run_metadata
350 rows where experiment.platform = "ILLUMINA" and technology = "iclip"
This data as json, CSV (advanced)
| Link | rowid ▼ | run.accession | experiment.accession | sample.accession | study.accession | bioproject | study.title | study.alias | study.type | study.abstract | study.attributes | study.PMIDs | sample.description | sample.title | sample.alias | sample.centername | sample.attributes | GEOsample.title | GEOsample.dataprocessing | GEOsample.source | GEOsample.treatmentprotocol | GEOsample.extractprotocol | GEOsample.growthprotocol | GEOsample.characteristics | GEOsample.accession | experiment.title | experiment.alias | experiment.library_name | experiment.design_description | experiment.library_construction_protocol | experiment.attributes | experiment.library_strategy | experiment.library_source | experiment.library_selection | experiment.library_layout | experiment.platform | experiment.instrument_model | experiment.spot_descriptor | experiment.study_ref | run.title | run.attributes | run.filename | run.semantic_name | run.total_bases | run.total_spots | run.alias | run.read_lengths | run.base_counts | run.r1_length | run.r2_length | run.r3_length | run.r4_length | run.Acount | run.Ccount | run.Gcount | run.Tcount | run.Ncount | run.experiment | run.pool_member | submission.accession | submission.srasource | submission.bioprojectsource | seqdetective.n_mates | seqdetective.mapping_rate.mate1 | seqdetective.mapping_rate.mate2 | seqdetective.nofeature_rate.mate1 | seqdetective.nofeature_rate.mate2 | seqdetective.sparsity.mate1 | seqdetective.sparsity.mate2 | seqdetective.pos_strand_rate.mate1 | seqdetective.pos_strand_rate.mate2 | seqdetective.readlen.mate1 | seqdetective.readlen.mate2 | seqdetective.judgement.mate1 | seqdetective.judgement.mate2 | seqdetective.judgement.reason | platform_family | instrument_generation | read_bias | selection_class | prep_kit | sc_or_bulk | tech_class | technology | tech_variant | submission.bioprojectsource.country | earliest_date | devstage_curation | devstage_curation_coarse | tissue_curation | tissue_curation_coarse |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 40249 | 40249 | SRR3038049 | SRX1494244 | SRS1217111 | SRP067641 | PRJNA306648 | Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition | GSE76212 | Other | We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined | pubmed:28381614 | IgG iCLIP zf ZGA rep3 | GSM1976593 | tissue:zebrafish embryo|developmental stage:ZGA 1K cell stage|antibody:anti IgG|barcode sequence:NNNTGGCNN | IgG iCLIP zf ZGA rep3 | Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls. | zebrafish embryo | Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions. | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | Zebrafish embryos were raised from WT AB strain and maintained using standard conditions. | developmental stage:ZGA 1K cell stage|antibody:anti IgG|barcode sequence:NNNTGGCNN | GSM1976593 | GSM1976593: IgG iCLIP zf ZGA rep3; Danio rerio; OTHER | GSM1976593 | 1 | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | GEO Accession:GSM1976593 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP067641 | iCLIP_IgG_zebrafishembryo_wt_1K_IgGcontrol_Dr_NNNTGGCNN_20140613_L4333_4.fq.gz | fastq | 82722124.0 | 1088449.0 | GSM1976593 r1 | 0:76 | A:21959870;C:19048567;G:22289272;T:19403630;N:20785 | 76 | 21959870 | 19048567 | 22289272 | 19403630 | 20785 | SRX1494244 | SRS1217111 | SRA320959 | GEO | Molecular Biophysics and Biochemistry, Yale University | 1 | 0.08124 | 0.02181 | 0.98591 | 0.59183 | 76 | B | usable mapping rate | illumina | hiseq_era | 3prime | other | unknown | bulk | clip | iclip | United States | 2015-12-21 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 40250 | 40250 | SRR3038048 | SRX1494243 | SRS1217112 | SRP067641 | PRJNA306648 | Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition | GSE76212 | Other | We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined | pubmed:28381614 | IgG iCLIP zf ZGA rep2 | GSM1976592 | tissue:zebrafish embryo|developmental stage:ZGA 1K cell stage|antibody:anti IgG|barcode sequence:NNNCCACNN | IgG iCLIP zf ZGA rep2 | Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls. | zebrafish embryo | Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions. | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | Zebrafish embryos were raised from WT AB strain and maintained using standard conditions. | developmental stage:ZGA 1K cell stage|antibody:anti IgG|barcode sequence:NNNCCACNN | GSM1976592 | GSM1976592: IgG iCLIP zf ZGA rep2; Danio rerio; OTHER | GSM1976592 | 1 | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | GEO Accession:GSM1976592 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP067641 | iCLIP_IgG_zebrafishembryo_wt_1K_IgGcontrol_Dr_NNNCCACNN_20140613_L4333_2.fq.gz | fastq | 50195036.0 | 660461.0 | GSM1976592 r1 | 0:76 | A:14249581;C:12927029;G:12969451;T:10036400;N:12575 | 76 | 14249581 | 12927029 | 12969451 | 10036400 | 12575 | SRX1494243 | SRS1217112 | SRA320959 | GEO | Molecular Biophysics and Biochemistry, Yale University | 1 | 0.25447 | 0.03871 | 0.94556 | 0.7523 | 76 | B | usable mapping rate | illumina | hiseq_era | 3prime | other | unknown | bulk | clip | iclip | United States | 2015-12-21 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 40251 | 40251 | SRR3038047 | SRX1494242 | SRS1217113 | SRP067641 | PRJNA306648 | Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition | GSE76212 | Other | We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined | pubmed:28381614 | IgG iCLIP zf ZGA rep1 | GSM1976591 | tissue:zebrafish embryo|developmental stage:ZGA 1K cell stage|antibody:anti IgG|barcode sequence:NNNGGCGNN | IgG iCLIP zf ZGA rep1 | Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls. | zebrafish embryo | Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions. | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | Zebrafish embryos were raised from WT AB strain and maintained using standard conditions. | developmental stage:ZGA 1K cell stage|antibody:anti IgG|barcode sequence:NNNGGCGNN | GSM1976591 | GSM1976591: IgG iCLIP zf ZGA rep1; Danio rerio; OTHER | GSM1976591 | 1 | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | GEO Accession:GSM1976591 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP067641 | iCLIP_IgG_zebrafishembryo_wt_1K_IgGcontrol_Dr_NNNGGCGNN_20140613_L4333_5.fq.gz | fastq | 453449136.0 | 5966436.0 | GSM1976591 r1 | 0:76 | A:124726528;C:101139098;G:135573575;T:91900507;N:109428 | 76 | 124726528 | 101139098 | 135573575 | 91900507 | 109428 | SRX1494242 | SRS1217113 | SRA320959 | GEO | Molecular Biophysics and Biochemistry, Yale University | 1 | 0.51353 | 0.10729 | 0.88069 | 0.7159 | 76 | B | usable mapping rate | illumina | hiseq_era | 3prime | other | unknown | bulk | clip | iclip | United States | 2015-12-21 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 40252 | 40252 | SRR3038046 | SRX1494241 | SRS1217114 | SRP067641 | PRJNA306648 | Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition | GSE76212 | Other | We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined | pubmed:28381614 | IgG iCLIP zf preZGA rep3 | GSM1976590 | tissue:zebrafish embryo|developmental stage:preZGA 32 cell stage|antibody:anti IgG|barcode sequence:NNNTGGCNN | IgG iCLIP zf preZGA rep3 | Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls. | zebrafish embryo | Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions. | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | Zebrafish embryos were raised from WT AB strain and maintained using standard conditions. | developmental stage:preZGA 32 cell stage|antibody:anti IgG|barcode sequence:NNNTGGCNN | GSM1976590 | GSM1976590: IgG iCLIP zf preZGA rep3; Danio rerio; OTHER | GSM1976590 | 1 | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | GEO Accession:GSM1976590 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP067641 | iCLIP_IgG_Drembryo_wt_IgGcontrol_Dr_NNNTGGCNN_20130812_hnRNPA1_4.fq.gz | fastq | 600183932.0 | 7897157.0 | GSM1976590 r1 | 0:76 | A:173843237;C:131372689;G:170729621;T:124187689;N:50696 | 76 | 173843237 | 131372689 | 170729621 | 124187689 | 50696 | SRX1494241 | SRS1217114 | SRA320959 | GEO | Molecular Biophysics and Biochemistry, Yale University | 1 | 0.14511 | 0.03659 | 0.9332 | 0.651 | 76 | B | usable mapping rate | illumina | hiseq_era | 3prime | other | unknown | bulk | clip | iclip | United States | 2015-12-21 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 40253 | 40253 | SRR3038045 | SRX1494240 | SRS1217115 | SRP067641 | PRJNA306648 | Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition | GSE76212 | Other | We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined | pubmed:28381614 | IgG iCLIP zf preZGA rep2 | GSM1976589 | tissue:zebrafish embryo|developmental stage:preZGA 32 cell stage|antibody:anti IgG|barcode sequence:NNNCCGGNN | IgG iCLIP zf preZGA rep2 | Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls. | zebrafish embryo | Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions. | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | Zebrafish embryos were raised from WT AB strain and maintained using standard conditions. | developmental stage:preZGA 32 cell stage|antibody:anti IgG|barcode sequence:NNNCCGGNN | GSM1976589 | GSM1976589: IgG iCLIP zf preZGA rep2; Danio rerio; OTHER | GSM1976589 | 1 | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | GEO Accession:GSM1976589 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP067641 | iCLIP_IgG_Drembryo_wt_IgGcontrol_Dr_NNNCCGGNN_20130812_hnRNPA1_5.fq.gz | fastq | 612280168.0 | 8056318.0 | GSM1976589 r1 | 0:76 | A:175101988;C:144456623;G:172272609;T:120400014;N:48934 | 76 | 175101988 | 144456623 | 172272609 | 120400014 | 48934 | SRX1494240 | SRS1217115 | SRA320959 | GEO | Molecular Biophysics and Biochemistry, Yale University | 1 | 0.05322 | 0.01649 | 0.97656 | 0.67242 | 76 | B | usable mapping rate | illumina | hiseq_era | 3prime | other | unknown | bulk | clip | iclip | United States | 2015-12-21 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 40254 | 40254 | SRR3038044 | SRX1494239 | SRS1217116 | SRP067641 | PRJNA306648 | Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition | GSE76212 | Other | We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined | pubmed:28381614 | IgG iCLIP zf preZGA rep1 | GSM1976588 | tissue:zebrafish embryo|developmental stage:preZGA 32 cell stage|antibody:anti IgG|barcode sequence:NNNGGCGNN | IgG iCLIP zf preZGA rep1 | Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls. | zebrafish embryo | Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions. | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | Zebrafish embryos were raised from WT AB strain and maintained using standard conditions. | developmental stage:preZGA 32 cell stage|antibody:anti IgG|barcode sequence:NNNGGCGNN | GSM1976588 | GSM1976588: IgG iCLIP zf preZGA rep1; Danio rerio; OTHER | GSM1976588 | 1 | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | GEO Accession:GSM1976588 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP067641 | iCLIP_IgG_Drembryo_wt_IgGcontrol_Dr_NNNGGCGNN_20130812_hnRNPA1_1.fq-3.gz | fastq | 12806760.0 | 168510.0 | GSM1976588 r1 | 0:76 | A:3652525;C:2758781;G:3842061;T:2552042;N:1351 | 76 | 3652525 | 2758781 | 3842061 | 2552042 | 1351 | SRX1494239 | SRS1217116 | SRA320959 | GEO | Molecular Biophysics and Biochemistry, Yale University | 1 | 0.02784 | 0.01181 | 0.99813 | 0.68217 | 76 | B | usable mapping rate | illumina | hiseq_era | 3prime | other | unknown | bulk | clip | iclip | United States | 2015-12-21 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 40255 | 40255 | SRR3038043 | SRX1494238 | SRS1217117 | SRP067641 | PRJNA306648 | Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition | GSE76212 | Other | We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined | pubmed:28381614 | hnRNP A1 iCLIP zf ZGA rep4 | GSM1976587 | tissue:zebrafish embryo|developmental stage:ZGA 1K cell stage|antibody:anti hnRNP A1|barcode sequence:NNNGGTCNN | hnRNP A1 iCLIP zf ZGA rep4 | Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls. | zebrafish embryo | Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions. | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | Zebrafish embryos were raised from WT AB strain and maintained using standard conditions. | developmental stage:ZGA 1K cell stage|antibody:anti hnRNP A1|barcode sequence:NNNGGTCNN | GSM1976587 | GSM1976587: hnRNP A1 iCLIP zf ZGA rep4; Danio rerio; OTHER | GSM1976587 | 1 | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | GEO Accession:GSM1976587 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP067641 | iCLIP_hnRNPA1_zebrafishembryo_wt_1K_hnRNPA1_Dr_NNNGGTCNN_20140613_L4333_6.fq.gz | fastq | 2884007568.0 | 37947468.0 | GSM1976587 r1 | 0:76 | A:936463452;C:557587142;G:746595510;T:642623181;N:738283 | 76 | 936463452 | 557587142 | 746595510 | 642623181 | 738283 | SRX1494238 | SRS1217117 | SRA320959 | GEO | Molecular Biophysics and Biochemistry, Yale University | 1 | 0.38306 | 0.08291 | 0.80568 | 0.62132 | 76 | B | usable mapping rate | illumina | hiseq_era | 3prime | other | unknown | bulk | clip | iclip | United States | 2015-12-21 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 40256 | 40256 | SRR3038042 | SRX1494237 | SRS1217118 | SRP067641 | PRJNA306648 | Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition | GSE76212 | Other | We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined | pubmed:28381614 | hnRNP A1 iCLIP zf ZGA rep3 | GSM1976586 | tissue:zebrafish embryo|developmental stage:ZGA 1K cell stage|antibody:anti hnRNP A1|barcode sequence:NNNCAATNN | hnRNP A1 iCLIP zf ZGA rep3 | Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls. | zebrafish embryo | Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions. | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | Zebrafish embryos were raised from WT AB strain and maintained using standard conditions. | developmental stage:ZGA 1K cell stage|antibody:anti hnRNP A1|barcode sequence:NNNCAATNN | GSM1976586 | GSM1976586: hnRNP A1 iCLIP zf ZGA rep3; Danio rerio; OTHER | GSM1976586 | 1 | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | GEO Accession:GSM1976586 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP067641 | iCLIP_hnRNPA1_zebrafishembryo_wt_1K_hnRNPA1_Dr_NNNCAATNN_20140613_L4333_3.fq.gz | fastq | 3875071508.0 | 50987783.0 | GSM1976586 r1 | 0:76 | A:1328984506;C:775814536;G:956147632;T:813109146;N:1015688 | 76 | 1328984506 | 775814536 | 956147632 | 813109146 | 1015688 | SRX1494237 | SRS1217118 | SRA320959 | GEO | Molecular Biophysics and Biochemistry, Yale University | 1 | 0.35787 | 0.0904 | 0.81874 | 0.64706 | 76 | B | usable mapping rate | illumina | hiseq_era | 3prime | other | unknown | bulk | clip | iclip | United States | 2015-12-21 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 40257 | 40257 | SRR3038041 | SRX1494236 | SRS1217119 | SRP067641 | PRJNA306648 | Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition | GSE76212 | Other | We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined | pubmed:28381614 | hnRNP A1 iCLIP zf ZGA rep2 | GSM1976585 | tissue:zebrafish embryo|developmental stage:ZGA 1K cell stage|antibody:anti hnRNP A1|barcode sequence:NNNTTGTNN | hnRNP A1 iCLIP zf ZGA rep2 | Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls. | zebrafish embryo | Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions. | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | Zebrafish embryos were raised from WT AB strain and maintained using standard conditions. | developmental stage:ZGA 1K cell stage|antibody:anti hnRNP A1|barcode sequence:NNNTTGTNN | GSM1976585 | GSM1976585: hnRNP A1 iCLIP zf ZGA rep2; Danio rerio; OTHER | GSM1976585 | 1 | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | GEO Accession:GSM1976585 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP067641 | iCLIP_hnRNPA1_zebrafishembryo_wt_1K_hnRNPA1_Dr_NNNTTGTNN_20140613_L4333_1.fq.gz | fastq | 3482039180.0 | 45816305.0 | GSM1976585 r1 | 0:76 | A:1093877493;C:647486562;G:914636686;T:825135975;N:902464 | 76 | 1093877493 | 647486562 | 914636686 | 825135975 | 902464 | SRX1494236 | SRS1217119 | SRA320959 | GEO | Molecular Biophysics and Biochemistry, Yale University | 1 | 0.29908 | 0.07356 | 0.83459 | 0.62976 | 76 | B | usable mapping rate | illumina | hiseq_era | 3prime | other | unknown | bulk | clip | iclip | United States | 2015-12-21 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 40258 | 40258 | SRR3038040 | SRX1494235 | SRS1217120 | SRP067641 | PRJNA306648 | Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition | GSE76212 | Other | We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined | pubmed:28381614 | hnRNP A1 iCLIP zf ZGA rep1 | GSM1976584 | tissue:zebrafish embryo|developmental stage:ZGA 1K cell stage|antibody:anti hnRNP A1|barcode sequence:NNNGGTTNN | hnRNP A1 iCLIP zf ZGA rep1 | Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls. | zebrafish embryo | Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions. | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | Zebrafish embryos were raised from WT AB strain and maintained using standard conditions. | developmental stage:ZGA 1K cell stage|antibody:anti hnRNP A1|barcode sequence:NNNGGTTNN | GSM1976584 | GSM1976584: hnRNP A1 iCLIP zf ZGA rep1; Danio rerio; OTHER | GSM1976584 | 1 | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | GEO Accession:GSM1976584 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP067641 | iCLIP_hnRNPA1_zebrafishembryo_wt_1K_hnRNPA1_Dr_NNNGGTTNN_20140613_L4333_7.fq.gz | fastq | 3547711920.0 | 46680420.0 | GSM1976584 r1 | 0:76 | A:1105542969;C:658172853;G:958654426;T:824422930;N:918742 | 76 | 1105542969 | 658172853 | 958654426 | 824422930 | 918742 | SRX1494235 | SRS1217120 | SRA320959 | GEO | Molecular Biophysics and Biochemistry, Yale University | 1 | 0.34257 | 0.08694 | 0.83055 | 0.64965 | 76 | B | usable mapping rate | illumina | hiseq_era | 3prime | other | unknown | bulk | clip | iclip | United States | 2015-12-21 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 40259 | 40259 | SRR3038039 | SRX1494234 | SRS1217121 | SRP067641 | PRJNA306648 | Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition | GSE76212 | Other | We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined | pubmed:28381614 | hnRNP A1 iCLIP zf preZGA rep3 | GSM1976583 | tissue:zebrafish embryo|developmental stage:preZGA 32 cell stage|antibody:anti hnRNP A1|barcode sequence:NNNCAATNN | hnRNP A1 iCLIP zf preZGA rep3 | Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls. | zebrafish embryo | Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions. | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | Zebrafish embryos were raised from WT AB strain and maintained using standard conditions. | developmental stage:preZGA 32 cell stage|antibody:anti hnRNP A1|barcode sequence:NNNCAATNN | GSM1976583 | GSM1976583: hnRNP A1 iCLIP zf preZGA rep3; Danio rerio; OTHER | GSM1976583 | 1 | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | GEO Accession:GSM1976583 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP067641 | iCLIP_hnRNPA1_Drembryo_wt_hnRNPA1_Dr_NNNCAATNN_20130812_hnRNPA1_3.fq.gz | fastq | 1944912200.0 | 25590950.0 | GSM1976583 r1 | 0:76 | A:611172831;C:390755201;G:517844203;T:424973726;N:166239 | 76 | 611172831 | 390755201 | 517844203 | 424973726 | 166239 | SRX1494234 | SRS1217121 | SRA320959 | GEO | Molecular Biophysics and Biochemistry, Yale University | 1 | 0.23819 | 0.06019 | 0.85318 | 0.72811 | 76 | B | usable mapping rate | illumina | hiseq_era | 3prime | other | unknown | bulk | clip | iclip | United States | 2015-12-21 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 40260 | 40260 | SRR3038038 | SRX1494233 | SRS1217122 | SRP067641 | PRJNA306648 | Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition | GSE76212 | Other | We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined | pubmed:28381614 | hnRNP A1 iCLIP zf preZGA rep2 | GSM1976582 | tissue:zebrafish embryo|developmental stage:preZGA 32 cell stage|antibody:anti hnRNP A1|barcode sequence:NNNTTGTNN | hnRNP A1 iCLIP zf preZGA rep2 | Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls. | zebrafish embryo | Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions. | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | Zebrafish embryos were raised from WT AB strain and maintained using standard conditions. | developmental stage:preZGA 32 cell stage|antibody:anti hnRNP A1|barcode sequence:NNNTTGTNN | GSM1976582 | GSM1976582: hnRNP A1 iCLIP zf preZGA rep2; Danio rerio; OTHER | GSM1976582 | 1 | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | GEO Accession:GSM1976582 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP067641 | iCLIP_hnRNPA1_Drembryo_wt_hnRNPA1_Dr_NNNTTGTNN_20130812_hnRNPA1_6.fq.gz | fastq | 1804236124.0 | 23739949.0 | GSM1976582 r1 | 0:76 | A:520750722;C:337743522;G:499109535;T:446481275;N:151070 | 76 | 520750722 | 337743522 | 499109535 | 446481275 | 151070 | SRX1494233 | SRS1217122 | SRA320959 | GEO | Molecular Biophysics and Biochemistry, Yale University | 1 | 0.25184 | 0.06217 | 0.85687 | 0.67912 | 76 | B | usable mapping rate | illumina | hiseq_era | 3prime | other | unknown | bulk | clip | iclip | United States | 2015-12-21 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 40261 | 40261 | SRR3038037 | SRX1494232 | SRS1217123 | SRP067641 | PRJNA306648 | Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition | GSE76212 | Other | We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined | pubmed:28381614 | hnRNP A1 iCLIP zf preZGA rep1 | GSM1976581 | tissue:zebrafish embryo|developmental stage:preZGA 32 cell stage|antibody:anti hnRNP A1|barcode sequence:NNNGGTTNN | hnRNP A1 iCLIP zf preZGA rep1 | Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls. | zebrafish embryo | Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions. | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | Zebrafish embryos were raised from WT AB strain and maintained using standard conditions. | developmental stage:preZGA 32 cell stage|antibody:anti hnRNP A1|barcode sequence:NNNGGTTNN | GSM1976581 | GSM1976581: hnRNP A1 iCLIP zf preZGA rep1; Danio rerio; OTHER | GSM1976581 | 1 | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | GEO Accession:GSM1976581 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP067641 | iCLIP_hnRNPA1_Drembryo_wt_hnRNPA1_Dr_NNNGGTTNN_20130812_hnRNPA1_2.fq.gz | fastq | 2155200476.0 | 28357901.0 | GSM1976581 r1 | 0:76 | A:646739355;C:394864638;G:606938658;T:506474548;N:183277 | 76 | 646739355 | 394864638 | 606938658 | 506474548 | 183277 | SRX1494232 | SRS1217123 | SRA320959 | GEO | Molecular Biophysics and Biochemistry, Yale University | 1 | 0.24207 | 0.05859 | 0.84747 | 0.70564 | 76 | B | usable mapping rate | illumina | hiseq_era | 3prime | other | unknown | bulk | clip | iclip | United States | 2015-12-21 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 41262 | 41262 | SRR4026154 | SRX2018187 | SRS1614128 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | FUS KO 6 | GSM2277123 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | FUS KO 6 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | GSM2277123 | GSM2277123: FUS KO 6; Danio rerio; RNA Seq | GSM2277123 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277123 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | Sample_imb_ketting_2014_13_FUS_KO_6_R1.fastq.gz Sample_imb_ketting_2014_13_FUS_KO_6_R2.fastq.gz | fastq fastq | 7975498532.0 | 39482666.0 | GSM2277123 r1 | 0:101 1:101 | A:2277361634;C:1708878425;G:1702517993;T:2283731854;N:3008626 | 101 | 101 | 2277361634 | 1708878425 | 1702517993 | 2283731854 | 3008626 | SRX2018187 | SRS1614128 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.92046 | 0.9235 | 0.18223 | 0.18163 | 0.68866 | 0.68927 | 0.48519 | 0.47059 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41263 | 41263 | SRR4026155 | SRX2018187 | SRS1614128 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | FUS KO 6 | GSM2277123 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | FUS KO 6 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | GSM2277123 | GSM2277123: FUS KO 6; Danio rerio; RNA Seq | GSM2277123 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277123 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | FUS_KO_6_R1.fastq.gz FUS_KO_6_R2.fastq.gz | fastq fastq | 7173346028.0 | 35511614.0 | GSM2277123 r2 | 0:101 1:101 | A:1991537753;C:1595400788;G:1586024536;T:1997441866;N:2941085 | 101 | 101 | 1991537753 | 1595400788 | 1586024536 | 1997441866 | 2941085 | SRX2018187 | SRS1614128 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.93379 | 0.93701 | 0.16593 | 0.1657 | 0.68517 | 0.68558 | 0.49349 | 0.49229 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41264 | 41264 | SRR4026152 | SRX2018186 | SRS1614129 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | FUS KO 5 | GSM2277122 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | FUS KO 5 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | GSM2277122 | GSM2277122: FUS KO 5; Danio rerio; RNA Seq | GSM2277122 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277122 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | Sample_imb_ketting_2014_13_FUS_KO_5_R1.fastq.gz Sample_imb_ketting_2014_13_FUS_KO_5_R2.fastq.gz | fastq fastq | 7478598328.0 | 37022764.0 | GSM2277122 r1 | 0:101 1:101 | A:2133855925;C:1603288158;G:1598612742;T:2140065375;N:2776128 | 101 | 101 | 2133855925 | 1603288158 | 1598612742 | 2140065375 | 2776128 | SRX2018186 | SRS1614129 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.9197 | 0.92307 | 0.17221 | 0.17171 | 0.68578 | 0.68586 | 0.49581 | 0.50519 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41265 | 41265 | SRR4026153 | SRX2018186 | SRS1614129 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | FUS KO 5 | GSM2277122 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | FUS KO 5 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | GSM2277122 | GSM2277122: FUS KO 5; Danio rerio; RNA Seq | GSM2277122 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277122 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | FUS_KO_5_R1.fastq.gz FUS_KO_5_R2.fastq.gz | fastq fastq | 6719087822.0 | 33262811.0 | GSM2277122 r2 | 0:101 1:101 | A:1785013612;C:1574089873;G:1572290158;T:1784978560;N:2715619 | 101 | 101 | 1785013612 | 1574089873 | 1572290158 | 1784978560 | 2715619 | SRX2018186 | SRS1614129 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.94652 | 0.94901 | 0.12756 | 0.12603 | 0.67834 | 0.6789 | 0.50281 | 0.50397 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41266 | 41266 | SRR4026151 | SRX2018185 | SRS1614126 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | FUS KO 3 | GSM2277121 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | FUS KO 3 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | GSM2277121 | GSM2277121: FUS KO 3; Danio rerio; RNA Seq | GSM2277121 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277121 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | Sample_imb_ketting_2014_13_FUS_KO_3_R1.fastq.gz Sample_imb_ketting_2014_13_FUS_KO_3_R2.fastq.gz | fastq fastq | 7443582840.0 | 36849420.0 | GSM2277121 r1 | 0:101 1:101 | A:2135476546;C:1584607182;G:1583492766;T:2137210756;N:2795590 | 101 | 101 | 2135476546 | 1584607182 | 1583492766 | 2137210756 | 2795590 | SRX2018185 | SRS1614126 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.91865 | 0.92202 | 0.16917 | 0.16765 | 0.69402 | 0.69424 | 0.49158 | 0.505 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41267 | 41267 | SRR4026149 | SRX2018184 | SRS1614127 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | FUS KO 2 | GSM2277120 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | FUS KO 2 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | GSM2277120 | GSM2277120: FUS KO 2; Danio rerio; RNA Seq | GSM2277120 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277120 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | Sample_imb_ketting_2014_13_FUS_KO_2_R1.fastq.gz Sample_imb_ketting_2014_13_FUS_KO_2_R2.fastq.gz | fastq fastq | 7538568694.0 | 37319647.0 | GSM2277120 r1 | 0:101 1:101 | A:2147431018;C:1618323797;G:1622221747;T:2147775519;N:2816613 | 101 | 101 | 2147431018 | 1618323797 | 1622221747 | 2147775519 | 2816613 | SRX2018184 | SRS1614127 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.92241 | 0.92545 | 0.17277 | 0.17289 | 0.6882 | 0.68878 | 0.50153 | 0.49587 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41268 | 41268 | SRR4026150 | SRX2018184 | SRS1614127 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | FUS KO 2 | GSM2277120 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | FUS KO 2 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | GSM2277120 | GSM2277120: FUS KO 2; Danio rerio; RNA Seq | GSM2277120 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277120 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | FUS_KO_2_R1.fastq.gz FUS_KO_2_R2.fastq.gz | fastq fastq | 6447010386.0 | 31915893.0 | GSM2277120 r2 | 0:101 1:101 | A:1836751010;C:1386222757;G:1379853653;T:1841581040;N:2601926 | 101 | 101 | 1836751010 | 1386222757 | 1379853653 | 1841581040 | 2601926 | SRX2018184 | SRS1614127 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.92533 | 0.92991 | 0.17619 | 0.17625 | 0.69031 | 0.69081 | 0.49983 | 0.50191 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41269 | 41269 | SRR4026148 | SRX2018183 | SRS1614125 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | FUS KO 1 | GSM2277119 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | FUS KO 1 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | GSM2277119 | GSM2277119: FUS KO 1; Danio rerio; RNA Seq | GSM2277119 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277119 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | FUS_KO_1_R1.fastq.gz FUS_KO_1_R2.fastq.gz | fastq fastq | 7395102840.0 | 36609420.0 | GSM2277119 r1 | 0:101 1:101 | A:2103771703;C:1595017984;G:1583980946;T:2109307704;N:3024503 | 101 | 101 | 2103771703 | 1595017984 | 1583980946 | 2109307704 | 3024503 | SRX2018183 | SRS1614125 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.9246 | 0.92781 | 0.17577 | 0.17518 | 0.69116 | 0.69232 | 0.50228 | 0.49896 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41270 | 41270 | SRR4026146 | SRX2018182 | SRS1614123 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | WT 6 | GSM2277118 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | WT 6 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | GSM2277118 | GSM2277118: WT 6; Danio rerio; RNA Seq | GSM2277118 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277118 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | Sample_imb_ketting_2014_13_WT_6_R1.fastq.gz Sample_imb_ketting_2014_13_WT_6_R2.fastq.gz | fastq fastq | 8334635544.0 | 41260572.0 | GSM2277118 r1 | 0:101 1:101 | A:2382306534;C:1783081151;G:1778919442;T:2387251408;N:3077009 | 101 | 101 | 2382306534 | 1783081151 | 1778919442 | 2387251408 | 3077009 | SRX2018182 | SRS1614123 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.91647 | 0.9192 | 0.1793 | 0.17873 | 0.69215 | 0.69262 | 0.50463 | 0.50038 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41271 | 41271 | SRR4026147 | SRX2018182 | SRS1614123 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | WT 6 | GSM2277118 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | WT 6 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | GSM2277118 | GSM2277118: WT 6; Danio rerio; RNA Seq | GSM2277118 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277118 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | WT_6_R1.fastq.gz WT_6_R2.fastq.gz | fastq fastq | 7239861396.0 | 35840898.0 | GSM2277118 r2 | 0:101 1:101 | A:1993396411;C:1626521001;G:1620190105;T:1996794482;N:2959397 | 101 | 101 | 1993396411 | 1626521001 | 1620190105 | 1996794482 | 2959397 | SRX2018182 | SRS1614123 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.93444 | 0.93758 | 0.15305 | 0.15223 | 0.68781 | 0.6885 | 0.5083 | 0.50745 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41272 | 41272 | SRR4026144 | SRX2018181 | SRS1614122 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | WT 4 | GSM2277117 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | WT 4 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | GSM2277117 | GSM2277117: WT 4; Danio rerio; RNA Seq | GSM2277117 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277117 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | Sample_imb_ketting_2014_13_WT_4_R1.fastq.gz Sample_imb_ketting_2014_13_WT_4_R2.fastq.gz | fastq fastq | 7425010556.0 | 36757478.0 | GSM2277117 r1 | 0:101 1:101 | A:2145596358;C:1565455511;G:1562345442;T:2148814299;N:2798946 | 101 | 101 | 2145596358 | 1565455511 | 1562345442 | 2148814299 | 2798946 | SRX2018181 | SRS1614122 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.91897 | 0.92157 | 0.17645 | 0.17633 | 0.6981 | 0.69948 | 0.51038 | 0.50544 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41273 | 41273 | SRR4026145 | SRX2018181 | SRS1614122 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | WT 4 | GSM2277117 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | WT 4 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | GSM2277117 | GSM2277117: WT 4; Danio rerio; RNA Seq | GSM2277117 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277117 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | WT_4_R1.fastq.gz WT_4_R2.fastq.gz | fastq fastq | 6322186910.0 | 31297955.0 | GSM2277117 r2 | 0:101 1:101 | A:1808695425;C:1352265448;G:1346884156;T:1811742728;N:2599153 | 101 | 101 | 1808695425 | 1352265448 | 1346884156 | 1811742728 | 2599153 | SRX2018181 | SRS1614122 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.927 | 0.92959 | 0.17323 | 0.17284 | 0.69562 | 0.69601 | 0.50522 | 0.50634 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41274 | 41274 | SRR4026142 | SRX2018180 | SRS1614124 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | WT 3 | GSM2277116 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | WT 3 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | GSM2277116 | GSM2277116: WT 3; Danio rerio; RNA Seq | GSM2277116 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277116 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | Sample_imb_ketting_2014_13_WT_3_R1.fastq.gz Sample_imb_ketting_2014_13_WT_3_R2.fastq.gz | fastq fastq | 7556697588.0 | 37409394.0 | GSM2277116 r1 | 0:101 1:101 | A:2168554402;C:1607788560;G:1605790339;T:2171752391;N:2811896 | 101 | 101 | 2168554402 | 1607788560 | 1605790339 | 2171752391 | 2811896 | SRX2018180 | SRS1614124 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.91892 | 0.92233 | 0.17858 | 0.17763 | 0.69589 | 0.69674 | 0.50649 | 0.50869 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41275 | 41275 | SRR4026143 | SRX2018180 | SRS1614124 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | WT 3 | GSM2277116 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | WT 3 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | GSM2277116 | GSM2277116: WT 3; Danio rerio; RNA Seq | GSM2277116 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277116 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | WT_3_R1.fastq.gz WT_3_R2.fastq.gz | fastq fastq | 7898912858.0 | 39103529.0 | GSM2277116 r2 | 0:101 1:101 | A:2243356257;C:1706636846;G:1702064968;T:2243634692;N:3220095 | 101 | 101 | 2243356257 | 1706636846 | 1702064968 | 2243634692 | 3220095 | SRX2018180 | SRS1614124 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.92701 | 0.93109 | 0.17113 | 0.17214 | 0.69591 | 0.69716 | 0.50649 | 0.51272 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41276 | 41276 | SRR4026140 | SRX2018179 | SRS1614121 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | WT 1 | GSM2277115 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | WT 1 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | GSM2277115 | GSM2277115: WT 1; Danio rerio; RNA Seq | GSM2277115 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277115 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | Sample_imb_ketting_2014_13_WT_1_R1.fastq.gz Sample_imb_ketting_2014_13_WT_1_R2.fastq.gz | fastq fastq | 7999392910.0 | 39600955.0 | GSM2277115 r1 | 0:101 1:101 | A:2287512350;C:1711532349;G:1705616114;T:2291731604;N:3000493 | 101 | 101 | 2287512350 | 1711532349 | 1705616114 | 2291731604 | 3000493 | SRX2018179 | SRS1614121 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.92291 | 0.92474 | 0.16701 | 0.16646 | 0.698 | 0.69814 | 0.51025 | 0.51024 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41277 | 41277 | SRR4026141 | SRX2018179 | SRS1614121 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | WT 1 | GSM2277115 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | WT 1 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | GSM2277115 | GSM2277115: WT 1; Danio rerio; RNA Seq | GSM2277115 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277115 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | WT_1_R1.fastq.gz WT_1_R2.fastq.gz | fastq fastq | 6187101026.0 | 30629213.0 | GSM2277115 r2 | 0:101 1:101 | A:1757769151;C:1333826875;G:1336928364;T:1756068161;N:2508475 | 101 | 101 | 1757769151 | 1333826875 | 1336928364 | 1756068161 | 2508475 | SRX2018179 | SRS1614121 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.9294 | 0.9334 | 0.16402 | 0.16355 | 0.69682 | 0.69741 | 0.49912 | 0.50428 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41527 | 41527 | SRR5441898 | SRX2731753 | SRS2119651 | SRP092907 | PRJNA352850 | Transcriptomics analysis of gene expressions m6A enrichment levels and ythdf2 binding targets in control and mettl3 or ythdf2 morphants zebrafish embryos | GSE89655 | Other | RNA was isolated from control and mettl3 or ythdf2 morphants zebrafish cells using the TRIzol Invitrogen reagent by following the company manual. For all samples the RNA integrity was checked using an Agilent Bioanalyzer 2100. All samples showed a RIN RNA integrity number of higher than 9. Approximately 2.5 µg of total RNA was then used for library preparation using a TruSeq™ RNA Sample Prep Kit v2 Illumina San Diego CA USA according to the manufacturer’s protocol.The libraries were sequenced using HiSeq2500 or HiSeq 3000 Illumina in paired read mode creating reads with a length of 101 or 151 bp. Sequencing chemistry v2 Illumina was used. Overall design: Examination of gene expressive levels m6A enrichment levels m6A single uncleotide sites and ythdf2 binding targets in normal and mettl3 or ythdf2 morphants zebrafish cells | pubmed:28869969 | control zebrafish embryos m6A miCLIP rep2 | GSM2572320 | source name:zebrafish embryos|cell type:normal zebrafish embryos cells|age:28hpf|tissue:trunk|enrichment antibody vendor:Abcam | control zebrafish embryos m6A miCLIP rep2 | library strategy: miCLIP seq Reads were trimmed for adaptor sequence using fastx clipper from FASTX Toolkit fastx clipper a AGATCGGAAGAGCACACG n Q 33. Low quality bases were filtered by fastq filter.pl a custom perl script from CLIP Tool Kit CTK and reads shorter than 24 nt would be discard. The forward reads were demultiplexed based on 5’ barcodes for individual replicates by fastq2collapse.pl to remove PCR amplified reads. The reverse reads were reversed complemented and processed like their forward mates. And then paired end reads were mixed for downstream analysis. Random barcodes of remained reads were stripped by stripBarcode.pl. Then the barcode sequence was moved to header line for each read. Remained reads were mapped to the zebrafish genomes version zv9 with BWA v0.7.10. The CIMS pipeline https://zhanglab.c2b2.columbia.edu/index.php/CTK Documentation was used to collapse PCR duplicates based on their mapped coordinates and to determine the unique tag coverage k and the number of mutation m for each nucleotide. The filter for the dataset was k >= 15 and m/k <= 50% and only mutation positions within RRACH motif were identified as m6A for downstream analysis to exclude the potential m6Am modification. Genome build: zv9 Supplementary files format and content: Single nucleotide resolution m6A sites identified by CIMS software. | zebrafish embryos | For miCLIP seq mRNA was isolate from the trunck region of zebrafish embryos at 28hpf and the RNA integrity was checked using an Agilent Bioanalyzer 2100. 10 ug of mRNA was first fragmented and immunoprecipitated with m6A antibody and thus obtained m6A containing RNA was subjected to cDNA library construction according to previously reported method [Linder et al. 2015; PMID: 26121403]. The libraries were sequenced using HiSeq3000 Illumina in paired read mode creating reads with a length of 101 bp. | cell type:normal zebrafish embryos cells|age:28hpf|tissue:trunk|enrichment antibody vendor:Abcam | GSM2572320 | GSM2572320: control zebrafish embryos m6A miCLIP rep2; Danio rerio; OTHER | GSM2572320 | 1 | For miCLIP seq mRNA was isolate from the trunck region of zebrafish embryos at 28hpf and the RNA integrity was checked using an Agilent Bioanalyzer 2100. 10 ug of mRNA was first fragmented and immunoprecipitated with m6A antibody and thus obtained m6A containing RNA was subjected to cDNA library construction according to previously reported method [Linder et al. 2015; PMID: 26121403]. The libraries were sequenced using HiSeq2000 or HiSeq3000 Illumina in single read or paired read mode creating reads with a length of 101 bp | GEO Accession:GSM2572320 | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina HiSeq 3000 | SRP092907 | miCLIP_Abcam_rep2_1.fastq.gz miCLIP_Abcam_rep2_2.fastq.gz | fastq fastq | 5381144865.0 | 26771865.0 | GSM2572320 r1 | 0:101 1:100 | A:1590037266;C:1121098903;G:1187084038;T:1482144584;N:780074 | 101 | 100 | 1590037266 | 1121098903 | 1187084038 | 1482144584 | 780074 | SRX2731753 | SRS2119651 | SRA491654 | GEO | Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS) | 2 | 0.55442 | 0.60543 | 0.10037 | 0.11559 | 0.75432 | 0.747 | 0.55512 | 0.44818 | 101 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | other | trueseq | bulk | clip | iclip | China | 2017-04-10 | Pharyngula | Embryo | Trunk | Surface Structure | ||||||||||||
| 41528 | 41528 | SRR5441897 | SRX2731752 | SRS2119650 | SRP092907 | PRJNA352850 | Transcriptomics analysis of gene expressions m6A enrichment levels and ythdf2 binding targets in control and mettl3 or ythdf2 morphants zebrafish embryos | GSE89655 | Other | RNA was isolated from control and mettl3 or ythdf2 morphants zebrafish cells using the TRIzol Invitrogen reagent by following the company manual. For all samples the RNA integrity was checked using an Agilent Bioanalyzer 2100. All samples showed a RIN RNA integrity number of higher than 9. Approximately 2.5 µg of total RNA was then used for library preparation using a TruSeq™ RNA Sample Prep Kit v2 Illumina San Diego CA USA according to the manufacturer’s protocol.The libraries were sequenced using HiSeq2500 or HiSeq 3000 Illumina in paired read mode creating reads with a length of 101 or 151 bp. Sequencing chemistry v2 Illumina was used. Overall design: Examination of gene expressive levels m6A enrichment levels m6A single uncleotide sites and ythdf2 binding targets in normal and mettl3 or ythdf2 morphants zebrafish cells | pubmed:28869969 | control zebrafish embryos m6A miCLIP rep1 | GSM2572319 | source name:zebrafish embryos|cell type:normal zebrafish embryos cells|age:28hpf|tissue:trunk|enrichment antibody vendor:Abcam | control zebrafish embryos m6A miCLIP rep1 | library strategy: miCLIP seq Reads were trimmed for adaptor sequence using fastx clipper from FASTX Toolkit fastx clipper a AGATCGGAAGAGCACACG n Q 33. Low quality bases were filtered by fastq filter.pl a custom perl script from CLIP Tool Kit CTK and reads shorter than 24 nt would be discard. The forward reads were demultiplexed based on 5’ barcodes for individual replicates by fastq2collapse.pl to remove PCR amplified reads. The reverse reads were reversed complemented and processed like their forward mates. And then paired end reads were mixed for downstream analysis. Random barcodes of remained reads were stripped by stripBarcode.pl. Then the barcode sequence was moved to header line for each read. Remained reads were mapped to the zebrafish genomes version zv9 with BWA v0.7.10. The CIMS pipeline https://zhanglab.c2b2.columbia.edu/index.php/CTK Documentation was used to collapse PCR duplicates based on their mapped coordinates and to determine the unique tag coverage k and the number of mutation m for each nucleotide. The filter for the dataset was k >= 15 and m/k <= 50% and only mutation positions within RRACH motif were identified as m6A for downstream analysis to exclude the potential m6Am modification. Genome build: zv9 Supplementary files format and content: Single nucleotide resolution m6A sites identified by CIMS software. | zebrafish embryos | For miCLIP seq mRNA was isolate from the trunck region of zebrafish embryos at 28hpf and the RNA integrity was checked using an Agilent Bioanalyzer 2100. 10 ug of mRNA was first fragmented and immunoprecipitated with m6A antibody and thus obtained m6A containing RNA was subjected to cDNA library construction according to previously reported method [Linder et al. 2015; PMID: 26121403]. The libraries were sequenced using HiSeq3000 Illumina in paired read mode creating reads with a length of 101 bp. | cell type:normal zebrafish embryos cells|age:28hpf|tissue:trunk|enrichment antibody vendor:Abcam | GSM2572319 | GSM2572319: control zebrafish embryos m6A miCLIP rep1; Danio rerio; OTHER | GSM2572319 | 1 | For miCLIP seq mRNA was isolate from the trunck region of zebrafish embryos at 28hpf and the RNA integrity was checked using an Agilent Bioanalyzer 2100. 10 ug of mRNA was first fragmented and immunoprecipitated with m6A antibody and thus obtained m6A containing RNA was subjected to cDNA library construction according to previously reported method [Linder et al. 2015; PMID: 26121403]. The libraries were sequenced using HiSeq2000 or HiSeq3000 Illumina in single read or paired read mode creating reads with a length of 101 bp | GEO Accession:GSM2572319 | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina HiSeq 3000 | SRP092907 | miCLIP_Abcam_rep1_1.fastq.gz miCLIP_Abcam_rep1_2.fastq.gz | fastq fastq | 6036174318.0 | 30030718.0 | GSM2572319 r1 | 0:101 1:100 | A:1726466495;C:1297674104;G:1364186585;T:1647084426;N:762708 | 101 | 100 | 1726466495 | 1297674104 | 1364186585 | 1647084426 | 762708 | SRX2731752 | SRS2119650 | SRA491654 | GEO | Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS) | 2 | 0.5985 | 0.66835 | 0.09404 | 0.1086 | 0.74491 | 0.73596 | 0.54343 | 0.45047 | 101 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | other | trueseq | bulk | clip | iclip | China | 2017-04-10 | Pharyngula | Embryo | Trunk | Surface Structure | ||||||||||||
