run_metadata
34 rows where experiment.library_strategy = "RNA-Seq", experiment.platform = "ION_TORRENT" and tissue_curation = "Whole Organism"
This data as json, CSV (advanced)
| Link | rowid ▼ | run.accession | experiment.accession | sample.accession | study.accession | bioproject | study.title | study.alias | study.type | study.abstract | study.attributes | study.PMIDs | sample.description | sample.title | sample.alias | sample.centername | sample.attributes | GEOsample.title | GEOsample.dataprocessing | GEOsample.source | GEOsample.treatmentprotocol | GEOsample.extractprotocol | GEOsample.growthprotocol | GEOsample.characteristics | GEOsample.accession | experiment.title | experiment.alias | experiment.library_name | experiment.design_description | experiment.library_construction_protocol | experiment.attributes | experiment.library_strategy | experiment.library_source | experiment.library_selection | experiment.library_layout | experiment.platform | experiment.instrument_model | experiment.spot_descriptor | experiment.study_ref | run.title | run.attributes | run.filename | run.semantic_name | run.total_bases | run.total_spots | run.alias | run.read_lengths | run.base_counts | run.r1_length | run.r2_length | run.r3_length | run.r4_length | run.Acount | run.Ccount | run.Gcount | run.Tcount | run.Ncount | run.experiment | run.pool_member | submission.accession | submission.srasource | submission.bioprojectsource | seqdetective.n_mates | seqdetective.mapping_rate.mate1 | seqdetective.mapping_rate.mate2 | seqdetective.nofeature_rate.mate1 | seqdetective.nofeature_rate.mate2 | seqdetective.sparsity.mate1 | seqdetective.sparsity.mate2 | seqdetective.pos_strand_rate.mate1 | seqdetective.pos_strand_rate.mate2 | seqdetective.readlen.mate1 | seqdetective.readlen.mate2 | seqdetective.judgement.mate1 | seqdetective.judgement.mate2 | seqdetective.judgement.reason | platform_family | instrument_generation | read_bias | selection_class | prep_kit | sc_or_bulk | tech_class | technology | tech_variant | submission.bioprojectsource.country | earliest_date | devstage_curation | devstage_curation_coarse | tissue_curation | tissue_curation_coarse |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 43774 | 43774 | SRR6113350 | SRX3228188 | SRS2552755 | SRP119063 | PRJNA412499 | Analysis of gene expression changes by knock down of hace1 tumour suppressor in zebrafish | GSE104380 | Transcriptome Analysis | Background: In this study we reveal a previously undescribed role of the HACE1 HECT domain and Ankyrin repeat Containing E3 ubiquitin protein ligase 1 tumor suppressor protein in normal vertebrate heart development using the zebrafish Danio rerio model. We examined the link between the cardiac phenotypes associated with hace1 loss of function to the expression of the Rho small family GTPase rac1 which is a known target of HACE1 and promotes ROS production via its interaction with NADPH oxidase holoenzymes. We examined expression changes induced by knock down of hace1 in zebrafish at 48 hpf the stage when heart abnormalities are observed. This was done by collecting duplicate samples of control and hace1 morphant embryos and performing RNA sequencing on them. Conclusions: Our study demonstrates that HACE1 is critical in the normal development and proper function of the heart via a ROS dependent mechanism. Overall design: 2 samples of control and hace1 morphant zebrafish embryos at 48 hpf were analyzed | pubmed:29024245 | 48 hpf hace1 MO injected sample B | GSM2796627 | tissue:whole embryos|morpholino:hace1|strain:Tubingen|Stage:48 hpf | 48 hpf hace1 MO injected sample B | Torrent Suite 4.2.1 used for basecalling Trimming with Cutadapt v1.2.1 Second pass trimming with home made script in order to remove reads shorter than 17bp and larger than 300bp and Q<20 2 steps alignement for RNA with tophat v2.0.6 and bowtie2 v2.0.2 Quantification and normalization with StrandNGS Version 2.1 with the following settings Strand specific reads: false Consider partial reads: true Max EM Iterations: 1000 Convergence criterion for EM: 0.0010 Normalization Type = DeSeq Threshold for normalization = 1 Baseline type = median of all samples Genome build: Danio rerio Zv9 78 Transcripts 2015.01.22 Supplementary files format and content: tab delimited text files include normalised values or raw counts for each sample | whole embryos | The hace1 HECT 5’ CCCTCGAACTGTTAGACAGAATAAA 3’ and standard control morpholinos 5’ CCTCTTACCTCAGTTACAATTTATA 3’ were purchased from Genetools LLC Philomath OR. The hace1 morpholino splice site resides within the catalytically active HECT domain upstream of the critical cysteine residue required for hace1 ubiquitin ligase function. Knockdown of hace1 was verified by RT PCR as described in Daugaard et al Daugaard et al. 2013. | TRIzol Reagent RNA Extraction protocol Ambion RNA Life technologies was used to extract RNA from pooled samples of hace1 or control morphants n=6 per group. Approximately 100 embryos per sample were used. Tubingen wild type strain TU fish were previously injected with either hace1 MO or control MO using the injection protocol noted above. RNA samples were quantified using the NanoDrop Spectrophotometer ND 1000 Thermo Fisher Scientific Wilmington DE. RNA yields for this experiment were lower than the 100µg of RNA needed for RNA sequencing so 3 samples were pooled into one for a final n=2 for each of the hace1 MO and control MO groups. Barcoded cDNA libraries were prepared using RNA Seq Version 2 kit from Life Technologies following their recommended protocol. Library preparations were assayed for both quality control and quantity using Experion DNA 1K chip Life Technologies and diluted to 16 pM concentration. Samples were sequenced using a Proton Sequencer from Life Technologies on a PI chip following the manufacturer recommended protocol. Each chip was loaded with 2 samples. | Zebrafish housing breeding conditions and developmental staging of larvae were performed according to Westerfield Westerfield 2000. Use of zebrafish in this study was approved by the Dalhousie University Committee on Laboratory Animals Protocol 15 123. All zebrafish embryos were maintained in E3 embryo medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 in 10 cm Petri dishes at 28oC. | morpholino:hace1|strain:Tubingen|Stage:48 hpf | GSM2796627 | GSM2796627: 48 hpf hace1 MO injected sample B; Danio rerio; RNA Seq | GSM2796627 | 1 | TRIzol Reagent RNA Extraction protocol Ambion RNA Life technologies was used to extract RNA from pooled samples of hace1 or control morphants n=6 per group. Approximately 100 embryos per sample were used. Tubingen wild type strain TU fish were previously injected with either hace1 MO or control MO using the injection protocol noted above. RNA samples were quantified using the NanoDrop Spectrophotometer ND 1000 Thermo Fisher Scientific Wilmington DE. RNA yields for this experiment were lower than the 100µg of RNA needed for RNA sequencing so 3 samples were pooled into one for a final n=2 for each of the hace1 MO and control MO groups. Barcoded cDNA libraries were prepared using RNA Seq Version 2 kit from Life Technologies following their recommended protocol. Library preparations were assayed for both quality control and quantity using Experion DNA 1K chip Life Technologies and diluted to 16 pM concentration. Samples were sequenced using a Proton Sequencer from Life Technologies on a PI chip following the manufacturer recommended protocol. Each chip was loaded with 2 samples. | GEO Accession:GSM2796627 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ION_TORRENT | Ion Torrent Proton | SRP119063 | Hace1_B_raw.fastq.gz | fastq | 1757670144.0 | 24750483.0 | GSM2796627 r1 | 0:71.02 | A:487716171;C:407071737;G:421621529;T:441260707;N:0 | 71 | 487716171 | 407071737 | 421621529 | 441260707 | 0 | SRX3228188 | SRS2552755 | SRA615148 | GEO | Life Sciences Research Institute | 1 | 0.58062 | 0.04606 | 0.7933 | 0.45369 | 113 | B | usable mapping rate | ion_torrent | ion_torrent | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | Canada | 2017-09-28 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 43775 | 43775 | SRR6113349 | SRX3228187 | SRS2552754 | SRP119063 | PRJNA412499 | Analysis of gene expression changes by knock down of hace1 tumour suppressor in zebrafish | GSE104380 | Transcriptome Analysis | Background: In this study we reveal a previously undescribed role of the HACE1 HECT domain and Ankyrin repeat Containing E3 ubiquitin protein ligase 1 tumor suppressor protein in normal vertebrate heart development using the zebrafish Danio rerio model. We examined the link between the cardiac phenotypes associated with hace1 loss of function to the expression of the Rho small family GTPase rac1 which is a known target of HACE1 and promotes ROS production via its interaction with NADPH oxidase holoenzymes. We examined expression changes induced by knock down of hace1 in zebrafish at 48 hpf the stage when heart abnormalities are observed. This was done by collecting duplicate samples of control and hace1 morphant embryos and performing RNA sequencing on them. Conclusions: Our study demonstrates that HACE1 is critical in the normal development and proper function of the heart via a ROS dependent mechanism. Overall design: 2 samples of control and hace1 morphant zebrafish embryos at 48 hpf were analyzed | pubmed:29024245 | 48 hpf hace1 MO injected sample A | GSM2796626 | tissue:whole embryos|morpholino:hace1|strain:Tubingen|Stage:48 hpf | 48 hpf hace1 MO injected sample A | Torrent Suite 4.2.1 used for basecalling Trimming with Cutadapt v1.2.1 Second pass trimming with home made script in order to remove reads shorter than 17bp and larger than 300bp and Q<20 2 steps alignement for RNA with tophat v2.0.6 and bowtie2 v2.0.2 Quantification and normalization with StrandNGS Version 2.1 with the following settings Strand specific reads: false Consider partial reads: true Max EM Iterations: 1000 Convergence criterion for EM: 0.0010 Normalization Type = DeSeq Threshold for normalization = 1 Baseline type = median of all samples Genome build: Danio rerio Zv9 78 Transcripts 2015.01.22 Supplementary files format and content: tab delimited text files include normalised values or raw counts for each sample | whole embryos | The hace1 HECT 5’ CCCTCGAACTGTTAGACAGAATAAA 3’ and standard control morpholinos 5’ CCTCTTACCTCAGTTACAATTTATA 3’ were purchased from Genetools LLC Philomath OR. The hace1 morpholino splice site resides within the catalytically active HECT domain upstream of the critical cysteine residue required for hace1 ubiquitin ligase function. Knockdown of hace1 was verified by RT PCR as described in Daugaard et al Daugaard et al. 2013. | TRIzol Reagent RNA Extraction protocol Ambion RNA Life technologies was used to extract RNA from pooled samples of hace1 or control morphants n=6 per group. Approximately 100 embryos per sample were used. Tubingen wild type strain TU fish were previously injected with either hace1 MO or control MO using the injection protocol noted above. RNA samples were quantified using the NanoDrop Spectrophotometer ND 1000 Thermo Fisher Scientific Wilmington DE. RNA yields for this experiment were lower than the 100µg of RNA needed for RNA sequencing so 3 samples were pooled into one for a final n=2 for each of the hace1 MO and control MO groups. Barcoded cDNA libraries were prepared using RNA Seq Version 2 kit from Life Technologies following their recommended protocol. Library preparations were assayed for both quality control and quantity using Experion DNA 1K chip Life Technologies and diluted to 16 pM concentration. Samples were sequenced using a Proton Sequencer from Life Technologies on a PI chip following the manufacturer recommended protocol. Each chip was loaded with 2 samples. | Zebrafish housing breeding conditions and developmental staging of larvae were performed according to Westerfield Westerfield 2000. Use of zebrafish in this study was approved by the Dalhousie University Committee on Laboratory Animals Protocol 15 123. All zebrafish embryos were maintained in E3 embryo medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 in 10 cm Petri dishes at 28oC. | morpholino:hace1|strain:Tubingen|Stage:48 hpf | GSM2796626 | GSM2796626: 48 hpf hace1 MO injected sample A; Danio rerio; RNA Seq | GSM2796626 | 1 | TRIzol Reagent RNA Extraction protocol Ambion RNA Life technologies was used to extract RNA from pooled samples of hace1 or control morphants n=6 per group. Approximately 100 embryos per sample were used. Tubingen wild type strain TU fish were previously injected with either hace1 MO or control MO using the injection protocol noted above. RNA samples were quantified using the NanoDrop Spectrophotometer ND 1000 Thermo Fisher Scientific Wilmington DE. RNA yields for this experiment were lower than the 100µg of RNA needed for RNA sequencing so 3 samples were pooled into one for a final n=2 for each of the hace1 MO and control MO groups. Barcoded cDNA libraries were prepared using RNA Seq Version 2 kit from Life Technologies following their recommended protocol. Library preparations were assayed for both quality control and quantity using Experion DNA 1K chip Life Technologies and diluted to 16 pM concentration. Samples were sequenced using a Proton Sequencer from Life Technologies on a PI chip following the manufacturer recommended protocol. Each chip was loaded with 2 samples. | GEO Accession:GSM2796626 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ION_TORRENT | Ion Torrent Proton | SRP119063 | Hace1_A_raw.fastq.gz | fastq | 1715877862.0 | 25355156.0 | GSM2796626 r1 | 0:67.67 | A:472676520;C:396977327;G:417115591;T:429108424;N:0 | 67 | 472676520 | 396977327 | 417115591 | 429108424 | 0 | SRX3228187 | SRS2552754 | SRA615148 | GEO | Life Sciences Research Institute | 1 | 0.62221 | 0.05775 | 0.80373 | 0.45358 | 13 | B | usable mapping rate | ion_torrent | ion_torrent | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | Canada | 2017-09-28 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 43776 | 43776 | SRR6113348 | SRX3228186 | SRS2552753 | SRP119063 | PRJNA412499 | Analysis of gene expression changes by knock down of hace1 tumour suppressor