injured zebrafish heart and identified distinct cardiomyocyte populations in the injured heart. These cardiomyocyte populations indicate diverse functions that includes stress response myofibril assembly proliferation and contraction. The contracting cardiomyocyte population also involves activation of maturation pathways as an early response to injury. This intriguing finding suggests that constant maintenance of distinctive terminally differentiated cardiomyocyte population is important for cardiac function during regeneration. To test this we determined that cited4a a p300/CBP transcriptional co activator is xxx post injury in mature cardiomyocyte population. Moreover loss of cited4a mutants showed increased dedifferentiation proliferation and accelerated heart regeneration. Thus suppressing cardiomyocyte maturation pathway activity in injured hearts could be an approach to promote heart regeneration. Overall design: Wildtype and cited4a mutant adult heart regeneration study injured by ventricular amputation. Hearts were collected at 3 dy post amputation dpa. Total RNA was extracted from ventricles was used for RNA seq experiments. | pubmed:39713454 | WT5 S5 | GSM8581862 | source name:heart ventricle|tissue:heart ventricle|genotype:AB*|treatment:3 dpa|geo loc name:missing|collection date:missing | WT5 S5 | fastq files were processed with Cutadapt to remove adaptors Trimmed seq files were mapped to the zebrafish geneome using HiSat2 Mapped files were processed within featureCount for gene expression counts featureCount reads were imported into R package DeSeq2 for gene expression analysis. WT3 and cited4a 3 samples were omitted from the DeSeq2 analysis due to poor mapping. Normalized counts were calculated and log2 fold change and padj values were calculated using DeSeq2. Assembly: Danio rerio GRC.z11 Supplementary files format and content: RFR WTvsCited4aDeSeq2.xlsx Supplementary files format and content: .csv files are raw counts from featureCount processing post HiSat2 mapping. | heart ventricle | Adutls hearts were injured through ventricular resection and allowed to recover until 3 dy post amputation. Ventricles were removed flash frozen on dry ice and RNA was harvested using Trizol reagent and Quiagen RNeasy micro kit Cat# 74004. | Zebrafish adult at 6 month 1year of age | tissue:heart ventricle|genotype:AB*|treatment:3 dpa | GSM8581862 | GSM8581862: WT5 S5; Danio rerio; RNA Seq | GSM8581862 r1 | GSM8581862 | 1 | Adutls hearts were injured through ventricular resection and allowed to recover until 3 dy post amputation. Ventricles were removed flash frozen on dry ice and RNA was harvested using Trizol reagent and Quiagen RNeasy micro kit Cat# 74004. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539398 | WT5_S5_R1_001.fastq.gz WT5_S5_R2_001.fastq.gz | fastq fastq | 8709371640.0 | 44115862.0 | GSM8581862 r1 | 0:98.70 1:98.72 | A:2357235644;C:1985356744;G:2021578041;T:2331566065;N:13635146 | 98 | 98 | 2357235644 | 1985356744 | 2021578041 | 2331566065 | 13635146 | SRX26425360 | SRS22944825 | SRA1993635 | Cell Biology, University of Pittsburgh | Cell Biology, University of Pittsburgh | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | United States | 2024-10-18 | Adult | Adult | Heart | Cardiovascular System | ||||||||||||||||||||||
| 34068 | 34068 | SRR31040100 | SRX26425359 | SRS22944824 | SRP539398 | PRJNA1174770 | cited4a limits CM dedifferentiation and proliferation during zebrafish heart regeneration [Bulk RNA seq] | GSE279843 | Transcriptome Analysis | Cardiac regeneration involves interplay of complex interactions between many different cell types including cardiomyocytes. The exact mechanism that enables cardiomyocytes to undergo dedifferentiation and proliferation to replace lost cells has been under intense study. Here we report single nuclear RNA sequencing profile of the injured zebrafish heart and identified distinct cardiomyocyte populations in the injured heart. These cardiomyocyte populations indicate diverse functions that includes stress response myofibril assembly proliferation and contraction. The contracting cardiomyocyte population also involves activation of maturation pathways as an early response to injury. This intriguing finding suggests that constant maintenance of distinctive terminally differentiated cardiomyocyte population is important for cardiac function during regeneration. To test this we determined that cited4a a p300/CBP transcriptional co activator is xxx post injury in mature cardiomyocyte population. Moreover loss of cited4a mutants showed increased dedifferentiation proliferation and accelerated heart regeneration. Thus suppressing cardiomyocyte maturation pathway activity in injured