| 48384 | 48384 | SRR7236655 | SRX4142917 | SRS3356704 | SRP149368 | PRJNA473836 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis: KHSRP iCLIP | PRJNA473836 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. This is the endogenous KHSRP iCLIP part of the study. | Raw multiplex: KHSRP iCLIP iCLIP Khsrp Ab B2;KHSRP iCLIP iCLIP Khsrp noAb B2 | Raw multiplex: KHSRP iCLIP iC Khsrp Ab B2 AG01175;KHSRP iCLIP iC Khsrp noAb B2 AG01176 | strain:TU/AB|age:4.0|dev stage:sphere|sex:pooled male and female|tissue:embryo|treatment:iCLIP|molecule:RNA|selection:KHSRP antibody;|replicate group:1;2|replicate:2|barcode:TCTC;GTGT|BioSampleModel:Model organism or animal | Raw multiplex: KHSRP iCLIP iCLIP Khsrp Ab B2;KHSRP iCLIP iCLIP Khsrp noAb B2 | AG01175.2;AG01176.2 | AG01175.2;AG01176.2 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP149368 | HHLV3ADXX_kh2_NOBCX_R1.fastq.gz | fastq | 7675050912.0 | 100987512.0 | HHLV3ADXX kh2 NOBCX R1.fastq.gz | 0:76 | A:2241934669;C:1774343310;G:1727825603;T:1912212373;N:18734957 | 76 | 2241934669 | 1774343310 | 1727825603 | 1912212373 | 18734957 | SRX4142917 | SRS3356704 | SRA712863 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.00123 | 0.00083 | 0.99939 | 0.47297 | 76 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | clip | iclip | United States | 2018-06-07 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 48385 | 48385 | SRR7236656 | SRX4142916 | SRS3356704 | SRP149368 | PRJNA473836 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis: KHSRP iCLIP | PRJNA473836 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. This is the endogenous KHSRP iCLIP part of the study. | Raw multiplex: KHSRP iCLIP iCLIP Khsrp Ab B2;KHSRP iCLIP iCLIP Khsrp noAb B2 | Raw multiplex: KHSRP iCLIP iC Khsrp Ab B2 AG01175;KHSRP iCLIP iC Khsrp noAb B2 AG01176 | strain:TU/AB|age:4.0|dev stage:sphere|sex:pooled male and female|tissue:embryo|treatment:iCLIP|molecule:RNA|selection:KHSRP antibody;|replicate group:1;2|replicate:2|barcode:TCTC;GTGT|BioSampleModel:Model organism or animal | Raw multiplex: KHSRP iCLIP iCLIP Khsrp Ab B2;KHSRP iCLIP iCLIP Khsrp noAb B2 | AG01175.1;AG01176.1 | AG01175.1;AG01176.1 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP149368 | HHLY2ADXX_kh2_NOBCX_R1.fastq.gz | fastq | 10199922760.0 | 134209510.0 | HHLY2ADXX kh2 NOBCX R1.fastq.gz | 0:76 | A:2990232290;C:2350693064;G:2293777949;T:2554099449;N:11120008 | 76 | 2990232290 | 2350693064 | 2293777949 | 2554099449 | 11120008 | SRX4142916 | SRS3356704 | SRA712863 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.00128 | 0.00076 | 0.99945 | 0.43877 | 76 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | clip | iclip | United States | 2018-06-07 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 48386 | 48386 | SRR7236657 | SRX4142915 | SRS3356703 | SRP149368 | PRJNA473836 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis: KHSRP iCLIP | PRJNA473836 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. This is the endogenous KHSRP iCLIP part of the study. | Raw multiplex: KHSRP iCLIP iCLIP Khsrp noAb B3;KHSRP iCLIP iCLIP Khsrp Ab B3 | Raw multiplex: KHSRP iCLIP iC Khsrp noAb B3 AG01177;KHSRP iCLIP iC Khsrp Ab B3 AG01178 | strain:TU/AB|age:4.0|dev stage:sphere|sex:pooled male and female|tissue:embryo|treatment:iCLIP|molecule:RNA|selection:;KHSRP antibody|replicate group:2;1|replicate:3|barcode:CACA;AGAG|BioSampleModel:Model organism or animal | Raw multiplex: KHSRP iCLIP iCLIP Khsrp noAb B3;KHSRP iCLIP iCLIP Khsrp Ab B3 | AG01177.2;AG01178.2 | AG01177.2;AG01178.2 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP149368 | HHLTFADXX_kh3_022_R1.fastq.gz | fastq | 5612942988.0 | 73854513.0 | HHLTFADXX kh3 022 R1.fastq.gz | 0:76 | A:1761182916;C:1273000548;G:1339715056;T:1238748082;N:296386 | 76 | 1761182916 | 1273000548 | 1339715056 | 1238748082 | 296386 | SRX4142915 | SRS3356703 | SRA712863 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.00125 | 0.00069 | 0.99831 | 0.5566 | 76 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | clip | iclip | United States | 2018-06-07 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 48387 | 48387 | SRR7236658 | SRX4142914 | SRS3356703 | SRP149368 | PRJNA473836 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis: KHSRP iCLIP | PRJNA473836 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. This is the endogenous KHSRP iCLIP part of the study. | Raw multiplex: KHSRP iCLIP iCLIP Khsrp noAb B3;KHSRP iCLIP iCLIP Khsrp Ab B3 | Raw multiplex: KHSRP iCLIP iC Khsrp noAb B3 AG01177;KHSRP iCLIP iC Khsrp Ab B3 AG01178 | strain:TU/AB|age:4.0|dev stage:sphere|sex:pooled male and female|tissue:embryo|treatment:iCLIP|molecule:RNA|selection:;KHSRP antibody|replicate group:2;1|replicate:3|barcode:CACA;AGAG|BioSampleModel:Model organism or animal | Raw multiplex: KHSRP iCLIP iCLIP Khsrp noAb B3;KHSRP iCLIP iCLIP Khsrp Ab B3 | AG01177.1;AG01178.1 | AG01177.1;AG01178.1 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP149368 | HHLV3ADXX_kh3_NOBCX_R1.fastq.gz | fastq | 7810653532.0 | 102771757.0 | HHLV3ADXX kh3 NOBCX R1.fastq.gz | 0:76 | A:2439317937;C:1775190292;G:1863760875;T:1714265680;N:18118748 | 76 | 2439317937 | 1775190292 | 1863760875 | 1714265680 | 18118748 | SRX4142914 | SRS3356703 | SRA712863 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.00121 | 0.00071 | 0.99864 | 0.54444 | 76 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | clip | iclip | United States | 2018-06-07 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 48388 | 48388 | SRR7236659 | SRX4142913 | SRS3356702 | SRP149368 | PRJNA473836 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis: KHSRP iCLIP | PRJNA473836 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. This is the endogenous KHSRP iCLIP part of the study. | KHSRP iCLIP iCLIP Khsrp Ab B3 | KHSRP iCLIP iC Khsrp Ab B3 AG01178 | strain:TU/AB|age:4.0|dev stage:sphere|sex:pooled male and female|tissue:embryo|treatment:iCLIP|molecule:RNA|selection:KHSRP antibody|replicate group:1|replicate:3|barcode:AGAG|BioSampleModel:Model organism or animal | KHSRP iCLIP iCLIP Khsrp Ab B3 | AG01178.2 | AG01178.2 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP149368 | AG01178.2_R1.fastq.gz | fastq | 1046051929.0 | 35061189.0 | AG01178.2 R1.fastq.gz | 0:29.84 1:0 | A:304629557;C:170568838;G:208541597;T:362307791;N:4146 | 29 | 0 | 304629557 | 170568838 | 208541597 | 362307791 | 4146 | SRX4142913 | SRS3356702 | SRA712863 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.68324 | 0.4824 | 0.78139 | 0.51734 | 20 | B | usable mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | clip | iclip | United States | 2018-06-07 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 48389 | 48389 | SRR7236660 | SRX4142912 | SRS3356702 | SRP149368 | PRJNA473836 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis: KHSRP iCLIP | PRJNA473836 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. This is the endogenous KHSRP iCLIP part of the study. | KHSRP iCLIP iCLIP Khsrp Ab B3 | KHSRP iCLIP iC Khsrp Ab B3 AG01178 | strain:TU/AB|age:4.0|dev stage:sphere|sex:pooled male and female|tissue:embryo|treatment:iCLIP|molecule:RNA|selection:KHSRP antibody|replicate group:1|replicate:3|barcode:AGAG|BioSampleModel:Model organism or animal | KHSRP iCLIP iCLIP Khsrp Ab B3 | AG01178.1 | AG01178.1 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP149368 | AG01178.1_R1.fastq.gz | fastq | 1429865561.0 | 47958542.0 | AG01178.1 R1.fastq.gz | 0:29.81 1:0 | A:416462367;C:233529708;G:285810572;T:494062288;N:626 | 29 | 0 | 416462367 | 233529708 | 285810572 | 494062288 | 626 | SRX4142912 | SRS3356702 | SRA712863 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.67776 | 0.47933 | 0.782 | 0.52337 | 31 | B | usable mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | clip | iclip | United States | 2018-05-30 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 48390 | 48390 | SRR7236661 | SRX4142911 | SRS3356701 | SRP149368 | PRJNA473836 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis: KHSRP iCLIP | PRJNA473836 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. This is the endogenous KHSRP iCLIP part of the study. | Raw multiplex: KHSRP iCLIP iCLIP Khsrp Ab B1;KHSRP iCLIP iCLIP Khsrp noAb B1 | Raw multiplex: KHSRP iCLIP iC Khsrp Ab B1 AG01173;KHSRP iCLIP iC Khsrp noAb B1 AG01174 | strain:TU/AB|age:4.0|dev stage:sphere|sex:pooled male and female|tissue:embryo|treatment:iCLIP|molecule:RNA|selection:KHSRP antibody;|replicate group:1;2|replicate:1|barcode:CACA;AGAG|BioSampleModel:Model organism or animal | Raw multiplex: KHSRP iCLIP iCLIP Khsrp Ab B1;KHSRP iCLIP iCLIP Khsrp noAb B1 | AG01173.2;AG01174.2 | AG01173.2;AG01174.2 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP149368 | HHMMTADXX_kh1_020_R1.fastq.gz | fastq | 5281915868.0 | 69498893.0 | HHMMTADXX kh1 020 R1.fastq.gz | 0:76 | A:1639173476;C:1196546385;G:1285461861;T:1160482436;N:251710 | 76 | 1639173476 | 1196546385 | 1285461861 | 1160482436 | 251710 | SRX4142911 | SRS3356701 | SRA712863 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.00021 | 0.00011 | 0.99973 | 0.64705 | 76 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | clip | iclip | United States | 2018-06-07 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 48391 | 48391 | SRR7236662 | SRX4142910 | SRS3356701 | SRP149368 | PRJNA473836 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis: KHSRP iCLIP | PRJNA473836 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. This is the endogenous KHSRP iCLIP part of the study. | Raw multiplex: KHSRP iCLIP iCLIP Khsrp Ab B1;KHSRP iCLIP iCLIP Khsrp noAb B1 | Raw multiplex: KHSRP iCLIP iC Khsrp Ab B1 AG01173;KHSRP iCLIP iC Khsrp noAb B1 AG01174 | strain:TU/AB|age:4.0|dev stage:sphere|sex:pooled male and female|tissue:embryo|treatment:iCLIP|molecule:RNA|selection:KHSRP antibody;|replicate group:1;2|replicate:1|barcode:CACA;AGAG|BioSampleModel:Model organism or animal | Raw multiplex: KHSRP iCLIP iCLIP Khsrp Ab B1;KHSRP iCLIP iCLIP Khsrp noAb B1 | AG01173.1;AG01174.1 | AG01173.1;AG01174.1 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP149368 | HHLY2ADXX_kh1_NOBCX_R1.fastq.gz | fastq | 9991920032.0 | 131472632.0 | HHLY2ADXX kh1 NOBCX R1.fastq.gz | 0:76 | A:3100849614;C:2254998457;G:2420727161;T:2205131206;N:10213594 | 76 | 3100849614 | 2254998457 | 2420727161 | 2205131206 | 10213594 | SRX4142910 | SRS3356701 | SRA712863 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.00019 | 0.0001 | 0.99975 | 0.46666 | 76 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | clip | iclip | United States | 2018-05-31 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 48392 | 48392 | SRR7236663 | SRX4142909 | SRS3356700 | SRP149368 | PRJNA473836 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis: KHSRP iCLIP | PRJNA473836 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. This is the endogenous KHSRP iCLIP part of the study. | KHSRP iCLIP iCLIP Khsrp noAb B3 | KHSRP iCLIP iC Khsrp noAb B3 AG01177 | strain:TU/AB|age:4.0|dev stage:sphere|sex:pooled male and female|tissue:embryo|treatment:iCLIP|molecule:RNA|replicate group:2|replicate:3|barcode:CACA|BioSampleModel:Model organism or animal | KHSRP iCLIP iCLIP Khsrp noAb B3 | AG01177.2 | AG01177.2 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP149368 | AG01177.2_R1.fastq.gz | fastq | 885888031.0 | 33497952.0 | AG01177.2 R1.fastq.gz | 0:26.45 1:0 | A:206425913;C:174763971;G:243957147;T:260737810;N:3190 | 26 | 0 | 206425913 | 174763971 | 243957147 | 260737810 | 3190 | SRX4142909 | SRS3356700 | SRA712863 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.06832 | 0.02459 | 0.98098 | 0.60923 | 28 | B | usable mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | clip | iclip | United States | 2018-05-30 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 48393 | 48393 | SRR7236664 | SRX4142908 | SRS3356700 | SRP149368 | PRJNA473836 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis: KHSRP iCLIP | PRJNA473836 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. This is the endogenous KHSRP iCLIP part of the study. | KHSRP iCLIP iCLIP Khsrp noAb B3 | KHSRP iCLIP iC Khsrp noAb B3 AG01177 | strain:TU/AB|age:4.0|dev stage:sphere|sex:pooled male and female|tissue:embryo|treatment:iCLIP|molecule:RNA|replicate group:2|replicate:3|barcode:CACA|BioSampleModel:Model organism or animal | KHSRP iCLIP iCLIP Khsrp noAb B3 | AG01177.1 | AG01177.1 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP149368 | AG01177.1_R1.fastq.gz | fastq | 1222226291.0 | 46319107.0 | AG01177.1 R1.fastq.gz | 0:26.39 1:0 | A:284330952;C:241163311;G:337366164;T:359365256;N:608 | 26 | 0 | 284330952 | 241163311 | 337366164 | 359365256 | 608 | SRX4142908 | SRS3356700 | SRA712863 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.06321 | 0.02496 | 0.99541 | 0.59566 | 24 | B | usable mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | clip | iclip | United States | 2018-06-07 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 48394 | 48394 | SRR7236665 | SRX4142907 | SRS3356699 | SRP149368 | PRJNA473836 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis: KHSRP iCLIP | PRJNA473836 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. This is the endogenous KHSRP iCLIP part of the study. | KHSRP iCLIP iCLIP Khsrp noAb B2 | KHSRP iCLIP iC Khsrp noAb B2 AG01176 | strain:TU/AB|age:4.0|dev stage:sphere|sex:pooled male and female|tissue:embryo|treatment:iCLIP|molecule:RNA|replicate group:2|replicate:2|barcode:GTGT|BioSampleModel:Model organism or animal | KHSRP iCLIP iCLIP Khsrp noAb B2 | AG01176.2 | AG01176.2 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP149368 | AG01176.2_R1.fastq.gz | fastq | 233885454.0 | 7281208.0 | AG01176.2 R1.fastq.gz | 0:32.12 1:0 | A:54788902;C:54168846;G:66577250;T:58350443;N:13 | 32 | 0 | 54788902 | 54168846 | 66577250 | 58350443 | 13 | SRX4142907 | SRS3356699 | SRA712863 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.10795 | 0.04438 | 0.97516 | 0.69327 | 38 | B | usable mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | clip | iclip | United States | 2018-06-07 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 48395 | 48395 | SRR7236666 | SRX4142906 | SRS3356699 | SRP149368 | PRJNA473836 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis: KHSRP iCLIP | PRJNA473836 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. This is the endogenous KHSRP iCLIP part of the study. | KHSRP iCLIP iCLIP Khsrp noAb B2 | KHSRP iCLIP iC Khsrp noAb B2 AG01176 | strain:TU/AB|age:4.0|dev stage:sphere|sex:pooled male and female|tissue:embryo|treatment:iCLIP|molecule:RNA|replicate group:2|replicate:2|barcode:GTGT|BioSampleModel:Model organism or animal | KHSRP iCLIP iCLIP Khsrp noAb B2 | AG01176.1 | AG01176.1 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP149368 | AG01176.1_R1.fastq.gz | fastq | 311212095.0 | 9672607.0 | AG01176.1 R1.fastq.gz | 0:32.17 1:0 | A:73018762;C:72027124;G:88456228;T:77709256;N:725 | 32 | 0 | 73018762 | 72027124 | 88456228 | 77709256 | 725 | SRX4142906 | SRS3356699 | SRA712863 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.10719 | 0.04462 | 0.97498 | 0.70725 | 37 | B | usable mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | clip | iclip | United States | 2018-05-30 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 48396 | 48396 | SRR7236667 | SRX4142905 | SRS3356698 | SRP149368 | PRJNA473836 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis: KHSRP iCLIP | PRJNA473836 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. This is the endogenous KHSRP iCLIP part of the study. | KHSRP iCLIP iCLIP Khsrp Ab B2 | KHSRP iCLIP iC Khsrp Ab B2 AG01175 | strain:TU/AB|age:4.0|dev stage:sphere|sex:pooled male and female|tissue:embryo|treatment:iCLIP|molecule:RNA|selection:KHSRP antibody|replicate group:1|replicate:2|barcode:TCTC|BioSampleModel:Model organism or animal | KHSRP iCLIP iCLIP Khsrp Ab B2 | AG01175.2 | AG01175.2 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP149368 | AG01175.2_R1.fastq.gz | fastq | 2466162835.0 | 77779195.0 | AG01175.2 R1.fastq.gz | 0:31.71 1:0 | A:716944933;C:413092452;G:514707831;T:821417411;N:208 | 31 | 0 | 716944933 | 413092452 | 514707831 | 821417411 | 208 | SRX4142905 | SRS3356698 | SRA712863 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.64577 | 0.4225 | 0.77516 | 0.52286 | 23 | B | usable mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | clip | iclip | United States | 2018-06-07 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 48397 | 48397 | SRR7236668 | SRX4142904 | SRS3356698 | SRP149368 | PRJNA473836 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis: KHSRP iCLIP | PRJNA473836 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. This is the endogenous KHSRP iCLIP part of the study. | KHSRP iCLIP iCLIP Khsrp Ab B2 | KHSRP iCLIP iC Khsrp Ab B2 AG01175 | strain:TU/AB|age:4.0|dev stage:sphere|sex:pooled male and female|tissue:embryo|treatment:iCLIP|molecule:RNA|selection:KHSRP antibody|replicate group:1|replicate:2|barcode:TCTC|BioSampleModel:Model organism or animal | KHSRP iCLIP iCLIP Khsrp Ab B2 | AG01175.1 | AG01175.1 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP149368 | AG01175.1_R1.fastq.gz | fastq | 3316001149.0 | 104496257.0 | AG01175.1 R1.fastq.gz | 0:31.73 1:0 | A:964563720;C:554605513;G:690144862;T:1106678088;N:8966 | 31 | 0 | 964563720 | 554605513 | 690144862 | 1106678088 | 8966 | SRX4142904 | SRS3356698 | SRA712863 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.64794 | 0.42598 | 0.77719 | 0.53602 | 31 | B | usable mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | clip | iclip | United States | 2018-05-31 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 48398 | 48398 | SRR7236669 | SRX4142903 | SRS3356697 | SRP149368 | PRJNA473836 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis: KHSRP iCLIP | PRJNA473836 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. This is the endogenous KHSRP iCLIP part of the study. | KHSRP iCLIP iCLIP Khsrp noAb B1 | KHSRP iCLIP iC Khsrp noAb B1 AG01174 | strain:TU/AB|age:4.0|dev stage:sphere|sex:pooled male and female|tissue:embryo|treatment:iCLIP|molecule:RNA|replicate group:2|replicate:1|barcode:AGAG|BioSampleModel:Model organism or animal | KHSRP iCLIP iCLIP Khsrp noAb B1 | AG01174.2 | AG01174.2 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP149368 | AG01174.2_R1.fastq.gz | fastq | 997707611.0 | 35501164.0 | AG01174.2 R1.fastq.gz | 0:28.10 1:0 | A:234873124;C:200942687;G:273279747;T:288611385;N:668 | 28 | 0 | 234873124 | 200942687 | 273279747 | 288611385 | 668 | SRX4142903 | SRS3356697 | SRA712863 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.05803 | 0.02195 | 0.99632 | 0.62645 | 26 | B | usable mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | clip | iclip | United States | 2018-06-07 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 48399 | 48399 | SRR7236670 | SRX4142902 | SRS3356697 | SRP149368 | PRJNA473836 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis: KHSRP iCLIP | PRJNA473836 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. This is the endogenous KHSRP iCLIP part of the study. | KHSRP iCLIP iCLIP Khsrp noAb B1 | KHSRP iCLIP iC Khsrp noAb B1 AG01174 | strain:TU/AB|age:4.0|dev stage:sphere|sex:pooled male and female|tissue:embryo|treatment:iCLIP|molecule:RNA|replicate group:2|replicate:1|barcode:AGAG|BioSampleModel:Model organism or animal | KHSRP iCLIP iCLIP Khsrp noAb B1 | AG01174.1 | AG01174.1 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP149368 | AG01174.1_R1.fastq.gz | fastq | 1864739454.0 | 66313666.0 | AG01174.1 R1.fastq.gz | 0:28.12 1:0 | A:439206469;C:375517297;G:509810941;T:540192256;N:12491 | 28 | 0 | 439206469 | 375517297 | 509810941 | 540192256 | 12491 | SRX4142902 | SRS3356697 | SRA712863 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.0573 | 0.02132 | 0.99618 | 0.52433 | 34 | B | usable mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | clip | iclip | United States | 2018-06-07 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 48400 | 48400 | SRR7236671 | SRX4142901 | SRS3356696 | SRP149368 | PRJNA473836 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis: KHSRP iCLIP | PRJNA473836 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. This is the endogenous KHSRP iCLIP part of the study. | KHSRP iCLIP iCLIP Khsrp Ab B1 | KHSRP iCLIP iC Khsrp Ab B1 AG01173 | strain:TU/AB|age:4.0|dev stage:sphere|sex:pooled male and female|tissue:embryo|treatment:iCLIP|molecule:RNA|selection:KHSRP antibody|replicate group:1|replicate:1|barcode:CACA|BioSampleModel:Model organism or animal | KHSRP iCLIP iCLIP Khsrp Ab B1 | AG01173.2 | AG01173.2 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP149368 | AG01173.2_R1.fastq.gz | fastq | 867830730.0 | 28259963.0 | AG01173.2 R1.fastq.gz | 0:30.71 1:0 | A:248512374;C:137460842;G:175204067;T:306652878;N:569 | 30 | 0 | 248512374 | 137460842 | 175204067 | 306652878 | 569 | SRX4142901 | SRS3356696 | SRA712863 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.67622 | 0.4515 | 0.76765 | 0.52978 | 31 | B | usable mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | clip | iclip | United States | 2018-06-07 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 48401 | 48401 | SRR7236672 | SRX4142900 | SRS3356696 | SRP149368 | PRJNA473836 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis: KHSRP iCLIP | PRJNA473836 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. This is the endogenous KHSRP iCLIP part of the study. | KHSRP iCLIP iCLIP Khsrp Ab B1 | KHSRP iCLIP iC Khsrp Ab B1 AG01173 | strain:TU/AB|age:4.0|dev stage:sphere|sex:pooled male and female|tissue:embryo|treatment:iCLIP|molecule:RNA|selection:KHSRP antibody|replicate group:1|replicate:1|barcode:CACA|BioSampleModel:Model organism or animal | KHSRP iCLIP iCLIP Khsrp Ab B1 | AG01173.1 | AG01173.1 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP149368 | AG01173.1_R1.fastq.gz | fastq | 1644979798.0 | 53548650.0 | AG01173.1 R1.fastq.gz | 0:30.72 1:0 | A:471457103;C:259804358;G:331035207;T:582672297;N:10833 | 30 | 0 | 471457103 | 259804358 | 331035207 | 582672297 | 10833 | SRX4142900 | SRS3356696 | SRA712863 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.67964 | 0.45484 | 0.77147 | 0.52736 | 27 | B | usable mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | clip | iclip | United States | 2018-05-30 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 49537 | 49537 | SRR8937007 | SRX5717520 | SRS4655940 | SRP162876 | PRJNA493828 | Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo sample. | GSE120646 | Other | The maternal to zygotic transition MZT is a conserved and fundamental process during which the embryo undergoes dramatic reprogramming to convert maternal environment to embryonic driven programing. However how the maternally supplied transcripts are dynamically regulated during MZT remains largely unknown. Herein through genome wide profiling of RNA 5 methylcytosine m5C in zebrafish early embryos we show that m5C methylated maternal mRNAs display higher stability during MZT. We identify that the Y box binding protein 1 Ybx1 prefers to recognizing m5C modified mRNAs through p p interaction with a key residue Trp45 in its cold shock domain CSD which plays essential roles in maternal mRNA stability and early embryogenesis of zebrafish. Cooperated with an mRNA stabilizer Pabpc1a Ybx1 promotes the stability of its target mRNAs in an m5C dependent manner. Our study demonstrates a novel mechanism of RNA m5C methylation regulated maternal mRNA stability during zebrafish MZT highlighting the critical role of m5C mRNA methylation in early development. Overall design: Examination of Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo. RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/μl RNasin by rotating at 4°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4°C for 1 h. 50 μl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 μl Protein A Dynabeads for 4 h at 4°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/µl RNasin for eight times and once with 1ml ice cold 1× PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated i… | parent bioproject:PRJNA534030 | RIP BS 3hpf | GSM3732427 | source name:Zebrafish embryo|strain:AB strain|age:3 hpf|tissue:whole embryo|rip antibody:polyclonal anti Ybx1 antibody | RIP BS 3hpf | library strategy: RNA RIP BisSeq Reads were aligned to the zv9 genome assembly using meRanTK v1.2.0 m5C sites were called by meRanCall v1.2.0 and annotated by applying BEDTools’ intersectBed. MACS2 v2.1.1 were used for the peak calling and peaks were annotated by applying BEDTools’ intersectBed. Genome build: zv9 Supplementary files format and content: Ybx1 binding m5C sites in one biological replicates. | Zebrafish embryo | Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol® Reagent Ambion. mRNA was extracted with using Dynabeads® mRNA Purification Kit Ambion and subjected to TURBO™ DNase Invitrogen treatment at 37°C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. Thus purified mRNA was used for RNA BisSeq library construction. Around 200 ng mRNA premixed with the in vitro transcribed Dhfr mRNA at a ratio of 300:1 Dhfr mRNA serves as methylation conversion control was fragmented to 100 nt fragments for 1 min at 90°C in 10× RNA Fragmentation Reagent Ambion then stopped by 10× RNA stop solution Ambion and precipitated with 100% ethanol. The RNA pellet was resuspended in 100 µl bisulfite solution pH 5.1 which is a 100:1 mixture of 40% sodium bisulfite Sigma and 600 µM hydroquinone Sigma and subjected to heat incubation at 75°C for 4.5 h. The reaction mixture was desalted by passing through Nanosep with 3K Omega 500/pk columns PALL Corporation with centrifugation. post washed with nuclease free water and centrifuged for five times the RNA was finally disolved in 75 μl nuclease free water and then desulfonated by incubation with an equal volume of 1 M Tris HCl pH 9.0 at 75 °C for 1 h. post ethanol precipitation the RNA was resuspended in 11 µl of RNase free water and subjected to library construction. Reverse transcription was carried out with superscript II Reverse Transcriptase Invitrogen and ACT random hexamers. The following procedures were performed with the KAPA Stranded mRNA Seq Kit KAPA according to the manufacturer’s instructions.Libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 125 bp. | strain:AB strain|age:3 hpf|tissue:whole embryo|rip antibody:polyclonal anti Ybx1 antibody | GSM3732427 | GSM3732427: RIP BS 3hpf; Danio rerio; OTHER | GSM3732427 | 1 | Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol® Reagent Ambion. mRNA was extracted with using Dynabeads® mRNA Purification Kit Ambion and subjected to TURBO™ DNase Invitrogen treatment at 37°C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. Thus purified mRNA was used for RNA BisSeq library construction. Around 200 ng mRNA premixed with the in vitro transcribed Dhfr mRNA at a ratio of 300:1 Dhfr mRNA serves as methylation conversion control was fragmented to 100 nt fragments for 1 min at 90°C in 10× RNA Fragmentation Reagent Ambion then stopped by 10× RNA stop solution Ambion and precipitated with 100% ethanol. The RNA pellet was resuspended in 100 µl bisulfite solution pH 5.1 which is a 100:1 mixture of 40% sodium bisulfite Sigma and 600 µM hydroquinone Sigma and subjected to heat incubation at 75°C for 4.5 h. The reaction mixture was desalted by passing through Nanosep with 3K Omega 500/pk columns PALL Corporation with centrifugation. post washed with nuclease free water and centrifuged for five times the RNA was finally disolved in 75 μl nuclease free water and then desulfonated by incubation with an equal volume of 1 M Tris HCl pH 9.0 at 75 °C for 1 h. post ethanol precipitation the RNA was resuspended in 11 µl of RNase free water and subjected to library construction. Reverse transcription was carried out with superscript II Reverse Transcriptase Invitrogen and ACT random hexamers. The following procedures were performed with the KAPA Stranded mRNA Seq Kit KAPA according to the manufacturer's instructions.Libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 125 bp. | GEO Accession:GSM3732427 | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP162876 | RIP-BS_3hpf_R1.fastq.gz RIP-BS_3hpf_R2.fastq.gz | fastq fastq | 46222984200.0 | 154076614.0 | GSM3732427 r1 | 0:150 1:150 | A:13069130635;C:10120441406;G:10858372086;T:12169793951;N:5246122 | 150 | 150 | 13069130635 | 10120441406 | 10858372086 | 12169793951 | 5246122 | SRX5717520 | SRS4655940 | SRA786939 | GEO | Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS) | 2 | 0.0063 | 0.00488 | 0.00135 | 0.00112 | 0.99736 | 0.99801 | 0.66703 | 0.76167 | 150 | 150 | T | T | mates < 9% mapping rate | illumina | hiseq_era | full_length | random_priming | smarter | bulk | clip | iclip | China | 2019-04-22 | Blastula | Embryo | Whole Organism | All anatomical structures | ||||||||||||
