RNAquarium Metadata Server
Institute Website Terms of Use Privacy Policy

run_metadata

31 rows where experiment.platform = "ILLUMINA", technology = "generic-scrnaseq-only" and tissue_curation_coarse = "Reproductive System"

✎ View and edit SQL

This data as json, CSV (advanced)

experiment.library_selection 4

devstage_curation 4

experiment.library_strategy 3

devstage_curation_coarse 3

tissue_curation 2

experiment.library_source 2

experiment.library_layout 2

tissue_curation_coarse 1

  • Reproductive System · 31 ✖

technology 1

  • generic-scrnaseq-only · 31 ✖

experiment.platform 1

  • ILLUMINA · 31 ✖
Link rowid ▼ run.accession experiment.accession sample.accession study.accession bioproject study.title study.alias study.type study.abstract study.attributes study.PMIDs sample.description sample.title sample.alias sample.centername sample.attributes GEOsample.title GEOsample.dataprocessing GEOsample.source GEOsample.treatmentprotocol GEOsample.extractprotocol GEOsample.growthprotocol GEOsample.characteristics GEOsample.accession experiment.title experiment.alias experiment.library_name experiment.design_description experiment.library_construction_protocol experiment.attributes experiment.library_strategy experiment.library_source experiment.library_selection experiment.library_layout experiment.platform experiment.instrument_model experiment.spot_descriptor experiment.study_ref run.title run.attributes run.filename run.semantic_name run.total_bases run.total_spots run.alias run.read_lengths run.base_counts run.r1_length run.r2_length run.r3_length run.r4_length run.Acount run.Ccount run.Gcount run.Tcount run.Ncount run.experiment run.pool_member submission.accession submission.srasource submission.bioprojectsource seqdetective.n_mates seqdetective.mapping_rate.mate1 seqdetective.mapping_rate.mate2 seqdetective.nofeature_rate.mate1 seqdetective.nofeature_rate.mate2 seqdetective.sparsity.mate1 seqdetective.sparsity.mate2 seqdetective.pos_strand_rate.mate1 seqdetective.pos_strand_rate.mate2 seqdetective.readlen.mate1 seqdetective.readlen.mate2 seqdetective.judgement.mate1 seqdetective.judgement.mate2 seqdetective.judgement.reason platform_family instrument_generation read_bias selection_class prep_kit sc_or_bulk tech_class technology tech_variant submission.bioprojectsource.country earliest_date devstage_curation devstage_curation_coarse tissue_curation tissue_curation_coarse
40701 40701 SRR3231363 SRX1637111 SRS1342926 SRP071849 PRJNA315400 Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [RIP Seq] GSE79161 Transcriptome Analysis Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: RNA was extracted from ovary tissue or from RIP experiments by Trizol extraction. parent bioproject:PRJNA315403 pubmed:30086300   Input 3 GSM2087141   tissue:Zebrafish Zygotes|fraction:Input Input 3 Reads were mapped to Zv9 using tophat trapnell et al 2009to the ENSEMBLE gene build and further processing of the read counts was performed using Deseq Anders et al 2009 Genome build: zv9 Supplementary files format and content: The mRNA counts.csv contains the DESeq normalized read counts per Ensemble gene as indicated. Headers indicate the sample name. Zebrafish Zygotes   mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing. Zebrafish were maintained under standard conditions. fraction:Input GSM2087141 GSM2087141: Input 3; Danio rerio; RIP Seq GSM2087141   1 mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing. GEO Accession:GSM2087141 RIP-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2000   SRP071849     WT_Input_3.fastq.gz fastq 1902296226.0 37299926.0 GSM2087141 r1 0:51 A:466290166;C:465344039;G:486942278;T:483240280;N:479463 51       466290166 465344039 486942278 483240280 479463 SRX1637111 SRS1342926 SRA385813 GEO Rene Ketting, RNA silencing, IMB 1 0.85793   0.14814   0.79941   0.55214   51   B   usable mapping rate illumina hiseq_era unknown other unknown sc_generic single_cell_generic generic-scrnaseq-only   Germany 2016-03-13 Zygote Embryo Oocyte Reproductive System
40702 40702 SRR3231362 SRX1637110 SRS1342927 SRP071849 PRJNA315400 Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [RIP Seq] GSE79161 Transcriptome Analysis Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: RNA was extracted from ovary tissue or from RIP experiments by Trizol extraction. parent bioproject:PRJNA315403 pubmed:30086300   Input 2 GSM2087140   tissue:Zebrafish Zygotes|fraction:Input Input 2 Reads were mapped to Zv9 using tophat trapnell et al 2009to the ENSEMBLE gene build and further processing of the read counts was performed using Deseq Anders et al 2009 Genome build: zv9 Supplementary files format and content: The mRNA counts.csv contains the DESeq normalized read counts per Ensemble gene as indicated. Headers indicate the sample name. Zebrafish Zygotes   mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing. Zebrafish were maintained under standard conditions. fraction:Input GSM2087140 GSM2087140: Input 2; Danio rerio; RIP Seq GSM2087140   1 mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing. GEO Accession:GSM2087140 RIP-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2000   SRP071849     WT_Input_2.fastq.gz fastq 1540737999.0 30210549.0 GSM2087140 r1 0:51 A:380481772;C:379741192;G:395453141;T:384675313;N:386581 51       380481772 379741192 395453141 384675313 386581 SRX1637110 SRS1342927 SRA385813 GEO Rene Ketting, RNA silencing, IMB 1 0.8787   0.14935   0.79202   0.54381   51   B   usable mapping rate illumina hiseq_era unknown other unknown sc_generic single_cell_generic generic-scrnaseq-only   Germany 2016-03-13 Zygote Embryo Oocyte Reproductive System
40703 40703 SRR3231361 SRX1637109 SRS1342928 SRP071849 PRJNA315400 Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [RIP Seq] GSE79161 Transcriptome Analysis Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: RNA was extracted from ovary tissue or from RIP experiments by Trizol extraction. parent bioproject:PRJNA315403 pubmed:30086300   Input 1 GSM2087139   tissue:Zebrafish Zygotes|fraction:Input Input 1 Reads were mapped to Zv9 using tophat trapnell et al 2009to the ENSEMBLE gene build and further processing of the read counts was performed using Deseq Anders et al 2009 Genome build: zv9 Supplementary files format and content: The mRNA counts.csv contains the DESeq normalized read counts per Ensemble gene as indicated. Headers indicate the sample name. Zebrafish Zygotes   mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing. Zebrafish were maintained under standard conditions. fraction:Input GSM2087139 GSM2087139: Input 1; Danio rerio; RIP Seq GSM2087139   1 mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing. GEO Accession:GSM2087139 RIP-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2000   SRP071849     WT_Input_1.fastq.gz fastq 1109818905.0 21761155.0 GSM2087139 r1                       SRX1637109 SRS1342928 SRA385813 GEO Rene Ketting, RNA silencing, IMB 1 0.87467   0.18794   0.79411   0.63378   51   B   usable mapping rate illumina hiseq_era unknown other unknown sc_generic single_cell_generic generic-scrnaseq-only   Germany 2016-03-13 Zygote Embryo Oocyte Reproductive System
40704 40704 SRR3231360 SRX1637108 SRS1342929 SRP071849 PRJNA315400 Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [RIP Seq] GSE79161 Transcriptome Analysis Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: RNA was extracted from ovary tissue or from RIP experiments by Trizol extraction. parent bioproject:PRJNA315403 pubmed:30086300   Tdrd6a IP 3 GSM2087138   tissue:Zebrafish Zygotes|fraction:Tdrd6a IP Tdrd6a IP 3 Reads were mapped to Zv9 using tophat trapnell et al 2009to the ENSEMBLE gene build and further processing of the read counts was performed using Deseq Anders et al 2009 Genome build: zv9 Supplementary files format and content: The mRNA counts.csv contains the DESeq normalized read counts per Ensemble gene as indicated. Headers indicate the sample name. Zebrafish Zygotes   mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing. Zebrafish were maintained under standard conditions. fraction:Tdrd6a IP GSM2087138 GSM2087138: Tdrd6a IP 3; Danio rerio; RIP Seq GSM2087138   1 mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing. GEO Accession:GSM2087138 RIP-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2000   SRP071849     WT_Tdrd6a_IP_3.fastq.gz fastq 843641439.0 16541989.0 GSM2087138 r1 0:51 A:216465581;C:196892096;G:207722567;T:222361382;N:199813 51       216465581 196892096 207722567 222361382 199813 SRX1637108 SRS1342929 SRA385813 GEO Rene Ketting, RNA silencing, IMB 1 0.84615   0.08957   0.78768   0.50612   51   B   usable mapping rate illumina hiseq_era unknown other unknown sc_generic single_cell_generic generic-scrnaseq-only   Germany 2016-03-13 Zygote Embryo Oocyte Reproductive System
40705 40705 SRR3231359 SRX1637107 SRS1342930 SRP071849 PRJNA315400 Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [RIP Seq] GSE79161 Transcriptome Analysis Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: RNA was extracted from ovary tissue or from RIP experiments by Trizol extraction. parent bioproject:PRJNA315403 pubmed:30086300   Tdrd6a IP 2 GSM2087137   tissue:Zebrafish Zygotes|fraction:Tdrd6a IP Tdrd6a IP 2 Reads were mapped to Zv9 using tophat trapnell et al 2009to the ENSEMBLE gene build and further processing of the read counts was performed using Deseq Anders et al 2009 Genome build: zv9 Supplementary files format and content: The mRNA counts.csv contains the DESeq normalized read counts per Ensemble gene as indicated. Headers indicate the sample name. Zebrafish Zygotes   mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing. Zebrafish were maintained under standard conditions. fraction:Tdrd6a IP GSM2087137 GSM2087137: Tdrd6a IP 2; Danio rerio; RIP Seq GSM2087137   1 mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing. GEO Accession:GSM2087137 RIP-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2000   SRP071849     WT_Tdrd6a_IP_2.fastq.gz fastq 391198050.0 7670550.0 GSM2087137 r1 0:51 A:99015594;C:91525929;G:97155710;T:103371571;N:129246 51       99015594 91525929 97155710 103371571 129246 SRX1637107 SRS1342930 SRA385813 GEO Rene Ketting, RNA silencing, IMB 1 0.85778   0.12015   0.80515   0.47541   51   B   usable mapping rate illumina hiseq_era unknown other unknown sc_generic single_cell_generic generic-scrnaseq-only   Germany 2016-03-13 Zygote Embryo Oocyte Reproductive System
40706 40706 SRR3231358 SRX1637106 SRS1342931 SRP071849 PRJNA315400 Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [RIP Seq] GSE79161 Transcriptome Analysis Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: RNA was extracted from ovary tissue or from RIP experiments by Trizol extraction. parent bioproject:PRJNA315403 pubmed:30086300   Tdrd6a IP 1 GSM2087136   tissue:Zebrafish Zygotes|fraction:Tdrd6a IP Tdrd6a IP 1 Reads were mapped to Zv9 using tophat trapnell et al 2009to the ENSEMBLE gene build and further processing of the read counts was performed using Deseq Anders et al 2009 Genome build: zv9 Supplementary files format and content: The mRNA counts.csv contains the DESeq normalized read counts per Ensemble gene as indicated. Headers indicate the sample name. Zebrafish Zygotes   mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing. Zebrafish were maintained under standard conditions. fraction:Tdrd6a IP GSM2087136 GSM2087136: Tdrd6a IP 1; Danio rerio; RIP Seq GSM2087136   1 mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing. GEO Accession:GSM2087136 RIP-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2000   SRP071849     WT_Tdrd6a_IP_1.fastq.gz fastq 1927415052.0 37792452.0 GSM2087136 r1 0:51 A:498125298;C:444860381;G:468826607;T:515142356;N:460410 51       498125298 444860381 468826607 515142356 460410 SRX1637106 SRS1342931 SRA385813 GEO Rene Ketting, RNA silencing, IMB 1 0.86194   0.09753   0.80146   0.47808   51   B   usable mapping rate illumina hiseq_era unknown other unknown sc_generic single_cell_generic generic-scrnaseq-only   Germany 2016-03-13 Zygote Embryo Oocyte Reproductive System
44967 44967 SRR6345660 SRX3442976 SRS2733636 SRP126106 PRJNA421016 Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA] GSE107682 Transcriptome Analysis Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish. parent bioproject:PRJNA315403 pubmed:30086300   smRNA seq library of ovary from tdrd6a mut fish GSM2875719   source name:Ovary from tdrd6a mut fish|tissue:whole ovary|genotype:tdrd6a mutant smRNA seq library of ovary from tdrd6a mut fish 1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15  6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.    8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.  Supplementary files format and content: Files ending in .bw are bigwig tracks. Ovary from tdrd6a mut fish   RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation   tissue:whole ovary|genotype:tdrd6a mutant GSM2875719 GSM2875719: smRNA seq library of ovary from tdrd6a mut fish; Danio rerio; ncRNA Seq GSM2875719   1 RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation GEO Accession:GSM2875719 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP126106     Tdrd6a-mut-ovary-input-Adult.fastq.gz fastq 817885062.0 16036962.0 GSM2875719 r1 0:51 A:212456064;C:163491733;G:233627239;T:208262707;N:47319 51       212456064 163491733 233627239 208262707 47319 SRX3442976 SRS2733636 SRA636010 GEO Rene Ketting, RNA silencing, IMB 1 0.46308   0.13668   0.83587   0.79104   51   B   usable mapping rate illumina hiseq_era 5prime size_fractionation unknown sc_generic single_cell_generic generic-scrnaseq-only   Germany 2017-12-04 Undetermined Undetermined Gonad Reproductive System