in zebrafish | GSE104380 | Transcriptome Analysis | Background: In this study we reveal a previously undescribed role of the HACE1 HECT domain and Ankyrin repeat Containing E3 ubiquitin protein ligase 1 tumor suppressor protein in normal vertebrate heart development using the zebrafish Danio rerio model. We examined the link between the cardiac phenotypes associated with hace1 loss of function to the expression of the Rho small family GTPase rac1 which is a known target of HACE1 and promotes ROS production via its interaction with NADPH oxidase holoenzymes. We examined expression changes induced by knock down of hace1 in zebrafish at 48 hpf the stage when heart abnormalities are observed. This was done by collecting duplicate samples of control and hace1 morphant embryos and performing RNA sequencing on them. Conclusions: Our study demonstrates that HACE1 is critical in the normal development and proper function of the heart via a ROS dependent mechanism. Overall design: 2 samples of control and hace1 morphant zebrafish embryos at 48 hpf were analyzed | pubmed:29024245 | 48 hpf control MO injected sample B | GSM2796625 | tissue:whole embryos|morpholino:control|strain:Tubingen|Stage:48 hpf | 48 hpf control MO injected sample B | Torrent Suite 4.2.1 used for basecalling Trimming with Cutadapt v1.2.1 Second pass trimming with home made script in order to remove reads shorter than 17bp and larger than 300bp and Q<20 2 steps alignement for RNA with tophat v2.0.6 and bowtie2 v2.0.2 Quantification and normalization with StrandNGS Version 2.1 with the following settings Strand specific reads: false Consider partial reads: true Max EM Iterations: 1000 Convergence criterion for EM: 0.0010 Normalization Type = DeSeq Threshold for normalization = 1 Baseline type = median of all samples Genome build: Danio rerio Zv9 78 Transcripts 2015.01.22 Supplementary files format and content: tab delimited text files include normalised values or raw counts for each sample | whole embryos | The hace1 HECT 5’ CCCTCGAACTGTTAGACAGAATAAA 3’ and standard control morpholinos 5’ CCTCTTACCTCAGTTACAATTTATA 3’ were purchased from Genetools LLC Philomath OR. The hace1 morpholino splice site resides within the catalytically active HECT domain upstream of the critical cysteine residue required for hace1 ubiquitin ligase function. Knockdown of hace1 was verified by RT PCR as described in Daugaard et al Daugaard et al. 2013. | TRIzol Reagent RNA Extraction protocol Ambion RNA Life technologies was used to extract RNA from pooled samples of hace1 or control morphants n=6 per group. Approximately 100 embryos per sample were used. Tubingen wild type strain TU fish were previously injected with either hace1 MO or control MO using the injection protocol noted above. RNA samples were quantified using the NanoDrop Spectrophotometer ND 1000 Thermo Fisher Scientific Wilmington DE. RNA yields for this experiment were lower than the 100µg of RNA needed for RNA sequencing so 3 samples were pooled into one for a final n=2 for each of the hace1 MO and control MO groups. Barcoded cDNA libraries were prepared using RNA Seq Version 2 kit from Life Technologies following their recommended protocol. Library preparations were assayed for both quality control and quantity using Experion DNA 1K chip Life Technologies and diluted to 16 pM concentration. Samples were sequenced using a Proton Sequencer from Life Technologies on a PI chip following the manufacturer recommended protocol. Each chip was loaded with 2 samples. | Zebrafish housing breeding conditions and developmental staging of larvae were performed according to Westerfield Westerfield 2000. Use of zebrafish in this study was approved by the Dalhousie University Committee on Laboratory Animals Protocol 15 123. All zebrafish embryos were maintained in E3 embryo medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 in 10 cm Petri dishes at 28oC. | morpholino:control|strain:Tubingen|Stage:48 hpf | GSM2796625 | GSM2796625: 48 hpf control MO injected sample B; Danio rerio; RNA Seq | GSM2796625 | 1 | TRIzol Reagent RNA Extraction protocol Ambion RNA Life technologies was used to extract RNA from pooled samples of hace1 or control morphants n=6 per group. Approximately 100 embryos per sample were used. Tubingen wild type strain TU fish were previously injected with either hace1 MO or control MO using the injection protocol noted above. RNA samples were quantified using the NanoDrop Spectrophotometer ND 1000 Thermo Fisher Scientific Wilmington DE. RNA yields for this experiment were lower than the 100µg of RNA needed for RNA sequencing so 3 samples were pooled into one for a final n=2 for each of the hace1 MO and control MO groups. Barcoded cDNA libraries were prepared using RNA Seq Version 2 kit from Life Technologies following their recommended protocol. Library preparations were assayed for both quality control and quantity using Experion DNA 1K chip Life Technologies and diluted to 16 pM concentration. Samples were sequenced using a Proton Sequencer from Life Technologies on a PI chip following the manufacturer recommended protocol. Each chip was loaded with 2 samples. | GEO Accession:GSM2796625 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ION_TORRENT | Ion Torrent Proton | SRP119063 | Ctl_B_raw.fastq.gz | fastq | 1645083935.0 | 24006365.0 | GSM2796625 r1 | 0:68.53 | A:451390140;C:379131185;G:405300969;T:409261641;N:0 | 68 | 451390140 | 379131185 | 405300969 | 409261641 | 0 | SRX3228186 | SRS2552753 | SRA615148 | GEO | Life Sciences Research Institute | 1 | 0.70292 | 0.09465 | 0.78776 | 0.4826 | 50 | B | usable mapping rate | ion_torrent | ion_torrent | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | Canada | 2017-09-28 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 43777 | 43777 | SRR6113347 | SRX3228185 | SRS2552752 | SRP119063 | PRJNA412499 | Analysis of gene expression changes by knock down of hace1 tumour suppressor in zebrafish | GSE104380 | Transcriptome Analysis | Background: In this study we reveal a previously undescribed role of the HACE1 HECT domain and Ankyrin repeat Containing E3 ubiquitin protein ligase 1 tumor suppressor protein in normal vertebrate heart development using the zebrafish Danio rerio model. We examined the link between the cardiac phenotypes associated with hace1 loss of function to the expression of the Rho small family GTPase rac1 which is a known target of HACE1 and promotes ROS production via its interaction with NADPH oxidase holoenzymes. We examined expression changes induced by knock down of hace1 in zebrafish at 48 hpf the stage when heart abnormalities are observed. This was done by collecting duplicate samples of control and hace1 morphant embryos and performing RNA sequencing on them. Conclusions: Our study demonstrates that HACE1 is critical in the normal development and proper function of the heart via a ROS dependent mechanism. Overall design: 2 samples of control and hace1 morphant zebrafish embryos at 48 hpf were analyzed | pubmed:29024245 | 48 hpf control MO injected sample A | GSM2796624 | tissue:whole embryos|morpholino:control|strain:Tubingen|Stage:48 hpf | 48 hpf control MO injected sample A | Torrent Suite 4.2.1 used for basecalling Trimming with Cutadapt v1.2.1 Second pass trimming with home made script in order to remove reads shorter than 17bp and larger than 300bp and Q<20 2 steps alignement for RNA with tophat v2.0.6 and bowtie2 v2.0.2 Quantification and normalization with StrandNGS Version 2.1 with the following settings Strand specific reads: false Consider partial reads: true Max EM Iterations: 1000 Convergence criterion for EM: 0.0010 Normalization Type = DeSeq Threshold for normalization = 1 Baseline type = median of all samples Genome build: Danio rerio Zv9 78 Transcripts 2015.01.22 Supplementary files format and content: tab delimited text files include normalised values or raw counts for each sample | whole embryos | The hace1 HECT 5’ CCCTCGAACTGTTAGACAGAATAAA 3’ and standard control morpholinos 5’ CCTCTTACCTCAGTTACAATTTATA 3’ were purchased from Genetools LLC Philomath OR. The hace1 morpholino splice site resides within the catalytically active HECT domain upstream of the critical cysteine residue required for hace1 ubiquitin ligase function. Knockdown of hace1 was verified by RT PCR as described in Daugaard et al Daugaard et al. 2013. | TRIzol Reagent RNA Extraction protocol Ambion RNA Life technologies was used to extract RNA from pooled samples of hace1 or control morphants n=6 per group. Approximately 100 embryos per sample were used. Tubingen wild type strain TU fish were previously injected with either hace1 MO or control MO using the injection protocol noted above. RNA samples were quantified using the NanoDrop Spectrophotometer ND 1000 Thermo Fisher Scientific Wilmington DE. RNA yields for this experiment were lower than the 100µg of RNA needed for RNA sequencing so 3 samples were pooled into one for a final n=2 for each of the hace1 MO and control MO groups. Barcoded cDNA libraries were prepared using RNA Seq Version 2 kit from Life Technologies following their recommended protocol. Library preparations were assayed for both quality control and quantity using Experion DNA 1K chip Life Technologies and diluted to 16 pM concentration. Samples were sequenced using a Proton Sequencer from Life Technologies on a PI chip following the manufacturer recommended protocol. Each chip was loaded with 2 samples. | Zebrafish housing breeding conditions and developmental staging of larvae were performed according to Westerfield Westerfield 2000. Use of zebrafish in this study was approved by the Dalhousie University Committee on Laboratory Animals Protocol 15 123. All zebrafish embryos were maintained in E3 embryo medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 in 10 cm Petri dishes at 28oC. | morpholino:control|strain:Tubingen|Stage:48 hpf | GSM2796624 | GSM2796624: 48 hpf control MO injected sample A; Danio rerio; RNA Seq | GSM2796624 | 1 | TRIzol Reagent RNA Extraction protocol Ambion RNA Life technologies was used to extract RNA from pooled samples of hace1 or control morphants n=6 per group. Approximately 100 embryos per sample were used. Tubingen wild type strain TU fish were previously injected with either hace1 MO or control MO using the injection protocol noted above. RNA samples were quantified using the NanoDrop Spectrophotometer ND 1000 Thermo Fisher Scientific Wilmington DE. RNA yields for this experiment were lower than the 100µg of RNA needed for RNA sequencing so 3 samples were pooled into one for a final n=2 for each of the hace1 MO and control MO groups. Barcoded cDNA libraries were prepared using RNA Seq Version 2 kit from Life Technologies following their recommended protocol. Library preparations were assayed for both quality control and quantity using Experion DNA 1K chip Life Technologies and diluted to 16 pM concentration. Samples were sequenced using a Proton Sequencer from Life Technologies on a PI chip following the manufacturer recommended protocol. Each chip was loaded with 2 samples. | GEO Accession:GSM2796624 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ION_TORRENT | Ion Torrent Proton | SRP119063 | Ctl_A_raw.fastq.gz | fastq | 1286925679.0 | 21135316.0 | GSM2796624 r1 | 0:60.89 | A:358307800;C:293470722;G:312171155;T:322976002;N:0 | 60 | 358307800 | 293470722 | 312171155 | 322976002 | 0 | SRX3228185 | SRS2552752 | SRA615148 | GEO | Life Sciences Research Institute | 1 | 0.65876 | 0.09304 | 0.77441 | 0.48609 | 15 | B | usable mapping rate | ion_torrent | ion_torrent | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | Canada | 2017-09-28 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 55735 | 55735 | SRR10747736 | SRX7423118 | SRS5869238 | SRP238398 | PRJNA597022 | RNA seq analysis of gene regulation by miR 34a and expression changes induced by DNA damage in zebrafish | GSE142440 | Transcriptome Analysis | Li Fraumeni syndrome LFS is a disorder due to inherited mutations in the TP53 gene resulting in an increased risk of developing several types of cancer. MicroRNA miR 34a has been implicated downstream of p53 on the basis of being a direct transcriptional target and when over expressed having pro apoptotic phenotypes in cell lines. Moreover miR 34a has been shown to be a modifier gene in the context of LFS since its epigenetic silencing increases the likelihood of tumour development in patients with mutant TP53. However the in vivo consequences of miR 34 loss are still unclear. For example mice lacking all three a b c miR 34 homologs show no detectable abnormalities in p53 responses. The relative expression of different miR 34 genes in zebrafish was studied using qRT PCR with specific assays. The miR 34a miR 34b and miR 34c display unique onset of developmental expression and expression levels with miR 34a being the most abundant and constant in expression. All of the miR 34 genes also showed clear induction by p53 when DNA damaging treatments are performed. Using CRISPR Cas9 technology we generated a zebrafish miR 34a deletion mutant to further investigate the roles of miR 34a on its own and its association with the p53 pathway. Predictably a miR 34a deletion mutant demonstrated absence of miR 34a though without xxx 34b and miR 34c compensation beyond baseline expression levels. Mutants survive to maturity show no overt phenotypes and have normal apoptotic responses to DNA damaging irradiation or camptothecin treatments. To further explore the effects of miR 34a we performed gene expression profiling using RNA seq of wild type and miR 34a deletion mutant zebrafish embryos at 28 hpf with or without xxx with a DNA damaging drug camptothecin. The results of this RNA seq experiments showed that the loss of miR 34a does not strongly affect induction of genes by DNA damage. However the overall pattern of gene expression is significantly different as shown by Principal Component Analysis and there is a gr… | 28 hpf miR 34a / treated with 1μM CPT rep3 | GSM4227412 | tissue:whole embryo|genotype:miR 34a / |Stage:28 hpf|treatment:4 hours with 1μM camptothecin | 28 hpf miR 34a / treated with 1μM CPT rep3 | Read trimming: the raw reads had the adapters “ATCACCGAC” removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts | whole embryo | Camptothecin CPT treatments were performed by adding either DMSO control groups or the 2 mM stock CPT solution in DMSO to fish water for 1 µM concentration and incubating embryos for 4 hours. | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University of Ottawa Animal Care Committee approval number: CHEOe 3168 A1. Zebrafish embryos were maintained at 28.5 °C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock. | genotype:miR 34a / |Stage:28 hpf|treatment:4 hours with 1μM camptothecin | GSM4227412 | GSM4227412: 28 hpf miR 34a / treated with 1μM CPT rep3; Danio rerio; RNA Seq | GSM4227412 | 1 | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | GEO Accession:GSM4227412 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ION_TORRENT | Ion Torrent Proton | SRP238398 | 28h_miR34a_CPT3.fastq.gz | fastq | 2466204640.0 | 30514491.0 | GSM4227412 r1 | 0:80.82 | A:674261100;C:584057064;G:643569450;T:564317026;N:0 | 80 | 674261100 | 584057064 | 643569450 | 564317026 | 0 | SRX7423118 | SRS5869238 | SRA1014962 | GEO | Berman Lab, CHEO Research Institute/University of Ottawa | 1 | 0.75398 | 0.07249 | 0.75018 | 0.47891 | 61 | B | usable mapping rate | ion_torrent | ion_torrent | full_length | poly_a | unknown | bulk | unknown | unknown | Canada | 2019-12-20 | Pharyngula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 55736 | 55736 | SRR10747735 | SRX7423117 | SRS5869237 | SRP238398 | PRJNA597022 | RNA seq analysis of gene regulation by miR 34a and expression changes induced by DNA damage in zebrafish | GSE142440 | Transcriptome Analysis | Li Fraumeni syndrome LFS is a disorder due to inherited mutations in the TP53 gene resulting in an increased risk of developing several types of cancer. MicroRNA miR 34a has been implicated downstream of p53 on the basis of being a direct transcriptional target and when over expressed having pro apoptotic phenotypes in cell lines. Moreover miR 34a has been shown to be a modifier gene in the context of LFS since its epigenetic silencing increases the likelihood of tumour development in patients with mutant TP53. However the in vivo consequences of miR 34 loss are still unclear. For example mice lacking all three a b c miR 34 homologs show no detectable abnormalities in p53 responses. The relative expression of different miR 34 genes in zebrafish was studied using qRT PCR with specific assays. The miR 34a miR 34b and miR 34c display unique onset of developmental expression and expression levels with miR 34a being the most abundant and constant in expression. All of the miR 34 genes also showed clear induction by p53 when DNA damaging treatments are performed. Using CRISPR Cas9 technology we generated a zebrafish miR 34a deletion mutant to further investigate the roles of miR 34a on its own and its association with the p53 pathway. Predictably a miR 34a deletion mutant demonstrated absence of miR 34a though without xxx 34b and miR 34c compensation beyond baseline expression levels. Mutants survive to maturity show no overt phenotypes and have normal apoptotic responses to DNA damaging irradiation or camptothecin treatments. To further explore the effects of miR 34a we performed gene expression profiling using RNA seq of wild type and miR 34a deletion mutant zebrafish embryos at 28 hpf with or without xxx with a DNA damaging drug camptothecin. The results of this RNA seq experiments showed that the loss of miR 34a does not strongly affect induction of genes by DNA damage. However the overall pattern of gene expression is significantly different as shown by Principal Component Analysis and there is a gr… | 28 hpf miR 34a / treated with 1μM CPT rep2 | GSM4227411 | tissue:whole embryo|genotype:miR 34a / |Stage:28 hpf|treatment:4 hours with 1μM camptothecin | 28 hpf miR 34a / treated with 1μM CPT rep2 | Read trimming: the raw reads had the adapters “ATCACCGAC” removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts | whole embryo | Camptothecin CPT treatments were performed by adding either DMSO control groups or the 2 mM stock CPT solution in DMSO to fish water for 1 µM concentration and incubating embryos for 4 hours. | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University of Ottawa Animal Care Committee approval number: CHEOe 3168 A1. Zebrafish embryos were maintained at 28.5 °C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock. | genotype:miR 34a / |Stage:28 hpf|treatment:4 hours with 1μM camptothecin | GSM4227411 | GSM4227411: 28 hpf miR 34a / treated with 1μM CPT rep2; Danio rerio; RNA Seq | GSM4227411 | 1 | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | GEO Accession:GSM4227411 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ION_TORRENT | Ion Torrent Proton | SRP238398 | 28h_miR34a_CPT2.fastq.gz | fastq | 2799449877.0 | 35729096.0 | GSM4227411 r1 | 0:78.35 | A:774111861;C:655625280;G:720330370;T:649382366;N:0 | 78 | 774111861 | 655625280 | 720330370 | 649382366 | 0 | SRX7423117 | SRS5869237 | SRA1014962 | GEO | Berman Lab, CHEO Research Institute/University of Ottawa | 1 | 0.75821 | 0.06442 | 0.75528 | 0.47533 | 39 | B | usable mapping rate | ion_torrent | ion_torrent | full_length | poly_a | unknown | bulk | unknown | unknown | Canada | 2019-12-20 | Pharyngula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 55737 | 55737 | SRR10747734 | SRX7423116 | SRS5869236 | SRP238398 | PRJNA597022 | RNA seq analysis of gene regulation by miR 34a and expression changes induced by DNA damage in zebrafish | GSE142440 | Transcriptome Analysis | Li Fraumeni syndrome LFS is a disorder due to inherited mutations in the TP53 gene resulting in an increased risk of developing several types of cancer. MicroRNA miR 34a has been implicated downstream of p53 on the basis of being a direct transcriptional target and when over expressed having pro apoptotic phenotypes in cell lines. Moreover miR 34a has been shown to be a modifier gene in the context of LFS since its epigenetic silencing increases the likelihood of tumour development in patients with mutant TP53. However the in vivo consequences of miR 34 loss are still unclear. For example mice lacking all three a b c miR 34 homologs show no detectable abnormalities in p53 responses. The relative expression of different miR 34 genes in zebrafish was studied using qRT PCR with specific assays. The miR 34a miR 34b and miR 34c display unique onset of developmental expression and expression levels with miR 34a being the most abundant and constant in expression. All of the miR 34 genes also showed clear induction by p53 when DNA damaging treatments are performed. Using CRISPR Cas9 technology we generated a zebrafish miR 34a deletion mutant to further investigate the roles of miR 34a on its own and its association with the p53 pathway. Predictably a miR 34a deletion mutant demonstrated absence of miR 34a though without xxx 34b and miR 34c compensation beyond baseline expression levels. Mutants survive to maturity show no overt phenotypes and have normal apoptotic responses to DNA damaging irradiation or camptothecin treatments. To further explore the effects of miR 34a we performed gene expression profiling using RNA seq of wild type and miR 34a deletion mutant zebrafish embryos at 28 hpf with or without xxx with a DNA damaging drug camptothecin. The results of this RNA seq experiments showed that the loss of miR 34a does not strongly affect induction of genes by DNA damage. However the overall pattern of gene expression is significantly different as shown by Principal Component Analysis and there is a gr… | 28 hpf miR 34a / treated with 1μM CPT rep1 | GSM4227410 | tissue:whole embryo|genotype:miR 34a / |Stage:28 hpf|treatment:4 hours with 1μM camptothecin | 28 hpf miR 34a / treated with 1μM CPT rep1 | Read trimming: the raw reads had the adapters “ATCACCGAC” removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts | whole embryo | Camptothecin CPT treatments were performed by adding either DMSO control groups or the 2 mM stock CPT solution in DMSO to fish water for 1 µM concentration and incubating embryos for 4 hours. | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University of Ottawa Animal Care Committee approval number: CHEOe 3168 A1. Zebrafish embryos were maintained at 28.5 °C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock. | genotype:miR 34a / |Stage:28 hpf|treatment:4 hours with 1μM camptothecin | GSM4227410 | GSM4227410: 28 hpf miR 34a / treated with 1μM CPT rep1; Danio rerio; RNA Seq | GSM4227410 | 1 | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | GEO Accession:GSM4227410 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ION_TORRENT | Ion Torrent Proton | SRP238398 | 28h_miR34a_CPT1.fastq.gz | fastq | 3324553506.0 | 48175746.0 | GSM4227410 r1 | 0:69.01 | A:917927255;C:782740771;G:859994003;T:763891477;N:0 | 69 | 917927255 | 782740771 | 859994003 | 763891477 | 0 | SRX7423116 | SRS5869236 | SRA1014962 | GEO | Berman Lab, CHEO Research Institute/University of Ottawa | 1 | 0.76943 | 0.06284 | 0.7428 | 0.47633 | 115 | B | usable mapping rate | ion_torrent | ion_torrent | full_length | poly_a | unknown | bulk | unknown | unknown | Canada | 2019-12-20 | Pharyngula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 55738 | 55738 | SRR10747733 | SRX7423115 | SRS5869235 | SRP238398 | PRJNA597022 | RNA seq analysis of gene regulation by miR 34a and expression changes induced by DNA damage in zebrafish | GSE142440 | Transcriptome Analysis | Li Fraumeni syndrome LFS is a disorder due to inherited mutations in the TP53 gene resulting in an increased risk of developing several types of cancer. MicroRNA miR 34a has been implicated downstream of p53 on the basis of being a direct transcriptional target and when over expressed having pro apoptotic phenotypes in cell lines. Moreover miR 34a has been shown to be a modifier gene in the context of LFS since its epigenetic silencing increases the likelihood of tumour development in patients with mutant TP53. However the in vivo consequences of miR 34 loss are still unclear. For example mice lacking all three a b c miR 34 homologs show no detectable abnormalities in p53 responses. The relative expression of different miR 34 genes in zebrafish was studied using qRT PCR with specific assays. The miR 34a miR 34b and miR 34c display unique onset of developmental expression and expression levels with miR 34a being the most abundant and constant in expression. All of the miR 34 genes also showed clear induction by p53 when DNA damaging treatments are performed. Using CRISPR Cas9 technology we generated a zebrafish miR 34a deletion mutant to further investigate the roles of miR 34a on its own and its association with the p53 pathway. Predictably a miR 34a deletion mutant demonstrated absence of miR 34a though without xxx 34b and miR 34c compensation beyond baseline expression levels. Mutants survive to maturity show no overt phenotypes and have normal apoptotic responses to DNA damaging irradiation or camptothecin treatments. To further explore the effects of miR 34a we performed gene expression profiling using RNA seq of wild type and miR 34a deletion mutant zebrafish embryos at 28 hpf with or without xxx with a DNA damaging drug camptothecin. The results of this RNA seq experiments showed that the loss of miR 34a does not strongly affect induction of genes by DNA damage. However the overall pattern of gene expression is significantly different as shown by Principal Component Analysis and there is a gr… | 28 hpf miR 34a / DMSO control rep3 | GSM4227409 | tissue:whole embryo|genotype:miR 34a / |Stage:28 hpf|treatment:4 hours with 0.005% DMSO | 28 hpf miR 34a / DMSO control rep3 | Read trimming: the raw reads had the adapters “ATCACCGAC” removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts | whole embryo | Camptothecin CPT treatments were performed by adding either DMSO control groups or the 2 mM stock CPT solution in DMSO to fish water for 1 µM concentration and incubating embryos for 4 hours. | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University of Ottawa Animal Care Committee approval number: CHEOe 3168 A1. Zebrafish embryos were maintained at 28.5 °C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock. | genotype:miR 34a / |Stage:28 hpf|treatment:4 hours with 0.005% DMSO | GSM4227409 | GSM4227409: 28 hpf miR 34a / DMSO control rep3; Danio rerio; RNA Seq | GSM4227409 | 1 | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | GEO Accession:GSM4227409 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ION_TORRENT | Ion Torrent Proton | SRP238398 | 28h_miR34a_DMSO3.fastq.gz | fastq | 2998520813.0 | 37166834.0 | GSM4227409 r1 | 0:80.68 | A:831969226;C:705126074;G:792553026;T:668872487;N:0 | 80 | 831969226 | 705126074 | 792553026 | 668872487 | 0 | SRX7423115 | SRS5869235 | SRA1014962 | GEO | Berman Lab, CHEO Research Institute/University of Ottawa | 1 | 0.80425 | 0.05204 | 0.73143 | 0.46724 | 44 | B | usable mapping rate | ion_torrent | ion_torrent | full_length | poly_a | unknown | bulk | unknown | unknown | Canada | 2019-12-20 | Pharyngula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 55739 | 55739 | SRR10747732 | SRX7423114 | SRS5869234 | SRP238398 | PRJNA597022 | RNA seq analysis of gene regulation by miR 34a and expression changes induced by DNA damage in zebrafish | GSE142440 | Transcriptome Analysis | Li Fraumeni syndrome LFS is a disorder due to inherited mutations in the TP53 gene resulting in an increased risk of developing several types of cancer. MicroRNA miR 34a has been implicated downstream of p53 on the basis of being a direct transcriptional target and when over expressed having pro apoptotic phenotypes in cell lines. Moreover miR 34a has been shown to be a modifier gene in the context of LFS since its epigenetic silencing increases the likelihood of tumour development in patients with mutant TP53. However the in vivo consequences of miR 34 loss are still unclear. For example mice lacking all three a b c miR 34 homologs show no detectable abnormalities in p53 responses. The relative expression of different miR 34 genes in zebrafish was studied using qRT PCR with specific assays. The miR 34a miR 34b and miR 34c display