| 49538 | 49538 | SRR8937006 | SRX5717519 | SRS4655939 | SRP162876 | PRJNA493828 | Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo sample. | GSE120646 | Other | The maternal to zygotic transition MZT is a conserved and fundamental process during which the embryo undergoes dramatic reprogramming to convert maternal environment to embryonic driven programing. However how the maternally supplied transcripts are dynamically regulated during MZT remains largely unknown. Herein through genome wide profiling of RNA 5 methylcytosine m5C in zebrafish early embryos we show that m5C methylated maternal mRNAs display higher stability during MZT. We identify that the Y box binding protein 1 Ybx1 prefers to recognizing m5C modified mRNAs through p p interaction with a key residue Trp45 in its cold shock domain CSD which plays essential roles in maternal mRNA stability and early embryogenesis of zebrafish. Cooperated with an mRNA stabilizer Pabpc1a Ybx1 promotes the stability of its target mRNAs in an m5C dependent manner. Our study demonstrates a novel mechanism of RNA m5C methylation regulated maternal mRNA stability during zebrafish MZT highlighting the critical role of m5C mRNA methylation in early development. Overall design: Examination of Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo. RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/μl RNasin by rotating at 4°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4°C for 1 h. 50 μl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 μl Protein A Dynabeads for 4 h at 4°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/µl RNasin for eight times and once with 1ml ice cold 1× PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated i… | parent bioproject:PRJNA534030 | RIP BS 0hpf | GSM3732426 | source name:Zebrafish embryo|strain:AB strain|age:0 hpf|tissue:whole embryo|rip antibody:polyclonal anti Ybx1 antibody | RIP BS 0hpf | library strategy: RNA RIP BisSeq Reads were aligned to the zv9 genome assembly using meRanTK v1.2.0 m5C sites were called by meRanCall v1.2.0 and annotated by applying BEDTools’ intersectBed. MACS2 v2.1.1 were used for the peak calling and peaks were annotated by applying BEDTools’ intersectBed. Genome build: zv9 Supplementary files format and content: Ybx1 binding m5C sites in one biological replicates. | Zebrafish embryo | Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol® Reagent Ambion. mRNA was extracted with using Dynabeads® mRNA Purification Kit Ambion and subjected to TURBO™ DNase Invitrogen treatment at 37°C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. Thus purified mRNA was used for RNA BisSeq library construction. Around 200 ng mRNA premixed with the in vitro transcribed Dhfr mRNA at a ratio of 300:1 Dhfr mRNA serves as methylation conversion control was fragmented to 100 nt fragments for 1 min at 90°C in 10× RNA Fragmentation Reagent Ambion then stopped by 10× RNA stop solution Ambion and precipitated with 100% ethanol. The RNA pellet was resuspended in 100 µl bisulfite solution pH 5.1 which is a 100:1 mixture of 40% sodium bisulfite Sigma and 600 µM hydroquinone Sigma and subjected to heat incubation at 75°C for 4.5 h. The reaction mixture was desalted by passing through Nanosep with 3K Omega 500/pk columns PALL Corporation with centrifugation. post washed with nuclease free water and centrifuged for five times the RNA was finally disolved in 75 μl nuclease free water and then desulfonated by incubation with an equal volume of 1 M Tris HCl pH 9.0 at 75 °C for 1 h. post ethanol precipitation the RNA was resuspended in 11 µl of RNase free water and subjected to library construction. Reverse transcription was carried out with superscript II Reverse Transcriptase Invitrogen and ACT random hexamers. The following procedures were performed with the KAPA Stranded mRNA Seq Kit KAPA according to the manufacturer’s instructions.Libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 125 bp. | strain:AB strain|age:0 hpf|tissue:whole embryo|rip antibody:polyclonal anti Ybx1 antibody | GSM3732426 | GSM3732426: RIP BS 0hpf; Danio rerio; OTHER | GSM3732426 | 1 | Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol® Reagent Ambion. mRNA was extracted with using Dynabeads® mRNA Purification Kit Ambion and subjected to TURBO™ DNase Invitrogen treatment at 37°C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. Thus purified mRNA was used for RNA BisSeq library construction. Around 200 ng mRNA premixed with the in vitro transcribed Dhfr mRNA at a ratio of 300:1 Dhfr mRNA serves as methylation conversion control was fragmented to 100 nt fragments for 1 min at 90°C in 10× RNA Fragmentation Reagent Ambion then stopped by 10× RNA stop solution Ambion and precipitated with 100% ethanol. The RNA pellet was resuspended in 100 µl bisulfite solution pH 5.1 which is a 100:1 mixture of 40% sodium bisulfite Sigma and 600 µM hydroquinone Sigma and subjected to heat incubation at 75°C for 4.5 h. The reaction mixture was desalted by passing through Nanosep with 3K Omega 500/pk columns PALL Corporation with centrifugation. post washed with nuclease free water and centrifuged for five times the RNA was finally disolved in 75 μl nuclease free water and then desulfonated by incubation with an equal volume of 1 M Tris HCl pH 9.0 at 75 °C for 1 h. post ethanol precipitation the RNA was resuspended in 11 µl of RNase free water and subjected to library construction. Reverse transcription was carried out with superscript II Reverse Transcriptase Invitrogen and ACT random hexamers. The following procedures were performed with the KAPA Stranded mRNA Seq Kit KAPA according to the manufacturer's instructions.Libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 125 bp. | GEO Accession:GSM3732426 | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP162876 | RIP-BS_0hpf_R1.fastq.gz RIP-BS_0hpf_R2.fastq.gz | fastq fastq | 41224496700.0 | 137414989.0 | GSM3732426 r1 | 0:150 1:150 | A:11515809359;C:9072060634;G:9856717145;T:10775122637;N:4786925 | 150 | 150 | 11515809359 | 9072060634 | 9856717145 | 10775122637 | 4786925 | SRX5717519 | SRS4655939 | SRA786939 | GEO | Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS) | 2 | 0.00575 | 0.00421 | 0.00122 | 0.00083 | 0.99738 | 0.99801 | 0.70652 | 0.78053 | 150 | 150 | T | T | mates < 9% mapping rate | illumina | hiseq_era | full_length | random_priming | smarter | bulk | clip | iclip | China | 2019-04-22 | Zygote | Embryo | Whole Organism | All anatomical structures | ||||||||||||
| 49539 | 49539 | SRR8937005 | SRX5717518 | SRS4655938 | SRP162876 | PRJNA493828 | Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo sample. | GSE120646 | Other | The maternal to zygotic transition MZT is a conserved and fundamental process during which the embryo undergoes dramatic reprogramming to convert maternal environment to embryonic driven programing. However how the maternally supplied transcripts are dynamically regulated during MZT remains largely unknown. Herein through genome wide profiling of RNA 5 methylcytosine m5C in zebrafish early embryos we show that m5C methylated maternal mRNAs display higher stability during MZT. We identify that the Y box binding protein 1 Ybx1 prefers to recognizing m5C modified mRNAs through p p interaction with a key residue Trp45 in its cold shock domain CSD which plays essential roles in maternal mRNA stability and early embryogenesis of zebrafish. Cooperated with an mRNA stabilizer Pabpc1a Ybx1 promotes the stability of its target mRNAs in an m5C dependent manner. Our study demonstrates a novel mechanism of RNA m5C methylation regulated maternal mRNA stability during zebrafish MZT highlighting the critical role of m5C mRNA methylation in early development. Overall design: Examination of Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo. RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/μl RNasin by rotating at 4°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4°C for 1 h. 50 μl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 μl Protein A Dynabeads for 4 h at 4°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/µl RNasin for eight times and once with 1ml ice cold 1× PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated i… | parent bioproject:PRJNA534030 | RIP INPUT 2hpf rep2 | GSM3732425 | source name:RIP INPUT 2hpf|strain:AB strain|age:2 hpf|tissue:whole embryo | RIP INPUT 2hpf rep2 | Reads were aligned to the zv9 genome assembly using TopHat v2.1.1. MACS2 v2.1.1 were used for the peak calling and peaks were annotated by applying BEDTools’ intersectBed. Genome build: zv9 Supplementary files format and content: Ybx1 binding sites in two biological replicates. | RIP INPUT 2hpf | Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol® Reagent Ambion. mRNA was extracted with using Dynabeads® mRNA Purification Kit Ambion and subjected to TURBO™ DNase Invitrogen treatment at 37°C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp. | strain:AB strain|age:2 hpf|tissue:whole embryo | GSM3732425 | GSM3732425: RIP INPUT 2hpf rep2; Danio rerio; RIP Seq | GSM3732425 | 1 | Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol® Reagent Ambion. mRNA was extracted with using Dynabeads® mRNA Purification Kit Ambion and subjected to TURBO™ DNase Invitrogen treatment at 37°C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp. | GEO Accession:GSM3732425 | RIP-Seq | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP162876 | RIP-INPUT_2hpf_rep2_R1.fastq.gz RIP-INPUT_2hpf_rep2_R2.fastq.gz | fastq fastq | 16388119500.0 | 54627065.0 | GSM3732425 r1 | 0:150 1:150 | A:3232127065;C:4976385987;G:5052844082;T:3122288663;N:4473703 | 150 | 150 | 3232127065 | 4976385987 | 5052844082 | 3122288663 | 4473703 | SRX5717518 | SRS4655938 | SRA786939 | GEO | Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS) | 2 | 0.98209 | 0.9812 | 0.33332 | 0.33565 | 0.93811 | 0.94186 | 0.95153 | 0.95984 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | random_priming | smarter | bulk | clip | iclip | China | 2019-04-22 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||
| 49540 | 49540 | SRR8937004 | SRX5717517 | SRS4655937 | SRP162876 | PRJNA493828 | Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo sample. | GSE120646 | Other | The maternal to zygotic transition MZT is a conserved and fundamental process during which the embryo undergoes dramatic reprogramming to convert maternal environment to embryonic driven programing. However how the maternally supplied transcripts are dynamically regulated during MZT remains largely unknown. Herein through genome wide profiling of RNA 5 methylcytosine m5C in zebrafish early embryos we show that m5C methylated maternal mRNAs display higher stability during MZT. We identify that the Y box binding protein 1 Ybx1 prefers to recognizing m5C modified mRNAs through p p interaction with a key residue Trp45 in its cold shock domain CSD which plays essential roles in maternal mRNA stability and early embryogenesis of zebrafish. Cooperated with an mRNA stabilizer Pabpc1a Ybx1 promotes the stability of its target mRNAs in an m5C dependent manner. Our study demonstrates a novel mechanism of RNA m5C methylation regulated maternal mRNA stability during zebrafish MZT highlighting the critical role of m5C mRNA methylation in early development. Overall design: Examination of Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo. RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/μl RNasin by rotating at 4°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4°C for 1 h. 50 μl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 μl Protein A Dynabeads for 4 h at 4°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/µl RNasin for eight times and once with 1ml ice cold 1× PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated i… | parent bioproject:PRJNA534030 | RIP INPUT 2hpf rep1 | GSM3732424 | source name:RIP INPUT 2hpf|strain:AB strain|age:2 hpf|tissue:whole embryo | RIP INPUT 2hpf rep1 | Reads were aligned to the zv9 genome assembly using TopHat v2.1.1. MACS2 v2.1.1 were used for the peak calling and peaks were annotated by applying BEDTools’ intersectBed. Genome build: zv9 Supplementary files format and content: Ybx1 binding sites in two biological replicates. | RIP INPUT 2hpf | Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol® Reagent Ambion. mRNA was extracted with using Dynabeads® mRNA Purification Kit Ambion and subjected to TURBO™ DNase Invitrogen treatment at 37°C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp. | strain:AB strain|age:2 hpf|tissue:whole embryo | GSM3732424 | GSM3732424: RIP INPUT 2hpf rep1; Danio rerio; RIP Seq | GSM3732424 | 1 | Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol® Reagent Ambion. mRNA was extracted with using Dynabeads® mRNA Purification Kit Ambion and subjected to TURBO™ DNase Invitrogen treatment at 37°C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp. | GEO Accession:GSM3732424 | RIP-Seq | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP162876 | RIP-INPUT_2hpf_rep1_R1.fastq.gz RIP-INPUT_2hpf_rep1_R2.fastq.gz | fastq fastq | 18857336400.0 | 62857788.0 | GSM3732424 r1 | 0:150 1:150 | A:3116761123;C:6239715125;G:6450542871;T:3049605751;N:711530 | 150 | 150 | 3116761123 | 6239715125 | 6450542871 | 3049605751 | 711530 | SRX5717517 | SRS4655937 | SRA786939 | GEO | Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS) | 2 | 0.97874 | 0.96891 | 0.03494 | 0.03355 | 0.92693 | 0.93456 | 0.9502 | 0.94986 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | random_priming | smarter | bulk | clip | iclip | China | 2019-04-22 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||
| 49541 | 49541 | SRR8937003 | SRX5717516 | SRS4655936 | SRP162876 | PRJNA493828 | Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo sample. | GSE120646 | Other | The maternal to zygotic transition MZT is a conserved and fundamental process during which the embryo undergoes dramatic reprogramming to convert maternal environment to embryonic driven programing. However how the maternally supplied transcripts are dynamically regulated during MZT remains largely unknown. Herein through genome wide profiling of RNA 5 methylcytosine m5C in zebrafish early embryos we show that m5C methylated maternal mRNAs display higher stability during MZT. We identify that the Y box binding protein 1 Ybx1 prefers to recognizing m5C modified mRNAs through p p interaction with a key residue Trp45 in its cold shock domain CSD which plays essential roles in maternal mRNA stability and early embryogenesis of zebrafish. Cooperated with an mRNA stabilizer Pabpc1a Ybx1 promotes the stability of its target mRNAs in an m5C dependent manner. Our study demonstrates a novel mechanism of RNA m5C methylation regulated maternal mRNA stability during zebrafish MZT highlighting the critical role of m5C mRNA methylation in early development. Overall design: Examination of Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo. RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/μl RNasin by rotating at 4°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4°C for 1 h. 50 μl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 μl Protein A Dynabeads for 4 h at 4°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/µl RNasin for eight times and once with 1ml ice cold 1× PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated i… | parent bioproject:PRJNA534030 | RIP INPUT 0hpf rep2 | GSM3732423 | source name:RIP INPUT 0hpf|strain:AB strain|age:0 hpf|tissue:whole embryo | RIP INPUT 0hpf rep2 | Reads were aligned to the zv9 genome assembly using TopHat v2.1.1. MACS2 v2.1.1 were used for the peak calling and peaks were annotated by applying BEDTools’ intersectBed. Genome build: zv9 Supplementary files format and content: Ybx1 binding sites in two biological replicates. | RIP INPUT 0hpf | Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol® Reagent Ambion. mRNA was extracted with using Dynabeads® mRNA Purification Kit Ambion and subjected to TURBO™ DNase Invitrogen treatment at 37°C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp. | strain:AB strain|age:0 hpf|tissue:whole embryo | GSM3732423 | GSM3732423: RIP INPUT 0hpf rep2; Danio rerio; RIP Seq | GSM3732423 | 1 | Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol® Reagent Ambion. mRNA was extracted with using Dynabeads® mRNA Purification Kit Ambion and subjected to TURBO™ DNase Invitrogen treatment at 37°C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp. | GEO Accession:GSM3732423 | RIP-Seq | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP162876 | RIP-INPUT_0hpf_rep2_R1.fastq.gz RIP-INPUT_0hpf_rep2_R2.fastq.gz | fastq fastq | 17402218800.0 | 58007396.0 | GSM3732423 r1 | 0:150 1:150 | A:3416144403;C:5315174821;G:5345201218;T:3320906221;N:4792137 | 150 | 150 | 3416144403 | 5315174821 | 5345201218 | 3320906221 | 4792137 | SRX5717516 | SRS4655936 | SRA786939 | GEO | Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS) | 2 | 0.9819 | 0.9814 | 0.33605 | 0.34016 | 0.93458 | 0.93963 | 0.90172 | 0.91272 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | random_priming | smarter | bulk | clip | iclip | China | 2019-04-22 | Zygote | Embryo | Whole Organism | All anatomical structures | ||||||||||||
| 49542 | 49542 | SRR8937002 | SRX5717515 | SRS4655935 | SRP162876 | PRJNA493828 | Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo sample. | GSE120646 | Other | The maternal to zygotic transition MZT is a conserved and fundamental process during which the embryo undergoes dramatic reprogramming to convert maternal environment to embryonic driven programing. However how the maternally supplied transcripts are dynamically regulated during MZT remains largely unknown. Herein through genome wide profiling of RNA 5 methylcytosine m5C in zebrafish early embryos we show that m5C methylated maternal mRNAs display higher stability during MZT. We identify that the Y box binding protein 1 Ybx1 prefers to recognizing m5C modified mRNAs through p p interaction with a key residue Trp45 in its cold shock domain CSD which plays essential roles in maternal mRNA stability and early embryogenesis of zebrafish. Cooperated with an mRNA stabilizer Pabpc1a Ybx1 promotes the stability of its target mRNAs in an m5C dependent manner. Our study demonstrates a novel mechanism of RNA m5C methylation regulated maternal mRNA stability during zebrafish MZT highlighting the critical role of m5C mRNA methylation in early development. Overall design: Examination of Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo. RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/μl RNasin by rotating at 4°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4°C for 1 h. 50 μl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 μl Protein A Dynabeads for 4 h at 4°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/µl RNasin for eight times and once with 1ml ice cold 1× PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated i… | parent bioproject:PRJNA534030 | RIP INPUT 0hpf rep1 | GSM3732422 | source name:RIP INPUT 0hpf|strain:AB strain|age:0 hpf|tissue:whole embryo | RIP INPUT 0hpf rep1 | Reads were aligned to the zv9 genome assembly using TopHat v2.1.1. MACS2 v2.1.1 were used for the peak calling and peaks were annotated by applying BEDTools’ intersectBed. Genome build: zv9 Supplementary files format and content: Ybx1 binding sites in two biological replicates. | RIP INPUT 0hpf | Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol® Reagent Ambion. mRNA was extracted with using Dynabeads® mRNA Purification Kit Ambion and subjected to TURBO™ DNase Invitrogen treatment at 37°C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp. | strain:AB strain|age:0 hpf|tissue:whole embryo | GSM3732422 | GSM3732422: RIP INPUT 0hpf rep1; Danio rerio; RIP Seq | GSM3732422 | 1 | Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol® Reagent Ambion. mRNA was extracted with using Dynabeads® mRNA Purification Kit Ambion and subjected to TURBO™ DNase Invitrogen treatment at 37°C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp. | GEO Accession:GSM3732422 | RIP-Seq | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP162876 | RIP-INPUT_0hpf_rep1_R1.fastq.gz RIP-INPUT_0hpf_rep1_R2.fastq.gz | fastq fastq | 16615204800.0 | 55384016.0 | GSM3732422 r1 | 0:150 1:150 | A:2869477028;C:5392959051;G:5575878422;T:2776252538;N:637761 | 150 | 150 | 2869477028 | 5392959051 | 5575878422 | 2776252538 | 637761 | SRX5717515 | SRS4655935 | SRA786939 | GEO | Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS) | 2 | 0.97584 | 0.96561 | 0.04007 | 0.03832 | 0.9262 | 0.933 | 0.94642 | 0.94376 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | random_priming | smarter | bulk | clip | iclip | China | 2019-04-22 | Zygote | Embryo | Whole Organism | All anatomical structures | ||||||||||||