44968 44968 SRR6345659 SRX3442975 SRS2733637 SRP126106 PRJNA421016 Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA] GSE107682 Transcriptome Analysis Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish. parent bioproject:PRJNA315403 pubmed:30086300   smRNA seq library of ovary from tdrd6a het fish GSM2875718   source name:Ovary from tdrd6a het fish|tissue:whole ovary|genotype:tdrd6a heterozygous smRNA seq library of ovary from tdrd6a het fish 1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15  6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.    8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.  Supplementary files format and content: Files ending in .bw are bigwig tracks. Ovary from tdrd6a het fish   RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation   tissue:whole ovary|genotype:tdrd6a heterozygous GSM2875718 GSM2875718: smRNA seq library of ovary from tdrd6a het fish; Danio rerio; ncRNA Seq GSM2875718   1 RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation GEO Accession:GSM2875718 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP126106     Tdrd6a-het-ovary-input-Adult.fastq.gz fastq 1452353571.0 28477521.0 GSM2875718 r1 0:51 A:397993735;C:284194126;G:396142390;T:373939235;N:84085 51       397993735 284194126 396142390 373939235 84085 SRX3442975 SRS2733637 SRA636010 GEO Rene Ketting, RNA silencing, IMB 1 0.3869   0.1369   0.86397   0.77165   51   B   usable mapping rate illumina hiseq_era 5prime size_fractionation unknown sc_generic single_cell_generic generic-scrnaseq-only   Germany 2017-12-04 Undetermined Undetermined Gonad Reproductive System
44969 44969 SRR6345658 SRX3442974 SRS2733632 SRP126106 PRJNA421016 Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA] GSE107682 Transcriptome Analysis Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish. parent bioproject:PRJNA315403 pubmed:30086300   smRNA seq library of late oocytes from tdrd6a hett fish GSM2875717   source name:late oocytes from tdrd6a hett fish|tissue:late oocytes|genotype:tdrd6a heterozygous smRNA seq library of late oocytes from tdrd6a hett fish 1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15  6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.    8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.  Supplementary files format and content: Files ending in .bw are bigwig tracks. late oocytes from tdrd6a hett fish   RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation   tissue:late oocytes|genotype:tdrd6a heterozygous GSM2875717 GSM2875717: smRNA seq library of late oocytes from tdrd6a hett fish; Danio rerio; ncRNA Seq GSM2875717   1 RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation GEO Accession:GSM2875717 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP126106     tdrd6a-het_oocytes-late-input.fastq.gz fastq 1884769630.0 28130890.0 GSM2875717 r1 0:67 A:519051884;C:437635381;G:510738306;T:417295309;N:48750 67       519051884 437635381 510738306 417295309 48750 SRX3442974 SRS2733632 SRA636010 GEO Rene Ketting, RNA silencing, IMB 1 0.17778   0.06655   0.95931   0.91529   67   B   usable mapping rate illumina hiseq_era 5prime size_fractionation unknown sc_generic single_cell_generic generic-scrnaseq-only   Germany 2017-12-04 Zygote Embryo Oocyte Reproductive System
44970 44970 SRR6345657 SRX3442973 SRS2733634 SRP126106 PRJNA421016 Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA] GSE107682 Transcriptome Analysis Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish. parent bioproject:PRJNA315403 pubmed:30086300   smRNA seq library of early oocytes from tdrd6a mut fish GSM2875716   source name:early oocytes from tdrd6a mut fish|tissue:early oocytes|genotype:tdrd6a mutant smRNA seq library of early oocytes from tdrd6a mut fish 1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15  6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.    8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.  Supplementary files format and content: Files ending in .bw are bigwig tracks. early oocytes from tdrd6a mut fish   RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation   tissue:early oocytes|genotype:tdrd6a mutant GSM2875716 GSM2875716: smRNA seq library of early oocytes from tdrd6a mut fish; Danio rerio; ncRNA Seq GSM2875716   1 RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation GEO Accession:GSM2875716 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP126106     tdrd6a-mut_oocytes-early-input.fastq.gz fastq 2102216723.0 31376369.0 GSM2875716 r1 0:67 A:592618102;C:472348913;G:550028898;T:487165955;N:54855 67       592618102 472348913 550028898 487165955 54855 SRX3442973 SRS2733634 SRA636010 GEO Rene Ketting, RNA silencing, IMB 1 0.08293   0.04595   0.96193   0.77321   67   B   usable mapping rate illumina hiseq_era 5prime size_fractionation unknown sc_generic single_cell_generic generic-scrnaseq-only   Germany 2017-12-04 Zygote Embryo Oocyte Reproductive System
44971 44971 SRR6345656 SRX3442972 SRS2733635 SRP126106 PRJNA421016 Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA] GSE107682 Transcriptome Analysis Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish. parent bioproject:PRJNA315403 pubmed:30086300   smRNA seq library of late oocytes from tdrd6a mut fish GSM2875715   source name:late oocytes from tdrd6a mut fish|tissue:late oocytes|genotype:tdrd6a mutant smRNA seq library of late oocytes from tdrd6a mut fish 1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15  6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.    8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.  Supplementary files format and content: Files ending in .bw are bigwig tracks. late oocytes from tdrd6a mut fish   RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation   tissue:late oocytes|genotype:tdrd6a mutant GSM2875715 GSM2875715: smRNA seq library of late oocytes from tdrd6a mut fish; Danio rerio; ncRNA Seq GSM2875715   1 RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation GEO Accession:GSM2875715 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP126106     tdrd6a-mut_oocytes-late-input.fastq.gz fastq 2110760295.0 31503885.0 GSM2875715 r1 0:67 A:582021495;C:486821539;G:582933348;T:458929133;N:54780 67       582021495 486821539 582933348 458929133 54780 SRX3442972 SRS2733635 SRA636010 GEO Rene Ketting, RNA silencing, IMB 1 0.17064   0.06728   0.96173   0.9114   67   B   usable mapping rate illumina hiseq_era 5prime size_fractionation unknown sc_generic single_cell_generic generic-scrnaseq-only   Germany 2017-12-04 Zygote Embryo Oocyte Reproductive System
44972 44972 SRR6345655 SRX3442971 SRS2733633 SRP126106 PRJNA421016 Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA] GSE107682 Transcriptome Analysis Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish. parent bioproject:PRJNA315403 pubmed:30086300   smRNA seq library of early oocytes from tdrd6a het fish GSM2875714   source name:early oocytes from tdrd6a het fish|tissue:Early oocytes|genotype:tdrd6a heterozygous smRNA seq library of early oocytes from tdrd6a het fish 1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15  6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.    8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.  Supplementary files format and content: Files ending in .bw are bigwig tracks. early oocytes from tdrd6a het fish   RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation   tissue:Early oocytes|genotype:tdrd6a heterozygous GSM2875714 GSM2875714: smRNA seq library of early oocytes from tdrd6a het fish; Danio rerio; ncRNA Seq GSM2875714   1 RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation GEO Accession:GSM2875714 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP126106     tdrd6a-het_oocytes-early-input.fastq.gz fastq 2243425655.0 33483965.0 GSM2875714 r1 0:67 A:633468129;C:503239215;G:592089295;T:514571679;N:57337 67       633468129 503239215 592089295 514571679 57337 SRX3442971 SRS2733633 SRA636010 GEO Rene Ketting, RNA silencing, IMB 1 0.06641   0.04254   0.96806   0.58509   67   B   usable mapping rate illumina hiseq_era 5prime size_fractionation unknown sc_generic single_cell_generic generic-scrnaseq-only   Germany 2017-12-04 Zygote Embryo Oocyte Reproductive System
64217 64217 SRR14343411 SRX10697276 SRS8786690 SRP316710 PRJNA725806 foxl2l regulates female meiotic entry during juvenile gonadal development in zebrafish GSE173480 Transcriptome Analysis Sex determination is distinct from development of other organs for its diversity among species. In zebrafish the sex determination in juvenile stage could be hermaphroditic or gonochoristic. However the detail mechanism is still unclear. Here in this study we found that the transcription factor that belongs to forkhead box family Foxl2l is required for determination of female fate in zebrafish. Foxl2l was expressed from larva stage and became female bias in juvenile stage. The expression was restricted in pre meiotic germ cells. Disruption of Foxl2l function by CRISPR/Cas9 system resulted in all male phenotype in the mutant. Germ cells in foxl2l mutant were arrested in pre meiotic stage at 21 dpf the critical period for female meiotic entry. To further verify the downstream mechanism of Foxl2l on female sex determination wildtype or foxl2l mutant germ cells labeled by foxl2l:egfp at 21 dpf dpf and germ cells labeled by ziwi:egfp at 26 dpf were analyzed by RNA seq and single cell RNA seq respectively Overall design: Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. and RNA sequencing was performed by Illumina NextSeq 500. Each genotype contained triple samples.       HO 3 GSM5268475   tissue:gonad|strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l / |age:21 dpf HO 3 Sequenced data was analyzed by NextSeq Control Software 2.2.0 The de multiplexing adaptor removal and FASTQ file transformation were performed by bcl2fastq Conversion Software 2.17 Illumina Inc. The FASTQ files were imported into CLC Genomics Workbench v.11.0.1 QIAGEN to remove low quality reads including reads with lengths less than 30 nucleotides or with Phred quality score lower than 20 The trimmed reads were mapped to zebrafish genome GRCz11 and TPM were calculated by CLC Genomics Workbench v.11.0.1 QIAGEN Genome build: GRCz11 Supplementary files format and content: txt files contain expression data for all cells gonad   Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols.   strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l / |age:21 dpf GSM5268475 GSM5268475: HO 3; Danio rerio; RNA Seq GSM5268475   1 Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols. GEO Accession:GSM5268475 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP316710     HO_3_run1.R1.fastq HO_3_run1.R2.fastq fastq fastq 3534673132.0 24300429.0 GSM5268475 r1 0:72.72 1:72.74 A:983413722;C:772614472;G:797390978;T:980739251;N:514709 72 72     983413722 772614472 797390978 980739251 514709 SRX10697276 SRS8786690 SRA1224866 GEO Institute of Molecular Biology, Academia Sinica 2 0.92009 0.92081 0.07189 0.07113 0.66176 0.66502 0.48304 0.4818 76 76 B B biological fallback assumption illumina nextseq unknown cdna_unspecified nextera sc_generic single_cell_generic generic-scrnaseq-only   Taiwan 2021-04-28 Larval Larval Gonad Reproductive System