hearts could be an approach to promote heart regeneration. Overall design: Wildtype and cited4a mutant adult heart regeneration study injured by ventricular amputation. Hearts were collected at 3 dy post amputation dpa. Total RNA was extracted from ventricles was used for RNA seq experiments. | pubmed:39713454 | WT4 S4 | GSM8581861 | source name:heart ventricle|tissue:heart ventricle|genotype:AB*|treatment:3 dpa|geo loc name:missing|collection date:missing | WT4 S4 | fastq files were processed with Cutadapt to remove adaptors Trimmed seq files were mapped to the zebrafish geneome using HiSat2 Mapped files were processed within featureCount for gene expression counts featureCount reads were imported into R package DeSeq2 for gene expression analysis. WT3 and cited4a 3 samples were omitted from the DeSeq2 analysis due to poor mapping. Normalized counts were calculated and log2 fold change and padj values were calculated using DeSeq2. Assembly: Danio rerio GRC.z11 Supplementary files format and content: RFR WTvsCited4aDeSeq2.xlsx Supplementary files format and content: .csv files are raw counts from featureCount processing post HiSat2 mapping. | heart ventricle | Adutls hearts were injured through ventricular resection and allowed to recover until 3 dy post amputation. Ventricles were removed flash frozen on dry ice and RNA was harvested using Trizol reagent and Quiagen RNeasy micro kit Cat# 74004. | Zebrafish adult at 6 month 1year of age | tissue:heart ventricle|genotype:AB*|treatment:3 dpa | GSM8581861 | GSM8581861: WT4 S4; Danio rerio; RNA Seq | GSM8581861 r1 | GSM8581861 | 1 | Adutls hearts were injured through ventricular resection and allowed to recover until 3 dy post amputation. Ventricles were removed flash frozen on dry ice and RNA was harvested using Trizol reagent and Quiagen RNeasy micro kit Cat# 74004. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539398 | WT4_S4_R1_001.fastq.gz WT4_S4_R2_001.fastq.gz | fastq fastq | 8819585885.0 | 44667709.0 | GSM8581861 r1 | 0:98.71 1:98.74 | A:2389247108;C:2011663856;G:2042796445;T:2366564662;N:9313814 | 98 | 98 | 2389247108 | 2011663856 | 2042796445 | 2366564662 | 9313814 | SRX26425359 | SRS22944824 | SRA1993635 | Cell Biology, University of Pittsburgh | Cell Biology, University of Pittsburgh | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | United States | 2024-10-18 | Adult | Adult | Heart | Cardiovascular System | ||||||||||||||||||||||
| 34069 | 34069 | SRR31040101 | SRX26425358 | SRS22944823 | SRP539398 | PRJNA1174770 | cited4a limits CM dedifferentiation and proliferation during zebrafish heart regeneration [Bulk RNA seq] | GSE279843 | Transcriptome Analysis | Cardiac regeneration involves interplay of complex interactions between many different cell types including cardiomyocytes. The exact mechanism that enables cardiomyocytes to undergo dedifferentiation and proliferation to replace lost cells has been under intense study. Here we report single nuclear RNA sequencing profile of the injured zebrafish heart and identified distinct cardiomyocyte populations in the injured heart. These cardiomyocyte populations indicate diverse functions that includes stress response myofibril assembly proliferation and contraction. The contracting cardiomyocyte population also involves activation of maturation pathways as an early response to injury. This intriguing finding suggests that constant maintenance of distinctive terminally differentiated cardiomyocyte population is important for cardiac function during regeneration. To test this we determined that cited4a a p300/CBP transcriptional co activator is xxx post injury in mature cardiomyocyte population. Moreover loss of cited4a mutants showed increased dedifferentiation proliferation and accelerated heart regeneration. Thus suppressing cardiomyocyte maturation pathway activity in injured hearts could be an approach to promote heart regeneration. Overall design: Wildtype and cited4a mutant adult heart regeneration study injured by ventricular amputation. Hearts were collected at 3 dy post amputation dpa. Total RNA was extracted from ventricles was used for RNA seq experiments. | pubmed:39713454 | WT3 S3 | GSM8581860 | source name:heart ventricle|tissue:heart ventricle|genotype:AB*|treatment:3 dpa|geo loc name:missing|collection date:missing | WT3 S3 | fastq files were processed with Cutadapt to remove adaptors Trimmed seq files were mapped to the zebrafish geneome using HiSat2 Mapped files were processed within featureCount for gene expression counts featureCount reads were imported into R package DeSeq2 for gene expression analysis. WT3 and cited4a 3 samples were omitted from the DeSeq2 analysis due to poor mapping. Normalized