| 49543 | 49543 | SRR8937001 | SRX5717514 | SRS4655934 | SRP162876 | PRJNA493828 | Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo sample. | GSE120646 | Other | The maternal to zygotic transition MZT is a conserved and fundamental process during which the embryo undergoes dramatic reprogramming to convert maternal environment to embryonic driven programing. However how the maternally supplied transcripts are dynamically regulated during MZT remains largely unknown. Herein through genome wide profiling of RNA 5 methylcytosine m5C in zebrafish early embryos we show that m5C methylated maternal mRNAs display higher stability during MZT. We identify that the Y box binding protein 1 Ybx1 prefers to recognizing m5C modified mRNAs through p p interaction with a key residue Trp45 in its cold shock domain CSD which plays essential roles in maternal mRNA stability and early embryogenesis of zebrafish. Cooperated with an mRNA stabilizer Pabpc1a Ybx1 promotes the stability of its target mRNAs in an m5C dependent manner. Our study demonstrates a novel mechanism of RNA m5C methylation regulated maternal mRNA stability during zebrafish MZT highlighting the critical role of m5C mRNA methylation in early development. Overall design: Examination of Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo. RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/μl RNasin by rotating at 4°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4°C for 1 h. 50 μl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 μl Protein A Dynabeads for 4 h at 4°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/µl RNasin for eight times and once with 1ml ice cold 1× PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated i… | parent bioproject:PRJNA534030 | RIP 2hpf rep2 | GSM3732421 | source name:RIP 2hpf|strain:AB strain|age:2 hpf|tissue:whole embryo|rip antibody:rabbit polyclonal anti Ybx1 antibody | RIP 2hpf rep2 | Reads were aligned to the zv9 genome assembly using TopHat v2.1.1. MACS2 v2.1.1 were used for the peak calling and peaks were annotated by applying BEDTools’ intersectBed. Genome build: zv9 Supplementary files format and content: Ybx1 binding sites in two biological replicates. | RIP 2hpf | Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol® Reagent Ambion. mRNA was extracted with using Dynabeads® mRNA Purification Kit Ambion and subjected to TURBO™ DNase Invitrogen treatment at 37°C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp. | strain:AB strain|age:2 hpf|tissue:whole embryo|rip antibody:rabbit polyclonal anti Ybx1 antibody | GSM3732421 | GSM3732421: RIP 2hpf rep2; Danio rerio; RIP Seq | GSM3732421 | 1 | Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol® Reagent Ambion. mRNA was extracted with using Dynabeads® mRNA Purification Kit Ambion and subjected to TURBO™ DNase Invitrogen treatment at 37°C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp. | GEO Accession:GSM3732421 | RIP-Seq | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP162876 | RIP_2hpf_rep2_R1.fastq.gz RIP_2hpf_rep2_R2.fastq.gz | fastq fastq | 17557024800.0 | 58523416.0 | GSM3732421 r1 | 0:150 1:150 | A:4454737772;C:4407385601;G:4364085079;T:4328962997;N:1853351 | 150 | 150 | 4454737772 | 4407385601 | 4364085079 | 4328962997 | 1853351 | SRX5717514 | SRS4655934 | SRA786939 | GEO | Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS) | 2 | 0.96216 | 0.96226 | 0.08174 | 0.08009 | 0.76907 | 0.77693 | 0.68824 | 0.65939 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | random_priming | smarter | bulk | clip | iclip | China | 2019-04-22 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||
| 49544 | 49544 | SRR8937000 | SRX5717513 | SRS4655933 | SRP162876 | PRJNA493828 | Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo sample. | GSE120646 | Other | The maternal to zygotic transition MZT is a conserved and fundamental process during which the embryo undergoes dramatic reprogramming to convert maternal environment to embryonic driven programing. However how the maternally supplied transcripts are dynamically regulated during MZT remains largely unknown. Herein through genome wide profiling of RNA 5 methylcytosine m5C in zebrafish early embryos we show that m5C methylated maternal mRNAs display higher stability during MZT. We identify that the Y box binding protein 1 Ybx1 prefers to recognizing m5C modified mRNAs through p p interaction with a key residue Trp45 in its cold shock domain CSD which plays essential roles in maternal mRNA stability and early embryogenesis of zebrafish. Cooperated with an mRNA stabilizer Pabpc1a Ybx1 promotes the stability of its target mRNAs in an m5C dependent manner. Our study demonstrates a novel mechanism of RNA m5C methylation regulated maternal mRNA stability during zebrafish MZT highlighting the critical role of m5C mRNA methylation in early development. Overall design: Examination of Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo. RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/μl RNasin by rotating at 4°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4°C for 1 h. 50 μl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 μl Protein A Dynabeads for 4 h at 4°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/µl RNasin for eight times and once with 1ml ice cold 1× PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated i… | parent bioproject:PRJNA534030 | RIP 2hpf rep1 | GSM3732420 | source name:RIP 2hpf|strain:AB strain|age:2 hpf|tissue:whole embryo|rip antibody:rabbit polyclonal anti Ybx1 antibody | RIP 2hpf rep1 | Reads were aligned to the zv9 genome assembly using TopHat v2.1.1. MACS2 v2.1.1 were used for the peak calling and peaks were annotated by applying BEDTools’ intersectBed. Genome build: zv9 Supplementary files format and content: Ybx1 binding sites in two biological replicates. | RIP 2hpf | Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol® Reagent Ambion. mRNA was extracted with using Dynabeads® mRNA Purification Kit Ambion and subjected to TURBO™ DNase Invitrogen treatment at 37°C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp. | strain:AB strain|age:2 hpf|tissue:whole embryo|rip antibody:rabbit polyclonal anti Ybx1 antibody | GSM3732420 | GSM3732420: RIP 2hpf rep1; Danio rerio; RIP Seq | GSM3732420 | 1 | Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol® Reagent Ambion. mRNA was extracted with using Dynabeads® mRNA Purification Kit Ambion and subjected to TURBO™ DNase Invitrogen treatment at 37°C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp. | GEO Accession:GSM3732420 | RIP-Seq | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP162876 | RIP_2hpf_rep1_R1.fastq.gz RIP_2hpf_rep1_R2.fastq.gz | fastq fastq | 5656083600.0 | 18853612.0 | GSM3732420 r1 | 0:150 1:150 | A:1244757394;C:1581273853;G:1666307178;T:1162885398;N:859777 | 150 | 150 | 1244757394 | 1581273853 | 1666307178 | 1162885398 | 859777 | SRX5717513 | SRS4655933 | SRA786939 | GEO | Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS) | 2 | 0.80705 | 0.80575 | 0.2454 | 0.24923 | 0.85478 | 0.85644 | 0.83319 | 0.80065 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | random_priming | smarter | bulk | clip | iclip | China | 2019-04-22 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||
| 49545 | 49545 | SRR8936999 | SRX5717512 | SRS4655932 | SRP162876 | PRJNA493828 | Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo sample. | GSE120646 | Other | The maternal to zygotic transition MZT is a conserved and fundamental process during which the embryo undergoes dramatic reprogramming to convert maternal environment to embryonic driven programing. However how the maternally supplied transcripts are dynamically regulated during MZT remains largely unknown. Herein through genome wide profiling of RNA 5 methylcytosine m5C in zebrafish early embryos we show that m5C methylated maternal mRNAs display higher stability during MZT. We identify that the Y box binding protein 1 Ybx1 prefers to recognizing m5C modified mRNAs through p p interaction with a key residue Trp45 in its cold shock domain CSD which plays essential roles in maternal mRNA stability and early embryogenesis of zebrafish. Cooperated with an mRNA stabilizer Pabpc1a Ybx1 promotes the stability of its target mRNAs in an m5C dependent manner. Our study demonstrates a novel mechanism of RNA m5C methylation regulated maternal mRNA stability during zebrafish MZT highlighting the critical role of m5C mRNA methylation in early development. Overall design: Examination of Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo. RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/μl RNasin by rotating at 4°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4°C for 1 h. 50 μl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 μl Protein A Dynabeads for 4 h at 4°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/µl RNasin for eight times and once with 1ml ice cold 1× PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated i… | parent bioproject:PRJNA534030 | RIP 0hpf rep2 | GSM3732419 | source name:RIP 0hpf|strain:AB strain|age:0 hpf|tissue:whole embryo|rip antibody:rabbit polyclonal anti Ybx1 antibody | RIP 0hpf rep2 | Reads were aligned to the zv9 genome assembly using TopHat v2.1.1. MACS2 v2.1.1 were used for the peak calling and peaks were annotated by applying BEDTools’ intersectBed. Genome build: zv9 Supplementary files format and content: Ybx1 binding sites in two biological replicates. | RIP 0hpf | Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol® Reagent Ambion. mRNA was extracted with using Dynabeads® mRNA Purification Kit Ambion and subjected to TURBO™ DNase Invitrogen treatment at 37°C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp. | strain:AB strain|age:0 hpf|tissue:whole embryo|rip antibody:rabbit polyclonal anti Ybx1 antibody | GSM3732419 | GSM3732419: RIP 0hpf rep2; Danio rerio; RIP Seq | GSM3732419 | 1 | Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol® Reagent Ambion. mRNA was extracted with using Dynabeads® mRNA Purification Kit Ambion and subjected to TURBO™ DNase Invitrogen treatment at 37°C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp. | GEO Accession:GSM3732419 | RIP-Seq | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP162876 | RIP_0hpf_rep2_R1.fastq.gz RIP_0hpf_rep2_R2.fastq.gz | fastq fastq | 14319153300.0 | 47730511.0 | GSM3732419 r1 | 0:150 1:150 | A:3633266473;C:3581763715;G:3602109377;T:3500497801;N:1515934 | 150 | 150 | 3633266473 | 3581763715 | 3602109377 | 3500497801 | 1515934 | SRX5717512 | SRS4655932 | SRA786939 | GEO | Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS) | 2 | 0.96309 | 0.96299 | 0.09978 | 0.09922 | 0.80012 | 0.80635 | 0.7641 | 0.76535 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | random_priming | smarter | bulk | clip | iclip | China | 2019-04-22 | Zygote | Embryo | Whole Organism | All anatomical structures | ||||||||||||
| 49546 | 49546 | SRR8936998 | SRX5717511 | SRS4655931 | SRP162876 | PRJNA493828 | Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo sample. | GSE120646 | Other | The maternal to zygotic transition MZT is a conserved and fundamental process during which the embryo undergoes dramatic reprogramming to convert maternal environment to embryonic driven programing. However how the maternally supplied transcripts are dynamically regulated during MZT remains largely unknown. Herein through genome wide profiling of RNA 5 methylcytosine m5C in zebrafish early embryos we show that m5C methylated maternal mRNAs display higher stability during MZT. We identify that the Y box binding protein 1 Ybx1 prefers to recognizing m5C modified mRNAs through p p interaction with a key residue Trp45 in its cold shock domain CSD which plays essential roles in maternal mRNA stability and early embryogenesis of zebrafish. Cooperated with an mRNA stabilizer Pabpc1a Ybx1 promotes the stability of its target mRNAs in an m5C dependent manner. Our study demonstrates a novel mechanism of RNA m5C methylation regulated maternal mRNA stability during zebrafish MZT highlighting the critical role of m5C mRNA methylation in early development. Overall design: Examination of Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo. RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/μl RNasin by rotating at 4°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4°C for 1 h. 50 μl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 μl Protein A Dynabeads for 4 h at 4°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/µl RNasin for eight times and once with 1ml ice cold 1× PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated i… | parent bioproject:PRJNA534030 | RIP 0hpf rep1 | GSM3732418 | source name:RIP 0hpf|strain:AB strain|age:0 hpf|tissue:whole embryo|rip antibody:rabbit polyclonal anti Ybx1 antibody | RIP 0hpf rep1 | Reads were aligned to the zv9 genome assembly using TopHat v2.1.1. MACS2 v2.1.1 were used for the peak calling and peaks were annotated by applying BEDTools’ intersectBed. Genome build: zv9 Supplementary files format and content: Ybx1 binding sites in two biological replicates. | RIP 0hpf | Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol® Reagent Ambion. mRNA was extracted with using Dynabeads® mRNA Purification Kit Ambion and subjected to TURBO™ DNase Invitrogen treatment at 37°C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp. | strain:AB strain|age:0 hpf|tissue:whole embryo|rip antibody:rabbit polyclonal anti Ybx1 antibody | GSM3732418 | GSM3732418: RIP 0hpf rep1; Danio rerio; RIP Seq | GSM3732418 | 1 | Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol® Reagent Ambion. mRNA was extracted with using Dynabeads® mRNA Purification Kit Ambion and subjected to TURBO™ DNase Invitrogen treatment at 37°C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp. | GEO Accession:GSM3732418 | RIP-Seq | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP162876 | RIP_0hpf_rep1_R1.fastq.gz RIP_0hpf_rep1_R2.fastq.gz | fastq fastq | 7807878000.0 | 26026260.0 | GSM3732418 r1 | 0:150 1:150 | A:1698013251;C:2200605244;G:2305251364;T:1602824248;N:1183893 | 150 | 150 | 1698013251 | 2200605244 | 2305251364 | 1602824248 | 1183893 | SRX5717511 | SRS4655931 | SRA786939 | GEO | Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS) | 2 | 0.89154 | 0.89105 | 0.26373 | 0.26886 | 0.82477 | 0.827 | 0.79125 | 0.77711 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | random_priming | smarter | bulk | clip | iclip | China | 2019-04-22 | Zygote | Embryo | Whole Organism | All anatomical structures | ||||||||||||
| 49547 | 49547 | SRR7942638 | SRX4776903 | SRS3857464 | SRP162876 | PRJNA493828 | Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo sample. | GSE120646 | Other | The maternal to zygotic transition MZT is a conserved and fundamental process during which the embryo undergoes dramatic reprogramming to convert maternal environment to embryonic driven programing. However how the maternally supplied transcripts are dynamically regulated during MZT remains largely unknown. Herein through genome wide profiling of RNA 5 methylcytosine m5C in zebrafish early embryos we show that m5C methylated maternal mRNAs display higher stability during MZT. We identify that the Y box binding protein 1 Ybx1 prefers to recognizing m5C modified mRNAs through p p interaction with a key residue Trp45 in its cold shock domain CSD which plays essential roles in maternal mRNA stability and early embryogenesis of zebrafish. Cooperated with an mRNA stabilizer Pabpc1a Ybx1 promotes the stability of its target mRNAs in an m5C dependent manner. Our study demonstrates a novel mechanism of RNA m5C methylation regulated maternal mRNA stability during zebrafish MZT highlighting the critical role of m5C mRNA methylation in early development. Overall design: Examination of Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo. RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/μl RNasin by rotating at 4°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4°C for 1 h. 50 μl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 μl Protein A Dynabeads for 4 h at 4°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/µl RNasin for eight times and once with 1ml ice cold 1× PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated i… | parent bioproject:PRJNA534030 | iCLIP 4hpf rep2 | GSM3406904 | source name:Zebrafish embryo|strain:AB strain|cell type:Zebrafish embryo|age:4 hpf|tissue:whole embryo | iCLIP 4hpf rep2 | RIP seq and iCLIP seq reads were aligned to the zv9 genome assembly using TopHat v2.1.1 and BWA v0.7.10 respectively. RIP seq: MACS2 v2.1.1 were used for the peak calling and peaks were annotated by applying BEDTools’ intersectBed. iCLIP: To identify the Ybx1 targets’ locus the mode of truncation calling was performed. For each truncation position the coverages of unique tag k and truncations m were determined by CIMS.pl program CLIP Tool Kit CTK. The sites were annotated by applying BEDTools’ intersectBed. Genome build: zv9 Supplementary files format and content: Ybx1 binding sites in two biological replicates. | Zebrafish embryo | RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/μl RNasin by rotating at 4°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4°C for 1 h. 50 μl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 μl Protein A Dynabeads for 4 h at 4°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/µl RNasin for eight times and once with 1ml ice cold 1× PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche 0311582001 for 1 h at 55°C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The Input RNA was extracted by using TRIzol reagent. Both the Input and IP RNA were treated by TURBO™ DNase Invitrogen AM2238. iCLIP seq: 1000 zebrafish embryos at 4 hpf were irradiated twice with 0.8 J/cm2 Stratalinker 2400 Stratagene lysed and subjected to mild fragmentation. Crosslinked RNA protein complexes were immunoprecipated using polyclonal Ybx1 antibody Abmax and protein A dynabeads. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp. | strain:AB strain|cell type:Zebrafish embryo|age:4 hpf|tissue:whole embryo | GSM3406904 | GSM3406904: iCLIP 4hpf rep2; Danio rerio; OTHER | GSM3406904 | 1 | RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/μl RNasin by rotating at 4°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4°C for 1 h. 50 μl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 μl Protein A Dynabeads for 4 h at 4°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/µl RNasin for eight times and once with 1ml ice cold 1× PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche 0311582001 for 1 h at 55°C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The Input RNA was extracted by using TRIzol reagent. Both the Input and IP RNA were treated by TURBO™ DNase Invitrogen AM2238. iCLIP seq: 1000 zebrafish embryos at 4 hpf were irradiated twice with 0.8 J/cm2 Stratalinker 2400 Stratagene lysed and subjected to mild fragmentation. Crosslinked RNA protein complexes were immunoprecipated using polyclonal Ybx1 antibody Abmax and protein A dynabeads. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp. | GEO Accession:GSM3406904 | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP162876 | iCLIP_4hpf_rep2_R1.fastq.gz iCLIP_4hpf_rep2_R2.fastq.gz | fastq fastq | 17432004900.0 | 58106683.0 | GSM3406904 r1 | 0:150 1:150 | A:5027776225;C:3413769313;G:3531157280;T:5459126811;N:175271 | 150 | 150 | 5027776225 | 3413769313 | 3531157280 | 5459126811 | 175271 | SRX4776903 | SRS3857464 | SRA786939 | GEO | Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS) | 2 | 0.62059 | 0.61563 | 0.02838 | 0.02072 | 0.95298 | 0.9628 | 0.94729 | 0.94715 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | random_priming | smarter | bulk | clip | iclip | China | 2018-09-28 | Blastula | Embryo | Whole Organism | All anatomical structures | ||||||||||||
| 49548 | 49548 | SRR7942637 | SRX4776902 | SRS3857447 | SRP162876 | PRJNA493828 | Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo sample. | GSE120646 | Other | The maternal to zygotic transition MZT is a conserved and fundamental process during which the embryo undergoes dramatic reprogramming to convert maternal environment to embryonic driven programing. However how the maternally supplied transcripts are dynamically regulated during MZT remains largely unknown. Herein through genome wide profiling of RNA 5 methylcytosine m5C in zebrafish early embryos we show that m5C methylated maternal mRNAs display higher stability during MZT. We identify that the Y box binding protein 1 Ybx1 prefers to recognizing m5C modified mRNAs through p p interaction with a key residue Trp45 in its cold shock domain CSD which plays essential roles in maternal mRNA stability and early embryogenesis of zebrafish. Cooperated with an mRNA stabilizer Pabpc1a Ybx1 promotes the stability of its target mRNAs in an m5C dependent manner. Our study demonstrates a novel mechanism of RNA m5C methylation regulated maternal mRNA stability during zebrafish MZT highlighting the critical role of m5C mRNA methylation in early development. Overall design: Examination of Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo. RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/μl RNasin by rotating at 4°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4°C for 1 h. 50 μl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 μl Protein A Dynabeads for 4 h at 4°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/µl RNasin for eight times and once with 1ml ice cold 1× PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated i… | parent bioproject:PRJNA534030 | iCLIP 4hpf rep1 | GSM3406903 | source name:Zebrafish embryo|strain:AB strain|cell type:Zebrafish embryo|age:4 hpf|tissue:whole embryo | iCLIP 4hpf rep1 | RIP seq and iCLIP seq reads were aligned to the zv9 genome assembly using TopHat v2.1.1 and BWA v0.7.10 respectively. RIP seq: MACS2 v2.1.1 were used for the peak calling and peaks were annotated by applying BEDTools’ intersectBed. iCLIP: To identify the Ybx1 targets’ locus the mode of truncation calling was performed. For each truncation position the coverages of unique tag k and truncations m were determined by CIMS.pl program CLIP Tool Kit CTK. The sites were annotated by applying BEDTools’ intersectBed. Genome build: zv9 Supplementary files format and content: Ybx1 binding sites in two biological replicates. | Zebrafish embryo | RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/μl RNasin by rotating at 4°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4°C for 1 h. 50 μl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 μl Protein A Dynabeads for 4 h at 4°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/µl RNasin for eight times and once with 1ml ice cold 1× PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche 0311582001 for 1 h at 55°C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The Input RNA was extracted by using TRIzol reagent. Both the Input and IP RNA were treated by TURBO™ DNase Invitrogen AM2238. iCLIP seq: 1000 zebrafish embryos at 4 hpf were irradiated twice with 0.8 J/cm2 Stratalinker 2400 Stratagene lysed and subjected to mild fragmentation. Crosslinked RNA protein complexes were immunoprecipated using polyclonal Ybx1 antibody Abmax and protein A dynabeads. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp. | strain:AB strain|cell type:Zebrafish embryo|age:4 hpf|tissue:whole embryo | GSM3406903 | GSM3406903: iCLIP 4hpf rep1; Danio rerio; OTHER | GSM3406903 | 1 | RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/μl RNasin by rotating at 4°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4°C for 1 h. 50 μl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 μl Protein A Dynabeads for 4 h at 4°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/µl RNasin for eight times and once with 1ml ice cold 1× PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche 0311582001 for 1 h at 55°C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The Input RNA was extracted by using TRIzol reagent. Both the Input and IP RNA were treated by TURBO™ DNase Invitrogen AM2238. iCLIP seq: 1000 zebrafish embryos at 4 hpf were irradiated twice with 0.8 J/cm2 Stratalinker 2400 Stratagene lysed and subjected to mild fragmentation. Crosslinked RNA protein complexes were immunoprecipated using polyclonal Ybx1 antibody Abmax and protein A dynabeads. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp. | GEO Accession:GSM3406903 | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP162876 | iCLIP_4hpf_rep1_R1.fastq.gz iCLIP_4hpf_rep1_R2.fastq.gz | fastq fastq | 18547407600.0 | 61824692.0 | GSM3406903 r1 | 0:150 1:150 | A:5264017245;C:3699523947;G:3688768985;T:5894912242;N:185181 | 150 | 150 | 5264017245 | 3699523947 | 3688768985 | 5894912242 | 185181 | SRX4776902 | SRS3857447 | SRA786939 | GEO | Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS) | 2 | 0.68368 | 0.67882 | 0.0342 | 0.02328 | 0.95375 | 0.96623 | 0.962 | 0.9572 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | random_priming | smarter | bulk | clip | iclip | China | 2018-09-28 | Blastula | Embryo | Whole Organism | All anatomical structures | ||||||||||||