64218 64218 SRR14343412 SRX10697276 SRS8786690 SRP316710 PRJNA725806 foxl2l regulates female meiotic entry during juvenile gonadal development in zebrafish GSE173480 Transcriptome Analysis Sex determination is distinct from development of other organs for its diversity among species. In zebrafish the sex determination in juvenile stage could be hermaphroditic or gonochoristic. However the detail mechanism is still unclear. Here in this study we found that the transcription factor that belongs to forkhead box family Foxl2l is required for determination of female fate in zebrafish. Foxl2l was expressed from larva stage and became female bias in juvenile stage. The expression was restricted in pre meiotic germ cells. Disruption of Foxl2l function by CRISPR/Cas9 system resulted in all male phenotype in the mutant. Germ cells in foxl2l mutant were arrested in pre meiotic stage at 21 dpf the critical period for female meiotic entry. To further verify the downstream mechanism of Foxl2l on female sex determination wildtype or foxl2l mutant germ cells labeled by foxl2l:egfp at 21 dpf dpf and germ cells labeled by ziwi:egfp at 26 dpf were analyzed by RNA seq and single cell RNA seq respectively Overall design: Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. and RNA sequencing was performed by Illumina NextSeq 500. Each genotype contained triple samples.       HO 3 GSM5268475   tissue:gonad|strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l / |age:21 dpf HO 3 Sequenced data was analyzed by NextSeq Control Software 2.2.0 The de multiplexing adaptor removal and FASTQ file transformation were performed by bcl2fastq Conversion Software 2.17 Illumina Inc. The FASTQ files were imported into CLC Genomics Workbench v.11.0.1 QIAGEN to remove low quality reads including reads with lengths less than 30 nucleotides or with Phred quality score lower than 20 The trimmed reads were mapped to zebrafish genome GRCz11 and TPM were calculated by CLC Genomics Workbench v.11.0.1 QIAGEN Genome build: GRCz11 Supplementary files format and content: txt files contain expression data for all cells gonad   Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols.   strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l / |age:21 dpf GSM5268475 GSM5268475: HO 3; Danio rerio; RNA Seq GSM5268475   1 Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols. GEO Accession:GSM5268475 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP316710     HO_3_run2.R1.fastq HO_3_run2.R2.fastq fastq fastq 3789665865.0 25970236.0 GSM5268475 r2 0:72.95 1:72.97 A:1055034390;C:825452326;G:851854221;T:1054834294;N:2490634 72 72     1055034390 825452326 851854221 1054834294 2490634 SRX10697276 SRS8786690 SRA1224866 GEO Institute of Molecular Biology, Academia Sinica 2 0.92122 0.92134 0.07291 0.07232 0.66346 0.66649 0.48355 0.48092 74 74 B B biological fallback assumption illumina nextseq unknown cdna_unspecified nextera sc_generic single_cell_generic generic-scrnaseq-only   Taiwan 2021-04-28 Larval Larval Gonad Reproductive System
64219 64219 SRR14343409 SRX10697275 SRS8786689 SRP316710 PRJNA725806 foxl2l regulates female meiotic entry during juvenile gonadal development in zebrafish GSE173480 Transcriptome Analysis Sex determination is distinct from development of other organs for its diversity among species. In zebrafish the sex determination in juvenile stage could be hermaphroditic or gonochoristic. However the detail mechanism is still unclear. Here in this study we found that the transcription factor that belongs to forkhead box family Foxl2l is required for determination of female fate in zebrafish. Foxl2l was expressed from larva stage and became female bias in juvenile stage. The expression was restricted in pre meiotic germ cells. Disruption of Foxl2l function by CRISPR/Cas9 system resulted in all male phenotype in the mutant. Germ cells in foxl2l mutant were arrested in pre meiotic stage at 21 dpf the critical period for female meiotic entry. To further verify the downstream mechanism of Foxl2l on female sex determination wildtype or foxl2l mutant germ cells labeled by foxl2l:egfp at 21 dpf dpf and germ cells labeled by ziwi:egfp at 26 dpf were analyzed by RNA seq and single cell RNA seq respectively Overall design: Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. and RNA sequencing was performed by Illumina NextSeq 500. Each genotype contained triple samples.       HO 2 GSM5268474   tissue:gonad|strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l / |age:21 dpf HO 2 Sequenced data was analyzed by NextSeq Control Software 2.2.0 The de multiplexing adaptor removal and FASTQ file transformation were performed by bcl2fastq Conversion Software 2.17 Illumina Inc. The FASTQ files were imported into CLC Genomics Workbench v.11.0.1 QIAGEN to remove low quality reads including reads with lengths less than 30 nucleotides or with Phred quality score lower than 20 The trimmed reads were mapped to zebrafish genome GRCz11 and TPM were calculated by CLC Genomics Workbench v.11.0.1 QIAGEN Genome build: GRCz11 Supplementary files format and content: txt files contain expression data for all cells gonad   Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols.   strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l / |age:21 dpf GSM5268474 GSM5268474: HO 2; Danio rerio; RNA Seq GSM5268474   1 Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols. GEO Accession:GSM5268474 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP316710     HO_2_run1.R1.fastq HO_2_run1.R2.fastq fastq fastq 3972958992.0 27776809.0 GSM5268474 r1 0:71.50 1:71.53 A:1124808892;C:846395118;G:875350364;T:1125141364;N:1263254 71 71     1124808892 846395118 875350364 1125141364 1263254 SRX10697275 SRS8786689 SRA1224866 GEO Institute of Molecular Biology, Academia Sinica 2 0.89819 0.89964 0.11368 0.11314 0.65052 0.65387 0.49509 0.49244 76 76 B B biological fallback assumption illumina nextseq unknown cdna_unspecified nextera sc_generic single_cell_generic generic-scrnaseq-only   Taiwan 2021-04-28 Larval Larval Gonad Reproductive System
64220 64220 SRR14343410 SRX10697275 SRS8786689 SRP316710 PRJNA725806 foxl2l regulates female meiotic entry during juvenile gonadal development in zebrafish GSE173480 Transcriptome Analysis Sex determination is distinct from development of other organs for its diversity among species. In zebrafish the sex determination in juvenile stage could be hermaphroditic or gonochoristic. However the detail mechanism is still unclear. Here in this study we found that the transcription factor that belongs to forkhead box family Foxl2l is required for determination of female fate in zebrafish. Foxl2l was expressed from larva stage and became female bias in juvenile stage. The expression was restricted in pre meiotic germ cells. Disruption of Foxl2l function by CRISPR/Cas9 system resulted in all male phenotype in the mutant. Germ cells in foxl2l mutant were arrested in pre meiotic stage at 21 dpf the critical period for female meiotic entry. To further verify the downstream mechanism of Foxl2l on female sex determination wildtype or foxl2l mutant germ cells labeled by foxl2l:egfp at 21 dpf dpf and germ cells labeled by ziwi:egfp at 26 dpf were analyzed by RNA seq and single cell RNA seq respectively Overall design: Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. and RNA sequencing was performed by Illumina NextSeq 500. Each genotype contained triple samples.       HO 2 GSM5268474   tissue:gonad|strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l / |age:21 dpf HO 2 Sequenced data was analyzed by NextSeq Control Software 2.2.0 The de multiplexing adaptor removal and FASTQ file transformation were performed by bcl2fastq Conversion Software 2.17 Illumina Inc. The FASTQ files were imported into CLC Genomics Workbench v.11.0.1 QIAGEN to remove low quality reads including reads with lengths less than 30 nucleotides or with Phred quality score lower than 20 The trimmed reads were mapped to zebrafish genome GRCz11 and TPM were calculated by CLC Genomics Workbench v.11.0.1 QIAGEN Genome build: GRCz11 Supplementary files format and content: txt files contain expression data for all cells gonad   Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols.   strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l / |age:21 dpf GSM5268474 GSM5268474: HO 2; Danio rerio; RNA Seq GSM5268474   1 Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols. GEO Accession:GSM5268474 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP316710     HO_2_run2.R2.fastq HO_2_run2.R1.fastq fastq fastq 4396792493.0 30653836.0 GSM5268474 r2 0:71.70 1:71.73 A:1244672283;C:933954952;G:965736051;T:1248628688;N:3800519 71 71     1244672283 933954952 965736051 1248628688 3800519 SRX10697275 SRS8786689 SRA1224866 GEO Institute of Molecular Biology, Academia Sinica 2 0.89957 0.90042 0.11576 0.11485 0.64985 0.65348 0.48847 0.48933 76 76 B B biological fallback assumption illumina nextseq unknown cdna_unspecified nextera sc_generic single_cell_generic generic-scrnaseq-only   Taiwan 2021-04-28 Larval Larval Gonad Reproductive System
64221 64221 SRR14343407 SRX10697274 SRS8786688 SRP316710 PRJNA725806 foxl2l regulates female meiotic entry during juvenile gonadal development in zebrafish GSE173480 Transcriptome Analysis Sex determination is distinct from development of other organs for its diversity among species. In zebrafish the sex determination in juvenile stage could be hermaphroditic or gonochoristic. However the detail mechanism is still unclear. Here in this study we found that the transcription factor that belongs to forkhead box family Foxl2l is required for determination of female fate in zebrafish. Foxl2l was expressed from larva stage and became female bias in juvenile stage. The expression was restricted in pre meiotic germ cells. Disruption of Foxl2l function by CRISPR/Cas9 system resulted in all male phenotype in the mutant. Germ cells in foxl2l mutant were arrested in pre meiotic stage at 21 dpf the critical period for female meiotic entry. To further verify the downstream mechanism of Foxl2l on female sex determination wildtype or foxl2l mutant germ cells labeled by foxl2l:egfp at 21 dpf dpf and germ cells labeled by ziwi:egfp at 26 dpf were analyzed by RNA seq and single cell RNA seq respectively Overall design: Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. and RNA sequencing was performed by Illumina NextSeq 500. Each genotype contained triple samples.       HO 1 GSM5268473   tissue:gonad|strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l / |age:21 dpf HO 1 Sequenced data was analyzed by NextSeq Control Software 2.2.0 The de multiplexing adaptor removal and FASTQ file transformation were performed by bcl2fastq Conversion Software 2.17 Illumina Inc. The FASTQ files were imported into CLC Genomics Workbench v.11.0.1 QIAGEN to remove low quality reads including reads with lengths less than 30 nucleotides or with Phred quality score lower than 20 The trimmed reads were mapped to zebrafish genome GRCz11 and TPM were calculated by CLC Genomics Workbench v.11.0.1 QIAGEN Genome build: GRCz11 Supplementary files format and content: txt files contain expression data for all cells gonad   Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols.   strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l / |age:21 dpf GSM5268473 GSM5268473: HO 1; Danio rerio; RNA Seq GSM5268473   1 Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols. GEO Accession:GSM5268473 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP316710     HO_1_run1.R1.fastq HO_1_run1.R2.fastq fastq fastq 3833739891.0 26806927.0 GSM5268473 r1 0:71.49 1:71.52 A:1084861861;C:818381943;G:845191898;T:1084121864;N:1182325 71 71     1084861861 818381943 845191898 1084121864 1182325 SRX10697274 SRS8786688 SRA1224866 GEO Institute of Molecular Biology, Academia Sinica 2 0.90273 0.90247 0.09672 0.09556 0.6565 0.65932 0.48356 0.49197 74 75 B B biological fallback assumption illumina nextseq unknown cdna_unspecified nextera sc_generic single_cell_generic generic-scrnaseq-only   Taiwan 2021-04-28 Larval Larval Gonad Reproductive System
64222 64222 SRR14343408 SRX10697274 SRS8786688 SRP316710 PRJNA725806 foxl2l regulates female meiotic entry during juvenile gonadal development in zebrafish GSE173480 Transcriptome Analysis Sex determination is distinct from development of other organs for its diversity among species. In zebrafish the sex determination in juvenile stage could be hermaphroditic or gonochoristic. However the detail mechanism is still unclear. Here in this study we found that the transcription factor that belongs to forkhead box family Foxl2l is required for determination of female fate in zebrafish. Foxl2l was expressed from larva stage and became female bias in juvenile stage. The expression was restricted in pre meiotic germ cells. Disruption of Foxl2l function by CRISPR/Cas9 system resulted in all male phenotype in the mutant. Germ cells in foxl2l mutant were arrested in pre meiotic stage at 21 dpf the critical period for female meiotic entry. To further verify the downstream mechanism of Foxl2l on female sex determination wildtype or foxl2l mutant germ cells labeled by foxl2l:egfp at 21 dpf dpf and germ cells labeled by ziwi:egfp at 26 dpf were analyzed by RNA seq and single cell RNA seq respectively Overall design: Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. and RNA sequencing was performed by Illumina NextSeq 500. Each genotype contained triple samples.       HO 1 GSM5268473   tissue:gonad|strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l / |age:21 dpf HO 1 Sequenced data was analyzed by NextSeq Control Software 2.2.0 The de multiplexing adaptor removal and FASTQ file transformation were performed by bcl2fastq Conversion Software 2.17 Illumina Inc. The FASTQ files were imported into CLC Genomics Workbench v.11.0.1 QIAGEN to remove low quality reads including reads with lengths less than 30 nucleotides or with Phred quality score lower than 20 The trimmed reads were mapped to zebrafish genome GRCz11 and TPM were calculated by CLC Genomics Workbench v.11.0.1 QIAGEN Genome build: GRCz11 Supplementary files format and content: txt files contain expression data for all cells gonad   Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols.   strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l / |age:21 dpf GSM5268473 GSM5268473: HO 1; Danio rerio; RNA Seq GSM5268473   1 Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols. GEO Accession:GSM5268473 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP316710     HO_1_run2.R2.fastq HO_1_run2.R1.fastq fastq fastq 4251914417.0 29647144.0 GSM5268473 r2 0:71.69 1:71.72 A:1202985882;C:905068322;G:934722262;T:1205490290;N:3647661 71 71     1202985882 905068322 934722262 1205490290 3647661 SRX10697274 SRS8786688 SRA1224866 GEO Institute of Molecular Biology, Academia Sinica 2 0.90347 0.9046 0.09694 0.09634 0.65662 0.66131 0.49104 0.48825 76 76 B B biological fallback assumption illumina nextseq unknown cdna_unspecified nextera sc_generic single_cell_generic generic-scrnaseq-only   Taiwan 2021-04-28 Larval Larval Gonad Reproductive System