unique onset of developmental expression and expression levels with miR 34a being the most abundant and constant in expression. All of the miR 34 genes also showed clear induction by p53 when DNA damaging treatments are performed. Using CRISPR Cas9 technology we generated a zebrafish miR 34a deletion mutant to further investigate the roles of miR 34a on its own and its association with the p53 pathway. Predictably a miR 34a deletion mutant demonstrated absence of miR 34a though without xxx 34b and miR 34c compensation beyond baseline expression levels. Mutants survive to maturity show no overt phenotypes and have normal apoptotic responses to DNA damaging irradiation or camptothecin treatments. To further explore the effects of miR 34a we performed gene expression profiling using RNA seq of wild type and miR 34a deletion mutant zebrafish embryos at 28 hpf with or without xxx with a DNA damaging drug camptothecin. The results of this RNA seq experiments showed that the loss of miR 34a does not strongly affect induction of genes by DNA damage. However the overall pattern of gene expression is significantly different as shown by Principal Component Analysis and there is a gr… | 28 hpf miR 34a / DMSO control rep2 | GSM4227408 | tissue:whole embryo|genotype:miR 34a / |Stage:28 hpf|treatment:4 hours with 0.005% DMSO | 28 hpf miR 34a / DMSO control rep2 | Read trimming: the raw reads had the adapters “ATCACCGAC” removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts | whole embryo | Camptothecin CPT treatments were performed by adding either DMSO control groups or the 2 mM stock CPT solution in DMSO to fish water for 1 µM concentration and incubating embryos for 4 hours. | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University of Ottawa Animal Care Committee approval number: CHEOe 3168 A1. Zebrafish embryos were maintained at 28.5 °C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock. | genotype:miR 34a / |Stage:28 hpf|treatment:4 hours with 0.005% DMSO | GSM4227408 | GSM4227408: 28 hpf miR 34a / DMSO control rep2; Danio rerio; RNA Seq | GSM4227408 | 1 | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | GEO Accession:GSM4227408 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ION_TORRENT | Ion Torrent Proton | SRP238398 | 28h_miR34a_DMSO2.fastq.gz | fastq | 3717672599.0 | 48384751.0 | GSM4227408 r1 | 0:76.84 | A:1007096699;C:899919892;G:1013267190;T:797388818;N:0 | 76 | 1007096699 | 899919892 | 1013267190 | 797388818 | 0 | SRX7423114 | SRS5869234 | SRA1014962 | GEO | Berman Lab, CHEO Research Institute/University of Ottawa | 1 | 0.7766 | 0.06285 | 0.74393 | 0.46447 | 115 | B | usable mapping rate | ion_torrent | ion_torrent | full_length | poly_a | unknown | bulk | unknown | unknown | Canada | 2019-12-20 | Pharyngula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 55740 | 55740 | SRR10747731 | SRX7423113 | SRS5869233 | SRP238398 | PRJNA597022 | RNA seq analysis of gene regulation by miR 34a and expression changes induced by DNA damage in zebrafish | GSE142440 | Transcriptome Analysis | Li Fraumeni syndrome LFS is a disorder due to inherited mutations in the TP53 gene resulting in an increased risk of developing several types of cancer. MicroRNA miR 34a has been implicated downstream of p53 on the basis of being a direct transcriptional target and when over expressed having pro apoptotic phenotypes in cell lines. Moreover miR 34a has been shown to be a modifier gene in the context of LFS since its epigenetic silencing increases the likelihood of tumour development in patients with mutant TP53. However the in vivo consequences of miR 34 loss are still unclear. For example mice lacking all three a b c miR 34 homologs show no detectable abnormalities in p53 responses. The relative expression of different miR 34 genes in zebrafish was studied using qRT PCR with specific assays. The miR 34a miR 34b and miR 34c display unique onset of developmental expression and expression levels with miR 34a being the most abundant and constant in expression. All of the miR 34 genes also showed clear induction by p53 when DNA damaging treatments are performed. Using CRISPR Cas9 technology we generated a zebrafish miR 34a deletion mutant to further investigate the roles of miR 34a on its own and its association with the p53 pathway. Predictably a miR 34a deletion mutant demonstrated absence of miR 34a though without xxx 34b and miR 34c compensation beyond baseline expression levels. Mutants survive to maturity show no overt phenotypes and have normal apoptotic responses to DNA damaging irradiation or camptothecin treatments. To further explore the effects of miR 34a we performed gene expression profiling using RNA seq of wild type and miR 34a deletion mutant zebrafish embryos at 28 hpf with or without xxx with a DNA damaging drug camptothecin. The results of this RNA seq experiments showed that the loss of miR 34a does not strongly affect induction of genes by DNA damage. However the overall pattern of gene expression is significantly different as shown by Principal Component Analysis and there is a gr… | 28 hpf miR 34a / DMSO control rep1 | GSM4227407 | tissue:whole embryo|genotype:miR 34a / |Stage:28 hpf|treatment:4 hours with 0.005% DMSO | 28 hpf miR 34a / DMSO control rep1 | Read trimming: the raw reads had the adapters “ATCACCGAC” removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts | whole embryo | Camptothecin CPT treatments were performed by adding either DMSO control groups or the 2 mM stock CPT solution in DMSO to fish water for 1 µM concentration and incubating embryos for 4 hours. | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University of Ottawa Animal Care Committee approval number: CHEOe 3168 A1. Zebrafish embryos were maintained at 28.5 °C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock. | genotype:miR 34a / |Stage:28 hpf|treatment:4 hours with 0.005% DMSO | GSM4227407 | GSM4227407: 28 hpf miR 34a / DMSO control rep1; Danio rerio; RNA Seq | GSM4227407 | 1 | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | GEO Accession:GSM4227407 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ION_TORRENT | Ion Torrent Proton | SRP238398 | 28h_miR34a_DMSO1.fastq.gz | fastq | 2648513845.0 | 34032135.0 | GSM4227407 r1 | 0:77.82 | A:723351205;C:631864519;G:693886300;T:599411821;N:0 | 77 | 723351205 | 631864519 | 693886300 | 599411821 | 0 | SRX7423113 | SRS5869233 | SRA1014962 | GEO | Berman Lab, CHEO Research Institute/University of Ottawa | 1 | 0.73119 | 0.05014 | 0.7417 | 0.46453 | 115 | B | usable mapping rate | ion_torrent | ion_torrent | full_length | poly_a | unknown | bulk | unknown | unknown | Canada | 2019-12-20 | Pharyngula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 55741 | 55741 | SRR10747730 | SRX7423112 | SRS5869232 | SRP238398 | PRJNA597022 | RNA seq analysis of gene regulation by miR 34a and expression changes induced by DNA damage in zebrafish | GSE142440 | Transcriptome Analysis | Li Fraumeni syndrome LFS is a disorder due to inherited mutations in the TP53 gene resulting in an increased risk of developing several types of cancer. MicroRNA miR 34a has been implicated downstream of p53 on the basis of being a direct transcriptional target and when over expressed having pro apoptotic phenotypes in cell lines. Moreover miR 34a has been shown to be a modifier gene in the context of LFS since its epigenetic silencing increases the likelihood of tumour development in patients with mutant TP53. However the in vivo consequences of miR 34 loss are still unclear. For example mice lacking all three a b c miR 34 homologs show no detectable abnormalities in p53 responses. The relative expression of different miR 34 genes in zebrafish was studied using qRT PCR with specific assays. The miR 34a miR 34b and miR 34c display unique onset of developmental expression and expression levels with miR 34a being the most abundant and constant in expression. All of the miR 34 genes also showed clear induction by p53 when DNA damaging treatments are performed. Using CRISPR Cas9 technology we generated a zebrafish miR 34a deletion mutant to further investigate the roles of miR 34a on its own and its association with the p53 pathway. Predictably a miR 34a deletion mutant demonstrated absence of miR 34a though without xxx 34b and miR 34c compensation beyond baseline expression levels. Mutants survive to maturity show no overt phenotypes and have normal apoptotic responses to DNA damaging irradiation or camptothecin treatments. To further explore the effects of miR 34a we performed gene expression profiling using RNA seq of wild type and miR 34a deletion mutant zebrafish embryos at 28 hpf with or without xxx with a DNA damaging drug camptothecin. The results of this RNA seq experiments showed that the loss of miR 34a does not strongly affect induction of genes by DNA damage. However the overall pattern of gene expression is significantly different as shown by Principal Component Analysis and there is a gr… | 28 hpf wild type treated with 1μM CPT rep3 | GSM4227406 | tissue:whole embryo|genotype:wild type|Stage:28 hpf|treatment:4 hours with 1μM camptothecin | 28 hpf wild type treated with 1μM CPT rep3 | Read trimming: the raw reads had the adapters “ATCACCGAC” removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts | whole embryo | Camptothecin CPT treatments were performed by adding either DMSO control groups or the 2 mM stock CPT solution in DMSO to fish water for 1 µM concentration and incubating embryos for 4 hours. | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University of Ottawa Animal Care Committee approval number: CHEOe 3168 A1. Zebrafish embryos were maintained at 28.5 °C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock. | genotype:wild type|Stage:28 hpf|treatment:4 hours with 1μM camptothecin | GSM4227406 | GSM4227406: 28 hpf wild type treated with 1μM CPT rep3; Danio rerio; RNA Seq | GSM4227406 | 1 | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | GEO Accession:GSM4227406 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ION_TORRENT | Ion Torrent Proton | SRP238398 | 28h_wt_CPT3.fastq.gz | fastq | 4910665916.0 | 54209032.0 | GSM4227406 r1 | 0:90.59 | A:1333252314;C:1180672328;G:1270082657;T:1126658617;N:0 | 90 | 1333252314 | 1180672328 | 1270082657 | 1126658617 | 0 | SRX7423112 | SRS5869232 | SRA1014962 | GEO | Berman Lab, CHEO Research Institute/University of Ottawa | 1 | 0.74851 | 0.0448 | 0.74793 | 0.47706 | 81 | B | usable mapping rate | ion_torrent | ion_torrent | full_length | poly_a | unknown | bulk | unknown | unknown | Canada | 2019-12-20 | Pharyngula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 55742 | 55742 | SRR10747729 | SRX7423111 | SRS5869231 | SRP238398 | PRJNA597022 | RNA seq analysis of gene regulation by miR 34a and expression changes induced by DNA damage in zebrafish | GSE142440 | Transcriptome Analysis | Li Fraumeni syndrome LFS is a disorder due to inherited mutations in the TP53 gene resulting in an increased risk of developing several types of cancer. MicroRNA miR 34a has been implicated downstream of p53 on the basis of being a direct transcriptional target and when over expressed having pro apoptotic phenotypes in cell lines. Moreover miR 34a has been shown to be a modifier gene in the context of LFS since its epigenetic silencing increases the likelihood of tumour development in patients with mutant TP53. However the in vivo consequences of miR 34 loss are still unclear. For example mice lacking all three a b c miR 34 homologs show no detectable abnormalities in p53 responses. The relative expression of different miR 34 genes in zebrafish was studied using qRT PCR with specific assays. The miR 34a miR 34b and miR 34c display unique onset of developmental expression and expression levels with miR 34a being the most abundant and constant in expression. All of the miR 34 genes also showed clear induction by p53 when DNA damaging treatments are performed. Using CRISPR Cas9 technology we generated a zebrafish miR 34a deletion mutant to further investigate the roles of miR 34a on its own and its association with the p53 pathway. Predictably a miR 34a deletion mutant demonstrated absence of miR 34a though without xxx 34b and miR 34c compensation beyond baseline expression levels. Mutants survive to maturity show no overt phenotypes and have normal apoptotic responses to DNA damaging irradiation or camptothecin treatments. To further explore the effects of miR 34a we performed gene expression profiling using RNA seq of wild type and miR 34a deletion mutant zebrafish embryos at 28 hpf with or without xxx with a DNA damaging drug camptothecin. The results of this RNA seq experiments showed that the loss of miR 34a does not strongly affect induction of genes by DNA damage. However the overall pattern of gene expression is significantly different as shown by Principal Component Analysis and there is a gr… | 28 hpf wild type treated with 1μM CPT rep2 | GSM4227405 | tissue:whole embryo|genotype:wild type|Stage:28 hpf|treatment:4 hours with 1μM camptothecin | 28 hpf wild type treated with 1μM CPT rep2 | Read trimming: the raw reads had the adapters “ATCACCGAC” removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts | whole embryo | Camptothecin CPT treatments were performed by adding either DMSO control groups or the 2 mM stock CPT solution in DMSO to fish water for 1 µM concentration and incubating embryos for 4 hours. | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University of Ottawa Animal Care Committee approval number: CHEOe 3168 A1. Zebrafish embryos were maintained at 28.5 °C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock. | genotype:wild type|Stage:28 hpf|treatment:4 hours with 1μM camptothecin | GSM4227405 | GSM4227405: 28 hpf wild type treated with 1μM CPT rep2; Danio rerio; RNA Seq | GSM4227405 | 1 | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | GEO Accession:GSM4227405 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ION_TORRENT | Ion Torrent Proton | SRP238398 | 28h_wt_CPT2.fastq.gz | fastq | 4706787896.0 | 52433187.0 | GSM4227405 r1 | 0:89.77 | A:1271959985;C:1139661957;G:1248571859;T:1046594095;N:0 | 89 | 1271959985 | 1139661957 | 1248571859 | 1046594095 | 0 | SRX7423111 | SRS5869231 | SRA1014962 | GEO | Berman Lab, CHEO Research Institute/University of Ottawa | 1 | 0.75052 | 0.06118 | 0.7667 | 0.48756 | 86 | B | usable mapping rate | ion_torrent | ion_torrent | full_length | poly_a | unknown | bulk | unknown | unknown | Canada | 2019-12-20 | Pharyngula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 55743 | 55743 | SRR10747728 | SRX7423110 | SRS5869230 | SRP238398 | PRJNA597022 | RNA seq analysis of gene regulation by miR 34a and expression changes induced by DNA damage in zebrafish | GSE142440 | Transcriptome Analysis | Li Fraumeni syndrome LFS is a disorder due to inherited mutations in the TP53 gene resulting in an increased risk of developing several types of cancer. MicroRNA miR 34a has been implicated downstream of p53 on the basis of being a direct transcriptional target and when over expressed having pro apoptotic phenotypes in cell lines. Moreover miR 34a has been shown to be a modifier gene in the context of LFS since its epigenetic silencing increases the likelihood of tumour development in patients with mutant TP53. However the in vivo consequences of miR 34 loss are still unclear. For example mice lacking all three a b c miR 34 homologs show no detectable abnormalities in p53 responses. The relative expression of different miR 34 genes in zebrafish was studied using qRT PCR with specific assays. The miR 34a miR 34b and miR 34c display unique onset of developmental expression and expression levels with miR 34a being the most abundant and constant in expression. All of the miR 34 genes also showed clear induction by p53 when DNA damaging treatments are performed. Using CRISPR Cas9 technology we generated a zebrafish miR 34a deletion mutant to further investigate the roles of miR 34a on its own and its association with the p53 pathway. Predictably a miR 34a deletion mutant demonstrated absence of miR 34a though without xxx 34b and miR 34c compensation beyond baseline expression levels. Mutants survive to maturity show no overt phenotypes and have normal apoptotic responses to DNA damaging irradiation or camptothecin treatments. To further explore the effects of miR 34a we performed gene expression profiling using RNA seq of wild type and miR 34a deletion mutant zebrafish embryos at 28 hpf with or without xxx with a DNA damaging drug camptothecin. The results of this RNA seq experiments showed that the loss of miR 34a does not strongly affect induction of genes by DNA damage. However the overall pattern of gene expression is significantly different as shown by Principal Component Analysis and there is a gr… | 28 hpf wild type treated with 1μM CPT rep1 | GSM4227404 | tissue:whole embryo|genotype:wild type|Stage:28 hpf|treatment:4 hours with 1μM camptothecin | 28 hpf wild type treated with 1μM CPT rep1 | Read trimming: the raw reads had the adapters “ATCACCGAC” removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts | whole embryo | Camptothecin CPT treatments were performed by adding either DMSO control groups or the 2 mM stock CPT solution in DMSO to fish water for 1 µM concentration and incubating embryos for 4 hours. | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University of Ottawa Animal Care Committee approval number: CHEOe 3168 A1. Zebrafish embryos were maintained at 28.5 °C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock. | genotype:wild type|Stage:28 hpf|treatment:4 hours with 1μM camptothecin | GSM4227404 | GSM4227404: 28 hpf wild type treated with 1μM CPT rep1; Danio rerio; RNA Seq | GSM4227404 | 1 | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | GEO Accession:GSM4227404 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ION_TORRENT | Ion Torrent Proton | SRP238398 | 28h_wt_CPT1.fastq.gz | fastq | 4344364040.0 | 47174313.0 | GSM4227404 r1 | 0:92.09 | A:1162056747;C:1055561948;G:1156595580;T:970149765;N:0 | 92 | 1162056747 | 1055561948 | 1156595580 | 970149765 | 0 | SRX7423110 | SRS5869230 | SRA1014962 | GEO | Berman Lab, CHEO Research Institute/University of Ottawa | 1 | 0.68985 | 0.07087 | 0.79078 | 0.49968 | 106 | B | usable mapping rate | ion_torrent | ion_torrent | full_length | poly_a | unknown | bulk | unknown | unknown | Canada | 2019-12-20 | Pharyngula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 55744 | 55744 | SRR10747727 | SRX7423109 | SRS5869228 | SRP238398 | PRJNA597022 | RNA seq analysis of gene regulation by miR 34a and expression changes induced by DNA damage in zebrafish | GSE142440 | Transcriptome Analysis | Li Fraumeni syndrome LFS is a disorder due to inherited mutations in the TP53 gene resulting in an increased risk of developing several types of cancer. MicroRNA miR 34a has been implicated downstream of p53 on the basis of being a direct transcriptional target and when over expressed having pro apoptotic phenotypes in cell lines. Moreover miR 34a has been shown to be a modifier gene in the context of LFS since its epigenetic silencing increases the likelihood of tumour development in patients with mutant TP53. However the in vivo consequences of miR 34 loss are still unclear. For example mice lacking all three a b c miR 34 homologs show no detectable abnormalities in p53 responses. The relative expression of different miR 34 genes in zebrafish was studied using qRT PCR with specific assays. The miR 34a miR 34b and miR 34c display unique onset of developmental expression and expression levels with miR 34a being the most abundant and constant in expression. All of the miR 34 genes also showed clear induction by p53 when DNA damaging treatments are performed. Using CRISPR Cas9 technology we generated a zebrafish miR 34a deletion mutant to further investigate the roles of miR 34a on its own and its association with the p53 pathway. Predictably a miR 34a deletion mutant demonstrated absence of miR 34a though without xxx 34b and miR 34c compensation beyond baseline expression levels. Mutants survive to maturity show no overt phenotypes and have normal apoptotic responses to DNA damaging irradiation or camptothecin treatments. To further explore the effects of miR 34a we performed gene expression profiling using RNA seq of wild type and miR 34a deletion mutant zebrafish embryos at 28 hpf with or without xxx with a DNA damaging drug camptothecin. The results of this RNA seq experiments showed that the loss of miR 34a does not strongly affect induction of genes by DNA damage. However the overall pattern of gene expression is significantly different as shown by Principal Component Analysis and there is a gr… | 28 hpf wild type DMSO control rep3 | GSM4227403 | tissue:whole embryo|genotype:wild type|Stage:28 hpf|treatment:4 hours with 0.005% DMSO | 28 hpf wild type DMSO control rep3 | Read trimming: the raw reads had the adapters “ATCACCGAC” removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts | whole embryo | Camptothecin CPT treatments were performed by adding either DMSO control groups or the 2 mM stock CPT solution in DMSO to fish water for 1 µM concentration and incubating embryos for 4 hours. | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University of Ottawa Animal Care Committee approval number: CHEOe 3168 A1. Zebrafish embryos were maintained at 28.5 °C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock. | genotype:wild type|Stage:28 hpf|treatment:4 hours with 0.005% DMSO | GSM4227403 | GSM4227403: 28 hpf wild type DMSO control rep3; Danio rerio; RNA Seq | GSM4227403 | 1 | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | GEO Accession:GSM4227403 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ION_TORRENT | Ion Torrent Proton | SRP238398 | 28h_wt_DMSO3.fastq.gz | fastq | 4067298489.0 | 50935402.0 | GSM4227403 r1 | 0:79.85 | A:1113757653;C:963268241;G:1062451618;T:927820977;N:0 | 79 | 1113757653 | 963268241 | 1062451618 | 927820977 | 0 | SRX7423109 | SRS5869228 | SRA1014962 | GEO | Berman Lab, CHEO Research Institute/University of Ottawa | 1 | 0.77461 | 0.06582 | 0.74633 | 0.47778 | 86 | B | usable mapping rate | ion_torrent | ion_torrent | full_length | poly_a | unknown | bulk | unknown | unknown | Canada | 2019-12-20 | Pharyngula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 55745 | 55745 | SRR10747726 | SRX7423108 | SRS5869229 | SRP238398 | PRJNA597022 | RNA seq analysis of gene regulation by miR 34a and expression changes induced by DNA damage in zebrafish | GSE142440 | Transcriptome Analysis | Li Fraumeni syndrome LFS is a disorder due to inherited mutations in the TP53 gene resulting in an increased risk of developing several types of cancer. MicroRNA miR 34a has been implicated downstream of p53 on the basis of being a direct transcriptional target and when over expressed having pro apoptotic phenotypes in cell lines. Moreover miR 34a has been shown to be a modifier gene in the context of LFS since its epigenetic silencing increases the likelihood of tumour development in patients with mutant TP53. However the in vivo consequences of miR 34 loss are still unclear. For example mice lacking all three a b c miR 34 homologs show no detectable abnormalities in p53 responses. The relative expression of different miR 34 genes in zebrafish was studied using qRT PCR with specific assays. The miR 34a miR 34b and miR 34c display unique onset of developmental expression and expression levels with miR 34a being the most abundant and constant in expression. All of the miR 34 genes also showed clear induction by p53 when DNA damaging treatments are performed. Using CRISPR Cas9 technology we generated a zebrafish miR 34a deletion mutant to further investigate the roles of miR 34a on its own and its association with the p53 pathway. Predictably a miR 34a deletion mutant demonstrated absence of miR 34a though without xxx 34b and miR 34c compensation beyond baseline expression levels. Mutants survive to maturity show no overt phenotypes and have normal apoptotic responses to DNA damaging irradiation or camptothecin treatments. To further explore the effects of miR 34a we performed gene expression profiling using RNA seq of wild type and miR 34a deletion mutant zebrafish embryos at 28 hpf with or without xxx with a DNA damaging drug camptothecin. The results of this RNA seq experiments showed that the loss of miR 34a does not strongly affect induction of genes by DNA damage. However the overall pattern of gene expression is significantly different as shown by Principal Component Analysis and there is a gr… | 28 hpf wild type DMSO control rep2 | GSM4227402 | tissue:whole embryo|genotype:wild type|Stage:28 hpf|treatment:4 hours with 0.005% DMSO | 28 hpf wild type DMSO control rep2 | Read trimming: the raw reads had the adapters “ATCACCGAC” removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts | whole embryo | Camptothecin CPT treatments were performed by adding either DMSO control groups or the 2 mM stock CPT solution in DMSO to fish water for 1 µM concentration and incubating embryos for 4 hours. | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University of Ottawa Animal Care Committee approval number: CHEOe 3168 A1. Zebrafish embryos were maintained at 28.5 °C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock. | genotype:wild type|Stage:28 hpf|treatment:4 hours with 0.005% DMSO | GSM4227402 | GSM4227402: 28 hpf wild type DMSO control rep2; Danio rerio; RNA Seq | GSM4227402 | 1 | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | GEO Accession:GSM4227402 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ION_TORRENT | Ion Torrent Proton | SRP238398 | 28h_wt_DMSO2.fastq.gz | fastq | 3977775840.0 | 46861941.0 | GSM4227402 r1 | 0:84.88 | A:1100615887;C:933911324;G:1061089489;T:882159140;N:0 | 84 | 1100615887 | 933911324 | 1061089489 | 882159140 | 0 | SRX7423108 | SRS5869229 | SRA1014962 | GEO | Berman Lab, CHEO Research Institute/University of Ottawa | 1 | 0.7831 | 0.06264 | 0.74117 | 0.47727 | 98 | B | usable mapping rate | ion_torrent | ion_torrent | full_length | poly_a | unknown | bulk | unknown | unknown | Canada | 2019-12-20 | Pharyngula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 55746 | 55746 | SRR10747725 | SRX7423107 | SRS5869227 | SRP238398 | PRJNA597022 | RNA seq analysis of gene regulation by miR 34a and expression changes induced by DNA damage in zebrafish | GSE142440 | Transcriptome Analysis | Li Fraumeni syndrome LFS is a disorder due to inherited mutations in the TP53 gene resulting in an increased risk of developing several types of cancer. MicroRNA miR 34a has been implicated downstream of p53 on the basis of being a direct transcriptional target and when over expressed having pro apoptotic phenotypes in cell lines. Moreover miR 34a has been shown to be a modifier gene in the context of LFS since its epigenetic silencing increases the likelihood of tumour development in patients with mutant TP53. However the in vivo consequences of miR 34 loss are still unclear. For example mice lacking all three a b c miR 34 homologs show no detectable abnormalities in p53 responses. The relative expression of different miR 34 genes in zebrafish was studied using qRT PCR with specific assays. The miR 34a miR 34b and miR 34c display unique onset of developmental expression and expression levels with miR 34a being the most abundant and constant in expression. All of the miR 34 genes also showed clear induction by p53 when DNA damaging treatments are performed. Using CRISPR Cas9 technology we generated a zebrafish miR 34a deletion mutant to further investigate the roles of miR 34a on its own and its association with the p53 pathway. Predictably a miR 34a deletion mutant demonstrated absence of miR 34a though without xxx 34b and miR 34c compensation beyond baseline expression levels. Mutants survive to maturity show no overt phenotypes and have normal apoptotic responses to DNA damaging irradiation or camptothecin treatments. To further explore the effects of miR 34a we performed gene expression profiling using RNA seq of wild type and miR 34a deletion mutant zebrafish embryos at 28 hpf with or without xxx with a DNA damaging drug camptothecin. The results of this RNA seq experiments showed that the loss of miR 34a does not strongly affect induction of genes by DNA damage. However the overall pattern of