| 49549 | 49549 | SRR7942636 | SRX4776901 | SRS3857441 | SRP162876 | PRJNA493828 | Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo sample. | GSE120646 | Other | The maternal to zygotic transition MZT is a conserved and fundamental process during which the embryo undergoes dramatic reprogramming to convert maternal environment to embryonic driven programing. However how the maternally supplied transcripts are dynamically regulated during MZT remains largely unknown. Herein through genome wide profiling of RNA 5 methylcytosine m5C in zebrafish early embryos we show that m5C methylated maternal mRNAs display higher stability during MZT. We identify that the Y box binding protein 1 Ybx1 prefers to recognizing m5C modified mRNAs through p p interaction with a key residue Trp45 in its cold shock domain CSD which plays essential roles in maternal mRNA stability and early embryogenesis of zebrafish. Cooperated with an mRNA stabilizer Pabpc1a Ybx1 promotes the stability of its target mRNAs in an m5C dependent manner. Our study demonstrates a novel mechanism of RNA m5C methylation regulated maternal mRNA stability during zebrafish MZT highlighting the critical role of m5C mRNA methylation in early development. Overall design: Examination of Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo. RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/μl RNasin by rotating at 4°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4°C for 1 h. 50 μl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 μl Protein A Dynabeads for 4 h at 4°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/µl RNasin for eight times and once with 1ml ice cold 1× PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated i… | parent bioproject:PRJNA534030 | RIP 4hpf rep2 | GSM3406902 | source name:Zebrafish embryo|strain:AB strain|cell type:Zebrafish embryo|age:4 hpf|tissue:whole embryo | RIP 4hpf rep2 | RIP seq and iCLIP seq reads were aligned to the zv9 genome assembly using TopHat v2.1.1 and BWA v0.7.10 respectively. RIP seq: MACS2 v2.1.1 were used for the peak calling and peaks were annotated by applying BEDTools’ intersectBed. iCLIP: To identify the Ybx1 targets’ locus the mode of truncation calling was performed. For each truncation position the coverages of unique tag k and truncations m were determined by CIMS.pl program CLIP Tool Kit CTK. The sites were annotated by applying BEDTools’ intersectBed. Genome build: zv9 Supplementary files format and content: Ybx1 binding sites in two biological replicates. | Zebrafish embryo | RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/μl RNasin by rotating at 4°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4°C for 1 h. 50 μl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 μl Protein A Dynabeads for 4 h at 4°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/µl RNasin for eight times and once with 1ml ice cold 1× PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche 0311582001 for 1 h at 55°C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The Input RNA was extracted by using TRIzol reagent. Both the Input and IP RNA were treated by TURBO™ DNase Invitrogen AM2238. iCLIP seq: 1000 zebrafish embryos at 4 hpf were irradiated twice with 0.8 J/cm2 Stratalinker 2400 Stratagene lysed and subjected to mild fragmentation. Crosslinked RNA protein complexes were immunoprecipated using polyclonal Ybx1 antibody Abmax and protein A dynabeads. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp. | strain:AB strain|cell type:Zebrafish embryo|age:4 hpf|tissue:whole embryo | GSM3406902 | GSM3406902: RIP 4hpf rep2; Danio rerio; RIP Seq | GSM3406902 | 1 | RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/μl RNasin by rotating at 4°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4°C for 1 h. 50 μl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 μl Protein A Dynabeads for 4 h at 4°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/µl RNasin for eight times and once with 1ml ice cold 1× PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche 0311582001 for 1 h at 55°C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The Input RNA was extracted by using TRIzol reagent. Both the Input and IP RNA were treated by TURBO™ DNase Invitrogen AM2238. iCLIP seq: 1000 zebrafish embryos at 4 hpf were irradiated twice with 0.8 J/cm2 Stratalinker 2400 Stratagene lysed and subjected to mild fragmentation. Crosslinked RNA protein complexes were immunoprecipated using polyclonal Ybx1 antibody Abmax and protein A dynabeads. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp. | GEO Accession:GSM3406902 | RIP-Seq | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP162876 | RIP_4hpf_rep2_R1.fastq.gz RIP_4hpf_rep2_R2.fastq.gz | fastq fastq | 22888305600.0 | 76294352.0 | GSM3406902 r1 | 0:150 1:150 | A:5927520807;C:4846894836;G:4996844576;T:7111789925;N:5255456 | 150 | 150 | 5927520807 | 4846894836 | 4996844576 | 7111789925 | 5255456 | SRX4776901 | SRS3857441 | SRA786939 | GEO | Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS) | 2 | 0.2704 | 0.17205 | 0.06114 | 0.06961 | 0.95879 | 0.9698 | 0.94515 | 0.83252 | 150 | 150 | B | B | mate2-mate1 similar by mapping diff | illumina | hiseq_era | full_length | random_priming | smarter | bulk | clip | iclip | China | 2018-09-28 | Blastula | Embryo | Whole Organism | All anatomical structures | ||||||||||||
| 49550 | 49550 | SRR7942635 | SRX4776900 | SRS3857440 | SRP162876 | PRJNA493828 | Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo sample. | GSE120646 | Other | The maternal to zygotic transition MZT is a conserved and fundamental process during which the embryo undergoes dramatic reprogramming to convert maternal environment to embryonic driven programing. However how the maternally supplied transcripts are dynamically regulated during MZT remains largely unknown. Herein through genome wide profiling of RNA 5 methylcytosine m5C in zebrafish early embryos we show that m5C methylated maternal mRNAs display higher stability during MZT. We identify that the Y box binding protein 1 Ybx1 prefers to recognizing m5C modified mRNAs through p p interaction with a key residue Trp45 in its cold shock domain CSD which plays essential roles in maternal mRNA stability and early embryogenesis of zebrafish. Cooperated with an mRNA stabilizer Pabpc1a Ybx1 promotes the stability of its target mRNAs in an m5C dependent manner. Our study demonstrates a novel mechanism of RNA m5C methylation regulated maternal mRNA stability during zebrafish MZT highlighting the critical role of m5C mRNA methylation in early development. Overall design: Examination of Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo. RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/μl RNasin by rotating at 4°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4°C for 1 h. 50 μl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 μl Protein A Dynabeads for 4 h at 4°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/µl RNasin for eight times and once with 1ml ice cold 1× PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated i… | parent bioproject:PRJNA534030 | RIP 4hpf rep1 | GSM3406901 | source name:Zebrafish embryo|strain:AB strain|cell type:Zebrafish embryo|age:4 hpf|tissue:whole embryo | RIP 4hpf rep1 | RIP seq and iCLIP seq reads were aligned to the zv9 genome assembly using TopHat v2.1.1 and BWA v0.7.10 respectively. RIP seq: MACS2 v2.1.1 were used for the peak calling and peaks were annotated by applying BEDTools’ intersectBed. iCLIP: To identify the Ybx1 targets’ locus the mode of truncation calling was performed. For each truncation position the coverages of unique tag k and truncations m were determined by CIMS.pl program CLIP Tool Kit CTK. The sites were annotated by applying BEDTools’ intersectBed. Genome build: zv9 Supplementary files format and content: Ybx1 binding sites in two biological replicates. | Zebrafish embryo | RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/μl RNasin by rotating at 4°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4°C for 1 h. 50 μl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 μl Protein A Dynabeads for 4 h at 4°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/µl RNasin for eight times and once with 1ml ice cold 1× PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche 0311582001 for 1 h at 55°C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The Input RNA was extracted by using TRIzol reagent. Both the Input and IP RNA were treated by TURBO™ DNase Invitrogen AM2238. iCLIP seq: 1000 zebrafish embryos at 4 hpf were irradiated twice with 0.8 J/cm2 Stratalinker 2400 Stratagene lysed and subjected to mild fragmentation. Crosslinked RNA protein complexes were immunoprecipated using polyclonal Ybx1 antibody Abmax and protein A dynabeads. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp. | strain:AB strain|cell type:Zebrafish embryo|age:4 hpf|tissue:whole embryo | GSM3406901 | GSM3406901: RIP 4hpf rep1; Danio rerio; RIP Seq | GSM3406901 | 1 | RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/μl RNasin by rotating at 4°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4°C for 1 h. 50 μl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 μl Protein A Dynabeads for 4 h at 4°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/µl RNasin for eight times and once with 1ml ice cold 1× PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche 0311582001 for 1 h at 55°C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The Input RNA was extracted by using TRIzol reagent. Both the Input and IP RNA were treated by TURBO™ DNase Invitrogen AM2238. iCLIP seq: 1000 zebrafish embryos at 4 hpf were irradiated twice with 0.8 J/cm2 Stratalinker 2400 Stratagene lysed and subjected to mild fragmentation. Crosslinked RNA protein complexes were immunoprecipated using polyclonal Ybx1 antibody Abmax and protein A dynabeads. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp. | GEO Accession:GSM3406901 | RIP-Seq | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP162876 | RIP_4hpf_rep1_R1.fastq.gz RIP_4hpf_rep1_R2.fastq.gz | fastq fastq | 19929300600.0 | 66431002.0 | GSM3406901 r1 | 0:150 1:150 | A:5076575451;C:4235012507;G:4442151234;T:6170975339;N:4586069 | 150 | 150 | 5076575451 | 4235012507 | 4442151234 | 6170975339 | 4586069 | SRX4776900 | SRS3857440 | SRA786939 | GEO | Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS) | 2 | 0.27932 | 0.16557 | 0.06585 | 0.06178 | 0.95692 | 0.96844 | 0.94238 | 0.84334 | 150 | 150 | B | B | mate2-mate1 similar by mapping diff | illumina | hiseq_era | full_length | random_priming | smarter | bulk | clip | iclip | China | 2018-09-28 | Blastula | Embryo | Whole Organism | All anatomical structures | ||||||||||||
| 49565 | 49565 | SRR11537844 | SRX8108899 | SRS6473985 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | Shield Elavl1a MO NAIN3.rep2 | GSM4473292 | tissue:Shield Elavl1a MO NAIN3|strain background:AB|age:6hpf|cell type:elavl1a morphants zebrafish embryos cells|treatment:NAI N3 | Shield Elavl1a MO NAIN3.rep2 | Library strategy: icSHAPE trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calulate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | Shield Elavl1a MO NAIN3 | For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages. For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5°C for 5min | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37℃ for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25℃ for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30℃ for 90 min. And then 1µl RecJf NEB was added with another incubation at 37℃ for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain background:AB|age:6hpf|cell type:elavl1a morphants zebrafish embryos cells|treatment:NAI N3 | GSM4473292 | GSM4473292: Shield Elavl1a MO NAIN3.rep2; Danio rerio; OTHER | GSM4473292 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37℃ for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25℃ for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30℃ for 90 min. And then 1µl RecJf NEB was added with another incubation at 37℃ for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM4473292 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP163087 | Shield_Elavl1a_MO_NAIN3.rep2.fastq.gz | fastq | 125703095100.0 | 838020634.0 | GSM4473292 r1 | 0:150 1:0 | A:32023181587;C:24765137819;G:46378114606;T:22535691781;N:969307 | 150 | 0 | 32023181587 | 24765137819 | 46378114606 | 22535691781 | 969307 | SRX8108899 | SRS6473985 | SRA787572 | GEO | Life Science, Tsinghua University | 1 | 0.11412 | 0.02142 | 0.92147 | 0.70154 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2020-04-12 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 49566 | 49566 | SRR11537843 | SRX8108898 | SRS6473984 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | Shield Elavl1a MO NAIN3.rep1 | GSM4473291 | tissue:Shield Elavl1a MO NAIN3|strain background:AB|age:6hpf|cell type:elavl1a morphants zebrafish embryos cells|treatment:NAI N3 | Shield Elavl1a MO NAIN3.rep1 | Library strategy: icSHAPE trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calulate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | Shield Elavl1a MO NAIN3 | For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages. For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5°C for 5min | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37℃ for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25℃ for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30℃ for 90 min. And then 1µl RecJf NEB was added with another incubation at 37℃ for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain background:AB|age:6hpf|cell type:elavl1a morphants zebrafish embryos cells|treatment:NAI N3 | GSM4473291 | GSM4473291: Shield Elavl1a MO NAIN3.rep1; Danio rerio; OTHER | GSM4473291 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37℃ for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25℃ for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30℃ for 90 min. And then 1µl RecJf NEB was added with another incubation at 37℃ for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM4473291 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP163087 | Shield_Elavl1a_MO_NAIN3.rep1.fastq.gz | fastq | 97684476300.0 | 651229842.0 | GSM4473291 r1 | 0:150 1:0 | A:23448978329;C:19171932414;G:36104881456;T:18957926032;N:758069 | 150 | 0 | 23448978329 | 19171932414 | 36104881456 | 18957926032 | 758069 | SRX8108898 | SRS6473984 | SRA787572 | GEO | Life Science, Tsinghua University | 1 | 0.07298 | 0.01306 | 0.93789 | 0.71752 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2020-04-12 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 49567 | 49567 | SRR11537842 | SRX8108897 | SRS6473983 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | Shield Elavl1a MO DMSO.rep2 | GSM4473290 | tissue:Shield Elavl1a MO DMSO|strain background:AB|age:6hpf|cell type:elavl1a morphants zebrafish embryos cells|treatment:DMSO | Shield Elavl1a MO DMSO.rep2 | Library strategy: icSHAPE trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calulate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | Shield Elavl1a MO DMSO | For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages. For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5°C for 5min | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37℃ for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25℃ for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30℃ for 90 min. And then 1µl RecJf NEB was added with another incubation at 37℃ for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain background:AB|age:6hpf|cell type:elavl1a morphants zebrafish embryos cells|treatment:DMSO | GSM4473290 | GSM4473290: Shield Elavl1a MO DMSO.rep2; Danio rerio; OTHER | GSM4473290 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37℃ for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25℃ for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30℃ for 90 min. And then 1µl RecJf NEB was added with another incubation at 37℃ for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM4473290 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP163087 | Shield_Elavl1a_MO_DMSO.rep2.fastq.gz | fastq | 77964750450.0 | 519765003.0 | GSM4473290 r1 | 0:150 1:0 | A:23155551814;C:19934925592;G:15766394313;T:19078082759;N:29795972 | 150 | 0 | 23155551814 | 19934925592 | 15766394313 | 19078082759 | 29795972 | SRX8108897 | SRS6473983 | SRA787572 | GEO | Life Science, Tsinghua University | 1 | 0.07142 | 0.01724 | 0.94223 | 0.779 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2020-04-12 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 49568 | 49568 | SRR11537841 | SRX8108896 | SRS6473982 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | Shield Elavl1a MO DMSO.rep1 | GSM4473289 | tissue:Shield Elavl1a MO DMSO|strain background:AB|age:6hpf|cell type:elavl1a morphants zebrafish embryos cells|treatment:DMSO | Shield Elavl1a MO DMSO.rep1 | Library strategy: icSHAPE trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calulate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | Shield Elavl1a MO DMSO | For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages. For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5°C for 5min | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37℃ for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25℃ for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30℃ for 90 min. And then 1µl RecJf NEB was added with another incubation at 37℃ for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain background:AB|age:6hpf|cell type:elavl1a morphants zebrafish embryos cells|treatment:DMSO | GSM4473289 | GSM4473289: Shield Elavl1a MO DMSO.rep1; Danio rerio; OTHER | GSM4473289 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37℃ for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25℃ for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30℃ for 90 min. And then 1µl RecJf NEB was added with another incubation at 37℃ for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM4473289 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP163087 | Shield_Elavl1a_MO_DMSO.rep1.fastq.gz | fastq | 24430935750.0 | 162872905.0 | GSM4473289 r1 | 0:150 1:0 | A:6922313808;C:5215135549;G:7472148111;T:4821148458;N:189824 | 150 | 0 | 6922313808 | 5215135549 | 7472148111 | 4821148458 | 189824 | SRX8108896 | SRS6473982 | SRA787572 | GEO | Life Science, Tsinghua University | 1 | 0.27515 | 0.04834 | 0.86147 | 0.4542 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2020-04-12 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 49569 | 49569 | SRR11537840 | SRX8108895 | SRS6473981 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | Sphere Elavl1a MO NAIN3.rep2 | GSM4473288 | tissue:Sphere Elavl1a MO NAIN3|strain background:AB|age:4hpf|cell type:elavl1a morphants zebrafish embryos cells|treatment:NAI N3 | Sphere Elavl1a MO NAIN3.rep2 | Library strategy: icSHAPE trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calulate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | Sphere Elavl1a MO NAIN3 | For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages. For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5°C for 5min | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37℃ for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25℃ for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30℃ for 90 min. And then 1µl RecJf NEB was added with another incubation at 37℃ for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain background:AB|age:4hpf|cell type:elavl1a morphants zebrafish embryos cells|treatment:NAI N3 | GSM4473288 | GSM4473288: Sphere Elavl1a MO NAIN3.rep2; Danio rerio; OTHER | GSM4473288 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37℃ for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25℃ for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30℃ for 90 min. And then 1µl RecJf NEB was added with another incubation at 37℃ for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM4473288 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP163087 | Sphere_Elavl1a_MO_NAIN3.rep2.fastq.gz | fastq | 83266825200.0 | 555112168.0 | GSM4473288 r1 | 0:150 1:0 | A:20621422257;C:17635819340;G:29266248375;T:15742691319;N:643909 | 150 | 0 | 20621422257 | 17635819340 | 29266248375 | 15742691319 | 643909 | SRX8108895 | SRS6473981 | SRA787572 | GEO | Life Science, Tsinghua University | 1 | 0.13635 | 0.01536 | 0.88586 | 0.72417 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2020-04-12 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 49570 | 49570 | SRR11537839 | SRX8108894 | SRS6473980 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | Sphere Elavl1a MO NAIN3.rep1 | GSM4473287 | tissue:Sphere Elavl1a MO NAIN3|strain background:AB|age:4hpf|cell type:elavl1a morphants zebrafish embryos cells|treatment:NAI N3 | Sphere Elavl1a MO NAIN3.rep1 | Library strategy: icSHAPE trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calulate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | Sphere Elavl1a MO NAIN3 | For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages. For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5°C for 5min | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37℃ for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25℃ for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30℃ for 90 min. And then 1µl RecJf NEB was added with another incubation at 37℃ for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain background:AB|age:4hpf|cell type:elavl1a morphants zebrafish embryos cells|treatment:NAI N3 | GSM4473287 | GSM4473287: Sphere Elavl1a MO NAIN3.rep1; Danio rerio; OTHER | GSM4473287 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37℃ for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25℃ for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30℃ for 90 min. And then 1µl RecJf NEB was added with another incubation at 37℃ for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM4473287 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP163087 | Sphere_Elavl1a_MO_NAIN3.rep1.fastq.gz | fastq | 75408648300.0 | 502724322.0 | GSM4473287 r1 | 0:150 1:0 | A:19590532626;C:15494788593;G:26125416257;T:14197330642;N:580182 | 150 | 0 | 19590532626 | 15494788593 | 26125416257 | 14197330642 | 580182 | SRX8108894 | SRS6473980 | SRA787572 | GEO | Life Science, Tsinghua University | 1 | 0.0048 | 0.00055 | 0.99502 | 0.81456 | 150 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2020-04-12 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 49571 | 49571 | SRR11537838 | SRX8108893 | SRS6473979 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | Sphere Elavl1a MO DMSO.rep2 | GSM4473286 | tissue:Sphere Elavl1a MO DMSO|strain background:AB|age:4hpf|cell type:elavl1a morphants zebrafish embryos cells|treatment:DMSO | Sphere Elavl1a MO DMSO.rep2 | Library strategy: icSHAPE trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calulate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | Sphere Elavl1a MO DMSO | For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages. For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5°C for 5min | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37℃ for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25℃ for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30℃ for 90 min. And then 1µl RecJf NEB was added with another incubation at 37℃ for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain background:AB|age:4hpf|cell type:elavl1a morphants zebrafish embryos cells|treatment:DMSO | GSM4473286 | GSM4473286: Sphere Elavl1a MO DMSO.rep2; Danio rerio; OTHER | GSM4473286 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37℃ for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25℃ for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30℃ for 90 min. And then 1µl RecJf NEB was added with another incubation at 37℃ for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM4473286 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP163087 | Sphere_Elavl1a_MO_DMSO.rep2.fastq.gz | fastq | 21843179550.0 | 145621197.0 | GSM4473286 r1 | 0:150 1:0 | A:5896736067;C:4594959790;G:6585009703;T:4766305398;N:168592 | 150 | 0 | 5896736067 | 4594959790 | 6585009703 | 4766305398 | 168592 | SRX8108893 | SRS6473979 | SRA787572 | GEO | Life Science, Tsinghua University | 1 | 0.21638 | 0.03521 | 0.84902 | 0.66034 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2020-04-12 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 49572 | 49572 | SRR11537837 | SRX8108892 | SRS6473978 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | Sphere Elavl1a MO DMSO.rep1 | GSM4473285 | tissue:Sphere Elavl1a MO DMSO|strain background:AB|age:4hpf|cell type:elavl1a morphants zebrafish embryos cells|treatment:DMSO | Sphere Elavl1a MO DMSO.rep1 | Library strategy: icSHAPE trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calulate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | Sphere Elavl1a MO DMSO | For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages. For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5°C for 5min | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37℃ for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25℃ for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30℃ for 90 min. And then 1µl RecJf NEB was added with another incubation at 37℃ for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain background:AB|age:4hpf|cell type:elavl1a morphants zebrafish embryos cells|treatment:DMSO | GSM4473285 | GSM4473285: Sphere Elavl1a MO DMSO.rep1; Danio rerio; OTHER | GSM4473285 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37℃ for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25℃ for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30℃ for 90 min. And then 1µl RecJf NEB was added with another incubation at 37℃ for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM4473285 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP163087 | Sphere_Elavl1a_MO_DMSO.rep1.fastq.gz | fastq | 39150278250.0 | 261001855.0 | GSM4473285 r1 | 0:150 1:0 | A:10112519472;C:8251284950;G:12148560750;T:8637610037;N:303041 | 150 | 0 | 10112519472 | 8251284950 | 12148560750 | 8637610037 | 303041 | SRX8108892 | SRS6473978 | SRA787572 | GEO | Life Science, Tsinghua University | 1 | 0.24867 | 0.03662 | 0.83402 | 0.65435 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2020-04-12 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 49573 | 49573 | SRR10434662 | SRX7130632 | SRS5639976 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | shield Flag Elavl1a iCLIP rep2 | GSM4157939 | tissue:zebrafish embryos|strain:zebrafish embryos|cell type:normal zebrafish embryos cells|age:6hpf | shield Flag Elavl1a iCLIP rep2 | The proceesing procedure is similar to CTK toolhttps://zhanglab.c2b2.columbia.edu/index.php/ICLIP data analysis using CTK. First we trimmed three prime adaptor from reads by cutadapt collapsed duplicated reads by fastq2collapse.pl in CTK tool stripped 5’ degenerated barcode mapped clean reads to zebrafish reference genomez10 by bwav0.7.17. data from replicates was merged for peak calling We use CTK tool CITS mode to call the peaks. Reads were clustered using tag2cluster.pl with parameters big s maxgap " 1" peaks are identified using tag2peak.pl with parameters big ss v prefix "CITS" gap 25 p 0.05 Genome build: z10 Supplementary files format and content: iCLIP peaks identified by CTK tool were provided in bed file format. The first three columns represent the 0 based location of the peak in the genome and the last column represents the strand.The fourth column reprents the peak ID and describes the gene locus peak heightPH expected PH/backgroundPH0 and pvalueP. The fifth column represents the peak height. | zebrafish embryos | iCLIP seq was carried out as previously described Despic et al. 2017. Breifly flag elavl1a mRNA injected embryos were collected at xxx h.p.f. and 6 h.p.f.. 400 zebrafish embryos were irradiated twice with 0.8 J/cm2 Stratalinker 2400 Stratagene lysed and subjected to mild RNA fragmentation. Crosslinked RNA proteins complexes were immunopurified using Anti FLAG M2 Magnetic Beads Merck M8823 for 4 h.p.f. and 6 h.p.f. at 4 °C. RNA was extracted Library construction was performed by using Smarter smRNA Seq kit Clontech Laboratories Inc | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain:zebrafish embryos|cell type:normal zebrafish embryos cells|age:6hpf | GSM4157939 | GSM4157939: shield Flag Elavl1a iCLIP rep2; Danio rerio; OTHER | GSM4157939 | 1 | iCLIP seq was carried out as previously described Despic et al. 2017. Breifly flag elavl1a mRNA injected embryos were collected at xxx h.p.f. and 6 h.p.f.. 400 zebrafish embryos were irradiated twice with 0.8 J/cm2 Stratalinker 2400 Stratagene lysed and subjected to mild RNA fragmentation. Crosslinked RNA proteins complexes were immunopurified using Anti FLAG M2 Magnetic Beads Merck M8823 for 4 h.p.f. and 6 h.p.f. at 4 °C. RNA was extracted Library construction was performed by using Smarter smRNA Seq kit Clontech Laboratories Inc | GEO Accession:GSM4157939 | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | HiSeq X Ten | SRP163087 | Shield_Elavl1a_iCLIP_rep2.R2.fq.gz Shield_Elavl1a_iCLIP_rep2.R1.fq.gz | fastq fastq | 23879342400.0 | 79597808.0 | GSM4157939 r1 | 0:150 1:150 | A:6335254303;C:5166953187;G:6017120995;T:6358132998;N:1880917 | 150 | 150 | 6335254303 | 5166953187 | 6017120995 | 6358132998 | 1880917 | SRX7130632 | SRS5639976 | SRA787572 | GEO | Life Science, Tsinghua University | 2 | 0.14294 | 0.15151 | 0.03583 | 0.08959 | 0.99397 | 0.98269 | 0.96727 | 0.75507 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | poly_a | smarter | bulk | clip | iclip | China | 2019-11-12 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||
| 49574 | 49574 | SRR10434661 | SRX7130631 | SRS5639975 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | shield Flag Elavl1a iCLIP rep1 | GSM4157938 | tissue:zebrafish embryos|strain:zebrafish embryos|cell type:normal zebrafish embryos cells|age:6hpf | shield Flag Elavl1a iCLIP rep1 | The proceesing procedure is similar to CTK toolhttps://zhanglab.c2b2.columbia.edu/index.php/ICLIP data analysis using CTK. First we trimmed three prime adaptor from reads by cutadapt collapsed duplicated reads by fastq2collapse.pl in CTK tool stripped 5’ degenerated barcode mapped clean reads to zebrafish reference genomez10 by bwav0.7.17. data from replicates was merged for peak calling We use CTK tool CITS mode to call the peaks. Reads were clustered using tag2cluster.pl with parameters big s maxgap " 1" peaks are identified using tag2peak.pl with parameters big ss v prefix "CITS" gap 25 p 0.05 Genome build: z10 Supplementary files format and content: iCLIP peaks identified by CTK tool were provided in bed file format. The first three columns represent the 0 based location of the peak in the genome and the last column represents the strand.The fourth column reprents the peak ID and describes the gene locus peak heightPH expected PH/backgroundPH0 and pvalueP. The fifth column represents the peak height. | zebrafish embryos | iCLIP seq was carried out as previously described Despic et al. 2017. Breifly flag elavl1a mRNA injected embryos were collected at xxx h.p.f. and 6 h.p.f.. 400 zebrafish embryos were irradiated twice with 0.8 J/cm2 Stratalinker 2400 Stratagene lysed and subjected to mild RNA fragmentation. Crosslinked RNA proteins complexes were immunopurified using Anti FLAG M2 Magnetic Beads Merck M8823 for 4 h.p.f. and 6 h.p.f. at 4 °C. RNA was extracted Library construction was performed by using Smarter smRNA Seq kit Clontech Laboratories Inc | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain:zebrafish embryos|cell type:normal zebrafish embryos cells|age:6hpf | GSM4157938 | GSM4157938: shield Flag Elavl1a iCLIP rep1; Danio rerio; OTHER | GSM4157938 | 1 | iCLIP seq was carried out as previously described Despic et al. 2017. Breifly flag elavl1a mRNA injected embryos were collected at xxx h.p.f. and 6 h.p.f.. 400 zebrafish embryos were irradiated twice with 0.8 J/cm2 Stratalinker 2400 Stratagene lysed and subjected to mild RNA fragmentation. Crosslinked RNA proteins complexes were immunopurified using Anti FLAG M2 Magnetic Beads Merck M8823 for 4 h.p.f. and 6 h.p.f. at 4 °C. RNA was extracted Library construction was performed by using Smarter smRNA Seq kit Clontech Laboratories Inc | GEO Accession:GSM4157938 | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | HiSeq X Ten | SRP163087 | Shield_Elavl1a_iCLIP_rep1.R1.fq.gz Shield_Elavl1a_iCLIP_rep1.R2.fq.gz | fastq fastq | 22375977600.0 | 74586592.0 | GSM4157938 r1 | 0:150 1:150 | A:6243025236;C:5008499337;G:5418170547;T:5704514909;N:1767571 | 150 | 150 | 6243025236 | 5008499337 | 5418170547 | 5704514909 | 1767571 | SRX7130631 | SRS5639975 | SRA787572 | GEO | Life Science, Tsinghua University | 2 | 0.05144 | 0.12625 | 0.01219 | 0.09577 | 0.99734 | 0.98113 | 0.8629 | 0.52429 | 150 | 150 | B | B | mate1-mate2 similar by mapping diff | illumina | hiseq_era | full_length | poly_a | smarter | bulk | clip | iclip | China | 2019-11-12 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||
| 49575 | 49575 | SRR10434660 | SRX7130630 | SRS5639974 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | sphere Flag Elavl1a iCLIP rep2 | GSM4157937 | tissue:zebrafish embryos|strain:zebrafish embryos|cell type:normal zebrafish embryos cells|age:4hpf | sphere Flag Elavl1a iCLIP rep2 | The proceesing procedure is similar to CTK toolhttps://zhanglab.c2b2.columbia.edu/index.php/ICLIP data analysis using CTK. First we trimmed three prime adaptor from reads by cutadapt collapsed duplicated reads by fastq2collapse.pl in CTK tool stripped 5’ degenerated barcode mapped clean reads to zebrafish reference genomez10 by bwav0.7.17. data from replicates was merged for peak calling We use CTK tool CITS mode to call the peaks. Reads were clustered using tag2cluster.pl with parameters big s maxgap " 1" peaks are identified using tag2peak.pl with parameters big ss v prefix "CITS" gap 25 p 0.05 Genome build: z10 Supplementary files format and content: iCLIP peaks identified by CTK tool were provided in bed file format. The first three columns represent the 0 based location of the peak in the genome and the last column represents the strand.The fourth column reprents the peak ID and describes the gene locus peak heightPH expected PH/backgroundPH0 and pvalueP. The fifth column represents the peak height. | zebrafish embryos | iCLIP seq was carried out as previously described Despic et al. 2017. Breifly flag elavl1a mRNA injected embryos were collected at xxx h.p.f. and 6 h.p.f.. 400 zebrafish embryos were irradiated twice with 0.8 J/cm2 Stratalinker 2400 Stratagene lysed and subjected to mild RNA fragmentation. Crosslinked RNA proteins complexes were immunopurified using Anti FLAG M2 Magnetic Beads Merck M8823 for 4 h.p.f. and 6 h.p.f. at 4 °C. RNA was extracted Library construction was performed by using Smarter smRNA Seq kit Clontech Laboratories Inc | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain:zebrafish embryos|cell type:normal zebrafish embryos cells|age:4hpf | GSM4157937 | GSM4157937: sphere Flag Elavl1a iCLIP rep2; Danio rerio; OTHER | GSM4157937 | 1 | iCLIP seq was carried out as previously described Despic et al. 2017. Breifly flag elavl1a mRNA injected embryos were collected at xxx h.p.f. and 6 h.p.f.. 400 zebrafish embryos were irradiated twice with 0.8 J/cm2 Stratalinker 2400 Stratagene lysed and subjected to mild RNA fragmentation. Crosslinked RNA proteins complexes were immunopurified using Anti FLAG M2 Magnetic Beads Merck M8823 for 4 h.p.f. and 6 h.p.f. at 4 °C. RNA was extracted Library construction was performed by using Smarter smRNA Seq kit Clontech Laboratories Inc | GEO Accession:GSM4157937 | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | HiSeq X Ten | SRP163087 | Sphere_Elavl1a_iCLIP_rep2.R1.fq.gz Sphere_Elavl1a_iCLIP_rep2.R2.fq.gz | fastq fastq | 22090855200.0 | 73636184.0 | GSM4157937 r1 | 0:150 1:150 | A:5631298996;C:5114935575;G:5742247735;T:5600647498;N:1725396 | 150 | 150 | 5631298996 | 5114935575 | 5742247735 | 5600647498 | 1725396 | SRX7130630 | SRS5639974 | SRA787572 | GEO | Life Science, Tsinghua University | 2 | 0.23476 | 0.17586 | 0.06861 | 0.08859 | 0.99563 | 0.98873 | 0.95465 | 0.79994 | 150 | 150 | B | B | mate2-mate1 similar by mapping diff | illumina | hiseq_era | full_length | poly_a | smarter | bulk | clip | iclip | China | 2019-11-12 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||
| 49576 | 49576 | SRR10434659 | SRX7130629 | SRS5639973 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | sphere Flag Elavl1a iCLIP rep1 | GSM4157936 | tissue:zebrafish embryos|strain:zebrafish embryos|cell type:normal zebrafish embryos cells|age:4hpf | sphere Flag Elavl1a iCLIP rep1 | The proceesing procedure is similar to CTK toolhttps://zhanglab.c2b2.columbia.edu/index.php/ICLIP data analysis using CTK. First we trimmed three prime adaptor from reads by cutadapt collapsed duplicated reads by fastq2collapse.pl in CTK tool stripped 5’ degenerated barcode mapped clean reads to zebrafish reference genomez10 by bwav0.7.17. data from replicates was merged for peak calling We use CTK tool CITS mode to call the peaks. Reads were clustered using tag2cluster.pl with parameters big s maxgap " 1" peaks are identified using tag2peak.pl with parameters big ss v prefix "CITS" gap 25 p 0.05 Genome build: z10 Supplementary files format and content: iCLIP peaks identified by CTK tool were provided in bed file format. The first three columns represent the 0 based location of the peak in the genome and the last column represents the strand.The fourth column reprents the peak ID and describes the gene locus peak heightPH expected PH/backgroundPH0 and pvalueP. The fifth column represents the peak height. | zebrafish embryos | iCLIP seq was carried out as previously described Despic et al. 2017. Breifly flag elavl1a mRNA injected embryos were collected at xxx h.p.f. and 6 h.p.f.. 400 zebrafish embryos were irradiated twice with 0.8 J/cm2 Stratalinker 2400 Stratagene lysed and subjected to mild RNA fragmentation. Crosslinked RNA proteins complexes were immunopurified using Anti FLAG M2 Magnetic Beads Merck M8823 for 4 h.p.f. and 6 h.p.f. at 4 °C. RNA was extracted Library construction was performed by using Smarter smRNA Seq kit Clontech Laboratories Inc | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain:zebrafish embryos|cell type:normal zebrafish embryos cells|age:4hpf | GSM4157936 | GSM4157936: sphere Flag Elavl1a iCLIP rep1; Danio rerio; OTHER | GSM4157936 | 1 | iCLIP seq was carried out as previously described Despic et al. 2017. Breifly flag elavl1a mRNA injected embryos were collected at xxx h.p.f. and 6 h.p.f.. 400 zebrafish embryos were irradiated twice with 0.8 J/cm2 Stratalinker 2400 Stratagene lysed and subjected to mild RNA fragmentation. Crosslinked RNA proteins complexes were immunopurified using Anti FLAG M2 Magnetic Beads Merck M8823 for 4 h.p.f. and 6 h.p.f. at 4 °C. RNA was extracted Library construction was performed by using Smarter smRNA Seq kit Clontech Laboratories Inc | GEO Accession:GSM4157936 | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | HiSeq X Ten | SRP163087 | Sphere_Elavl1a_iCLIP_rep1.R2.fq.gz Sphere_Elavl1a_iCLIP_rep1.R1.fq.gz | fastq fastq | 15794202300.0 | 52647341.0 | GSM4157936 r1 | 0:150 1:150 | A:4443931911;C:3527112429;G:3707720167;T:4114188890;N:1248903 | 150 | 150 | 4443931911 | 3527112429 | 3707720167 | 4114188890 | 1248903 | SRX7130629 | SRS5639973 | SRA787572 | GEO | Life Science, Tsinghua University | 2 | 0.06877 | 0.10388 | 0.02139 | 0.07135 | 0.99776 | 0.98413 | 0.87145 | 0.57456 | 150 | 150 | B | B | mate1-mate2 similar by mapping diff | illumina | hiseq_era | full_length | poly_a | smarter | bulk | clip | iclip | China | 2019-11-12 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||
| 49577 | 49577 | SRR7947926 | SRX4781875 | SRS3862067 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | elavl1a morphant 6h rna seq rep2 | GSM3409399 | source name:elavl1a morphant 6h rna seq rep2|strain:AB|tissue:zebrafish embryos|genotype/variation:elavl1a morphants zebrafish embryos cells|age:6hpf | elavl1a morphant 6h rna seq rep2 | trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | elavl1a morphant 6h rna seq rep2 | For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain:AB|tissue:zebrafish embryos|genotype/variation:elavl1a morphants zebrafish embryos cells|age:6hpf | GSM3409399 | GSM3409399: elavl1a morphant 6h rna seq rep2; Danio rerio; RNA Seq | GSM3409399 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM3409399 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | HiSeq X Ten | SRP163087 | elavl1a_morphant_6h_rna-seq_rep2.R1.fastq.gz elavl1a_morphant_6h_rna-seq_rep2.R2.fastq.gz | fastq fastq | 19875464400.0 | 66251548.0 | GSM3409399 r1 | 0:150 1:150 | A:5352630990;C:4584661408;G:4726300804;T:5209787586;N:2083612 | 150 | 150 | 5352630990 | 4584661408 | 4726300804 | 5209787586 | 2083612 | SRX4781875 | SRS3862067 | SRA787572 | GEO | Life Science, Tsinghua University | 2 | 0.94901 | 0.95039 | 0.09074 | 0.08943 | 0.75866 | 0.76418 | 0.55609 | 0.56574 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2018-10-01 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||
| 49578 | 49578 | SRR7947925 | SRX4781874 | SRS3862066 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | elavl1a morphant 6h rna seq rep1 | GSM3409398 | source name:elavl1a morphant 6h rna seq rep1|strain:AB|tissue:zebrafish embryos|genotype/variation:elavl1a morphants zebrafish embryos cells|age:6hpf | elavl1a morphant 6h rna seq rep1 | trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | elavl1a morphant 6h rna seq rep1 | For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain:AB|tissue:zebrafish embryos|genotype/variation:elavl1a morphants zebrafish embryos cells|age:6hpf | GSM3409398 | GSM3409398: elavl1a morphant 6h rna seq rep1; Danio rerio; RNA Seq | GSM3409398 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM3409398 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | HiSeq X Ten | SRP163087 | elavl1a_morphant_6h_rna-seq_rep1.R2.fastq.gz elavl1a_morphant_6h_rna-seq_rep1.R1.fastq.gz | fastq fastq | 20202214200.0 | 67340714.0 | GSM3409398 r1 | 0:150 1:150 | A:5439747248;C:4667041902;G:4805911969;T:5287977733;N:1535348 | 150 | 150 | 5439747248 | 4667041902 | 4805911969 | 5287977733 | 1535348 | SRX4781874 | SRS3862066 | SRA787572 | GEO | Life Science, Tsinghua University | 2 | 0.94586 | 0.94757 | 0.09031 | 0.09016 | 0.76019 | 0.76493 | 0.55951 | 0.56185 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2018-10-01 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||
| 49579 | 49579 | SRR7947924 | SRX4781873 | SRS3862065 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | elavl1a morphant 4h rna seq rep2 | GSM3409397 | source name:elavl1a morphant 4h rna seq rep2|strain:AB|tissue:zebrafish embryos|genotype/variation:elavl1a morphants zebrafish embryos cells|age:4hpf | elavl1a morphant 4h rna seq rep2 | trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | elavl1a morphant 4h rna seq rep2 | For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain:AB|tissue:zebrafish embryos|genotype/variation:elavl1a morphants zebrafish embryos cells|age:4hpf | GSM3409397 | GSM3409397: elavl1a morphant 4h rna seq rep2; Danio rerio; RNA Seq | GSM3409397 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM3409397 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | HiSeq X Ten | SRP163087 | elavl1a_morphant_4h_rna-seq_rep2.R2.fastq.gz elavl1a_morphant_4h_rna-seq_rep2.R1.fastq.gz | fastq fastq | 38764196400.0 | 129213988.0 | GSM3409397 r1 | 0:150 1:150 | A:10980499317;C:8394995318;G:8739322914;T:10645637187;N:3741664 | 150 | 150 | 10980499317 | 8394995318 | 8739322914 | 10645637187 | 3741664 | SRX4781873 | SRS3862065 | SRA787572 | GEO | Life Science, Tsinghua University | 2 | 0.94567 | 0.94509 | 0.06713 | 0.06614 | 0.76191 | 0.76508 | 0.73283 | 0.74007 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2018-10-01 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||
| 49580 | 49580 | SRR7947923 | SRX4781872 | SRS3862064 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | elavl1a morphant 4h rna seq rep1 | GSM3409396 | source name:elavl1a morphant 4h rna seq rep1|strain:AB|tissue:zebrafish embryos|genotype/variation:elavl1a morphants zebrafish embryos cells|age:4hpf | elavl1a morphant 4h rna seq rep1 | trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | elavl1a morphant 4h rna seq rep1 | For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain:AB|tissue:zebrafish embryos|genotype/variation:elavl1a morphants zebrafish embryos cells|age:4hpf | GSM3409396 | GSM3409396: elavl1a morphant 4h rna seq rep1; Danio rerio; RNA Seq | GSM3409396 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM3409396 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | HiSeq X Ten | SRP163087 | elavl1a_morphant_4h_rna-seq_rep1.R1.fastq.gz elavl1a_morphant_4h_rna-seq_rep1.R2.fastq.gz | fastq fastq | 34417602600.0 | 114725342.0 | GSM3409396 r1 | 0:150 1:150 | A:9798364920;C:7402367067;G:7677976380;T:9534399996;N:4494237 | 150 | 150 | 9798364920 | 7402367067 | 7677976380 | 9534399996 | 4494237 | SRX4781872 | SRS3862064 | SRA787572 | GEO | Life Science, Tsinghua University | 2 | 0.94663 | 0.94701 | 0.06442 | 0.06367 | 0.76264 | 0.7655 | 0.73483 | 0.74221 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2018-10-01 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||
| 49581 | 49581 | SRR7947922 | SRX4781871 | SRS3862063 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | control 6h rna seq rep2 | GSM3409395 | source name:control 6h rna seq rep2|strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:6hpf | control 6h rna seq rep2 | trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | control 6h rna seq rep2 | For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:6hpf | GSM3409395 | GSM3409395: control 6h rna seq rep2; Danio rerio; RNA Seq | GSM3409395 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM3409395 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | HiSeq X Ten | SRP163087 | control_6h_rna-seq_rep2.R1.fastq.gz control_6h_rna-seq_rep2.R2.fastq.gz | fastq fastq | 39198242400.0 | 130660808.0 | GSM3409395 r1 | 0:150 1:150 | A:11268897172;C:8355243125;G:8663182840;T:10907160510;N:3758753 | 150 | 150 | 11268897172 | 8355243125 | 8663182840 | 10907160510 | 3758753 | SRX4781871 | SRS3862063 | SRA787572 | GEO | Life Science, Tsinghua University | 2 | 0.94553 | 0.94591 | 0.09312 | 0.09248 | 0.78098 | 0.78397 | 0.73432 | 0.73781 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2018-10-01 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||
| 49582 | 49582 | SRR7947921 | SRX4781870 | SRS3862062 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | control 6h rna seq rep1 | GSM3409394 | source name:control 6h rna seq rep1|strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:6hpf | control 6h rna seq rep1 | trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | control 6h rna seq rep1 | For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:6hpf | GSM3409394 | GSM3409394: control 6h rna seq rep1; Danio rerio; RNA Seq | GSM3409394 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM3409394 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | HiSeq X Ten | SRP163087 | control_6h_rna-seq_rep1.R1.fastq.gz control_6h_rna-seq_rep1.R2.fastq.gz | fastq fastq | 49781358600.0 | 165937862.0 | GSM3409394 r1 | 0:150 1:150 | A:14340306167;C:10572507738;G:11006666686;T:13855405563;N:6472446 | 150 | 150 | 14340306167 | 10572507738 | 11006666686 | 13855405563 | 6472446 | SRX4781870 | SRS3862062 | SRA787572 | GEO | Life Science, Tsinghua University | 2 | 0.94466 | 0.94506 | 0.09485 | 0.09402 | 0.77782 | 0.78303 | 0.72367 | 0.72791 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2018-10-01 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||
