metadata: run_metadata: 1,259 rows where experiment.library_source = "TRANSCRIPTOMIC SINGLE CELL", tissue_curation = "Brain" and tissue_curation

1,259 rows where experiment.library_source = "TRANSCRIPTOMIC SINGLE CELL", tissue_curation = "Brain" and tissue_curation_coarse = "Nervous System"

descending

Link	rowid ▼	run.accession	experiment.accession	sample.accession	study.accession	bioproject	study.title	study.alias	study.type	study.abstract	study.attributes	study.PMIDs	sample.description	sample.title	sample.alias	sample.centername	sample.attributes	GEOsample.title	GEOsample.dataprocessing	GEOsample.source	GEOsample.treatmentprotocol	GEOsample.extractprotocol	GEOsample.growthprotocol	GEOsample.characteristics	GEOsample.accession	experiment.title	experiment.alias	experiment.library_name	experiment.design_description	experiment.library_construction_protocol	experiment.library_strategy	experiment.library_source	experiment.library_selection	experiment.library_layout	experiment.platform	experiment.instrument_model	experiment.study_ref	run.title	run.attributes	run.filename	run.semantic_name	run.total_bases	run.total_spots	run.alias	run.read_lengths	run.base_counts	run.r1_length	run.r2_length	run.r3_length	run.r4_length	run.Acount	run.Ccount	run.Gcount	run.Tcount	run.Ncount	run.experiment	run.pool_member	submission.accession	submission.srasource	submission.bioprojectsource	seqdetective.n_mates	seqdetective.mapping_rate.mate1	seqdetective.mapping_rate.mate2	seqdetective.nofeature_rate.mate1	seqdetective.nofeature_rate.mate2	seqdetective.sparsity.mate1	seqdetective.sparsity.mate2	seqdetective.pos_strand_rate.mate1	seqdetective.pos_strand_rate.mate2	seqdetective.readlen.mate1	seqdetective.readlen.mate2	seqdetective.judgement.mate1	seqdetective.judgement.mate2	seqdetective.judgement.reason	platform_family	instrument_generation	read_bias	selection_class	prep_kit	sc_or_bulk	tech_class	technology	submission.bioprojectsource.country	earliest_date	devstage_curation	devstage_curation_coarse	tissue_curation	tissue_curation_coarse
11813	11813	ERR11788863	ERX11187331	ERS16221143	ERP149944	PRJEB64780	A single cell transcriptomic atlas reveals a new myeloid parenchymal population in the zebrafish brain	E-MTAB-13223	Transcriptome Analysis	To understand the cellular basis of the immune compartment of the zebrafish brain we have established reliable protocols for dissociation and prospective isolation of brain leukocytes using fluorescent transgenic lines. By combining this approach with single cell RNA sequencing we have generated a gene expression atlas composed of the distinct immune cells present in the homeostatic brain. These analyses revealed the presence of subpopulations of mononuclear phagocytes and other leukocytes including cell types that have not been or have been poorly characterized so far. Here we present the characterization of a new mononuclear phagocyte population that represents an important fraction among all brain leukocytes. Adult brain single cell suspensions were prepared from adult Tgp2ry12:GFP; cd45:DsRed fish n=3 and a total of 14 000 cd45:DsRed+ cells were processed for single cell profiling using the 10x Genomics platform.	ENA FIRST PUBLIC:2023 12 25\|ENA LAST UPDATE:2023 12 25		Protocols: FACS sorting of cd45:Dsred cells. Brains from adult Tgp2ry12:GFP; cd45:DsRed fish n=3 were dissected in 0.9X Dulbecco′s Phosphate Buffered Saline DPBS were triturated and treated with Liberase TM at 33°C for 30 45 minutes fully dissociated using a syringe with a 26G needle and washed in 2% fetal bovine serum diluted in 0.9X DPBS. Cell suspensions were centrifuged at 290g 4ºC 10 min and filtered through a 40µm nylon mesh. Just before flow cytometry analysis using calcein violet to exclude dead cells 1µM Thermo Fisher. Flow cytometry acquisition and cell sorting was performed on a FACS ARIA II Becton Dickinson. RNA Illumina	Sample 1	SAMEA114235870	Universite Libre de Bruxelles	ENA FIRST PUBLIC:2023 12 25T01:15:29Z\|ENA LAST UPDATE:2023 12 25T01:15:29Z\|External Id:SAMEA114235870\|INSDC