64223 64223 SRR14343405 SRX10697273 SRS8786687 SRP316710 PRJNA725806 foxl2l regulates female meiotic entry during juvenile gonadal development in zebrafish GSE173480 Transcriptome Analysis Sex determination is distinct from development of other organs for its diversity among species. In zebrafish the sex determination in juvenile stage could be hermaphroditic or gonochoristic. However the detail mechanism is still unclear. Here in this study we found that the transcription factor that belongs to forkhead box family Foxl2l is required for determination of female fate in zebrafish. Foxl2l was expressed from larva stage and became female bias in juvenile stage. The expression was restricted in pre meiotic germ cells. Disruption of Foxl2l function by CRISPR/Cas9 system resulted in all male phenotype in the mutant. Germ cells in foxl2l mutant were arrested in pre meiotic stage at 21 dpf the critical period for female meiotic entry. To further verify the downstream mechanism of Foxl2l on female sex determination wildtype or foxl2l mutant germ cells labeled by foxl2l:egfp at 21 dpf dpf and germ cells labeled by ziwi:egfp at 26 dpf were analyzed by RNA seq and single cell RNA seq respectively Overall design: Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. and RNA sequencing was performed by Illumina NextSeq 500. Each genotype contained triple samples.       WT 3 GSM5268472   tissue:gonad|strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l+/+|age:21 dpf WT 3 Sequenced data was analyzed by NextSeq Control Software 2.2.0 The de multiplexing adaptor removal and FASTQ file transformation were performed by bcl2fastq Conversion Software 2.17 Illumina Inc. The FASTQ files were imported into CLC Genomics Workbench v.11.0.1 QIAGEN to remove low quality reads including reads with lengths less than 30 nucleotides or with Phred quality score lower than 20 The trimmed reads were mapped to zebrafish genome GRCz11 and TPM were calculated by CLC Genomics Workbench v.11.0.1 QIAGEN Genome build: GRCz11 Supplementary files format and content: txt files contain expression data for all cells gonad   Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols.   strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l+/+|age:21 dpf GSM5268472 GSM5268472: WT 3; Danio rerio; RNA Seq GSM5268472   1 Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols. GEO Accession:GSM5268472 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP316710     WT_3_run1.R1.fastq WT_3_run1.R2.fastq fastq fastq 3615402373.0 25312788.0 GSM5268472 r1 0:71.39 1:71.44 A:1078168256;C:699509937;G:739078497;T:1097303558;N:1342125 71 71     1078168256 699509937 739078497 1097303558 1342125 SRX10697273 SRS8786687 SRA1224866 GEO Institute of Molecular Biology, Academia Sinica 2 0.7144 0.71612 0.09852 0.09708 0.70027 0.70331 0.49157 0.49119 75 76 B B biological fallback assumption illumina nextseq unknown cdna_unspecified nextera sc_generic single_cell_generic generic-scrnaseq-only   Taiwan 2021-04-28 Larval Larval Gonad Reproductive System
64224 64224 SRR14343406 SRX10697273 SRS8786687 SRP316710 PRJNA725806 foxl2l regulates female meiotic entry during juvenile gonadal development in zebrafish GSE173480 Transcriptome Analysis Sex determination is distinct from development of other organs for its diversity among species. In zebrafish the sex determination in juvenile stage could be hermaphroditic or gonochoristic. However the detail mechanism is still unclear. Here in this study we found that the transcription factor that belongs to forkhead box family Foxl2l is required for determination of female fate in zebrafish. Foxl2l was expressed from larva stage and became female bias in juvenile stage. The expression was restricted in pre meiotic germ cells. Disruption of Foxl2l function by CRISPR/Cas9 system resulted in all male phenotype in the mutant. Germ cells in foxl2l mutant were arrested in pre meiotic stage at 21 dpf the critical period for female meiotic entry. To further verify the downstream mechanism of Foxl2l on female sex determination wildtype or foxl2l mutant germ cells labeled by foxl2l:egfp at 21 dpf dpf and germ cells labeled by ziwi:egfp at 26 dpf were analyzed by RNA seq and single cell RNA seq respectively Overall design: Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. and RNA sequencing was performed by Illumina NextSeq 500. Each genotype contained triple samples.       WT 3 GSM5268472   tissue:gonad|strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l+/+|age:21 dpf WT 3 Sequenced data was analyzed by NextSeq Control Software 2.2.0 The de multiplexing adaptor removal and FASTQ file transformation were performed by bcl2fastq Conversion Software 2.17 Illumina Inc. The FASTQ files were imported into CLC Genomics Workbench v.11.0.1 QIAGEN to remove low quality reads including reads with lengths less than 30 nucleotides or with Phred quality score lower than 20 The trimmed reads were mapped to zebrafish genome GRCz11 and TPM were calculated by CLC Genomics Workbench v.11.0.1 QIAGEN Genome build: GRCz11 Supplementary files format and content: txt files contain expression data for all cells gonad   Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols.   strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l+/+|age:21 dpf GSM5268472 GSM5268472: WT 3; Danio rerio; RNA Seq GSM5268472   1 Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols. GEO Accession:GSM5268472 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP316710     WT_3_run2.R1.fastq WT_3_run2.R2.fastq fastq fastq 4010245556.0 27994253.0 GSM5268472 r2 0:71.60 1:71.65 A:1193569082;C:773024546;G:816013849;T:1223955095;N:3682984 71 71     1193569082 773024546 816013849 1223955095 3682984 SRX10697273 SRS8786687 SRA1224866 GEO Institute of Molecular Biology, Academia Sinica 2 0.71057 0.71162 0.09984 0.09845 0.70102 0.70435 0.4941 0.48909 74 75 B B biological fallback assumption illumina nextseq unknown cdna_unspecified nextera sc_generic single_cell_generic generic-scrnaseq-only   Taiwan 2021-04-28 Larval Larval Gonad Reproductive System
64225 64225 SRR14343403 SRX10697272 SRS8786686 SRP316710 PRJNA725806 foxl2l regulates female meiotic entry during juvenile gonadal development in zebrafish GSE173480 Transcriptome Analysis Sex determination is distinct from development of other organs for its diversity among species. In zebrafish the sex determination in juvenile stage could be hermaphroditic or gonochoristic. However the detail mechanism is still unclear. Here in this study we found that the transcription factor that belongs to forkhead box family Foxl2l is required for determination of female fate in zebrafish. Foxl2l was expressed from larva stage and became female bias in juvenile stage. The expression was restricted in pre meiotic germ cells. Disruption of Foxl2l function by CRISPR/Cas9 system resulted in all male phenotype in the mutant. Germ cells in foxl2l mutant were arrested in pre meiotic stage at 21 dpf the critical period for female meiotic entry. To further verify the downstream mechanism of Foxl2l on female sex determination wildtype or foxl2l mutant germ cells labeled by foxl2l:egfp at 21 dpf dpf and germ cells labeled by ziwi:egfp at 26 dpf were analyzed by RNA seq and single cell RNA seq respectively Overall design: Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. and RNA sequencing was performed by Illumina NextSeq 500. Each genotype contained triple samples.       WT 2 GSM5268471   tissue:gonad|strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l+/+|age:21 dpf WT 2 Sequenced data was analyzed by NextSeq Control Software 2.2.0 The de multiplexing adaptor removal and FASTQ file transformation were performed by bcl2fastq Conversion Software 2.17 Illumina Inc. The FASTQ files were imported into CLC Genomics Workbench v.11.0.1 QIAGEN to remove low quality reads including reads with lengths less than 30 nucleotides or with Phred quality score lower than 20 The trimmed reads were mapped to zebrafish genome GRCz11 and TPM were calculated by CLC Genomics Workbench v.11.0.1 QIAGEN Genome build: GRCz11 Supplementary files format and content: txt files contain expression data for all cells gonad   Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols.   strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l+/+|age:21 dpf GSM5268471 GSM5268471: WT 2; Danio rerio; RNA Seq GSM5268471   1 Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols. GEO Accession:GSM5268471 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP316710     WT_2_run1.R1.fastq WT_2_run1.R2.fastq fastq fastq 4242860973.0 29911182.0 GSM5268471 r1 0:70.91 1:70.94 A:1225861906;C:877846427;G:910477747;T:1227170958;N:1503935 70 70     1225861906 877846427 910477747 1227170958 1503935 SRX10697272 SRS8786686 SRA1224866 GEO Institute of Molecular Biology, Academia Sinica 2 0.88249 0.8846 0.12426 0.12254 0.67568 0.67777 0.49104 0.49087 76 76 B B biological fallback assumption illumina nextseq unknown cdna_unspecified nextera sc_generic single_cell_generic generic-scrnaseq-only   Taiwan 2021-04-28 Larval Larval Gonad Reproductive System
64226 64226 SRR14343404 SRX10697272 SRS8786686 SRP316710 PRJNA725806 foxl2l regulates female meiotic entry during juvenile gonadal development in zebrafish GSE173480 Transcriptome Analysis Sex determination is distinct from development of other organs for its diversity among species. In zebrafish the sex determination in juvenile stage could be hermaphroditic or gonochoristic. However the detail mechanism is still unclear. Here in this study we found that the transcription factor that belongs to forkhead box family Foxl2l is required for determination of female fate in zebrafish. Foxl2l was expressed from larva stage and became female bias in juvenile stage. The expression was restricted in pre meiotic germ cells. Disruption of Foxl2l function by CRISPR/Cas9 system resulted in all male phenotype in the mutant. Germ cells in foxl2l mutant were arrested in pre meiotic stage at 21 dpf the critical period for female meiotic entry. To further verify the downstream mechanism of Foxl2l on female sex determination wildtype or foxl2l mutant germ cells labeled by foxl2l:egfp at 21 dpf dpf and germ cells labeled by ziwi:egfp at 26 dpf were analyzed by RNA seq and single cell RNA seq respectively Overall design: Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. and RNA sequencing was performed by Illumina NextSeq 500. Each genotype contained triple samples.       WT 2 GSM5268471   tissue:gonad|strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l+/+|age:21 dpf WT 2 Sequenced data was analyzed by NextSeq Control Software 2.2.0 The de multiplexing adaptor removal and FASTQ file transformation were performed by bcl2fastq Conversion Software 2.17 Illumina Inc. The FASTQ files were imported into CLC Genomics Workbench v.11.0.1 QIAGEN to remove low quality reads including reads with lengths less than 30 nucleotides or with Phred quality score lower than 20 The trimmed reads were mapped to zebrafish genome GRCz11 and TPM were calculated by CLC Genomics Workbench v.11.0.1 QIAGEN Genome build: GRCz11 Supplementary files format and content: txt files contain expression data for all cells gonad   Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols.   strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l+/+|age:21 dpf GSM5268471 GSM5268471: WT 2; Danio rerio; RNA Seq GSM5268471   1 Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols. GEO Accession:GSM5268471 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP316710     WT_2_run2.R2.fastq WT_2_run2.R1.fastq fastq fastq 4702850600.0 33040042.0 GSM5268471 r2 0:71.15 1:71.19 A:1357977487;C:969603630;G:1005776160;T:1365277602;N:4215721 71 71     1357977487 969603630 1005776160 1365277602 4215721 SRX10697272 SRS8786686 SRA1224866 GEO Institute of Molecular Biology, Academia Sinica 2 0.88141 0.88412 0.12385 0.12227 0.67805 0.68156 0.48576 0.49354 76 76 B B biological fallback assumption illumina nextseq unknown cdna_unspecified nextera sc_generic single_cell_generic generic-scrnaseq-only   Taiwan 2021-04-28 Larval Larval Gonad Reproductive System