counts were calculated and log2 fold change and padj values were calculated using DeSeq2. Assembly: Danio rerio GRC.z11 Supplementary files format and content: RFR WTvsCited4aDeSeq2.xlsx Supplementary files format and content: .csv files are raw counts from featureCount processing post HiSat2 mapping. | heart ventricle | Adutls hearts were injured through ventricular resection and allowed to recover until 3 dy post amputation. Ventricles were removed flash frozen on dry ice and RNA was harvested using Trizol reagent and Quiagen RNeasy micro kit Cat# 74004. | Zebrafish adult at 6 month 1year of age | tissue:heart ventricle|genotype:AB*|treatment:3 dpa | GSM8581860 | GSM8581860: WT3 S3; Danio rerio; RNA Seq | GSM8581860 r1 | GSM8581860 | 1 | Adutls hearts were injured through ventricular resection and allowed to recover until 3 dy post amputation. Ventricles were removed flash frozen on dry ice and RNA was harvested using Trizol reagent and Quiagen RNeasy micro kit Cat# 74004. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539398 | WT3_S3_R1_001.fastq.gz WT3_S3_R2_001.fastq.gz | fastq fastq | 8357326499.0 | 42669115.0 | GSM8581860 r1 | 0:97.92 1:97.94 | A:2304405979;C:1857870557;G:1893015370;T:2272751770;N:29282823 | 97 | 97 | 2304405979 | 1857870557 | 1893015370 | 2272751770 | 29282823 | SRX26425358 | SRS22944823 | SRA1993635 | Cell Biology, University of Pittsburgh | Cell Biology, University of Pittsburgh | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | United States | 2024-10-18 | Adult | Adult | Heart | Cardiovascular System | ||||||||||||||||||||||
| 34070 | 34070 | SRR31040102 | SRX26425357 | SRS22944822 | SRP539398 | PRJNA1174770 | cited4a limits CM dedifferentiation and proliferation during zebrafish heart regeneration [Bulk RNA seq] | GSE279843 | Transcriptome Analysis | Cardiac regeneration involves interplay of complex interactions between many different cell types including cardiomyocytes. The exact mechanism that enables cardiomyocytes to undergo dedifferentiation and proliferation to replace lost cells has been under intense study. Here we report single nuclear RNA sequencing profile of the injured zebrafish heart and identified distinct cardiomyocyte populations in the injured heart. These cardiomyocyte populations indicate diverse functions that includes stress response myofibril assembly proliferation and contraction. The contracting cardiomyocyte population also involves activation of maturation pathways as an early response to injury. This intriguing finding suggests that constant maintenance of distinctive terminally differentiated cardiomyocyte population is important for cardiac function during regeneration. To test this we determined that cited4a a p300/CBP transcriptional co activator is xxx post injury in mature cardiomyocyte population. Moreover loss of cited4a mutants showed increased dedifferentiation proliferation and accelerated heart regeneration. Thus suppressing cardiomyocyte maturation pathway activity in injured hearts could be an approach to promote heart regeneration. Overall design: Wildtype and cited4a mutant adult heart regeneration study injured by ventricular amputation. Hearts were collected at 3 dy post amputation dpa. Total RNA was extracted from ventricles was used for RNA seq experiments. | pubmed:39713454 | WT2 S2 | GSM8581859 | source name:heart ventricle|tissue:heart ventricle|genotype:AB*|treatment:3 dpa|geo loc name:missing|collection date:missing | WT2 S2 | fastq files were processed with Cutadapt to remove adaptors Trimmed seq files were mapped to the zebrafish geneome using HiSat2 Mapped files were processed within featureCount for gene expression counts featureCount reads were imported into R package DeSeq2 for gene expression analysis. WT3 and cited4a 3 samples were omitted from the DeSeq2 analysis due to poor mapping. Normalized counts were calculated and log2 fold change and padj values were calculated using DeSeq2. Assembly: Danio rerio GRC.z11 Supplementary files format and content: RFR WTvsCited4aDeSeq2.xlsx Supplementary files format and content: .csv files are raw counts from featureCount processing post HiSat2 mapping. | heart ventricle | Adutls hearts were injured through ventricular resection and allowed to recover until 3 dy post amputation. Ventricles were removed flash frozen on dry ice and RNA was harvested using Trizol reagent and Quiagen RNeasy micro kit Cat# 74004. | Zebrafish adult at 6 month 1year of age | tissue:heart ventricle|genotype:AB*|treatment:3 dpa | GSM8581859 | GSM8581859: WT2 S2; Danio rerio; RNA Seq | GSM8581859 r1 | GSM8581859 | 1 | Adutls hearts were injured through ventricular resection and allowed to recover until 3 dy post amputation. Ventricles were removed flash frozen on dry ice and RNA was harvested using Trizol reagent and Quiagen RNeasy micro kit Cat# 74004. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539398 | WT2_S2_R1_001.fastq.gz WT2_S2_R2_001.fastq.gz | fastq fastq | 8274207122.0 | 41781305.0 | GSM8581859 r1 | 0:99.01 1:99.03 | A:2250541139;C:1878982349;G:1910085799;T:2229110688;N:5487147 | 99 | 99 | 2250541139 | 1878982349 | 1910085799 | 2229110688 | 5487147 | SRX26425357 | SRS22944822 | SRA1993635 | Cell Biology, University of Pittsburgh | Cell Biology, University of Pittsburgh | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | United States | 2024-10-18 | Adult | Adult | Heart | Cardiovascular System | ||||||||||||||||||||||
| 34071 | 34071 | SRR31040103 | SRX26425356 | SRS22944821 | SRP539398 | PRJNA1174770 | cited4a limits CM dedifferentiation and proliferation during zebrafish heart regeneration [Bulk RNA seq] | GSE279843 | Transcriptome Analysis | Cardiac regeneration involves interplay of complex interactions between many different cell types including cardiomyocytes. The exact mechanism that enables cardiomyocytes to undergo dedifferentiation and proliferation to replace lost cells has been under intense study. Here we report single nuclear RNA sequencing profile of the injured zebrafish heart and identified distinct cardiomyocyte populations in the injured heart. These cardiomyocyte populations indicate diverse functions that includes stress response myofibril assembly proliferation and contraction. The contracting cardiomyocyte population also involves activation of maturation pathways as an early response to injury. This intriguing finding suggests that constant maintenance of distinctive terminally differentiated cardiomyocyte population is important for cardiac function during regeneration. To test this we determined that cited4a a p300/CBP transcriptional co activator is xxx post injury in mature cardiomyocyte population. Moreover loss of cited4a mutants showed increased dedifferentiation proliferation and accelerated heart regeneration. Thus suppressing cardiomyocyte maturation pathway activity in injured hearts could be an approach to promote heart regeneration. Overall design: Wildtype and cited4a mutant adult heart regeneration study injured by ventricular amputation. Hearts were collected at 3 dy post amputation dpa. Total RNA was extracted from ventricles was used for RNA seq experiments. | pubmed:39713454 | WT1 S1 | GSM8581858 | source name:heart ventricle|tissue:heart ventricle|genotype:AB*|treatment:3 dpa|geo loc name:missing|collection date:missing | WT1 S1 | fastq files were processed with Cutadapt to remove adaptors Trimmed seq files were mapped to the zebrafish geneome using HiSat2 Mapped files were processed within featureCount for gene expression counts featureCount reads were imported into R package DeSeq2 for gene expression analysis. WT3 and cited4a 3 samples were omitted from the DeSeq2 analysis due to poor mapping. Normalized counts were calculated and log2 fold change and padj values were calculated using DeSeq2. Assembly: Danio rerio GRC.z11 Supplementary files format and content: RFR WTvsCited4aDeSeq2.xlsx Supplementary files format and content: .csv files are raw counts from featureCount processing post HiSat2 mapping. | heart ventricle | Adutls hearts were injured through ventricular resection and allowed to recover until 3 dy post amputation. Ventricles were removed flash frozen on dry ice and RNA was harvested using Trizol reagent and Quiagen RNeasy micro kit Cat# 74004. | Zebrafish adult at 6 month 1year of age | tissue:heart ventricle|genotype:AB*|treatment:3 dpa | GSM8581858 | GSM8581858: WT1 S1; Danio rerio; RNA Seq | GSM8581858 r1 | GSM8581858 | 1 | Adutls hearts were injured through ventricular resection and allowed to recover until 3 dy post amputation. Ventricles were removed flash frozen on dry ice and RNA was harvested using Trizol reagent and Quiagen RNeasy micro kit Cat# 74004. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539398 | WT1_S1_R1_001.fastq.gz WT1_S1_R2_001.fastq.gz | fastq fastq | 7859371275.0 | 39763922.0 | GSM8581858 r1 | 0:98.81 1:98.84 | A:2133343583;C:1785772799;G:1814362992;T:2113406098;N:12485803 | 98 | 98 | 2133343583 | 1785772799 | 1814362992 | 2113406098 | 12485803 | SRX26425356 | SRS22944821 | SRA1993635 | Cell Biology, University of Pittsburgh | Cell Biology, University of Pittsburgh | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | bulk | bulk | United States | 2024-10-18 | Adult | Adult | Heart | Cardiovascular System | ||||||||||||||||||||||