center name:Universite Libre de Bruxelles\|INSDC first public:2023 12 25T01:15:29Z\|INSDC last update:2023 12 25T01:15:29Z\|INSDC status:public\|Submitter Id:E MTAB 13223:Sample 1\|age:5\|broker name:ArrayExpress\|cell type:leukocyte\|collection date:not collected\|common name:zebrafish\|developmental stage:adult\|genotype:wild type genotype\|geographic location country and/or sea:not collected\|individual:pool of 3 fish\|isolate:not applicable\|organism part:brain\|sample name:E MTAB 13223:Sample 1\|scientific name:Danio rerio\|sex:male and female\|strain:AB									A single cell transcriptomic atlas reveals a new myeloid parenchymal population in the zebrafish brain	E MTAB 13223:Sample 1 p	Sample 1 p	A single cell transcriptomic atlas reveals a new myeloid parenchymal population in the zebrafish brain	FACS sorting of cd45:Dsred cells. Brains from adult Tgp2ry12:GFP; cd45:DsRed fish n=3 were dissected in 0.9X Dulbecco′s Phosphate Buffered Saline DPBS were triturated and treated with Liberase TM at 33°C for 30 45 minutes fully dissociated using a syringe with a 26G needle and washed in 2% fetal bovine serum diluted in 0.9X DPBS. Cell suspensions were centrifuged at 290g 4ºC 10 min and filtered through a 40µm nylon mesh. Just before flow cytometry analysis using calcein violet to exclude dead cells 1µM Thermo Fisher. Flow cytometry acquisition and cell sorting was performed on a FACS ARIA II Becton Dickinson. RNA Illumina	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	PolyA	PAIRED	ILLUMINA	NextSeq 550	ERP149944	NextSeq 550 paired end sequencing; A single cell transcriptomic atlas reveals a new myeloid parenchymal population in the zebrafish brain	ENA FIRST PUBLIC:2023 12 25\|ENA LAST UPDATE:2023 12 25	L41805_Track-81843_R1.fastq.gz L41805_Track-81843_R2.fastq.gz	fastq fastq	5545444464.0	66017196.0	E MTAB 13223:L41805 Track 81843	0:28 1:56	A:1576174024;C:1193175858;G:1221776615;T:1551009004;N:3308963	28	56			1576174024	1193175858	1221776615	1551009004	3308963	ERX11187331	ERS16221143	ERA26318932	European Bioinformatics Institute\|European Nucleotide Archive	European Bioinformatics Institute\|European Nucleotide Archive	2	0.00738	0.90151	0.00285	0.20553	0.99072	0.82402	0.4645	0.53817	28	56	T	B	sc-like readlen	illumina	nextseq	unknown	poly_a	unknown	sc	single_cell_droplet	10x	United Kingdom	2023-12-25	Adult	Adult	Brain	Nervous System
11814	11814	ERR11788864	ERX11187331	ERS16221143	ERP149944	PRJEB64780	A single cell transcriptomic atlas reveals a new myeloid parenchymal population in the zebrafish brain	E-MTAB-13223	Transcriptome Analysis	To understand the cellular basis of the immune compartment of the zebrafish brain we have established reliable protocols for dissociation and prospective isolation of brain leukocytes using fluorescent transgenic lines. By combining this approach with single cell RNA sequencing we have generated a gene expression atlas composed of the distinct immune cells present in the homeostatic brain. These analyses revealed the presence of subpopulations of mononuclear phagocytes and other leukocytes including cell types that have not been or have been poorly characterized so far. Here we present the characterization of a new mononuclear phagocyte population that represents an important fraction among all brain leukocytes. Adult brain single cell suspensions were prepared from adult Tgp2ry12:GFP; cd45:DsRed fish n=3 and a total of 14 000 cd45:DsRed+ cells were processed for single cell profiling using the 10x Genomics platform.	