64227 64227 SRR14343401 SRX10697271 SRS8786685 SRP316710 PRJNA725806 foxl2l regulates female meiotic entry during juvenile gonadal development in zebrafish GSE173480 Transcriptome Analysis Sex determination is distinct from development of other organs for its diversity among species. In zebrafish the sex determination in juvenile stage could be hermaphroditic or gonochoristic. However the detail mechanism is still unclear. Here in this study we found that the transcription factor that belongs to forkhead box family Foxl2l is required for determination of female fate in zebrafish. Foxl2l was expressed from larva stage and became female bias in juvenile stage. The expression was restricted in pre meiotic germ cells. Disruption of Foxl2l function by CRISPR/Cas9 system resulted in all male phenotype in the mutant. Germ cells in foxl2l mutant were arrested in pre meiotic stage at 21 dpf the critical period for female meiotic entry. To further verify the downstream mechanism of Foxl2l on female sex determination wildtype or foxl2l mutant germ cells labeled by foxl2l:egfp at 21 dpf dpf and germ cells labeled by ziwi:egfp at 26 dpf were analyzed by RNA seq and single cell RNA seq respectively Overall design: Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. and RNA sequencing was performed by Illumina NextSeq 500. Each genotype contained triple samples.       WT 1 GSM5268470   tissue:gonad|strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l+/+|age:21 dpf WT 1 Sequenced data was analyzed by NextSeq Control Software 2.2.0 The de multiplexing adaptor removal and FASTQ file transformation were performed by bcl2fastq Conversion Software 2.17 Illumina Inc. The FASTQ files were imported into CLC Genomics Workbench v.11.0.1 QIAGEN to remove low quality reads including reads with lengths less than 30 nucleotides or with Phred quality score lower than 20 The trimmed reads were mapped to zebrafish genome GRCz11 and TPM were calculated by CLC Genomics Workbench v.11.0.1 QIAGEN Genome build: GRCz11 Supplementary files format and content: txt files contain expression data for all cells gonad   Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols.   strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l+/+|age:21 dpf GSM5268470 GSM5268470: WT 1; Danio rerio; RNA Seq GSM5268470   1 Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols. GEO Accession:GSM5268470 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP316710     WT_1_run1.R2.fastq WT_1_run1.R1.fastq fastq fastq 3768759279.0 26193297.0 GSM5268470 r1 0:71.93 1:71.95 A:1068721513;C:803440242;G:829244956;T:1066480466;N:872102 71 71     1068721513 803440242 829244956 1066480466 872102 SRX10697271 SRS8786685 SRA1224866 GEO Institute of Molecular Biology, Academia Sinica 2 0.90907 0.91124 0.10338 0.1029 0.67054 0.67343 0.48963 0.49025 75 75 B B biological fallback assumption illumina nextseq unknown cdna_unspecified nextera sc_generic single_cell_generic generic-scrnaseq-only   Taiwan 2021-04-28 Larval Larval Gonad Reproductive System
64228 64228 SRR14343402 SRX10697271 SRS8786685 SRP316710 PRJNA725806 foxl2l regulates female meiotic entry during juvenile gonadal development in zebrafish GSE173480 Transcriptome Analysis Sex determination is distinct from development of other organs for its diversity among species. In zebrafish the sex determination in juvenile stage could be hermaphroditic or gonochoristic. However the detail mechanism is still unclear. Here in this study we found that the transcription factor that belongs to forkhead box family Foxl2l is required for determination of female fate in zebrafish. Foxl2l was expressed from larva stage and became female bias in juvenile stage. The expression was restricted in pre meiotic germ cells. Disruption of Foxl2l function by CRISPR/Cas9 system resulted in all male phenotype in the mutant. Germ cells in foxl2l mutant were arrested in pre meiotic stage at 21 dpf the critical period for female meiotic entry. To further verify the downstream mechanism of Foxl2l on female sex determination wildtype or foxl2l mutant germ cells labeled by foxl2l:egfp at 21 dpf dpf and germ cells labeled by ziwi:egfp at 26 dpf were analyzed by RNA seq and single cell RNA seq respectively Overall design: Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. and RNA sequencing was performed by Illumina NextSeq 500. Each genotype contained triple samples.       WT 1 GSM5268470   tissue:gonad|strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l+/+|age:21 dpf WT 1 Sequenced data was analyzed by NextSeq Control Software 2.2.0 The de multiplexing adaptor removal and FASTQ file transformation were performed by bcl2fastq Conversion Software 2.17 Illumina Inc. The FASTQ files were imported into CLC Genomics Workbench v.11.0.1 QIAGEN to remove low quality reads including reads with lengths less than 30 nucleotides or with Phred quality score lower than 20 The trimmed reads were mapped to zebrafish genome GRCz11 and TPM were calculated by CLC Genomics Workbench v.11.0.1 QIAGEN Genome build: GRCz11 Supplementary files format and content: txt files contain expression data for all cells gonad   Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols.   strain:TL|cell type:germ cell|genotype:foxl2l:egfp;foxl2l+/+|age:21 dpf GSM5268470 GSM5268470: WT 1; Danio rerio; RNA Seq GSM5268470   1 Trunks of foxl2l:egfp;foxl2l / or foxl2l:egfp;foxl2l+/+ containing gonad were dissociated by 0.2% collagenase and 0.25% trypsin at 21 dpf. Around 300 EGFP+ germ cells of each genotype were sorted by fluorescence activated cell sorter. cDNA was synthesized by SMART Seq HT kit seq Takara Bio. cDNA library was constructed by Nextera XT DNA Library Prep Kit Illumina Inc. following the manufacturer's protocols. GEO Accession:GSM5268470 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP316710     WT_1_run2.R2.fastq WT_1_run2.R1.fastq fastq fastq 4100200544.0 28410131.0 GSM5268470 r2 0:72.15 1:72.17 A:1163123243;C:871020431;G:898995203;T:1163892058;N:3169609 72 72     1163123243 871020431 898995203 1163892058 3169609 SRX10697271 SRS8786685 SRA1224866 GEO Institute of Molecular Biology, Academia Sinica 2 0.90943 0.91044 0.10346 0.103 0.66914 0.67004 0.48705 0.49202 76 76 B B biological fallback assumption illumina nextseq unknown cdna_unspecified nextera sc_generic single_cell_generic generic-scrnaseq-only   Taiwan 2021-04-28 Larval Larval Gonad Reproductive System
64467 64467 SRR14703424 SRX11041446 SRS9110374 SRP322195 PRJNA734348 Methylome inheritance and enhancer dememorization construct an epigenetic gate safeguarding embryonic programs GSE175951 Other Unlike that of mammals the total DNA methylome of many cold blooded vertebrates is globally inherited from gametes to early embryos. In zebrafish this is however accompanied by sweeping “dememorization” of enhancers prior to fertilization for sperm and just post fertilization for oocyte as they undergo full methylation and are not demethylated again until phylotypic stage. The significance of both global methylome inheritance and enhancer dememorization in early embryos remains largely unknown. Adding to the puzzles the zygotic mutant zebrafish of dnmt1 the major DNA methylation maintenance methyltransferase surprisingly can develop to term. To solve the role of DNA methylation in early development we generated zebrafish embryos derived from dnmt1 knocking down oocytes using a recently developed method OMIS microinjection in situ which successfully eliminated DNA methylation before zygotic genome activation. dnmt1 deficient embryos failed to initiate epiboly and died around gastrulation. This is in part caused by activation of immune response and p53 regulated apoptosis likely triggered by the derepression of transposable elements. Single cell RNA seq further revealed defective differentiation in these mutants. DNA methylation is also required for the establishment of repressive histone marks H3K27me3 and H2AK119ub. Strikingly the loss of DNA methylation leads to extensive derepression of somatic genes and enhancers which acquire ectopic H3K27ac accessible chromatin and H3K4me3. These somatic enhancers are preferentially CG rich and are bound by CG containing TFs. By contrast embryonic enhancers are generally CG poor methylation insensitive and are bound by CG less TFs. Hence the global DNA methylome inheritance is essential for vertebrate early development and enhancer dememorization resets an epigenetic gate that separates embryonic and somatic programs. Overall design: By employing MethylC seq total RNA seq scRNA seq CUT&RUN ChIP seq and ATAC seq in control and dnmt1 mKD embryos at oocyt…   pubmed:34936444   Oocyte dnmt1 mKD total RNA seq rep2 GSM5351801   source name:oocyte|strain:AB|genotype:WT|developmental stage:Oocyte|tissue:oocyte|treatment:microinjection with Rhodamine B and dnmt1 MO at oogenesis III stage GV Oocyte dnmt1 mKD total RNA seq rep2 All STEM seq datasets were mapped to the danRer7 reference genome by Bismark Krueger and Andrews 2011. Reads were trimmed with cutadaptor Martin 2011 using parameters: minimum length 20 pair filter=any. Alignments were performed with the following parameters: N 1 X 600 score min L 0 0.6. Multi mapped reads and PCR duplicates were removed. bismark methylation extractor was used to calculate the DNA methylation level. Total RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer7 by STAR version: STAR 2.5.3a modified Dobin et al. 2013 with the following parameters: outSAMstrandField intronMotif outSAMattributes All outSAMunmapped Within outSAMattrIHstart 0 outWigStrand Stranded outFilterMultimapNmax 20 twopassMode Basic. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1 Trapnell et al. 2012. The scRNA seq data were processed with Cell Ranger 3.1 for genome alignment danRer10 transcript counting and gene cell barcode matrix generation. Before the downstream analysis cells with unique detected genes lower than <2 000 and higher than 6 000 genes were discarded and cells with high percentage of mitochondrial genes >5% were removed too. Subtypes of cells were identified with Seurat 3.0 through the integrating of control and mKD embryos at dome and shield stages with setting control embryos as reference. To make the data comparable samples we performed SCTransform normalization separately for each dataset. To further reduce the bais caused by sequencing depth of scRNA seq and percentage of mitochondrial genes UMI variance and percent.mt were regressed out from SCTransform normalized data matrix by linear model with negative binomial distribution. All ChIP seq reads were aligned to the zebrafish reference genome danRer7 using Bowtie2 version 2.2.2 L… oocyte Briefly on the first day of OMIS Wu et al. 2018b adult females at 5 mpf 12 mpf were anesthetized in 550 µg/ml tricaine Sigma Cat A5040 in a petri dish. Then the fish was placed on a damp sponge with specific buffer 5.4 mM KCl 136.8 mM NaCl 4.2 mM NaHCO3 0.44 mM KH2PO4 0.25 mM Na2HPO4 and 0.5% wt/vol BSA. A cut was made on one side of belly to expose the ovary. The diluted MOs were microinjected into each oocyte. Rhodamine B Sigma Cat R8881 was co injected with MOs as a dye. post injection the wound on the belly was sewed with a surgical sewing needle carefully and quickly. Once the operation was done the female was transferred into fish water supplemented with 32 µg/ml tricaine 10 unit/ml penicillin and 10 µg/ml streptomycin HyClone Cat SV30010. Then the fish was transferred to fish water containing gradually reduced concentrations of tricaine. In the evening of the second day the female was paired with a wild type male. In the morning of the third day the pair started to chase and lay fertilized eggs naturally. The injected oocyte derived embryos were identified by co injected dye rhodamine B at very early developmental stages. The injection doses of dnmt1 MO were 5 ng per oocyte in the same assay. MOs were dissolved in RNase free water and heated to 65°C for 11 min before microinjection. The oocytes were dechorionated manually by tweezers and transferred into 750 µl Trizol Invitrogen Cat 15596018. About 10 fresh embryos were transferred into Trizol and vortexed until no visible particles. 150 µl chloroform Amresco Cat 0757 was added and mixed thoroughly. The mixture was then transferred into phasemaker tube Invitrogen Cat A33248 and spun at 14 000 rpm for 15 min. Next the top phase was taken out from the tube added 1 µl LPA Sigma Cat 56575 and mixed well using pipettes. Then RNA was precipitated by adding 750 µl isopropanol Sigma Cat 59304 at 20℃ overnight. At next day the tube was spun at 14 000 rpm for 30 min and supernatant was removed. The pellet was washed with freshly 70% ethanol re suspend in 20 µl RNase free water and stored at 80℃ for later usage. NEBNext rRNA Depletion Kit NEB Cat E6310S was used to deplete ribosomal RNA according to the manufacture’s instruction. Briefly rRNA were hybridized with probes and digested with RNase H then excess probes were digested with DNase I. post that NEBNext RNA sample purification beads were used to purify rRNA depleted RNA. Purified RNA was fragmented before cDNA synthesis at 95℃ for 8 min. Double stranded cDNA was synthesized with NEB Next first strand NEB Cat E7771S and second strand synthesis modules NEB Cat E7550S then purified with Ampure XP beads Beckman Cat A63882. Synthesized cDNA was subjected to library preparation with NEBNext Ultr II DNA Library Prep Kit NEB Cat E7645S. DNA was end repaired adenylated and ligated to TruSeq sequencing adaptors. DNA were amplified using KAPA HF HotStart ReadyMix KAPABiosystem Cat RR2602. The amplified DNA was size selected using Ampure XP beads for 200 500 bp DNA fragments. All libraries were sequenced by Illumina Hi Seq 1500 or 2500 or XTen platform according to manufacturer’s instruction. The wild type AB strain was used in the experiments. The females post OMIS were fed with live adult brine shrimp thrice a day. All embryos were raised in Holtfreter’s solution at 28.5C and staged as described previously Kimmel et al. 1995. strain:AB|genotype:WT|developmental stage:Oocyte|tissue:oocyte|treatment:microinjection with Rhodamine B and dnmt1 MO at oogenesis III stage GV GSM5351801 GSM5351801: Oocyte dnmt1 mKD total RNA seq rep2; Danio rerio; RNA Seq GSM5351801   1 The oocytes were dechorionated manually by tweezers and transferred into 750 µl Trizol Invitrogen Cat 15596018. About 10 fresh embryos were transferred into Trizol and vortexed until no visible particles. 