| 49583 | 49583 | SRR7947920 | SRX4781869 | SRS3862061 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | control 4h rna seq rep2 | GSM3409393 | source name:control 4h rna seq rep2|strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:4hpf | control 4h rna seq rep2 | trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | control 4h rna seq rep2 | For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:4hpf | GSM3409393 | GSM3409393: control 4h rna seq rep2; Danio rerio; RNA Seq | GSM3409393 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM3409393 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | HiSeq X Ten | SRP163087 | control_4h_rna-seq_rep2.R1.fastq.gz control_4h_rna-seq_rep2.R2.fastq.gz | fastq fastq | 33462197400.0 | 111540658.0 | GSM3409393 r1 | 0:150 1:150 | A:9246596683;C:7497270682;G:7798285753;T:8916810951;N:3233331 | 150 | 150 | 9246596683 | 7497270682 | 7798285753 | 8916810951 | 3233331 | SRX4781869 | SRS3862061 | SRA787572 | GEO | Life Science, Tsinghua University | 2 | 0.94792 | 0.94861 | 0.0862 | 0.08529 | 0.76084 | 0.76309 | 0.73536 | 0.73703 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2018-10-01 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||
| 49584 | 49584 | SRR7947919 | SRX4781868 | SRS3862060 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | control 4h rna seq rep1 | GSM3409392 | source name:control 4h rna seq rep1|strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:4hpf | control 4h rna seq rep1 | trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | control 4h rna seq rep1 | For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:4hpf | GSM3409392 | GSM3409392: control 4h rna seq rep1; Danio rerio; RNA Seq | GSM3409392 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM3409392 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | HiSeq X Ten | SRP163087 | control_4h_rna-seq_rep1.R1.fastq.gz control_4h_rna-seq_rep1.R2.fastq.gz | fastq fastq | 38719753500.0 | 129065845.0 | GSM3409392 r1 | 0:150 1:150 | A:10763970685;C:8606443742;G:8961006857;T:10383272808;N:5059408 | 150 | 150 | 10763970685 | 8606443742 | 8961006857 | 10383272808 | 5059408 | SRX4781868 | SRS3862060 | SRA787572 | GEO | Life Science, Tsinghua University | 2 | 0.94748 | 0.948 | 0.08608 | 0.08505 | 0.76023 | 0.76357 | 0.72873 | 0.73242 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2018-10-01 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||
| 49585 | 49585 | SRR7947918 | SRX4781867 | SRS3862059 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | control 2h rna seq rep2 | GSM3409391 | source name:control 2h rna seq rep2|strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:2hpf | control 2h rna seq rep2 | trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | control 2h rna seq rep2 | For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:2hpf | GSM3409391 | GSM3409391: control 2h rna seq rep2; Danio rerio; RNA Seq | GSM3409391 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM3409391 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | HiSeq X Ten | SRP163087 | control_2h_rna-seq_rep2.R1.fastq.gz control_2h_rna-seq_rep2.R2.fastq.gz | fastq fastq | 39017750100.0 | 130059167.0 | GSM3409391 r1 | 0:150 1:150 | A:10979134932;C:8549683633;G:8854910977;T:10629254366;N:4766192 | 150 | 150 | 10979134932 | 8549683633 | 8854910977 | 10629254366 | 4766192 | SRX4781867 | SRS3862059 | SRA787572 | GEO | Life Science, Tsinghua University | 2 | 0.94685 | 0.94869 | 0.03416 | 0.03311 | 0.76536 | 0.76731 | 0.65079 | 0.65387 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2018-10-01 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||
| 49586 | 49586 | SRR7947917 | SRX4781866 | SRS3862058 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | control 2h rna seq rep1 | GSM3409390 | source name:control 2h rna seq rep1|strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:2hpf | control 2h rna seq rep1 | trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | control 2h rna seq rep1 | For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:2hpf | GSM3409390 | GSM3409390: control 2h rna seq rep1; Danio rerio; RNA Seq | GSM3409390 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM3409390 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | HiSeq X Ten | SRP163087 | control_2h_rna-seq_rep1.R1.fastq.gz control_2h_rna-seq_rep1.R2.fastq.gz | fastq fastq | 33999089400.0 | 113330298.0 | GSM3409390 r1 | 0:150 1:150 | A:9602786363;C:7418727808;G:7667052932;T:9305137704;N:5384593 | 150 | 150 | 9602786363 | 7418727808 | 7667052932 | 9305137704 | 5384593 | SRX4781866 | SRS3862058 | SRA787572 | GEO | Life Science, Tsinghua University | 2 | 0.94874 | 0.95121 | 0.03388 | 0.03264 | 0.76524 | 0.76662 | 0.65127 | 0.65427 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2018-10-01 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||
| 49587 | 49587 | SRR7947911 | SRX4781863 | SRS3862055 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | shield NAIN3 icSHAPE | GSM3409387 | source name:shield NAIN3|strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:6hpf | shield NAIN3 icSHAPE | Library strategy: icSHAPE icSHAPE computational pipeline reference: PubMedID: 26766114 DOI: 10.1038/nprot.2016.011 trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | shield NAIN3 | For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5 C for 5min. | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:6hpf | GSM3409387 | GSM3409387: shield NAIN3; Danio rerio; OTHER | GSM3409387 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM3409387 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP163087 | shield_NAIN3_rep1.fastq.gz | fastq | 152239039350.0 | 1014926929.0 | GSM3409387 r1 | 0:150 1:0 | A:44641737173;C:38963190534;G:30007693087;T:38607452480;N:18966076 | 150 | 0 | 44641737173 | 38963190534 | 30007693087 | 38607452480 | 18966076 | SRX4781863 | SRS3862055 | SRA787572 | GEO | Life Science, Tsinghua University | 1 | 0.02906 | 0.01259 | 0.97009 | 0.74209 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2018-10-01 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 49588 | 49588 | SRR7947912 | SRX4781863 | SRS3862055 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | shield NAIN3 icSHAPE | GSM3409387 | source name:shield NAIN3|strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:6hpf | shield NAIN3 icSHAPE | Library strategy: icSHAPE icSHAPE computational pipeline reference: PubMedID: 26766114 DOI: 10.1038/nprot.2016.011 trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | shield NAIN3 | For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5 C for 5min. | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:6hpf | GSM3409387 | GSM3409387: shield NAIN3; Danio rerio; OTHER | GSM3409387 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM3409387 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP163087 | loader:latf load | shield_NAIN3_rep2.fastq.gz | fastq | 179520653400.0 | 1196804356.0 | GSM3409387 r2 | 0:150 1:0 | A:48366148973;C:44018616729;G:44760216650;T:42350167763;N:25503285 | 150 | 0 | 48366148973 | 44018616729 | 44760216650 | 42350167763 | 25503285 | SRX4781863 | SRS3862055 | SRA787572 | GEO | Life Science, Tsinghua University | 1 | 0.03361 | 0.01615 | 0.96497 | 0.718 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2018-10-01 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||
| 49589 | 49589 | SRR7947909 | SRX4781862 | SRS3862054 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | shield DMSO icSHAPE | GSM3409386 | source name:shield DMSO|strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:6hpf | shield DMSO icSHAPE | Library strategy: icSHAPE icSHAPE computational pipeline reference: PubMedID: 26766114 DOI: 10.1038/nprot.2016.011 trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | shield DMSO | For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5 C for 5min. | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:6hpf | GSM3409386 | GSM3409386: shield DMSO; Danio rerio; OTHER | GSM3409386 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM3409386 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP163087 | shield_DMSO_rep1.fastq.gz | fastq | 39528129600.0 | 263520864.0 | GSM3409386 r1 | 0:150 1:0 | A:11887790635;C:9698771811;G:8565313614;T:9372993255;N:3260285 | 150 | 0 | 11887790635 | 9698771811 | 8565313614 | 9372993255 | 3260285 | SRX4781862 | SRS3862054 | SRA787572 | GEO | Life Science, Tsinghua University | 1 | 0.06286 | 0.01684 | 0.93336 | 0.718 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2018-10-01 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 49590 | 49590 | SRR7947910 | SRX4781862 | SRS3862054 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | shield DMSO icSHAPE | GSM3409386 | source name:shield DMSO|strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:6hpf | shield DMSO icSHAPE | Library strategy: icSHAPE icSHAPE computational pipeline reference: PubMedID: 26766114 DOI: 10.1038/nprot.2016.011 trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | shield DMSO | For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5 C for 5min. | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:6hpf | GSM3409386 | GSM3409386: shield DMSO; Danio rerio; OTHER | GSM3409386 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM3409386 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP163087 | shield_DMSO_rep2.fastq.gz | fastq | 43632084450.0 | 290880563.0 | GSM3409386 r2 | 0:150 1:0 | A:12666468004;C:10421063446;G:9540808484;T:10977192542;N:26551974 | 150 | 0 | 12666468004 | 10421063446 | 9540808484 | 10977192542 | 26551974 | SRX4781862 | SRS3862054 | SRA787572 | GEO | Life Science, Tsinghua University | 1 | 0.08049 | 0.02275 | 0.91616 | 0.64879 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2018-10-01 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 49591 | 49591 | SRR7947907 | SRX4781861 | SRS3862053 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | sphere NAIN3 icSHAPE | GSM3409385 | source name:sphere NAIN3|strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:4hpf | sphere NAIN3 icSHAPE | Library strategy: icSHAPE icSHAPE computational pipeline reference: PubMedID: 26766114 DOI: 10.1038/nprot.2016.011 trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | sphere NAIN3 | For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5 C for 5min. | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:4hpf | GSM3409385 | GSM3409385: sphere NAIN3; Danio rerio; OTHER | GSM3409385 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM3409385 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP163087 | loader:latf load | sphere_NAIN3_rep1.fastq.gz | fastq | 146089426800.0 | 973929512.0 | GSM3409385 r1 | 0:150 1:0 | A:42514514559;C:39238639903;G:29724694125;T:34595978556;N:15599657 | 150 | 0 | 42514514559 | 39238639903 | 29724694125 | 34595978556 | 15599657 | SRX4781861 | SRS3862053 | SRA787572 | GEO | Life Science, Tsinghua University | 1 | 0.02746 | 0.01225 | 0.97013 | 0.77486 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2018-10-01 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||
| 49592 | 49592 | SRR7947908 | SRX4781861 | SRS3862053 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | sphere NAIN3 icSHAPE | GSM3409385 | source name:sphere NAIN3|strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:4hpf | sphere NAIN3 icSHAPE | Library strategy: icSHAPE icSHAPE computational pipeline reference: PubMedID: 26766114 DOI: 10.1038/nprot.2016.011 trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | sphere NAIN3 | For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5 C for 5min. | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:4hpf | GSM3409385 | GSM3409385: sphere NAIN3; Danio rerio; OTHER | GSM3409385 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM3409385 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP163087 | sphere_NAIN3_rep2.fastq.gz | fastq | 129289327500.0 | 861928850.0 | GSM3409385 r2 | 0:150 1:0 | A:36336840338;C:31424534096;G:31054195778;T:30457153761;N:16603527 | 150 | 0 | 36336840338 | 31424534096 | 31054195778 | 30457153761 | 16603527 | SRX4781861 | SRS3862053 | SRA787572 | GEO | Life Science, Tsinghua University | 1 | 0.02812 | 0.00884 | 0.95887 | 0.7364 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2018-10-01 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 49593 | 49593 | SRR7947905 | SRX4781860 | SRS3862052 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | sphere DMSO icSHAPE | GSM3409384 | source name:sphere DMSO|strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:4hpf | sphere DMSO icSHAPE | Library strategy: icSHAPE icSHAPE computational pipeline reference: PubMedID: 26766114 DOI: 10.1038/nprot.2016.011 trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | sphere DMSO | For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5 C for 5min. | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:4hpf | GSM3409384 | GSM3409384: sphere DMSO; Danio rerio; OTHER | GSM3409384 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM3409384 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP163087 | sphere_DMSO_rep1.fastq.gz | fastq | 57691963050.0 | 384613087.0 | GSM3409384 r1 | 0:150 1:0 | A:16432201667;C:13571913193;G:12837196407;T:14845080025;N:5571758 | 150 | 0 | 16432201667 | 13571913193 | 12837196407 | 14845080025 | 5571758 | SRX4781860 | SRS3862052 | SRA787572 | GEO | Life Science, Tsinghua University | 1 | 0.1036 | 0.01136 | 0.87645 | 0.65935 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2018-10-01 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 49594 | 49594 | SRR7947906 | SRX4781860 | SRS3862052 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | sphere DMSO icSHAPE | GSM3409384 | source name:sphere DMSO|strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:4hpf | sphere DMSO icSHAPE | Library strategy: icSHAPE icSHAPE computational pipeline reference: PubMedID: 26766114 DOI: 10.1038/nprot.2016.011 trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | sphere DMSO | For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5 C for 5min. | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:4hpf | GSM3409384 | GSM3409384: sphere DMSO; Danio rerio; OTHER | GSM3409384 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM3409384 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP163087 | sphere_DMSO_rep2.fastq.gz | fastq | 67804917750.0 | 452032785.0 | GSM3409384 r2 | 0:150 1:0 | A:18522337687;C:17556962469;G:15356031761;T:16361409956;N:8175877 | 150 | 0 | 18522337687 | 17556962469 | 15356031761 | 16361409956 | 8175877 | SRX4781860 | SRS3862052 | SRA787572 | GEO | Life Science, Tsinghua University | 1 | 0.04269 | 0.00601 | 0.92652 | 0.69825 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2018-10-01 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 49595 | 49595 | SRR7947903 | SRX4781859 | SRS3862051 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | 2h NAIN3 icSHAPE | GSM3409383 | source name:2h NAIN3|strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:2hpf | 2h NAIN3 icSHAPE | Library strategy: icSHAPE icSHAPE computational pipeline reference: PubMedID: 26766114 DOI: 10.1038/nprot.2016.011 trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | 2h NAIN3 | For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5 C for 5min. | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:2hpf | GSM3409383 | GSM3409383: 2h NAIN3; Danio rerio; OTHER | GSM3409383 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM3409383 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP163087 | 2h_NAIN3_rep1.fastq.gz | fastq | 124853039850.0 | 832353599.0 | GSM3409383 r1 | 0:150 1:0 | A:37867788703;C:28959738468;G:28543301824;T:29453073564;N:29137291 | 150 | 0 | 37867788703 | 28959738468 | 28543301824 | 29453073564 | 29137291 | SRX4781859 | SRS3862051 | SRA787572 | GEO | Life Science, Tsinghua University | 1 | 0.03381 | 0.00848 | 0.94479 | 0.68089 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2018-10-01 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 49596 | 49596 | SRR7947904 | SRX4781859 | SRS3862051 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | 2h NAIN3 icSHAPE | GSM3409383 | source name:2h NAIN3|strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:2hpf | 2h NAIN3 icSHAPE | Library strategy: icSHAPE icSHAPE computational pipeline reference: PubMedID: 26766114 DOI: 10.1038/nprot.2016.011 trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | 2h NAIN3 | For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5 C for 5min. | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:2hpf | GSM3409383 | GSM3409383: 2h NAIN3; Danio rerio; OTHER | GSM3409383 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM3409383 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP163087 | loader:latf load | 2h_NAIN3_rep2.fastq.gz | fastq | 159060679200.0 | 1060404528.0 | GSM3409383 r2 | 0:150 1:0 | A:45617471657;C:38274494766;G:38676362132;T:36414708832;N:77641813 | 150 | 0 | 45617471657 | 38274494766 | 38676362132 | 36414708832 | 77641813 | SRX4781859 | SRS3862051 | SRA787572 | GEO | Life Science, Tsinghua University | 1 | 0.03227 | 0.01386 | 0.96081 | 0.70955 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2018-10-01 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||
| 49597 | 49597 | SRR7947901 | SRX4781858 | SRS3862049 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | 2h DMSO icSHAPE | GSM3409382 | source name:2h DMSO|strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:2hpf | 2h DMSO icSHAPE | Library strategy: icSHAPE icSHAPE computational pipeline reference: PubMedID: 26766114 DOI: 10.1038/nprot.2016.011 trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | 2h DMSO | For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5 C for 5min. | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:2hpf | GSM3409382 | GSM3409382: 2h DMSO; Danio rerio; OTHER | GSM3409382 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM3409382 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP163087 | 2h_DMSO_rep1.fastq.gz | fastq | 33202617900.0 | 221350786.0 | GSM3409382 r1 | 0:150 1:0 | A:9125761193;C:9027862202;G:7094595163;T:7949637340;N:4762002 | 150 | 0 | 9125761193 | 9027862202 | 7094595163 | 7949637340 | 4762002 | SRX4781858 | SRS3862049 | SRA787572 | GEO | Life Science, Tsinghua University | 1 | 0.05426 | 0.01047 | 0.92322 | 0.74332 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2018-10-01 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 49598 | 49598 | SRR7947902 | SRX4781858 | SRS3862049 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | 2h DMSO icSHAPE | GSM3409382 | source name:2h DMSO|strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:2hpf | 2h DMSO icSHAPE | Library strategy: icSHAPE icSHAPE computational pipeline reference: PubMedID: 26766114 DOI: 10.1038/nprot.2016.011 trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | 2h DMSO | For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5 C for 5min. | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:2hpf | GSM3409382 | GSM3409382: 2h DMSO; Danio rerio; OTHER | GSM3409382 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM3409382 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP163087 | 2h_DMSO_rep2.fastq.gz | fastq | 48461244300.0 | 323074962.0 | GSM3409382 r2 | 0:150 1:0 | A:14458403614;C:11285495528;G:10770012549;T:11944151781;N:3180828 | 150 | 0 | 14458403614 | 11285495528 | 10770012549 | 11944151781 | 3180828 | SRX4781858 | SRS3862049 | SRA787572 | GEO | Life Science, Tsinghua University | 1 | 0.05259 | 0.01006 | 0.93206 | 0.75282 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2018-10-01 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 49599 | 49599 | SRR7947899 | SRX4781857 | SRS3862050 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | 4 cell NAIN3 icSHAPE | GSM3409381 | source name:4 cell NAIN3|strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:1hpf | 4 cell NAIN3 icSHAPE | Library strategy: icSHAPE icSHAPE computational pipeline reference: PubMedID: 26766114 DOI: 10.1038/nprot.2016.011 trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | 4 cell NAIN3 | For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5 C for 5min. | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:1hpf | GSM3409381 | GSM3409381: 4 cell NAIN3; Danio rerio; OTHER | GSM3409381 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM3409381 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP163087 | 4-cell_NAIN3_rep1.fastq.gz | fastq | 125465584950.0 | 836437233.0 | GSM3409381 r1 | 0:150 1:0 | A:38241494342;C:30192135809;G:25141580458;T:31866971314;N:23403027 | 150 | 0 | 38241494342 | 30192135809 | 25141580458 | 31866971314 | 23403027 | SRX4781857 | SRS3862050 | SRA787572 | GEO | Life Science, Tsinghua University | 1 | 0.02986 | 0.00805 | 0.9498 | 0.69733 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2018-10-01 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 49600 | 49600 | SRR7947900 | SRX4781857 | SRS3862050 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | 4 cell NAIN3 icSHAPE | GSM3409381 | source name:4 cell NAIN3|strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:1hpf | 4 cell NAIN3 icSHAPE | Library strategy: icSHAPE icSHAPE computational pipeline reference: PubMedID: 26766114 DOI: 10.1038/nprot.2016.011 trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | 4 cell NAIN3 | For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5 C for 5min. | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:1hpf | GSM3409381 | GSM3409381: 4 cell NAIN3; Danio rerio; OTHER | GSM3409381 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM3409381 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP163087 | 4-cell_NAIN3_rep2.fastq.gz | fastq | 124831078200.0 | 832207188.0 | GSM3409381 r2 | 0:150 1:0 | A:37122083059;C:30832904838;G:28247183546;T:28612305554;N:16601203 | 150 | 0 | 37122083059 | 30832904838 | 28247183546 | 28612305554 | 16601203 | SRX4781857 | SRS3862050 | SRA787572 | GEO | Life Science, Tsinghua University | 1 | 0.04217 | 0.01947 | 0.95542 | 0.71549 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2018-10-01 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 49601 | 49601 | SRR7947897 | SRX4781856 | SRS3862048 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | 4 cell DMSO icSHAPE | GSM3409380 | source name:4 cell DMSO|strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:1hpf | 4 cell DMSO icSHAPE | Library strategy: icSHAPE icSHAPE computational pipeline reference: PubMedID: 26766114 DOI: 10.1038/nprot.2016.011 trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | 4 cell DMSO | For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5 C for 5min. | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:1hpf | GSM3409380 | GSM3409380: 4 cell DMSO; Danio rerio; OTHER | GSM3409380 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM3409380 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP163087 | 4-cell_DMSO_rep1.fastq.gz | fastq | 36427183500.0 | 242847890.0 | GSM3409380 r1 | 0:150 1:0 | A:10144008700;C:9612700528;G:7003058984;T:9662936070;N:4479218 | 150 | 0 | 10144008700 | 9612700528 | 7003058984 | 9662936070 | 4479218 | SRX4781856 | SRS3862048 | SRA787572 | GEO | Life Science, Tsinghua University | 1 | 0.02972 | 0.00598 | 0.94998 | 0.74592 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2018-10-01 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures |
Advanced export
JSON shape: default, array, newline-delimited
CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;