ENA FIRST PUBLIC:2023 12 25\|ENA LAST UPDATE:2023 12 25		Protocols: FACS sorting of cd45:Dsred cells. Brains from adult Tgp2ry12:GFP; cd45:DsRed fish n=3 were dissected in 0.9X Dulbecco′s Phosphate Buffered Saline DPBS were triturated and treated with Liberase TM at 33°C for 30 45 minutes fully dissociated using a syringe with a 26G needle and washed in 2% fetal bovine serum diluted in 0.9X DPBS. Cell suspensions were centrifuged at 290g 4ºC 10 min and filtered through a 40µm nylon mesh. Just before flow cytometry analysis using calcein violet to exclude dead cells 1µM Thermo Fisher. Flow cytometry acquisition and cell sorting was performed on a FACS ARIA II Becton Dickinson. RNA Illumina	Sample 1	SAMEA114235870	Universite Libre de Bruxelles	ENA FIRST PUBLIC:2023 12 25T01:15:29Z\|ENA LAST UPDATE:2023 12 25T01:15:29Z\|External Id:SAMEA114235870\|INSDC center name:Universite Libre de Bruxelles\|INSDC first public:2023 12 25T01:15:29Z\|INSDC last update:2023 12 25T01:15:29Z\|INSDC status:public\|Submitter Id:E MTAB 13223:Sample 1\|age:5\|broker name:ArrayExpress\|cell type:leukocyte\|collection date:not collected\|common name:zebrafish\|developmental stage:adult\|genotype:wild type genotype\|geographic location country and/or sea:not collected\|individual:pool of 3 fish\|isolate:not applicable\|organism part:brain\|sample name:E MTAB 13223:Sample 1\|scientific name:Danio rerio\|sex:male and female\|strain:AB									A single cell transcriptomic atlas reveals a new myeloid parenchymal population in the zebrafish brain	E MTAB 13223:Sample 1 p	Sample 1 p	A single cell transcriptomic atlas reveals a new myeloid parenchymal population in the zebrafish brain	FACS sorting of cd45:Dsred cells. Brains from adult Tgp2ry12:GFP; cd45:DsRed fish n=3 were dissected in 0.9X Dulbecco′s Phosphate Buffered Saline DPBS were triturated and treated with Liberase TM at 33°C for 30 45 minutes fully dissociated using a syringe with a 26G needle and washed in 2% fetal bovine serum diluted in 0.9X DPBS. Cell suspensions were centrifuged at 290g 4ºC 10 min and filtered through a 40µm nylon mesh. Just before flow cytometry analysis using calcein violet to exclude dead cells 1µM Thermo Fisher. Flow cytometry acquisition and cell sorting was performed on a FACS ARIA II Becton Dickinson. RNA Illumina	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	PolyA	PAIRED	ILLUMINA	NextSeq 550	ERP149944	NextSeq 550 paired end sequencing; A single cell transcriptomic atlas reveals a new myeloid parenchymal population in the zebrafish brain	ENA FIRST PUBLIC:2023 12 25\|ENA LAST UPDATE:2023 12 25	L41805_Track-81377_R1.fastq.gz L41805_Track-81377_R2.fastq.gz	fastq fastq	3184137096.0	37906394.0	E MTAB 13223:L41805 Track 81377	0:28 1:56	A:899943184;C:685571078;G:703849582;T:889228559;N:5544693	28	56			899943184	685571078	703849582	889228559	5544693	ERX11187331	ERS16221143	ERA26318932	European Bioinformatics Institute\|European Nucleotide Archive	European Bioinformatics Institute\|European Nucleotide Archive	2	0.00734	0.90077	0.00293	0.20318	0.99064	0.82765	0.47994	0.53473	28	56	T	B	sc-like readlen	illumina	nextseq	unknown	poly_a	unknown	sc	single_cell_droplet	10x	United Kingdom	2023-12-25	Adult	Adult	Brain	Nervous System
26536	26536	SRR26130973	SRX21844394	SRS18942411	SRP462307	PRJNA1019490	Single Cell RNA seq of Zebrafish Hypothalamus	PRJNA1019490	Other	Brain nuclei are traditionally defined by their anatomy activity and expression of specific markers. The hypothalamus contains discrete neuronal populations that coordinate fundamental behavioral functions ranging from sleep and wakefulness to feeding stress and reward in all vertebrates.					10X49 2		breed:NA\|age:Adult\|collection date:2021\|geo loc name:Israel\|sex:not applicable\|tissue:Brain Hypothalamus\|sample type:single cell 6\|BioSampleModel:Model organism or animal									SC ZF Hypo6	10X49 2	10X49 2	we worked swiftly with cold well oxygenated solutions optimizing Papain incubation times for tissue age and brain region. We used caution with Ca2+ and Mg2+ in aCSF to avoid RNA extraction/RT interference favoring Ca2+/Mg2+ free aCSF if not diluted downstream. Modified aCSF had specific component concentrations and our materials included essential equipment and anesthesia. We prepared aCSF from an 8x stock with adjusted CaCl2 and MgSO4 concentrations kept it fresh and oxygenated it. The zebrafish procedure began with lethal anesthesia brain dissection in ice cold aCSF embedding in 1.5% gel and vibratome sectioning. Tissue was dissociated in the Papain vial triturated filtered and washed followed by centrifugation. The pellet was resuspended in aCSF with DNase assessed for cell viability counted and diluted for use.		RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	Oligo-dT	PAIRED	ILLUMINA	Illumina HiSeq 2000	SRP462307			10X49_2_S5_L001_R1_001.fastq.gz 10X49_2_S5_L001_R2_001.fastq.gz 10X49_2_S5_L002_R1_001.fastq.gz 10X49_2_S5_L002_R2_001.fastq.gz 10X49_2_S5_L003_R1_001.fastq.gz 10X49_2_S5_L003_R2_001.fastq.gz 10X49_2_S5_L004_R1_001.fastq.gz 10X49_2_S5_L004_R2_001.fastq.gz	fastq fastq fastq fastq fastq fastq fastq fastq	3126113844.0	37215641.0	10X49 2 S5 L001 R1 001.fastq.gz	0:28 1:56	A:898881980;C:657306128;G:664563758;T:905262774;N:99204	28	56			898881980	657306128	664563758	905262774	99204	SRX21844394	SRS18942411	SRA1717104	Technion - Israel Institute of Technology\|Neuroscince	Technion - Israel Institute of Technology	2	0.01241	0.88203	0.00542	0.35268	0.98129	0.7586	0.40274	0.5074	28	56	T	B	sc-like readlen	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_generic	generic-scrnaseq-only	Israel	2023-09-21	Adult	Adult	Brain	Nervous System
26537	26537	SRR26130974	SRX21844393	SRS18942407	SRP462307	PRJNA1019490	Single Cell RNA seq of Zebrafish Hypothalamus	PRJNA1019490	Other	Brain nuclei are traditionally defined by their anatomy activity and expression of specific markers. The hypothalamus contains discrete neuronal populations that coordinate fundamental behavioral functions ranging from sleep and wakefulness to feeding stress and reward in all vertebrates.					10X49 1		breed:NA\|age:Adult\|collection date:2021\|geo loc name:Israel\|sex:not applicable\|tissue:Brain Hypothalamus\|sample type:single cell 5\|BioSampleModel:Model organism or animal									SC ZF Hypo5	10X49 1	10X49 1	we worked swiftly with cold well oxygenated solutions optimizing Papain incubation times for tissue age and brain region. We used caution with Ca2+ and Mg2+ in aCSF to avoid RNA extraction/RT interference favoring Ca2+/Mg2+ free aCSF if not diluted downstream. Modified aCSF had specific component concentrations and our materials included essential equipment and anesthesia. We prepared aCSF from an 8x stock with adjusted CaCl2 and MgSO4 concentrations kept it fresh and oxygenated it. The zebrafish procedure began with lethal anesthesia brain dissection in ice cold aCSF embedding in 1.5% gel and vibratome sectioning. Tissue was dissociated in the Papain vial triturated filtered and washed followed by centrifugation. The pellet was resuspended in aCSF with DNase assessed for cell viability counted and diluted for use.		RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	Oligo-dT	PAIRED	ILLUMINA	Illumina HiSeq 2000	SRP462307			10X49_1_S4_L001_R1_001.fastq.gz 10X49_1_S4_L001_R2_001.fastq.gz 10X49_1_S4_L002_R1_001.fastq.gz 10X49_1_S4_L002_R2_001.fastq.gz 10X49_1_S4_L003_R1_001.fastq.gz 10X49_1_S4_L003_R2_001.fastq.gz 10X49_1_S4_L004_R1_001.fastq.gz 10X49_1_S4_L004_R2_001.fastq.gz	fastq fastq fastq fastq fastq fastq fastq fastq	3315364752.0	39468628.0	10X49 1 S4 L001 R1 001.fastq.gz	0:28 1:56	A:957164498;C:690985782;G:704099796;T:963009918;N:104758	28	56			957164498	690985782	704099796	963009918	104758	SRX21844393	SRS18942407	SRA1717104	Technion - Israel Institute of Technology\|Neuroscince	Technion - Israel Institute of Technology	2	0.0143	0.88325	0.00601	0.35854	0.97816	0.75868	0.4158	0.50825	28	56	T	B	sc-like readlen	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_generic	generic-scrnaseq-only	Israel	2023-09-21	Adult	Adult	Brain	Nervous System