150 µl chloroform Amresco Cat 0757 was added and mixed thoroughly. The mixture was then transferred into phasemaker tube Invitrogen Cat A33248 and spun at 14 000 rpm for 15 min. Next the top phase was taken out from the tube added 1 µl LPA Sigma Cat 56575 and mixed well using pipettes. Then RNA was precipitated by adding 750 µl isopropanol Sigma Cat 59304 at 20℃ overnight. At next day the tube was spun at 14 000 rpm for 30 min and supernatant was removed. The pellet was washed with freshly 70% ethanol re suspend in 20 µl RNase free water and stored at 80℃ for later usage. NEBNext rRNA Depletion Kit NEB Cat E6310S was used to deplete ribosomal RNA according to the manufacture's instruction. Briefly rRNA were hybridized with probes and digested with RNase H then excess probes were digested with DNase I. post that NEBNext RNA sample purification beads were used to purify rRNA depleted RNA. Purified RNA was fragmented before cDNA synthesis at 95℃ for 8 min. Double stranded cDNA was synthesized with NEB Next first strand NEB Cat E7771S and second strand synthesis modules NEB Cat E7550S then purified with Ampure XP beads Beckman Cat A63882. Synthesized cDNA was subjected to library preparation with NEBNext Ultr II DNA Library Prep Kit NEB Cat E7645S. DNA was end repaired adenylated and ligated to TruSeq sequencing adaptors. DNA were amplified using KAPA HF HotStart ReadyMix KAPABiosystem Cat RR2602. The amplified DNA was size selected using Ampure XP beads for 200 500 bp DNA fragments. All libraries were sequenced by Illumina Hi Seq 1500 or 2500 or XTen platform according to manufacturer's instruction. GEO Accession:GSM5351801 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 1500   SRP322195   loader:fastq load.py Oocyte_dnmt1_mKD_total_RNA_seq_rep2_r1.fq.gz Oocyte_dnmt1_mKD_total_RNA_seq_rep2_r2.fq.gz fastq fastq 16439504400.0 54798348.0 GSM5351801 r1 0:150 1:150 A:3396011593;C:4802098205;G:4970368429;T:3267104077;N:3922096 150 150     3396011593 4802098205 4970368429 3267104077 3922096 SRX11041446 SRS9110374 SRA1239365 GEO THU-PKU Center for Life Sciences, Tsinghua University 2 0.88579 0.90816 0.11025 0.11298 0.80095 0.80501 0.71771 0.73597 150 150 B B biological fallback assumption illumina hiseq_era unknown rrna_depletion nebnext sc_generic single_cell_generic generic-scrnaseq-only   China 2021-06-01 Zygote Embryo Oocyte Reproductive System
64468 64468 SRR14703423 SRX11041445 SRS9110373 SRP322195 PRJNA734348 Methylome inheritance and enhancer dememorization construct an epigenetic gate safeguarding embryonic programs GSE175951 Other Unlike that of mammals the total DNA methylome of many cold blooded vertebrates is globally inherited from gametes to early embryos. In zebrafish this is however accompanied by sweeping “dememorization” of enhancers prior to fertilization for sperm and just post fertilization for oocyte as they undergo full methylation and are not demethylated again until phylotypic stage. The significance of both global methylome inheritance and enhancer dememorization in early embryos remains largely unknown. Adding to the puzzles the zygotic mutant zebrafish of dnmt1 the major DNA methylation maintenance methyltransferase surprisingly can develop to term. To solve the role of DNA methylation in early development we generated zebrafish embryos derived from dnmt1 knocking down oocytes using a recently developed method OMIS microinjection in situ which successfully eliminated DNA methylation before zygotic genome activation. dnmt1 deficient embryos failed to initiate epiboly and died around gastrulation. This is in part caused by activation of immune response and p53 regulated apoptosis likely triggered by the derepression of transposable elements. Single cell RNA seq further revealed defective differentiation in these mutants. DNA methylation is also required for the establishment of repressive histone marks H3K27me3 and H2AK119ub. Strikingly the loss of DNA methylation leads to extensive derepression of somatic genes and enhancers which acquire ectopic H3K27ac accessible chromatin and H3K4me3. These somatic enhancers are preferentially CG rich and are bound by CG containing TFs. By contrast embryonic enhancers are generally CG poor methylation insensitive and are bound by CG less TFs. Hence the global DNA methylome inheritance is essential for vertebrate early development and enhancer dememorization resets an epigenetic gate that separates embryonic and somatic programs. Overall design: By employing MethylC seq total RNA seq scRNA seq CUT&RUN ChIP seq and ATAC seq in control and dnmt1 mKD embryos at oocyt…   pubmed:34936444   Oocyte dnmt1 mKD total RNA seq rep1 GSM5351800   source name:oocyte|strain:AB|genotype:WT|developmental stage:Oocyte|tissue:oocyte|treatment:microinjection with Rhodamine B and dnmt1 MO at oogenesis III stage GV Oocyte dnmt1 mKD total RNA seq rep1 All STEM seq datasets were mapped to the danRer7 reference genome by Bismark Krueger and Andrews 2011. Reads were trimmed with cutadaptor Martin 2011 using parameters: minimum length 20 pair filter=any. Alignments were performed with the following parameters: N 1 X 600 score min L 0 0.6. Multi mapped reads and PCR duplicates were removed. bismark methylation extractor was used to calculate the DNA methylation level. Total RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer7 by STAR version: STAR 2.5.3a modified Dobin et al. 2013 with the following parameters: outSAMstrandField intronMotif outSAMattributes All outSAMunmapped Within outSAMattrIHstart 0 outWigStrand Stranded outFilterMultimapNmax 20 twopassMode Basic. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1 Trapnell et al. 2012. The scRNA seq data were processed with Cell Ranger 3.1 for genome alignment danRer10 transcript counting and gene cell barcode matrix generation. Before the downstream analysis cells with unique detected genes lower than <2 000 and higher than 6 000 genes were discarded and cells with high percentage of mitochondrial genes >5% were removed too. Subtypes of cells were identified with Seurat 3.0 through the integrating of control and mKD embryos at dome and shield stages with setting control embryos as reference. To make the data comparable samples we performed SCTransform normalization separately for each dataset. To further reduce the bais caused by sequencing depth of scRNA seq and percentage of mitochondrial genes UMI variance and percent.mt were regressed out from SCTransform normalized data matrix by linear model with negative binomial distribution. All ChIP seq reads were aligned to the zebrafish reference genome danRer7 using Bowtie2 version 2.2.2 L… oocyte Briefly on the first day of OMIS Wu et al. 2018b adult females at 5 mpf 12 mpf were anesthetized in 550 µg/ml tricaine Sigma Cat A5040 in a petri dish. Then the fish was placed on a damp sponge with specific buffer 5.4 mM KCl 136.8 mM NaCl 4.2 mM NaHCO3 0.44 mM KH2PO4 0.25 mM Na2HPO4 and 0.5% wt/vol BSA. A cut was made on one side of belly to expose the ovary. The diluted MOs were microinjected into each oocyte. Rhodamine B Sigma Cat R8881 was co injected with MOs as a dye. post injection the wound on the belly was sewed with a surgical sewing needle carefully and quickly. Once the operation was done the female was transferred into fish water supplemented with 32 µg/ml tricaine 10 unit/ml penicillin and 10 µg/ml streptomycin HyClone Cat SV30010. Then the fish was transferred to fish water containing gradually reduced concentrations of tricaine. In the evening of the second day the female was paired with a wild type male. In the morning of the third day the pair started to chase and lay fertilized eggs naturally. The injected oocyte derived embryos were identified by co injected dye rhodamine B at very early developmental stages. The injection doses of dnmt1 MO were 5 ng per oocyte in the same assay. MOs were dissolved in RNase free water and heated to 65°C for 11 min before microinjection. The oocytes were dechorionated manually by tweezers and transferred into 750 µl Trizol Invitrogen Cat 15596018. About 10 fresh embryos were transferred into Trizol and vortexed until no visible particles. 150 µl chloroform Amresco Cat 0757 was added and mixed thoroughly. The mixture was then transferred into phasemaker tube Invitrogen Cat A33248 and spun at 14 000 rpm for 15 min. Next the top phase was taken out from the tube added 1 µl LPA Sigma Cat 56575 and mixed well using pipettes. Then RNA was precipitated by adding 750 µl isopropanol Sigma Cat 59304 at 20℃ overnight. At next day the tube was spun at 14 000 rpm for 30 min and supernatant was removed. The pellet was washed with freshly 70% ethanol re suspend in 20 µl RNase free water and stored at 80℃ for later usage. NEBNext rRNA Depletion Kit NEB Cat E6310S was used to deplete ribosomal RNA according to the manufacture’s instruction. Briefly rRNA were hybridized with probes and digested with RNase H then excess probes were digested with DNase I. post that NEBNext RNA sample purification beads were used to purify rRNA depleted RNA. Purified RNA was fragmented before cDNA synthesis at 95℃ for 8 min. Double stranded cDNA was synthesized with NEB Next first strand NEB Cat E7771S and second strand synthesis modules NEB Cat E7550S then purified with Ampure XP beads Beckman Cat A63882. Synthesized cDNA was subjected to library preparation with NEBNext Ultr II DNA Library Prep Kit NEB Cat E7645S. DNA was end repaired adenylated and ligated to TruSeq sequencing adaptors. DNA were amplified using KAPA HF HotStart ReadyMix KAPABiosystem Cat RR2602. The amplified DNA was size selected using Ampure XP beads for 200 500 bp DNA fragments. All libraries were sequenced by Illumina Hi Seq 1500 or 2500 or XTen platform according to manufacturer’s instruction. The wild type AB strain was used in the experiments. The females post OMIS were fed with live adult brine shrimp thrice a day. All embryos were raised in Holtfreter’s solution at 28.5C and staged as described previously Kimmel et al. 1995. strain:AB|genotype:WT|developmental stage:Oocyte|tissue:oocyte|treatment:microinjection with Rhodamine B and dnmt1 MO at oogenesis III stage GV GSM5351800 GSM5351800: Oocyte dnmt1 mKD total RNA seq rep1; Danio rerio; RNA Seq GSM5351800   1 The oocytes were dechorionated manually by tweezers and transferred into 750 µl Trizol Invitrogen Cat 15596018. About 10 fresh embryos were transferred into Trizol and vortexed until no visible particles. 150 µl chloroform Amresco Cat 0757 was added and mixed thoroughly. The mixture was then transferred into phasemaker tube Invitrogen Cat A33248 and spun at 14 000 rpm for 15 min. Next the top phase was taken out from the tube added 1 µl LPA Sigma Cat 56575 and mixed well using pipettes. Then RNA was precipitated by adding 750 µl isopropanol Sigma Cat 59304 at 20℃ overnight. At next day the tube was spun at 14 000 rpm for 30 min and supernatant was removed. The pellet was washed with freshly 70% ethanol re suspend in 20 µl RNase free water and stored at 80℃ for later usage. NEBNext rRNA Depletion Kit NEB Cat E6310S was used to deplete ribosomal RNA according to the manufacture's instruction. Briefly rRNA were hybridized with probes and digested with RNase H then excess probes were digested with DNase I. post that NEBNext RNA sample purification beads were used to purify rRNA depleted RNA. Purified RNA was fragmented before cDNA synthesis at 95℃ for 8 min. Double stranded cDNA was synthesized with NEB Next first strand NEB Cat E7771S and second strand synthesis modules NEB Cat E7550S then purified with Ampure XP beads Beckman Cat A63882. Synthesized cDNA was subjected to library preparation with NEBNext Ultr II DNA Library Prep Kit NEB Cat E7645S. DNA was end repaired adenylated and ligated to TruSeq sequencing adaptors. DNA were amplified using KAPA HF HotStart ReadyMix KAPABiosystem Cat RR2602. The amplified DNA was size selected using Ampure XP beads for 200 500 bp DNA fragments. All libraries were sequenced by Illumina Hi Seq 1500 or 2500 or XTen platform according to manufacturer's instruction. GEO Accession:GSM5351800 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 1500   SRP322195   loader:fastq load.py Oocyte_dnmt1_mKD_total_RNA_seq_rep1_r1.fq.gz Oocyte_dnmt1_mKD_total_RNA_seq_rep1_r2.fq.gz fastq fastq 14688433500.0 48961445.0 GSM5351800 r1 0:150 1:150 A:2682067386;C:4656142899;G:4847089762;T:2502503972;N:629481 150 150     2682067386 4656142899 4847089762 2502503972 629481 SRX11041445 SRS9110373 SRA1239365 GEO THU-PKU Center for Life Sciences, Tsinghua University 2 0.96866 0.97013 0.06205 0.06149 0.81138 0.81475 0.85317 0.85364 150 150 B B biological fallback assumption illumina hiseq_era unknown rrna_depletion nebnext sc_generic single_cell_generic generic-scrnaseq-only   China 2021-06-01 Zygote Embryo Oocyte Reproductive System