gene expression is significantly different as shown by Principal Component Analysis and there is a gr… | 28 hpf wild type DMSO control rep1 | GSM4227401 | tissue:whole embryo|genotype:wild type|Stage:28 hpf|treatment:4 hours with 0.005% DMSO | 28 hpf wild type DMSO control rep1 | Read trimming: the raw reads had the adapters “ATCACCGAC” removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts | whole embryo | Camptothecin CPT treatments were performed by adding either DMSO control groups or the 2 mM stock CPT solution in DMSO to fish water for 1 µM concentration and incubating embryos for 4 hours. | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University of Ottawa Animal Care Committee approval number: CHEOe 3168 A1. Zebrafish embryos were maintained at 28.5 °C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock. | genotype:wild type|Stage:28 hpf|treatment:4 hours with 0.005% DMSO | GSM4227401 | GSM4227401: 28 hpf wild type DMSO control rep1; Danio rerio; RNA Seq | GSM4227401 | 1 | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | GEO Accession:GSM4227401 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ION_TORRENT | Ion Torrent Proton | SRP238398 | 28h_wt_DMSO1.fastq.gz | fastq | 3589144707.0 | 44402480.0 | GSM4227401 r1 | 0:80.83 | A:982842105;C:850942867;G:952092389;T:803267346;N:0 | 80 | 982842105 | 850942867 | 952092389 | 803267346 | 0 | SRX7423107 | SRS5869227 | SRA1014962 | GEO | Berman Lab, CHEO Research Institute/University of Ottawa | 1 | 0.74503 | 0.06357 | 0.74207 | 0.47311 | 59 | B | usable mapping rate | ion_torrent | ion_torrent | full_length | poly_a | unknown | bulk | unknown | unknown | Canada | 2019-12-20 | Pharyngula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 55924 | 55924 | SRR10767295 | SRX7441213 | SRS5885540 | SRP238807 | PRJNA597725 | A Zebrafish JAK1 A634D Gain of Function Model Provides New Insights into the Pathogenesis of Familial Hypereosinophilia | GSE142599 | Transcriptome Analysis | JAK1 plays an important role during zebrafish development as hematopoietic regulator with a specific impact in the myeloid lineage from where the eosinophils arise. Several genes in the JAK STAT pathway are elevated in the transgenic mutants STAT1B SOCS3A SOCS3B PIAS2 as well as patways involved in hematopoiesis immunity response to interferon and response to biotic stimuli. Overall design: Total RNA from casper JAK1 WT and JAK1 A634D zebrafish embryos at 28 hpf and 36 hpf was extracted to characterize the transcriptomic effects of the JAK1 A634D gain of function mutation | 36 hpf JAK1 WT transgenic rep 3 | GSM4232679 | tissue:whole embryo|genotype:Tgubi:cDNA JAK1 WT p2A sfGFP|developmental stage:36 hpf embryo | 36 hpf JAK1 WT transgenic rep 3 | Read trimming: the raw reads had the adapters “ATCACCGAC” removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts | whole embryo | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University Committee on Laboratory Animals UCLA of Dalhousie University. Zebrafish embryos were maintained at 28.5 °C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock. | genotype:Tgubi:cDNA JAK1 WT p2A sfGFP|developmental stage:36 hpf embryo | GSM4232679 | GSM4232679: 36 hpf JAK1 WT transgenic rep 3; Danio rerio; RNA Seq | GSM4232679 | 1 | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | GEO Accession:GSM4232679 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ION_TORRENT | Ion Torrent Proton | SRP238807 | 36h_JAK1_WT_3.fastq.gz | fastq | 3207715934.0 | 39511938.0 | GSM4232679 r1 | 0:81.18 | A:896166458;C:753209973;G:826542873;T:731796630;N:0 | 81 | 896166458 | 753209973 | 826542873 | 731796630 | 0 | SRX7441213 | SRS5885540 | SRA1016603 | GEO | Berman Lab, CHEO Research Institute/University of Ottawa | 1 | 0.72565 | 0.04702 | 0.74466 | 0.46784 | 195 | B | usable mapping rate | ion_torrent | ion_torrent | full_length | poly_a | unknown | bulk | unknown | unknown | Canada | 2019-12-26 | Pharyngula | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||
| 55925 | 55925 | SRR10767294 | SRX7441212 | SRS5885539 | SRP238807 | PRJNA597725 | A Zebrafish JAK1 A634D Gain of Function Model Provides New Insights into the Pathogenesis of Familial Hypereosinophilia | GSE142599 | Transcriptome Analysis | JAK1 plays an important role during zebrafish development as hematopoietic regulator with a specific impact in the myeloid lineage from where the eosinophils arise. Several genes in the JAK STAT pathway are elevated in the transgenic mutants STAT1B SOCS3A SOCS3B PIAS2 as well as patways involved in hematopoiesis immunity response to interferon and response to biotic stimuli. Overall design: Total RNA from casper JAK1 WT and JAK1 A634D zebrafish embryos at 28 hpf and 36 hpf was extracted to characterize the transcriptomic effects of the JAK1 A634D gain of function mutation | 36 hpf JAK1 WT transgenic rep 2 | GSM4232678 | tissue:whole embryo|genotype:Tgubi:cDNA JAK1 WT p2A sfGFP|developmental stage:36 hpf embryo | 36 hpf JAK1 WT transgenic rep 2 | Read trimming: the raw reads had the adapters “ATCACCGAC” removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts | whole embryo | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University Committee on Laboratory Animals UCLA of Dalhousie University. Zebrafish embryos were maintained at 28.5 °C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock. | genotype:Tgubi:cDNA JAK1 WT p2A sfGFP|developmental stage:36 hpf embryo | GSM4232678 | GSM4232678: 36 hpf JAK1 WT transgenic rep 2; Danio rerio; RNA Seq | GSM4232678 | 1 | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | GEO Accession:GSM4232678 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ION_TORRENT | Ion Torrent Proton | SRP238807 | 36h_JAK1_WT_2.fastq.gz | fastq | 2560460349.0 | 43193416.0 | GSM4232678 r1 | 0:59.28 | A:730124916;C:589981787;G:645350763;T:595002883;N:0 | 59 | 730124916 | 589981787 | 645350763 | 595002883 | 0 | SRX7441212 | SRS5885539 | SRA1016603 | GEO | Berman Lab, CHEO Research Institute/University of Ottawa | 1 | 0.75327 | 0.05174 | 0.74752 | 0.45367 | 72 | B | usable mapping rate | ion_torrent | ion_torrent | full_length | poly_a | unknown | bulk | unknown | unknown | Canada | 2019-12-26 | Pharyngula | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||
| 55926 | 55926 | SRR10767293 | SRX7441211 | SRS5885538 | SRP238807 | PRJNA597725 | A Zebrafish JAK1 A634D Gain of Function Model Provides New Insights into the Pathogenesis of Familial Hypereosinophilia | GSE142599 | Transcriptome Analysis | JAK1 plays an important role during zebrafish development as hematopoietic regulator with a specific impact in the myeloid lineage from where the eosinophils arise. Several genes in the JAK STAT pathway are elevated in the transgenic mutants STAT1B SOCS3A SOCS3B PIAS2 as well as patways involved in hematopoiesis immunity response to interferon and response to biotic stimuli. Overall design: Total RNA from casper JAK1 WT and JAK1 A634D zebrafish embryos at 28 hpf and 36 hpf was extracted to characterize the transcriptomic effects of the JAK1 A634D gain of function mutation | 36 hpf JAK1 WT transgenic rep 1 | GSM4232677 | tissue:whole embryo|genotype:Tgubi:cDNA JAK1 WT p2A sfGFP|developmental stage:36 hpf embryo | 36 hpf JAK1 WT transgenic rep 1 | Read trimming: the raw reads had the adapters “ATCACCGAC” removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts | whole embryo | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University Committee on Laboratory Animals UCLA of Dalhousie University. Zebrafish embryos were maintained at 28.5 °C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock. | genotype:Tgubi:cDNA JAK1 WT p2A sfGFP|developmental stage:36 hpf embryo | GSM4232677 | GSM4232677: 36 hpf JAK1 WT transgenic rep 1; Danio rerio; RNA Seq | GSM4232677 | 1 | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | GEO Accession:GSM4232677 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ION_TORRENT | Ion Torrent Proton | SRP238807 | loader:fastq load.py | 36h_JAK1_WT_1.fastq.gz | fastq | 2094453215.0 | 31942604.0 | GSM4232677 r1 | 0:65.57 | A:592981403;C:482525539;G:529643794;T:489302479;N:0 | 65 | 592981403 | 482525539 | 529643794 | 489302479 | 0 | SRX7441211 | SRS5885538 | SRA1016603 | GEO | Berman Lab, CHEO Research Institute/University of Ottawa | 1 | 0.73635 | 0.05607 | 0.75635 | 0.47675 | 61 | B | usable mapping rate | ion_torrent | ion_torrent | full_length | poly_a | unknown | bulk | unknown | unknown | Canada | 2019-12-26 | Pharyngula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 55927 | 55927 | SRR10767292 | SRX7441210 | SRS5885537 | SRP238807 | PRJNA597725 | A Zebrafish JAK1 A634D Gain of Function Model Provides New Insights into the Pathogenesis of Familial Hypereosinophilia | GSE142599 | Transcriptome Analysis | JAK1 plays an important role during zebrafish development as hematopoietic regulator with a specific impact in the myeloid lineage from where the eosinophils arise. Several genes in the JAK STAT pathway are elevated in the transgenic mutants STAT1B SOCS3A SOCS3B PIAS2 as well as patways involved in hematopoiesis immunity response to interferon and response to biotic stimuli. Overall design: Total RNA from casper JAK1 WT and JAK1 A634D zebrafish embryos at 28 hpf and 36 hpf was extracted to characterize the transcriptomic effects of the JAK1 A634D gain of function mutation | 36 hpf JAK1 A634D transgenic rep 3 | GSM4232676 | tissue:whole embryo|genotype:Tgubi:cDNA JAK1 A634D p2A sfGFP|developmental stage:36 hpf embryo | 36 hpf JAK1 A634D transgenic rep 3 | Read trimming: the raw reads had the adapters “ATCACCGAC” removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts | whole embryo | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University Committee on Laboratory Animals UCLA of Dalhousie University. Zebrafish embryos were maintained at 28.5 °C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock. | genotype:Tgubi:cDNA JAK1 A634D p2A sfGFP|developmental stage:36 hpf embryo | GSM4232676 | GSM4232676: 36 hpf JAK1 A634D transgenic rep 3; Danio rerio; RNA Seq | GSM4232676 | 1 | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | GEO Accession:GSM4232676 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ION_TORRENT | Ion Torrent Proton | SRP238807 | 36h_JAK1_A634D_3.fastq.gz | fastq | 4241535970.0 | 47169114.0 | GSM4232676 r1 | 0:89.92 | A:1179967764;C:1000306138;G:1078691404;T:982570664;N:0 | 89 | 1179967764 | 1000306138 | 1078691404 | 982570664 | 0 | SRX7441210 | SRS5885537 | SRA1016603 | GEO | Berman Lab, CHEO Research Institute/University of Ottawa | 1 | 0.69334 | 0.04467 | 0.74773 | 0.46809 | 46 | B | usable mapping rate | ion_torrent | ion_torrent | full_length | poly_a | unknown | bulk | unknown | unknown | Canada | 2019-12-26 | Pharyngula | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||
| 55928 | 55928 | SRR10767291 | SRX7441209 | SRS5885536 | SRP238807 | PRJNA597725 | A Zebrafish JAK1 A634D Gain of Function Model Provides New Insights into the Pathogenesis of Familial Hypereosinophilia | GSE142599 | Transcriptome Analysis | JAK1 plays an important role during zebrafish development as hematopoietic regulator with a specific impact in the myeloid lineage from where the eosinophils arise. Several genes in the JAK STAT pathway are elevated in the transgenic mutants STAT1B SOCS3A SOCS3B PIAS2 as well as patways involved in hematopoiesis immunity response to interferon and response to biotic stimuli. Overall design: Total RNA from casper JAK1 WT and JAK1 A634D zebrafish embryos at 28 hpf and 36 hpf was extracted to characterize the transcriptomic effects of the JAK1 A634D gain of function mutation | 36 hpf JAK1 A634D transgenic rep 2 | GSM4232675 | tissue:whole embryo|genotype:Tgubi:cDNA JAK1 A634D p2A sfGFP|developmental stage:36 hpf embryo | 36 hpf JAK1 A634D transgenic rep 2 | Read trimming: the raw reads had the adapters “ATCACCGAC” removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts | whole embryo | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University Committee on Laboratory Animals UCLA of Dalhousie University. Zebrafish embryos were maintained at 28.5 °C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock. | genotype:Tgubi:cDNA JAK1 A634D p2A sfGFP|developmental stage:36 hpf embryo | GSM4232675 | GSM4232675: 36 hpf JAK1 A634D transgenic rep 2; Danio rerio; RNA Seq | GSM4232675 | 1 | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | GEO Accession:GSM4232675 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ION_TORRENT | Ion Torrent Proton | SRP238807 | 36h_JAK1_A634D_2.fastq.gz | fastq | 2456466408.0 | 32142937.0 | GSM4232675 r1 | 0:76.42 | A:709646128;C:553448600;G:580023523;T:613348157;N:0 | 76 | 709646128 | 553448600 | 580023523 | 613348157 | 0 | SRX7441209 | SRS5885536 | SRA1016603 | GEO | Berman Lab, CHEO Research Institute/University of Ottawa | 1 | 0.67769 | 0.05801 | 0.76059 | 0.48545 | 39 | B | usable mapping rate | ion_torrent | ion_torrent | full_length | poly_a | unknown | bulk | unknown | unknown | Canada | 2019-12-26 | Pharyngula | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||