| 36641 | 36641 | SRR700539 | SRX233125 | SRS393099 | SRP018538 | PRJNA189226 | Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos | GSE44233 | Transcriptome Analysis | The Gata4 transcription factor is essential for normal heart development but the molecular basis for its function remain poorly understood. We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos. Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited. Three replicate control samples and three replicate Gata4 morphant samples were analyzed. | pubmed:23850773 | Seq15 | GSM1081113 | tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant | Seq15 | Basecalls demultiplexing and filtering of reads was performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb version: development 20110921150240 with the following parameters: Ambiguity threshold = 1 Max Number Gap Opens = 1 Max Number Gap Extensions = 1. Differential expression was generated with the DESEQ package with native goby support using gobyweb version: development 20110921150240 with the following parameters: q value threshold = 1.0 weight adjustment = none Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1 a log2 fold change > 1 for WT/G4 and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb version: development20110921150240. Additional supplementary .xlsx file containing RPKM counts and statistical values was exported from gobyweb and processed in excel. | sorted cardiomyocytes | Embryos were injected with morpholino before the 4 cell stage of development. 2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo. At 24 hpf batches of approximately 200 embryos were pooled into 1.5 ml tube. Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS 0.8mM CaCl2 50U/ml penicillin and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies and stored at 80C until RNA isolation. | RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase the solution was transferred to an RNeasy minElute column Qiagen. On column DNase digestion subsequent washing and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries. Libraries were prepared for RNA sequencing using the mRNA Seq seq1 seq5 and seq11 or TruSeq Kit seq13 seq14 and seq15 according to the Illumina's recommended protocol. | Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes. 25 ml of E3 buffer was used per 50 60 embryos in each dish. | developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant | GSM1081113 | GSM1081113: Seq15; Danio rerio; RNA Seq | GSM1081113 1 | 1 | GEO Accession:GSM1081113 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP018538 | 1505008521.0 | 29509971.0 | GSM1081113 r1 | 0:51 | A:394410844;C:370013758;G:356489603;T:384055071;N:39245 | 51 | 394410844 | 370013758 | 356489603 | 384055071 | 39245 | SRX233125 | SRS393099 | SRA066447 | GEO | Todd Evans Lab, Cell and Developmental Biology, Weill Cornell | 1 | 0.9123 | 0.07373 | 0.71346 | 0.47555 | 51 | B | usable mapping rate | illumina | hiseq_era | full_length | random_priming | trueseq | bulk | bulk | bulk | United States | 2013-02-11 | Pharyngula | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||
| 36642 | 36642 | SRR700538 | SRX233124 | SRS393098 | SRP018538 | PRJNA189226 | Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos | GSE44233 | Transcriptome Analysis | The Gata4 transcription factor is essential for normal heart development but the molecular basis for its function remain poorly understood. We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos. Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited. Three replicate control samples and three replicate Gata4 morphant samples were analyzed. | pubmed:23850773 | Seq14 | GSM1081112 | tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant | Seq14 | Basecalls demultiplexing and filtering of reads was performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb version: development 20110921150240 with the following parameters: Ambiguity threshold = 1 Max Number Gap Opens = 1 Max Number Gap Extensions = 1. Differential expression was generated with the DESEQ package with native goby support using gobyweb version: development 20110921150240 with the following parameters: q value threshold = 1.0 weight adjustment = none Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1 a log2 fold change > 1 for WT/G4 and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb version: development20110921150240. Additional supplementary .xlsx file containing RPKM counts and statistical values was exported from gobyweb and processed in excel. | sorted cardiomyocytes | Embryos were injected with morpholino before the 4 cell stage of development. 2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo. At 24 hpf batches of approximately 200 embryos were pooled into 1.5 ml tube. Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS 0.8mM CaCl2 50U/ml penicillin and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies and stored at 80C until RNA isolation. | RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase the solution was transferred to an RNeasy minElute column Qiagen. On column DNase digestion subsequent washing and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries. Libraries were prepared for RNA sequencing using the mRNA Seq seq1 seq5 and seq11 or TruSeq Kit seq13 seq14 and seq15 according to the Illumina's recommended protocol. | Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes. 25 ml of E3 buffer was used per 50 60 embryos in each dish. | developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant | GSM1081112 | GSM1081112: Seq14; Danio rerio; RNA Seq | GSM1081112 1 | 1 | GEO Accession:GSM1081112 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP018538 | seq14.txt.gz | fastq | 3144425502.0 | 61655402.0 | GSM1081112 r1 | 0:51 | A:825172912;C:756354008;G:742919584;T:819897573;N:81425 | 51 | 825172912 | 756354008 | 742919584 | 819897573 | 81425 | SRX233124 | SRS393098 | SRA066447 | GEO | Todd Evans Lab, Cell and Developmental Biology, Weill Cornell | 1 | 0.93659 | 0.0806 | 0.73716 | 0.47614 | 51 | B | usable mapping rate | illumina | hiseq_era | full_length | random_priming | trueseq | bulk | bulk | bulk | United States | 2013-02-11 | Pharyngula | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 36643 | 36643 | SRR700537 | SRX233123 | SRS393097 | SRP018538 | PRJNA189226 | Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos | GSE44233 | Transcriptome Analysis | The Gata4 transcription factor is essential for normal heart development but the molecular basis for its function remain poorly understood. We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos. Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited. Three replicate control samples and three replicate Gata4 morphant samples were analyzed. | pubmed:23850773 | Seq11 | GSM1081111 | tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant | Seq11 | Basecalls demultiplexing and filtering of reads was performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb version: development 20110921150240 with the following parameters: Ambiguity threshold = 1 Max Number Gap Opens = 1 Max Number Gap Extensions = 1. Differential expression was generated with the DESEQ package with native goby support using gobyweb version: development 20110921150240 with the following parameters: q value threshold = 1.0 weight adjustment = none Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1 a log2 fold change > 1 for WT/G4 and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb version: development20110921150240. Additional supplementary .xlsx file containing RPKM counts and statistical values was exported from gobyweb and processed in excel. | sorted cardiomyocytes | Embryos were injected with morpholino before the 4 cell stage of development. 2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo. At 24 hpf batches of approximately 200 embryos were pooled into 1.5 ml tube. Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS 0.8mM CaCl2 50U/ml penicillin and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies and stored at 80C until RNA isolation. | RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase the solution was transferred to an RNeasy minElute column Qiagen. On column DNase digestion subsequent washing and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries. Libraries were prepared for RNA sequencing using the mRNA Seq seq1 seq5 and seq11 or TruSeq Kit seq13 seq14 and seq15 according to the Illumina's recommended protocol. | Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes. 25 ml of E3 buffer was used per 50 60 embryos in each dish. | developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant | GSM1081111 | GSM1081111: Seq11; Danio rerio; RNA Seq | GSM1081111 1 | 1 | GEO Accession:GSM1081111 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina Genome Analyzer II | SRP018538 | 1364181264.0 | 37893924.0 | GSM1081111 r1 | 0:36 | A:362442341;C:297159061;G:406723961;T:297355968;N:499933 | 36 | 362442341 | 297159061 | 406723961 | 297355968 | 499933 | SRX233123 | SRS393097 | SRA066447 | GEO | Todd Evans Lab, Cell and Developmental Biology, Weill Cornell | 1 | 0.67174 | 0.07612 | 0.74416 | 0.48016 | 36 | B | usable mapping rate | illumina | early_illumina | full_length | random_priming | trueseq | bulk | bulk | bulk | United States | 2013-02-11 | Pharyngula | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||