64469 64469 SRR14703422 SRX11041444 SRS9110371 SRP322195 PRJNA734348 Methylome inheritance and enhancer dememorization construct an epigenetic gate safeguarding embryonic programs GSE175951 Other Unlike that of mammals the total DNA methylome of many cold blooded vertebrates is globally inherited from gametes to early embryos. In zebrafish this is however accompanied by sweeping “dememorization” of enhancers prior to fertilization for sperm and just post fertilization for oocyte as they undergo full methylation and are not demethylated again until phylotypic stage. The significance of both global methylome inheritance and enhancer dememorization in early embryos remains largely unknown. Adding to the puzzles the zygotic mutant zebrafish of dnmt1 the major DNA methylation maintenance methyltransferase surprisingly can develop to term. To solve the role of DNA methylation in early development we generated zebrafish embryos derived from dnmt1 knocking down oocytes using a recently developed method OMIS microinjection in situ which successfully eliminated DNA methylation before zygotic genome activation. dnmt1 deficient embryos failed to initiate epiboly and died around gastrulation. This is in part caused by activation of immune response and p53 regulated apoptosis likely triggered by the derepression of transposable elements. Single cell RNA seq further revealed defective differentiation in these mutants. DNA methylation is also required for the establishment of repressive histone marks H3K27me3 and H2AK119ub. Strikingly the loss of DNA methylation leads to extensive derepression of somatic genes and enhancers which acquire ectopic H3K27ac accessible chromatin and H3K4me3. These somatic enhancers are preferentially CG rich and are bound by CG containing TFs. By contrast embryonic enhancers are generally CG poor methylation insensitive and are bound by CG less TFs. Hence the global DNA methylome inheritance is essential for vertebrate early development and enhancer dememorization resets an epigenetic gate that separates embryonic and somatic programs. Overall design: By employing MethylC seq total RNA seq scRNA seq CUT&RUN ChIP seq and ATAC seq in control and dnmt1 mKD embryos at oocyt…   pubmed:34936444   Oocyte ctrl total RNA seq rep2 GSM5351799   source name:oocyte|strain:AB|genotype:WT|developmental stage:Oocyte|tissue:oocyte|treatment:microinjection with Rhodamine B and control MO at oogenesis III stage GV Oocyte ctrl total RNA seq rep2 All STEM seq datasets were mapped to the danRer7 reference genome by Bismark Krueger and Andrews 2011. Reads were trimmed with cutadaptor Martin 2011 using parameters: minimum length 20 pair filter=any. Alignments were performed with the following parameters: N 1 X 600 score min L 0 0.6. Multi mapped reads and PCR duplicates were removed. bismark methylation extractor was used to calculate the DNA methylation level. Total RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer7 by STAR version: STAR 2.5.3a modified Dobin et al. 2013 with the following parameters: outSAMstrandField intronMotif outSAMattributes All outSAMunmapped Within outSAMattrIHstart 0 outWigStrand Stranded outFilterMultimapNmax 20 twopassMode Basic. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1 Trapnell et al. 2012. The scRNA seq data were processed with Cell Ranger 3.1 for genome alignment danRer10 transcript counting and gene cell barcode matrix generation. Before the downstream analysis cells with unique detected genes lower than <2 000 and higher than 6 000 genes were discarded and cells with high percentage of mitochondrial genes >5% were removed too. Subtypes of cells were identified with Seurat 3.0 through the integrating of control and mKD embryos at dome and shield stages with setting control embryos as reference. To make the data comparable samples we performed SCTransform normalization separately for each dataset. To further reduce the bais caused by sequencing depth of scRNA seq and percentage of mitochondrial genes UMI variance and percent.mt were regressed out from SCTransform normalized data matrix by linear model with negative binomial distribution. All ChIP seq reads were aligned to the zebrafish reference genome danRer7 using Bowtie2 version 2.2.2 L… oocyte Briefly on the first day of OMIS Wu et al. 2018b adult females at 5 mpf 12 mpf were anesthetized in 550 µg/ml tricaine Sigma Cat A5040 in a petri dish. Then the fish was placed on a damp sponge with specific buffer 5.4 mM KCl 136.8 mM NaCl 4.2 mM NaHCO3 0.44 mM KH2PO4 0.25 mM Na2HPO4 and 0.5% wt/vol BSA. A cut was made on one side of belly to expose the ovary. The diluted MOs were microinjected into each oocyte. Rhodamine B Sigma Cat R8881 was co injected with MOs as a dye. post injection the wound on the belly was sewed with a surgical sewing needle carefully and quickly. Once the operation was done the female was transferred into fish water supplemented with 32 µg/ml tricaine 10 unit/ml penicillin and 10 µg/ml streptomycin HyClone Cat SV30010. Then the fish was transferred to fish water containing gradually reduced concentrations of tricaine. In the evening of the second day the female was paired with a wild type male. In the morning of the third day the pair started to chase and lay fertilized eggs naturally. The injected oocyte derived embryos were identified by co injected dye rhodamine B at very early developmental stages. The injection doses of standard control MO cMO were 5 ng per oocyte in the same assay. MOs were dissolved in RNase free water and heated to 65°C for 10 min before microinjection. The oocytes were dechorionated manually by tweezers and transferred into 750 µl Trizol Invitrogen Cat 15596018. About 10 fresh embryos were transferred into Trizol and vortexed until no visible particles. 150 µl chloroform Amresco Cat 0757 was added and mixed thoroughly. The mixture was then transferred into phasemaker tube Invitrogen Cat A33248 and spun at 14 000 rpm for 15 min. Next the top phase was taken out from the tube added 1 µl LPA Sigma Cat 56575 and mixed well using pipettes. Then RNA was precipitated by adding 750 µl isopropanol Sigma Cat 59304 at 20℃ overnight. At next day the tube was spun at 14 000 rpm for 30 min and supernatant was removed. The pellet was washed with freshly 70% ethanol re suspend in 20 µl RNase free water and stored at 80℃ for later usage. NEBNext rRNA Depletion Kit NEB Cat E6310S was used to deplete ribosomal RNA according to the manufacture’s instruction. Briefly rRNA were hybridized with probes and digested with RNase H then excess probes were digested with DNase I. post that NEBNext RNA sample purification beads were used to purify rRNA depleted RNA. Purified RNA was fragmented before cDNA synthesis at 95℃ for 8 min. Double stranded cDNA was synthesized with NEB Next first strand NEB Cat E7771S and second strand synthesis modules NEB Cat E7550S then purified with Ampure XP beads Beckman Cat A63882. Synthesized cDNA was subjected to library preparation with NEBNext Ultr II DNA Library Prep Kit NEB Cat E7645S. DNA was end repaired adenylated and ligated to TruSeq sequencing adaptors. DNA were amplified using KAPA HF HotStart ReadyMix KAPABiosystem Cat RR2602. The amplified DNA was size selected using Ampure XP beads for 200 500 bp DNA fragments. All libraries were sequenced by Illumina Hi Seq 1500 or 2500 or XTen platform according to manufacturer’s instruction. The wild type AB strain was used in the experiments. The females post OMIS were fed with live adult brine shrimp thrice a day. All embryos were raised in Holtfreter’s solution at 28.5C and staged as described previously Kimmel et al. 1995. strain:AB|genotype:WT|developmental stage:Oocyte|tissue:oocyte|treatment:microinjection with Rhodamine B and control MO at oogenesis III stage GV GSM5351799 GSM5351799: Oocyte ctrl total RNA seq rep2; Danio rerio; RNA Seq GSM5351799   1 The oocytes were dechorionated manually by tweezers and transferred into 750 µl Trizol Invitrogen Cat 15596018. About 10 fresh embryos were transferred into Trizol and vortexed until no visible particles. 150 µl chloroform Amresco Cat 0757 was added and mixed thoroughly. The mixture was then transferred into phasemaker tube Invitrogen Cat A33248 and spun at 14 000 rpm for 15 min. Next the top phase was taken out from the tube added 1 µl LPA Sigma Cat 56575 and mixed well using pipettes. Then RNA was precipitated by adding 750 µl isopropanol Sigma Cat 59304 at 20℃ overnight. At next day the tube was spun at 14 000 rpm for 30 min and supernatant was removed. The pellet was washed with freshly 70% ethanol re suspend in 20 µl RNase free water and stored at 80℃ for later usage. NEBNext rRNA Depletion Kit NEB Cat E6310S was used to deplete ribosomal RNA according to the manufacture's instruction. Briefly rRNA were hybridized with probes and digested with RNase H then excess probes were digested with DNase I. post that NEBNext RNA sample purification beads were used to purify rRNA depleted RNA. Purified RNA was fragmented before cDNA synthesis at 95℃ for 8 min. Double stranded cDNA was synthesized with NEB Next first strand NEB Cat E7771S and second strand synthesis modules NEB Cat E7550S then purified with Ampure XP beads Beckman Cat A63882. Synthesized cDNA was subjected to library preparation with NEBNext Ultr II DNA Library Prep Kit NEB Cat E7645S. DNA was end repaired adenylated and ligated to TruSeq sequencing adaptors. DNA were amplified using KAPA HF HotStart ReadyMix KAPABiosystem Cat RR2602. The amplified DNA was size selected using Ampure XP beads for 200 500 bp DNA fragments. All libraries were sequenced by Illumina Hi Seq 1500 or 2500 or XTen platform according to manufacturer's instruction. GEO Accession:GSM5351799 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 1500   SRP322195   loader:fastq load.py Oocyte_ctrl_total_RNA_seq_rep2_r1.fq.gz Oocyte_ctrl_total_RNA_seq_rep2_r2.fq.gz fastq fastq 8180427000.0 27268090.0 GSM5351799 r1 0:150 1:150 A:1694775525;C:2388512701;G:2446021403;T:1649171179;N:1946192 150 150     1694775525 2388512701 2446021403 1649171179 1946192 SRX11041444 SRS9110371 SRA1239365 GEO THU-PKU Center for Life Sciences, Tsinghua University 2 0.95217 0.95176 0.08629 0.08619 0.79387 0.79778 0.76806 0.80396 150 150 B B biological fallback assumption illumina hiseq_era unknown rrna_depletion nebnext sc_generic single_cell_generic generic-scrnaseq-only   China 2021-06-01 Zygote Embryo Oocyte Reproductive System