| 55929 | 55929 | SRR10767290 | SRX7441208 | SRS5885535 | SRP238807 | PRJNA597725 | A Zebrafish JAK1 A634D Gain of Function Model Provides New Insights into the Pathogenesis of Familial Hypereosinophilia | GSE142599 | Transcriptome Analysis | JAK1 plays an important role during zebrafish development as hematopoietic regulator with a specific impact in the myeloid lineage from where the eosinophils arise. Several genes in the JAK STAT pathway are elevated in the transgenic mutants STAT1B SOCS3A SOCS3B PIAS2 as well as patways involved in hematopoiesis immunity response to interferon and response to biotic stimuli. Overall design: Total RNA from casper JAK1 WT and JAK1 A634D zebrafish embryos at 28 hpf and 36 hpf was extracted to characterize the transcriptomic effects of the JAK1 A634D gain of function mutation | 36 hpf JAK1 A634D transgenic rep 1 | GSM4232674 | tissue:whole embryo|genotype:Tgubi:cDNA JAK1 A634D p2A sfGFP|developmental stage:36 hpf embryo | 36 hpf JAK1 A634D transgenic rep 1 | Read trimming: the raw reads had the adapters “ATCACCGAC” removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts | whole embryo | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University Committee on Laboratory Animals UCLA of Dalhousie University. Zebrafish embryos were maintained at 28.5 °C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock. | genotype:Tgubi:cDNA JAK1 A634D p2A sfGFP|developmental stage:36 hpf embryo | GSM4232674 | GSM4232674: 36 hpf JAK1 A634D transgenic rep 1; Danio rerio; RNA Seq | GSM4232674 | 1 | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | GEO Accession:GSM4232674 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ION_TORRENT | Ion Torrent Proton | SRP238807 | 36h_JAK1_A634D_1.fastq.gz | fastq | 2197901663.0 | 33128985.0 | GSM4232674 r1 | 0:66.34 | A:621605948;C:508292358;G:560418617;T:507584740;N:0 | 66 | 621605948 | 508292358 | 560418617 | 507584740 | 0 | SRX7441208 | SRS5885535 | SRA1016603 | GEO | Berman Lab, CHEO Research Institute/University of Ottawa | 1 | 0.73924 | 0.05937 | 0.77234 | 0.46385 | 50 | B | usable mapping rate | ion_torrent | ion_torrent | full_length | poly_a | unknown | bulk | unknown | unknown | Canada | 2019-12-26 | Pharyngula | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||
| 55930 | 55930 | SRR10767289 | SRX7441207 | SRS5885534 | SRP238807 | PRJNA597725 | A Zebrafish JAK1 A634D Gain of Function Model Provides New Insights into the Pathogenesis of Familial Hypereosinophilia | GSE142599 | Transcriptome Analysis | JAK1 plays an important role during zebrafish development as hematopoietic regulator with a specific impact in the myeloid lineage from where the eosinophils arise. Several genes in the JAK STAT pathway are elevated in the transgenic mutants STAT1B SOCS3A SOCS3B PIAS2 as well as patways involved in hematopoiesis immunity response to interferon and response to biotic stimuli. Overall design: Total RNA from casper JAK1 WT and JAK1 A634D zebrafish embryos at 28 hpf and 36 hpf was extracted to characterize the transcriptomic effects of the JAK1 A634D gain of function mutation | 36 hpf wild type rep3 | GSM4232673 | tissue:whole embryo|genotype:wild type|developmental stage:36 hpf embryo | 36 hpf wild type rep3 | Read trimming: the raw reads had the adapters “ATCACCGAC” removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts | whole embryo | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University Committee on Laboratory Animals UCLA of Dalhousie University. Zebrafish embryos were maintained at 28.5 °C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock. | genotype:wild type|developmental stage:36 hpf embryo | GSM4232673 | GSM4232673: 36 hpf wild type rep3; Danio rerio; RNA Seq | GSM4232673 | 1 | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | GEO Accession:GSM4232673 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ION_TORRENT | Ion Torrent Proton | SRP238807 | 36h_Casper_3.fastq.gz | fastq | 2521721766.0 | 35478367.0 | GSM4232673 r1 | 0:71.08 | A:700525735;C:596259331;G:641495563;T:583441137;N:0 | 71 | 700525735 | 596259331 | 641495563 | 583441137 | 0 | SRX7441207 | SRS5885534 | SRA1016603 | GEO | Berman Lab, CHEO Research Institute/University of Ottawa | 1 | 0.70683 | 0.03758 | 0.77764 | 0.46898 | 113 | B | usable mapping rate | ion_torrent | ion_torrent | full_length | poly_a | unknown | bulk | unknown | unknown | Canada | 2019-12-26 | Pharyngula | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||
| 55931 | 55931 | SRR10767288 | SRX7441206 | SRS5885533 | SRP238807 | PRJNA597725 | A Zebrafish JAK1 A634D Gain of Function Model Provides New Insights into the Pathogenesis of Familial Hypereosinophilia | GSE142599 | Transcriptome Analysis | JAK1 plays an important role during zebrafish development as hematopoietic regulator with a specific impact in the myeloid lineage from where the eosinophils arise. Several genes in the JAK STAT pathway are elevated in the transgenic mutants STAT1B SOCS3A SOCS3B PIAS2 as well as patways involved in hematopoiesis immunity response to interferon and response to biotic stimuli. Overall design: Total RNA from casper JAK1 WT and JAK1 A634D zebrafish embryos at 28 hpf and 36 hpf was extracted to characterize the transcriptomic effects of the JAK1 A634D gain of function mutation | 36 hpf wild type rep2 | GSM4232672 | tissue:whole embryo|genotype:wild type|developmental stage:36 hpf embryo | 36 hpf wild type rep2 | Read trimming: the raw reads had the adapters “ATCACCGAC” removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts | whole embryo | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University Committee on Laboratory Animals UCLA of Dalhousie University. Zebrafish embryos were maintained at 28.5 °C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock. | genotype:wild type|developmental stage:36 hpf embryo | GSM4232672 | GSM4232672: 36 hpf wild type rep2; Danio rerio; RNA Seq | GSM4232672 | 1 | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | GEO Accession:GSM4232672 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ION_TORRENT | Ion Torrent Proton | SRP238807 | 36h_Casper_2.fastq.gz | fastq | 2178583599.0 | 36369833.0 | GSM4232672 r1 | 0:59.90 | A:614435594;C:523772191;G:571455142;T:468920672;N:0 | 59 | 614435594 | 523772191 | 571455142 | 468920672 | 0 | SRX7441206 | SRS5885533 | SRA1016603 | GEO | Berman Lab, CHEO Research Institute/University of Ottawa | 1 | 0.79523 | 0.0396 | 0.78677 | 0.48417 | 76 | B | usable mapping rate | ion_torrent | ion_torrent | full_length | poly_a | unknown | bulk | unknown | unknown | Canada | 2019-12-26 | Pharyngula | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||
| 55932 | 55932 | SRR10767287 | SRX7441205 | SRS5885532 | SRP238807 | PRJNA597725 | A Zebrafish JAK1 A634D Gain of Function Model Provides New Insights into the Pathogenesis of Familial Hypereosinophilia | GSE142599 | Transcriptome Analysis | JAK1 plays an important role during zebrafish development as hematopoietic regulator with a specific impact in the myeloid lineage from where the eosinophils arise. Several genes in the JAK STAT pathway are elevated in the transgenic mutants STAT1B SOCS3A SOCS3B PIAS2 as well as patways involved in hematopoiesis immunity response to interferon and response to biotic stimuli. Overall design: Total RNA from casper JAK1 WT and JAK1 A634D zebrafish embryos at 28 hpf and 36 hpf was extracted to characterize the transcriptomic effects of the JAK1 A634D gain of function mutation | 36 hpf wild type rep1 | GSM4232671 | tissue:whole embryo|genotype:wild type|developmental stage:36 hpf embryo | 36 hpf wild type rep1 | Read trimming: the raw reads had the adapters “ATCACCGAC” removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts | whole embryo | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University Committee on Laboratory Animals UCLA of Dalhousie University. Zebrafish embryos were maintained at 28.5 °C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock. | genotype:wild type|developmental stage:36 hpf embryo | GSM4232671 | GSM4232671: 36 hpf wild type rep1; Danio rerio; RNA Seq | GSM4232671 | 1 | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | GEO Accession:GSM4232671 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ION_TORRENT | Ion Torrent Proton | SRP238807 | 36h_Casper_1.fastq.gz | fastq | 2051080839.0 | 29493121.0 | GSM4232671 r1 | 0:69.54 | A:568337886;C:483385131;G:533547242;T:465810580;N:0 | 69 | 568337886 | 483385131 | 533547242 | 465810580 | 0 | SRX7441205 | SRS5885532 | SRA1016603 | GEO | Berman Lab, CHEO Research Institute/University of Ottawa | 1 | 0.76599 | 0.08449 | 0.7553 | 0.48389 | 62 | B | usable mapping rate | ion_torrent | ion_torrent | full_length | poly_a | unknown | bulk | unknown | unknown | Canada | 2019-12-26 | Pharyngula | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||
| 55933 | 55933 | SRR10767286 | SRX7441204 | SRS5885531 | SRP238807 | PRJNA597725 | A Zebrafish JAK1 A634D Gain of Function Model Provides New Insights into the Pathogenesis of Familial Hypereosinophilia | GSE142599 | Transcriptome Analysis | JAK1 plays an important role during zebrafish development as hematopoietic regulator with a specific impact in the myeloid lineage from where the eosinophils arise. Several genes in the JAK STAT pathway are elevated in the transgenic mutants STAT1B SOCS3A SOCS3B PIAS2 as well as patways involved in hematopoiesis immunity response to interferon and response to biotic stimuli. Overall design: Total RNA from casper JAK1 WT and JAK1 A634D zebrafish embryos at 28 hpf and 36 hpf was extracted to characterize the transcriptomic effects of the JAK1 A634D gain of function mutation | 28 hpf JAK1 WT transgenic rep 3 | GSM4232670 | tissue:whole embryo|genotype:Tgubi:cDNA JAK1 WT p2A sfGFP|developmental stage:28 hpf embryo | 28 hpf JAK1 WT transgenic rep 3 | Read trimming: the raw reads had the adapters “ATCACCGAC” removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts | whole embryo | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University Committee on Laboratory Animals UCLA of Dalhousie University. Zebrafish embryos were maintained at 28.5 °C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock. | genotype:Tgubi:cDNA JAK1 WT p2A sfGFP|developmental stage:28 hpf embryo | GSM4232670 | GSM4232670: 28 hpf JAK1 WT transgenic rep 3; Danio rerio; RNA Seq | GSM4232670 | 1 | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | GEO Accession:GSM4232670 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ION_TORRENT | Ion Torrent Proton | SRP238807 | 28h_JAK1_WT_3.fastq.gz | fastq | 3005037417.0 | 40912443.0 | GSM4232670 r1 | 0:73.45 | A:846279597;C:696356412;G:763013287;T:699388121;N:0 | 73 | 846279597 | 696356412 | 763013287 | 699388121 | 0 | SRX7441204 | SRS5885531 | SRA1016603 | GEO | Berman Lab, CHEO Research Institute/University of Ottawa | 1 | 0.74899 | 0.06252 | 0.73708 | 0.46159 | 164 | B | usable mapping rate | ion_torrent | ion_torrent | full_length | poly_a | unknown | bulk | unknown | unknown | Canada | 2019-12-26 | Pharyngula | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||
| 55934 | 55934 | SRR10767285 | SRX7441203 | SRS5885530 | SRP238807 | PRJNA597725 | A Zebrafish JAK1 A634D Gain of Function Model Provides New Insights into the Pathogenesis of Familial Hypereosinophilia | GSE142599 | Transcriptome Analysis | JAK1 plays an important role during zebrafish development as hematopoietic regulator with a specific impact in the myeloid lineage from where the eosinophils arise. Several genes in the JAK STAT pathway are elevated in the transgenic mutants STAT1B SOCS3A SOCS3B PIAS2 as well as patways involved in hematopoiesis immunity response to interferon and response to biotic stimuli. Overall design: Total RNA from casper JAK1 WT and JAK1 A634D zebrafish embryos at 28 hpf and 36 hpf was extracted to characterize the transcriptomic effects of the JAK1 A634D gain of function mutation | 28 hpf JAK1 WT transgenic rep 2 | GSM4232669 | tissue:whole embryo|genotype:Tgubi:cDNA JAK1 WT p2A sfGFP|developmental stage:28 hpf embryo | 28 hpf JAK1 WT transgenic rep 2 | Read trimming: the raw reads had the adapters “ATCACCGAC” removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts | whole embryo | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University Committee on Laboratory Animals UCLA of Dalhousie University. Zebrafish embryos were maintained at 28.5 °C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock. | genotype:Tgubi:cDNA JAK1 WT p2A sfGFP|developmental stage:28 hpf embryo | GSM4232669 | GSM4232669: 28 hpf JAK1 WT transgenic rep 2; Danio rerio; RNA Seq | GSM4232669 | 1 | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | GEO Accession:GSM4232669 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ION_TORRENT | Ion Torrent Proton | SRP238807 | 28h_JAK1_WT_2.fastq.gz | fastq | 2973958523.0 | 36683139.0 | GSM4232669 r1 | 0:81.07 | A:836795761;C:679113153;G:741994649;T:716054960;N:0 | 81 | 836795761 | 679113153 | 741994649 | 716054960 | 0 | SRX7441203 | SRS5885530 | SRA1016603 | GEO | Berman Lab, CHEO Research Institute/University of Ottawa | 1 | 0.7064 | 0.07418 | 0.74501 | 0.46732 | 94 | B | usable mapping rate | ion_torrent | ion_torrent | full_length | poly_a | unknown | bulk | unknown | unknown | Canada | 2019-12-26 | Pharyngula | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||
| 55935 | 55935 | SRR10767284 | SRX7441202 | SRS5885529 | SRP238807 | PRJNA597725 | A Zebrafish JAK1 A634D Gain of Function Model Provides New Insights into the Pathogenesis of Familial Hypereosinophilia | GSE142599 | Transcriptome Analysis | JAK1 plays an important role during zebrafish development as hematopoietic regulator with a specific impact in the myeloid lineage from where the eosinophils arise. Several genes in the JAK STAT pathway are elevated in the transgenic mutants STAT1B SOCS3A SOCS3B PIAS2 as well as patways involved in hematopoiesis immunity response to interferon and response to biotic stimuli. Overall design: Total RNA from casper JAK1 WT and JAK1 A634D zebrafish embryos at 28 hpf and 36 hpf was extracted to characterize the transcriptomic effects of the JAK1 A634D gain of function mutation | 28 hpf JAK1 WT transgenic rep 1 | GSM4232668 | tissue:whole embryo|genotype:Tgubi:cDNA JAK1 WT p2A sfGFP|developmental stage:28 hpf embryo | 28 hpf JAK1 WT transgenic rep 1 | Read trimming: the raw reads had the adapters “ATCACCGAC” removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts | whole embryo | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University Committee on Laboratory Animals UCLA of Dalhousie University. Zebrafish embryos were maintained at 28.5 °C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock. | genotype:Tgubi:cDNA JAK1 WT p2A sfGFP|developmental stage:28 hpf embryo | GSM4232668 | GSM4232668: 28 hpf JAK1 WT transgenic rep 1; Danio rerio; RNA Seq | GSM4232668 | 1 | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | GEO Accession:GSM4232668 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ION_TORRENT | Ion Torrent Proton | SRP238807 | 28h_JAK1_WT_1.fastq.gz | fastq | 1691518079.0 | 28932427.0 | GSM4232668 r1 | 0:58.46 | A:475931203;C:396253965;G:439590903;T:379742008;N:0 | 58 | 475931203 | 396253965 | 439590903 | 379742008 | 0 | SRX7441202 | SRS5885529 | SRA1016603 | GEO | Berman Lab, CHEO Research Institute/University of Ottawa | 1 | 0.73552 | 0.05663 | 0.75089 | 0.46344 | 64 | B | usable mapping rate | ion_torrent | ion_torrent | full_length | poly_a | unknown | bulk | unknown | unknown | Canada | 2019-12-26 | Pharyngula | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||