| 36644 | 36644 | SRR700536 | SRX233122 | SRS393096 | SRP018538 | PRJNA189226 | Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos | GSE44233 | Transcriptome Analysis | The Gata4 transcription factor is essential for normal heart development but the molecular basis for its function remain poorly understood. We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos. Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited. Three replicate control samples and three replicate Gata4 morphant samples were analyzed. | pubmed:23850773 | Seq13 | GSM1081110 | tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype | Seq13 | Basecalls demultiplexing and filtering of reads was performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb version: development 20110921150240 with the following parameters: Ambiguity threshold = 1 Max Number Gap Opens = 1 Max Number Gap Extensions = 1. Differential expression was generated with the DESEQ package with native goby support using gobyweb version: development 20110921150240 with the following parameters: q value threshold = 1.0 weight adjustment = none Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1 a log2 fold change > 1 for WT/G4 and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb version: development20110921150240. Additional supplementary .xlsx file containing RPKM counts and statistical values was exported from gobyweb and processed in excel. | sorted cardiomyocytes | Embryos were injected with morpholino before the 4 cell stage of development. 2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo. At 24 hpf batches of approximately 200 embryos were pooled into 1.5 ml tube. Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS 0.8mM CaCl2 50U/ml penicillin and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies and stored at 80C until RNA isolation. | RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase the solution was transferred to an RNeasy minElute column Qiagen. On column DNase digestion subsequent washing and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries. Libraries were prepared for RNA sequencing using the mRNA Seq seq1 seq5 and seq11 or TruSeq Kit seq13 seq14 and seq15 according to the Illumina's recommended protocol. | Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes. 25 ml of E3 buffer was used per 50 60 embryos in each dish. | developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype | GSM1081110 | GSM1081110: Seq13; Danio rerio; RNA Seq | GSM1081110 1 | 1 | GEO Accession:GSM1081110 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP018538 | seq13.txt.gz | fastq | 1693675269.0 | 33209319.0 | GSM1081110 r1 | 0:51 | A:443719209;C:411369010;G:404182982;T:434361031;N:43037 | 51 | 443719209 | 411369010 | 404182982 | 434361031 | 43037 | SRX233122 | SRS393096 | SRA066447 | GEO | Todd Evans Lab, Cell and Developmental Biology, Weill Cornell | 1 | 0.91781 | 0.08107 | 0.74976 | 0.46528 | 51 | B | usable mapping rate | illumina | hiseq_era | full_length | random_priming | trueseq | bulk | bulk | bulk | United States | 2013-02-11 | Pharyngula | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 36645 | 36645 | SRR700535 | SRX233121 | SRS393095 | SRP018538 | PRJNA189226 | Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos | GSE44233 | Transcriptome Analysis | The Gata4 transcription factor is essential for normal heart development but the molecular basis for its function remain poorly understood. We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos. Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited. Three replicate control samples and three replicate Gata4 morphant samples were analyzed. | pubmed:23850773 | Seq5 | GSM1081109 | tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype | Seq5 | Basecalls demultiplexing and filtering of reads was performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb version: development 20110921150240 with the following parameters: Ambiguity threshold = 1 Max Number Gap Opens = 1 Max Number Gap Extensions = 1. Differential expression was generated with the DESEQ package with native goby support using gobyweb version: development 20110921150240 with the following parameters: q value threshold = 1.0 weight adjustment = none Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1 a log2 fold change > 1 for WT/G4 and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb version: development20110921150240. Additional supplementary .xlsx file containing RPKM counts and statistical values was exported from gobyweb and processed in excel. | sorted cardiomyocytes | Embryos were injected with morpholino before the 4 cell stage of development. 2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo. At 24 hpf batches of approximately 200 embryos were pooled into 1.5 ml tube. Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS 0.8mM CaCl2 50U/ml penicillin and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies and stored at 80C until RNA isolation. | RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase the solution was transferred to an RNeasy minElute column Qiagen. On column DNase digestion subsequent washing and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries. Libraries were prepared for RNA sequencing using the mRNA Seq seq1 seq5 and seq11 or TruSeq Kit seq13 seq14 and seq15 according to the Illumina's recommended protocol. | Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes. 25 ml of E3 buffer was used per 50 60 embryos in each dish. | developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype | GSM1081109 | GSM1081109: Seq5; Danio rerio; RNA Seq | GSM1081109 1 | 1 | GEO Accession:GSM1081109 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina Genome Analyzer II | SRP018538 | seq5.txt.gz | fastq | 1245644280.0 | 34601230.0 | GSM1081109 r1 | 0:36 | A:334131135;C:287707996;G:288492153;T:334895459;N:417537 | 36 | 334131135 | 287707996 | 288492153 | 334895459 | 417537 | SRX233121 | SRS393095 | SRA066447 | GEO | Todd Evans Lab, Cell and Developmental Biology, Weill Cornell | 1 | 0.89495 | 0.1058 | 0.74247 | 0.46422 | 36 | B | usable mapping rate | illumina | early_illumina | full_length | random_priming | trueseq | bulk | bulk | bulk | United States | 2013-02-11 | Pharyngula | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 36646 | 36646 | SRR700534 | SRX233120 | SRS393094 | SRP018538 | PRJNA189226 | Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos | GSE44233 | Transcriptome Analysis | The Gata4 transcription factor is essential for normal heart development but the molecular basis for its function remain poorly understood. We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos. Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited. Three replicate control samples and three replicate Gata4 morphant samples were analyzed. | pubmed:23850773 | Seq1 | GSM1081108 | tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype | Seq1 | Basecalls demultiplexing and filtering of reads was performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb version: development 20110921150240 with the following parameters: Ambiguity threshold = 1 Max Number Gap Opens = 1 Max Number Gap Extensions = 1. Differential expression was generated with the DESEQ package with native goby support using gobyweb version: development 20110921150240 with the following parameters: q value threshold = 1.0 weight adjustment = none Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1 a log2 fold change > 1 for WT/G4 and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb version: development20110921150240. Additional supplementary .xlsx file containing RPKM counts and statistical values was exported from gobyweb and processed in excel. | sorted cardiomyocytes | Embryos were injected with morpholino before the 4 cell stage of development. 2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo. At 24 hpf batches of approximately 200 embryos were pooled into 1.5 ml tube. Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS 0.8mM CaCl2 50U/ml penicillin and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies and stored at 80C until RNA isolation. | RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase the solution was transferred to an RNeasy minElute column Qiagen. On column DNase digestion subsequent washing and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries. Libraries were prepared for RNA sequencing using the mRNA Seq seq1 seq5 and seq11 or TruSeq Kit seq13 seq14 and seq15 according to the Illumina's recommended protocol. | Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes. 25 ml of E3 buffer was used per 50 60 embryos in each dish. | developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype | GSM1081108 | GSM1081108: Seq1; Danio rerio; RNA Seq | GSM1081108 1 | 1 | GEO Accession:GSM1081108 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina Genome Analyzer II | SRP018538 | seq1.txt.gz | fastq | 929284704.0 | 25813464.0 | GSM1081108 r1 | 0:36 | A:244730361;C:220466820;G:213037296;T:250386569;N:663658 | 36 | 244730361 | 220466820 | 213037296 | 250386569 | 663658 | SRX233120 | SRS393094 | SRA066447 | GEO | Todd Evans Lab, Cell and Developmental Biology, Weill Cornell | 1 | 0.87436 | 0.11629 | 0.73302 | 0.46999 | 36 | B | usable mapping rate | illumina | early_illumina | full_length | random_priming | trueseq | bulk | bulk | bulk | United States | 2013-02-11 | Pharyngula | Embryo | Heart | Cardiovascular System |
Advanced export
JSON shape: default, array, newline-delimited
CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;