64470 64470 SRR14703421 SRX11041443 SRS9110372 SRP322195 PRJNA734348 Methylome inheritance and enhancer dememorization construct an epigenetic gate safeguarding embryonic programs GSE175951 Other Unlike that of mammals the total DNA methylome of many cold blooded vertebrates is globally inherited from gametes to early embryos. In zebrafish this is however accompanied by sweeping “dememorization” of enhancers prior to fertilization for sperm and just post fertilization for oocyte as they undergo full methylation and are not demethylated again until phylotypic stage. The significance of both global methylome inheritance and enhancer dememorization in early embryos remains largely unknown. Adding to the puzzles the zygotic mutant zebrafish of dnmt1 the major DNA methylation maintenance methyltransferase surprisingly can develop to term. To solve the role of DNA methylation in early development we generated zebrafish embryos derived from dnmt1 knocking down oocytes using a recently developed method OMIS microinjection in situ which successfully eliminated DNA methylation before zygotic genome activation. dnmt1 deficient embryos failed to initiate epiboly and died around gastrulation. This is in part caused by activation of immune response and p53 regulated apoptosis likely triggered by the derepression of transposable elements. Single cell RNA seq further revealed defective differentiation in these mutants. DNA methylation is also required for the establishment of repressive histone marks H3K27me3 and H2AK119ub. Strikingly the loss of DNA methylation leads to extensive derepression of somatic genes and enhancers which acquire ectopic H3K27ac accessible chromatin and H3K4me3. These somatic enhancers are preferentially CG rich and are bound by CG containing TFs. By contrast embryonic enhancers are generally CG poor methylation insensitive and are bound by CG less TFs. Hence the global DNA methylome inheritance is essential for vertebrate early development and enhancer dememorization resets an epigenetic gate that separates embryonic and somatic programs. Overall design: By employing MethylC seq total RNA seq scRNA seq CUT&RUN ChIP seq and ATAC seq in control and dnmt1 mKD embryos at oocyt…   pubmed:34936444   Oocyte ctrl total RNA seq rep1 GSM5351798   source name:oocyte|strain:AB|genotype:WT|developmental stage:Oocyte|tissue:oocyte|treatment:microinjection with Rhodamine B and control MO at oogenesis III stage GV Oocyte ctrl total RNA seq rep1 All STEM seq datasets were mapped to the danRer7 reference genome by Bismark Krueger and Andrews 2011. Reads were trimmed with cutadaptor Martin 2011 using parameters: minimum length 20 pair filter=any. Alignments were performed with the following parameters: N 1 X 600 score min L 0 0.6. Multi mapped reads and PCR duplicates were removed. bismark methylation extractor was used to calculate the DNA methylation level. Total RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer7 by STAR version: STAR 2.5.3a modified Dobin et al. 2013 with the following parameters: outSAMstrandField intronMotif outSAMattributes All outSAMunmapped Within outSAMattrIHstart 0 outWigStrand Stranded outFilterMultimapNmax 20 twopassMode Basic. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1 Trapnell et al. 2012. The scRNA seq data were processed with Cell Ranger 3.1 for genome alignment danRer10 transcript counting and gene cell barcode matrix generation. Before the downstream analysis cells with unique detected genes lower than <2 000 and higher than 6 000 genes were discarded and cells with high percentage of mitochondrial genes >5% were removed too. Subtypes of cells were identified with Seurat 3.0 through the integrating of control and mKD embryos at dome and shield stages with setting control embryos as reference. To make the data comparable samples we performed SCTransform normalization separately for each dataset. To further reduce the bais caused by sequencing depth of scRNA seq and percentage of mitochondrial genes UMI variance and percent.mt were regressed out from SCTransform normalized data matrix by linear model with negative binomial distribution. All ChIP seq reads were aligned to the zebrafish reference genome danRer7 using Bowtie2 version 2.2.2 L… oocyte Briefly on the first day of OMIS Wu et al. 2018b adult females at 5 mpf 12 mpf were anesthetized in 550 µg/ml tricaine Sigma Cat A5040 in a petri dish. Then the fish was placed on a damp sponge with specific buffer 5.4 mM KCl 136.8 mM NaCl 4.2 mM NaHCO3 0.44 mM KH2PO4 0.25 mM Na2HPO4 and 0.5% wt/vol BSA. A cut was made on one side of belly to expose the ovary. The diluted MOs were microinjected into each oocyte. Rhodamine B Sigma Cat R8881 was co injected with MOs as a dye. post injection the wound on the belly was sewed with a surgical sewing needle carefully and quickly. Once the operation was done the female was transferred into fish water supplemented with 32 µg/ml tricaine 10 unit/ml penicillin and 10 µg/ml streptomycin HyClone Cat SV30010. Then the fish was transferred to fish water containing gradually reduced concentrations of tricaine. In the evening of the second day the female was paired with a wild type male. In the morning of the third day the pair started to chase and lay fertilized eggs naturally. The injected oocyte derived embryos were identified by co injected dye rhodamine B at very early developmental stages. The injection doses of standard control MO cMO were 5 ng per oocyte in the same assay. MOs were dissolved in RNase free water and heated to 65°C for 10 min before microinjection. The oocytes were dechorionated manually by tweezers and transferred into 750 µl Trizol Invitrogen Cat 15596018. About 10 fresh embryos were transferred into Trizol and vortexed until no visible particles. 150 µl chloroform Amresco Cat 0757 was added and mixed thoroughly. The mixture was then transferred into phasemaker tube Invitrogen Cat A33248 and spun at 14 000 rpm for 15 min. Next the top phase was taken out from the tube added 1 µl LPA Sigma Cat 56575 and mixed well using pipettes. Then RNA was precipitated by adding 750 µl isopropanol Sigma Cat 59304 at 20℃ overnight. At next day the tube was spun at 14 000 rpm for 30 min and supernatant was removed. The pellet was washed with freshly 70% ethanol re suspend in 20 µl RNase free water and stored at 80℃ for later usage. NEBNext rRNA Depletion Kit NEB Cat E6310S was used to deplete ribosomal RNA according to the manufacture’s instruction. Briefly rRNA were hybridized with probes and digested with RNase H then excess probes were digested with DNase I. post that NEBNext RNA sample purification beads were used to purify rRNA depleted RNA. Purified RNA was fragmented before cDNA synthesis at 95℃ for 8 min. Double stranded cDNA was synthesized with NEB Next first strand NEB Cat E7771S and second strand synthesis modules NEB Cat E7550S then purified with Ampure XP beads Beckman Cat A63882. Synthesized cDNA was subjected to library preparation with NEBNext Ultr II DNA Library Prep Kit NEB Cat E7645S. DNA was end repaired adenylated and ligated to TruSeq sequencing adaptors. DNA were amplified using KAPA HF HotStart ReadyMix KAPABiosystem Cat RR2602. The amplified DNA was size selected using Ampure XP beads for 200 500 bp DNA fragments. All libraries were sequenced by Illumina Hi Seq 1500 or 2500 or XTen platform according to manufacturer’s instruction. The wild type AB strain was used in the experiments. The females post OMIS were fed with live adult brine shrimp thrice a day. All embryos were raised in Holtfreter’s solution at 28.5C and staged as described previously Kimmel et al. 1995. strain:AB|genotype:WT|developmental stage:Oocyte|tissue:oocyte|treatment:microinjection with Rhodamine B and control MO at oogenesis III stage GV GSM5351798 GSM5351798: Oocyte ctrl total RNA seq rep1; Danio rerio; RNA Seq GSM5351798   1 The oocytes were dechorionated manually by tweezers and transferred into 750 µl Trizol Invitrogen Cat 15596018. About 10 fresh embryos were transferred into Trizol and vortexed until no visible particles. 150 µl chloroform Amresco Cat 0757 was added and mixed thoroughly. The mixture was then transferred into phasemaker tube Invitrogen Cat A33248 and spun at 14 000 rpm for 15 min. Next the top phase was taken out from the tube added 1 µl LPA Sigma Cat 56575 and mixed well using pipettes. Then RNA was precipitated by adding 750 µl isopropanol Sigma Cat 59304 at 20℃ overnight. At next day the tube was spun at 14 000 rpm for 30 min and supernatant was removed. The pellet was washed with freshly 70% ethanol re suspend in 20 µl RNase free water and stored at 80℃ for later usage. NEBNext rRNA Depletion Kit NEB Cat E6310S was used to deplete ribosomal RNA according to the manufacture's instruction. Briefly rRNA were hybridized with probes and digested with RNase H then excess probes were digested with DNase I. post that NEBNext RNA sample purification beads were used to purify rRNA depleted RNA. Purified RNA was fragmented before cDNA synthesis at 95℃ for 8 min. Double stranded cDNA was synthesized with NEB Next first strand NEB Cat E7771S and second strand synthesis modules NEB Cat E7550S then purified with Ampure XP beads Beckman Cat A63882. Synthesized cDNA was subjected to library preparation with NEBNext Ultr II DNA Library Prep Kit NEB Cat E7645S. DNA was end repaired adenylated and ligated to TruSeq sequencing adaptors. DNA were amplified using KAPA HF HotStart ReadyMix KAPABiosystem Cat RR2602. The amplified DNA was size selected using Ampure XP beads for 200 500 bp DNA fragments. All libraries were sequenced by Illumina Hi Seq 1500 or 2500 or XTen platform according to manufacturer's instruction. GEO Accession:GSM5351798 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 1500   SRP322195   loader:fastq load.py Oocyte_ctrl_total_RNA_seq_rep1_r1.fq.gz Oocyte_ctrl_total_RNA_seq_rep1_r2.fq.gz fastq fastq 14857394100.0 49524647.0 GSM5351798 r1 0:150 1:150 A:2831227396;C:4590477521;G:4795177217;T:2639889839;N:622127 150 150     2831227396 4590477521 4795177217 2639889839 622127 SRX11041443 SRS9110372 SRA1239365 GEO THU-PKU Center for Life Sciences, Tsinghua University 2 0.96771 0.96848 0.26114 0.26288 0.83968 0.84356 0.80056 0.84647 150 150 B B biological fallback assumption illumina hiseq_era unknown rrna_depletion nebnext sc_generic single_cell_generic generic-scrnaseq-only   China 2021-06-01 Zygote Embryo Oocyte Reproductive System
68777 68777 SRR18188990 SRX14335888 SRS12150682 SRP362100 PRJNA811725 Single cell sequencing of zebra fish primordial germ cell PRJNA811725 Other Based on the transcriptome we constructed long non coding RNA lncRNA profile of zebrafish primordial germ cells PGCs to further discern functional lncRNA that might play role in PGCs development.         GC9   strain:kop:EGFP 3 primeUTR nanos primordial germ cell transgenic line|isolate:Based on green fluorescence single PGC was distinctively identified and picked out using a capillary tube|age:5hpf|dev stage:30% 50% epiboly|sex:not applicable|tissue:primordial germ cell|cell type:primordial germ cell|replicate:replicate3|BioSampleModel:Model organism or animal                 3pgc 3 3pgc 3 3pgc primordial germ cell from 5 hpf zebrafish embryos     RNA-Seq TRANSCRIPTOMIC SINGLE CELL RANDOM PAIRED ILLUMINA Illumina HiSeq 2500   SRP362100     GC9_R1.fq.gz GC9_R2.fq.gz fastq fastq 16392678600.0 54642262.0 GC9 R1.fq.gz 0:150 1:150 A:4548403510;C:3786937912;G:3801036342;T:4255236177;N:1064659 150 150     4548403510 3786937912 3801036342 4255236177 1064659 SRX14335888 SRS12150682 SRA1379556 Sun-Yat sen University|School of Marine Science Sun-Yat sen University 2 0.92711 0.93044 0.08622 0.08652 0.79693 0.80306 0.58096 0.58168 150 150 B B biological fallback assumption illumina hiseq_era unknown random_priming unknown sc single_cell_generic generic-scrnaseq-only   China 2022-03-02 Multi-stage Embryo Gonad Reproductive System
68778 68778 SRR18188991 SRX14335887 SRS12150683 SRP362100 PRJNA811725 Single cell sequencing of zebra fish primordial germ cell PRJNA811725 Other Based on the transcriptome we constructed long non coding RNA lncRNA profile of zebrafish primordial germ cells PGCs to further discern functional lncRNA that might play role in PGCs development.         GC4   strain:kop:EGFP 3 primeUTR nanos primordial germ cell transgenic line|isolate:Based on green fluorescence single PGC was distinctively identified and picked out using a capillary tube|age:5hpf|dev stage:30% 50% epiboly|sex:not applicable|tissue:primordial germ cell|cell type:primordial germ cell|replicate:replicate2|BioSampleModel:Model organism or animal                 2pgc 2 2pgc 2 2pgc primordial germ cell from 5 hpf zebrafish embryos     RNA-Seq TRANSCRIPTOMIC SINGLE CELL RANDOM PAIRED ILLUMINA Illumina HiSeq 2500   SRP362100     GC4_R1.fq.gz GC4_R2.fq.gz fastq fastq 14471348700.0 48237829.0 GC4 R1.fq.gz 0:150 1:150 A:4127039158;C:3211803959;G:3224340004;T:3907215356;N:950223 150 150     4127039158 3211803959 3224340004 3907215356 950223 SRX14335887 SRS12150683 SRA1379556 Sun-Yat sen University|School of Marine Science Sun-Yat sen University 2 0.91951 0.91886 0.14001 0.14043 0.75777 0.76605 0.55643 0.55313 150 150 B B biological fallback assumption illumina hiseq_era unknown random_priming unknown sc single_cell_generic generic-scrnaseq-only   China 2022-03-02 Multi-stage Embryo Gonad Reproductive System
68779 68779 SRR18188992 SRX14335886 SRS12150681 SRP362100 PRJNA811725 Single cell sequencing of zebra fish primordial germ cell PRJNA811725 Other Based on the transcriptome we constructed long non coding RNA lncRNA profile of zebrafish primordial germ cells PGCs to further discern functional lncRNA that might play role in PGCs development.         GC1   strain:kop:EGFP 3 primeUTR nanos primordial germ cell transgenic line|isolate:Based on green fluorescence single PGC was distinctively identified and picked out using a capillary tube|age:5hpf|dev stage:30% 50% epiboly|sex:not applicable|tissue:primordial germ cell|cell type:primordial germ cell|replicate:replicate1|BioSampleModel:Model organism or animal                 1pgc 1 1pgc 1 1pgc primordial germ cell from 5 hpf zebrafish embryos     RNA-Seq TRANSCRIPTOMIC SINGLE CELL RANDOM PAIRED ILLUMINA Illumina HiSeq 2500   SRP362100     GC1_R1.fq.gz GC1_R2.fq.gz fastq fastq 18801698100.0 62672327.0 GC1 R1.fq.gz 0:150 1:150 A:5242992703;C:4310290517;G:4334163362;T:4913025193;N:1226325 150 150     5242992703 4310290517 4334163362 4913025193 1226325 SRX14335886 SRS12150681 SRA1379556 Sun-Yat sen University|School of Marine Science Sun-Yat sen University 2 0.93192 0.93277 0.09532 0.09559 0.78358 0.7906 0.5661 0.56344 150 150 B B biological fallback assumption illumina hiseq_era unknown random_priming unknown sc single_cell_generic generic-scrnaseq-only   China 2022-03-02 Multi-stage Embryo Gonad Reproductive System

Advanced export

JSON shape: default, array, newline-delimited

CSV options: 

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;