| 55936 | 55936 | SRR10767283 | SRX7441201 | SRS5885528 | SRP238807 | PRJNA597725 | A Zebrafish JAK1 A634D Gain of Function Model Provides New Insights into the Pathogenesis of Familial Hypereosinophilia | GSE142599 | Transcriptome Analysis | JAK1 plays an important role during zebrafish development as hematopoietic regulator with a specific impact in the myeloid lineage from where the eosinophils arise. Several genes in the JAK STAT pathway are elevated in the transgenic mutants STAT1B SOCS3A SOCS3B PIAS2 as well as patways involved in hematopoiesis immunity response to interferon and response to biotic stimuli. Overall design: Total RNA from casper JAK1 WT and JAK1 A634D zebrafish embryos at 28 hpf and 36 hpf was extracted to characterize the transcriptomic effects of the JAK1 A634D gain of function mutation | 28 hpf JAK1 A634D transgenic rep 3 | GSM4232667 | tissue:whole embryo|genotype:Tgubi:cDNA JAK1 A634D p2A sfGFP|developmental stage:28 hpf embryo | 28 hpf JAK1 A634D transgenic rep 3 | Read trimming: the raw reads had the adapters “ATCACCGAC” removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts | whole embryo | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University Committee on Laboratory Animals UCLA of Dalhousie University. Zebrafish embryos were maintained at 28.5 °C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock. | genotype:Tgubi:cDNA JAK1 A634D p2A sfGFP|developmental stage:28 hpf embryo | GSM4232667 | GSM4232667: 28 hpf JAK1 A634D transgenic rep 3; Danio rerio; RNA Seq | GSM4232667 | 1 | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | GEO Accession:GSM4232667 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ION_TORRENT | Ion Torrent Proton | SRP238807 | 28h_JAK1_A634D_3.fastq.gz | fastq | 3045470999.0 | 42256971.0 | GSM4232667 r1 | 0:72.07 | A:852249654;C:717480980;G:783460499;T:692279866;N:0 | 72 | 852249654 | 717480980 | 783460499 | 692279866 | 0 | SRX7441201 | SRS5885528 | SRA1016603 | GEO | Berman Lab, CHEO Research Institute/University of Ottawa | 1 | 0.74394 | 0.05129 | 0.73097 | 0.47382 | 76 | B | usable mapping rate | ion_torrent | ion_torrent | full_length | poly_a | unknown | bulk | unknown | unknown | Canada | 2019-12-26 | Pharyngula | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||
| 55937 | 55937 | SRR10767282 | SRX7441200 | SRS5885527 | SRP238807 | PRJNA597725 | A Zebrafish JAK1 A634D Gain of Function Model Provides New Insights into the Pathogenesis of Familial Hypereosinophilia | GSE142599 | Transcriptome Analysis | JAK1 plays an important role during zebrafish development as hematopoietic regulator with a specific impact in the myeloid lineage from where the eosinophils arise. Several genes in the JAK STAT pathway are elevated in the transgenic mutants STAT1B SOCS3A SOCS3B PIAS2 as well as patways involved in hematopoiesis immunity response to interferon and response to biotic stimuli. Overall design: Total RNA from casper JAK1 WT and JAK1 A634D zebrafish embryos at 28 hpf and 36 hpf was extracted to characterize the transcriptomic effects of the JAK1 A634D gain of function mutation | 28 hpf JAK1 A634D transgenic rep 2 | GSM4232666 | tissue:whole embryo|genotype:Tgubi:cDNA JAK1 A634D p2A sfGFP|developmental stage:28 hpf embryo | 28 hpf JAK1 A634D transgenic rep 2 | Read trimming: the raw reads had the adapters “ATCACCGAC” removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts | whole embryo | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University Committee on Laboratory Animals UCLA of Dalhousie University. Zebrafish embryos were maintained at 28.5 °C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock. | genotype:Tgubi:cDNA JAK1 A634D p2A sfGFP|developmental stage:28 hpf embryo | GSM4232666 | GSM4232666: 28 hpf JAK1 A634D transgenic rep 2; Danio rerio; RNA Seq | GSM4232666 | 1 | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | GEO Accession:GSM4232666 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ION_TORRENT | Ion Torrent Proton | SRP238807 | 28h_JAK1_A634D_2.fastq.gz | fastq | 2828148639.0 | 42710224.0 | GSM4232666 r1 | 0:66.22 | A:810947164;C:659404496;G:725958457;T:631838522;N:0 | 66 | 810947164 | 659404496 | 725958457 | 631838522 | 0 | SRX7441200 | SRS5885527 | SRA1016603 | GEO | Berman Lab, CHEO Research Institute/University of Ottawa | 1 | 0.76652 | 0.04812 | 0.7638 | 0.48652 | 28 | B | usable mapping rate | ion_torrent | ion_torrent | full_length | poly_a | unknown | bulk | unknown | unknown | Canada | 2019-12-26 | Pharyngula | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||
| 55938 | 55938 | SRR10767281 | SRX7441199 | SRS5885526 | SRP238807 | PRJNA597725 | A Zebrafish JAK1 A634D Gain of Function Model Provides New Insights into the Pathogenesis of Familial Hypereosinophilia | GSE142599 | Transcriptome Analysis | JAK1 plays an important role during zebrafish development as hematopoietic regulator with a specific impact in the myeloid lineage from where the eosinophils arise. Several genes in the JAK STAT pathway are elevated in the transgenic mutants STAT1B SOCS3A SOCS3B PIAS2 as well as patways involved in hematopoiesis immunity response to interferon and response to biotic stimuli. Overall design: Total RNA from casper JAK1 WT and JAK1 A634D zebrafish embryos at 28 hpf and 36 hpf was extracted to characterize the transcriptomic effects of the JAK1 A634D gain of function mutation | 28 hpf JAK1 A634D transgenic rep 1 | GSM4232665 | tissue:whole embryo|genotype:Tgubi:cDNA JAK1 A634D p2A sfGFP|developmental stage:28 hpf embryo | 28 hpf JAK1 A634D transgenic rep 1 | Read trimming: the raw reads had the adapters “ATCACCGAC” removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts | whole embryo | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University Committee on Laboratory Animals UCLA of Dalhousie University. Zebrafish embryos were maintained at 28.5 °C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock. | genotype:Tgubi:cDNA JAK1 A634D p2A sfGFP|developmental stage:28 hpf embryo | GSM4232665 | GSM4232665: 28 hpf JAK1 A634D transgenic rep 1; Danio rerio; RNA Seq | GSM4232665 | 1 | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | GEO Accession:GSM4232665 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ION_TORRENT | Ion Torrent Proton | SRP238807 | 28h_JAK1_A634D_1.fastq.gz | fastq | 2435214022.0 | 32006444.0 | GSM4232665 r1 | 0:76.09 | A:671766129;C:571275330;G:623388119;T:568784444;N:0 | 76 | 671766129 | 571275330 | 623388119 | 568784444 | 0 | SRX7441199 | SRS5885526 | SRA1016603 | GEO | Berman Lab, CHEO Research Institute/University of Ottawa | 1 | 0.70175 | 0.0702 | 0.74925 | 0.48275 | 136 | B | usable mapping rate | ion_torrent | ion_torrent | full_length | poly_a | unknown | bulk | unknown | unknown | Canada | 2019-12-26 | Pharyngula | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||
| 55939 | 55939 | SRR10767280 | SRX7441198 | SRS5885525 | SRP238807 | PRJNA597725 | A Zebrafish JAK1 A634D Gain of Function Model Provides New Insights into the Pathogenesis of Familial Hypereosinophilia | GSE142599 | Transcriptome Analysis | JAK1 plays an important role during zebrafish development as hematopoietic regulator with a specific impact in the myeloid lineage from where the eosinophils arise. Several genes in the JAK STAT pathway are elevated in the transgenic mutants STAT1B SOCS3A SOCS3B PIAS2 as well as patways involved in hematopoiesis immunity response to interferon and response to biotic stimuli. Overall design: Total RNA from casper JAK1 WT and JAK1 A634D zebrafish embryos at 28 hpf and 36 hpf was extracted to characterize the transcriptomic effects of the JAK1 A634D gain of function mutation | 28 hpf wild type rep3 | GSM4232664 | tissue:whole embryo|genotype:wild type|developmental stage:28 hpf embryo | 28 hpf wild type rep3 | Read trimming: the raw reads had the adapters “ATCACCGAC” removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts | whole embryo | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University Committee on Laboratory Animals UCLA of Dalhousie University. Zebrafish embryos were maintained at 28.5 °C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock. | genotype:wild type|developmental stage:28 hpf embryo | GSM4232664 | GSM4232664: 28 hpf wild type rep3; Danio rerio; RNA Seq | GSM4232664 | 1 | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | GEO Accession:GSM4232664 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ION_TORRENT | Ion Torrent Proton | SRP238807 | 28h_Casper_3.fastq.gz | fastq | 1904992285.0 | 29766503.0 | GSM4232664 r1 | 0:64.00 | A:533559701;C:445590246;G:489978228;T:435864110;N:0 | 64 | 533559701 | 445590246 | 489978228 | 435864110 | 0 | SRX7441198 | SRS5885525 | SRA1016603 | GEO | Berman Lab, CHEO Research Institute/University of Ottawa | 1 | 0.75479 | 0.06238 | 0.74458 | 0.47429 | 9 | B | usable mapping rate | ion_torrent | ion_torrent | full_length | poly_a | unknown | bulk | unknown | unknown | Canada | 2019-12-26 | Pharyngula | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||
| 55940 | 55940 | SRR10767279 | SRX7441197 | SRS5885524 | SRP238807 | PRJNA597725 | A Zebrafish JAK1 A634D Gain of Function Model Provides New Insights into the Pathogenesis of Familial Hypereosinophilia | GSE142599 | Transcriptome Analysis | JAK1 plays an important role during zebrafish development as hematopoietic regulator with a specific impact in the myeloid lineage from where the eosinophils arise. Several genes in the JAK STAT pathway are elevated in the transgenic mutants STAT1B SOCS3A SOCS3B PIAS2 as well as patways involved in hematopoiesis immunity response to interferon and response to biotic stimuli. Overall design: Total RNA from casper JAK1 WT and JAK1 A634D zebrafish embryos at 28 hpf and 36 hpf was extracted to characterize the transcriptomic effects of the JAK1 A634D gain of function mutation | 28 hpf wild type rep2 | GSM4232663 | tissue:whole embryo|genotype:wild type|developmental stage:28 hpf embryo | 28 hpf wild type rep2 | Read trimming: the raw reads had the adapters “ATCACCGAC” removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts | whole embryo | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University Committee on Laboratory Animals UCLA of Dalhousie University. Zebrafish embryos were maintained at 28.5 °C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock. | genotype:wild type|developmental stage:28 hpf embryo | GSM4232663 | GSM4232663: 28 hpf wild type rep2; Danio rerio; RNA Seq | GSM4232663 | 1 | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | GEO Accession:GSM4232663 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ION_TORRENT | Ion Torrent Proton | SRP238807 | 28h_Casper_2.fastq.gz | fastq | 1993805090.0 | 28272142.0 | GSM4232663 r1 | 0:70.52 | A:556500481;C:463867930;G:517077272;T:456359407;N:0 | 70 | 556500481 | 463867930 | 517077272 | 456359407 | 0 | SRX7441197 | SRS5885524 | SRA1016603 | GEO | Berman Lab, CHEO Research Institute/University of Ottawa | 1 | 0.70292 | 0.06841 | 0.74588 | 0.45622 | 58 | B | usable mapping rate | ion_torrent | ion_torrent | full_length | poly_a | unknown | bulk | unknown | unknown | Canada | 2019-12-26 | Pharyngula | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||
| 55941 | 55941 | SRR10767278 | SRX7441196 | SRS5885523 | SRP238807 | PRJNA597725 | A Zebrafish JAK1 A634D Gain of Function Model Provides New Insights into the Pathogenesis of Familial Hypereosinophilia | GSE142599 | Transcriptome Analysis | JAK1 plays an important role during zebrafish development as hematopoietic regulator with a specific impact in the myeloid lineage from where the eosinophils arise. Several genes in the JAK STAT pathway are elevated in the transgenic mutants STAT1B SOCS3A SOCS3B PIAS2 as well as patways involved in hematopoiesis immunity response to interferon and response to biotic stimuli. Overall design: Total RNA from casper JAK1 WT and JAK1 A634D zebrafish embryos at 28 hpf and 36 hpf was extracted to characterize the transcriptomic effects of the JAK1 A634D gain of function mutation | 28 hpf wild type rep1 | GSM4232662 | tissue:whole embryo|genotype:wild type|developmental stage:28 hpf embryo | 28 hpf wild type rep1 | Read trimming: the raw reads had the adapters “ATCACCGAC” removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts | whole embryo | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University Committee on Laboratory Animals UCLA of Dalhousie University. Zebrafish embryos were maintained at 28.5 °C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock. | genotype:wild type|developmental stage:28 hpf embryo | GSM4232662 | GSM4232662: 28 hpf wild type rep1; Danio rerio; RNA Seq | GSM4232662 | 1 | Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 µL Trizol reagent Thermo Fisher Scientific 15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4ºC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number ≥8 were selected for library preparation. Poly A enrichment was performed from 20 µg of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere™ Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher. | GEO Accession:GSM4232662 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ION_TORRENT | Ion Torrent Proton | SRP238807 | 28h_Casper_1.fastq.gz | fastq | 2987237440.0 | 38462041.0 | GSM4232662 r1 | 0:77.67 | A:823935737;C:709854466;G:784861423;T:668585814;N:0 | 77 | 823935737 | 709854466 | 784861423 | 668585814 | 0 | SRX7441196 | SRS5885523 | SRA1016603 | GEO | Berman Lab, CHEO Research Institute/University of Ottawa | 1 | 0.79137 | 0.06249 | 0.76615 | 0.47782 | 70 | B | usable mapping rate | ion_torrent | ion_torrent | full_length | poly_a | unknown | bulk | unknown | unknown | Canada | 2019-12-26 | Pharyngula | Embryo | Whole Organism | All anatomical structures |
Advanced export
JSON shape: default, array, newline-delimited
CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;