26538	26538	SRR26130975	SRX21844392	SRS18942399	SRP462307	PRJNA1019490	Single Cell RNA seq of Zebrafish Hypothalamus	PRJNA1019490	Other	Brain nuclei are traditionally defined by their anatomy activity and expression of specific markers. The hypothalamus contains discrete neuronal populations that coordinate fundamental behavioral functions ranging from sleep and wakefulness to feeding stress and reward in all vertebrates.					10X47 2		breed:NA\|age:Adult\|collection date:2021\|geo loc name:Israel\|sex:not applicable\|tissue:Brain Hypothalamus\|sample type:single cell 4\|BioSampleModel:Model organism or animal									SC ZF Hypo4	10X47 2	10X47 2	we worked swiftly with cold well oxygenated solutions optimizing Papain incubation times for tissue age and brain region. We used caution with Ca2+ and Mg2+ in aCSF to avoid RNA extraction/RT interference favoring Ca2+/Mg2+ free aCSF if not diluted downstream. Modified aCSF had specific component concentrations and our materials included essential equipment and anesthesia. We prepared aCSF from an 8x stock with adjusted CaCl2 and MgSO4 concentrations kept it fresh and oxygenated it. The zebrafish procedure began with lethal anesthesia brain dissection in ice cold aCSF embedding in 1.5% gel and vibratome sectioning. Tissue was dissociated in the Papain vial triturated filtered and washed followed by centrifugation. The pellet was resuspended in aCSF with DNase assessed for cell viability counted and diluted for use.		RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	Oligo-dT	PAIRED	ILLUMINA	Illumina HiSeq 2000	SRP462307			10X47_2_S2_L001_R1_001.fastq.gz 10X47_2_S2_L001_R2_001.fastq.gz 10X47_2_S2_L002_R1_001.fastq.gz 10X47_2_S2_L002_R2_001.fastq.gz 10X47_2_S2_L003_R1_001.fastq.gz 10X47_2_S2_L003_R2_001.fastq.gz 10X47_2_S2_L004_R1_001.fastq.gz 10X47_2_S2_L004_R2_001.fastq.gz	fastq fastq fastq fastq fastq fastq fastq fastq	3525979800.0	41975950.0	10X47 2 S2 L001 R1 001.fastq.gz	0:28 1:56	A:1030048762;C:725438274;G:855378888;T:915005070;N:108806	28	56			1030048762	725438274	855378888	915005070	108806	SRX21844392	SRS18942399	SRA1717104	Technion - Israel Institute of Technology\|Neuroscince	Technion - Israel Institute of Technology	2	0.0126	0.69252	0.00546	0.25721	0.98005	0.85295	0.39068	0.51992	28	56	T	B	sc-like readlen	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_generic	generic-scrnaseq-only	Israel	2023-09-21	Adult	Adult	Brain	Nervous System
26539	26539	SRR26130976	SRX21844391	SRS18942406	SRP462307	PRJNA1019490	Single Cell RNA seq of Zebrafish Hypothalamus	PRJNA1019490	Other	Brain nuclei are traditionally defined by their anatomy activity and expression of specific markers. The hypothalamus contains discrete neuronal populations that coordinate fundamental behavioral functions ranging from sleep and wakefulness to feeding stress and reward in all vertebrates.					10X47 1		breed:NA\|age:Adult\|collection date:2021\|geo loc name:Israel\|sex:not applicable\|tissue:Brain Hypothalamus\|sample type:single cell 3\|BioSampleModel:Model organism or animal									SC ZF Hypo3	10X47 1	10X47 1	we worked swiftly with cold well oxygenated solutions optimizing Papain incubation times for tissue age and brain region. We used caution with Ca2+ and Mg2+ in aCSF to avoid RNA extraction/RT interference favoring Ca2+/Mg2+ free aCSF if not diluted downstream. Modified aCSF had specific component concentrations and our materials included essential equipment and anesthesia. We prepared aCSF from an 8x stock with adjusted CaCl2 and MgSO4 concentrations kept it fresh and oxygenated it. The zebrafish procedure began with lethal anesthesia brain dissection in ice cold aCSF embedding in 1.5% gel and vibratome sectioning. Tissue was dissociated in the Papain vial triturated filtered and washed followed by centrifugation. The pellet was resuspended in aCSF with DNase assessed for cell viability counted and diluted for use.		RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	Oligo-dT	PAIRED	ILLUMINA	Illumina HiSeq 2000	SRP462307			10X47_1_S1_L001_R1_001.fastq.gz 10X47_1_S1_L001_R2_001.fastq.gz 10X47_1_S1_L002_R1_001.fastq.gz 10X47_1_S1_L002_R2_001.fastq.gz 10X47_1_S1_L003_R1_001.fastq.gz 10X47_1_S1_L003_R2_001.fastq.gz 10X47_1_S1_L004_R1_001.fastq.gz 10X47_1_S1_L004_R2_001.fastq.gz	fastq fastq fastq fastq fastq fastq fastq fastq	3288490212.0	39148693.0	10X47 1 S1 L001 R1 001.fastq.gz	0:28 1:56	A:950740376;C:692224998;G:723085676;T:922337432;N:101730	28	56			950740376	692224998	723085676	922337432	101730	SRX21844391	SRS18942406	SRA1717104	Technion - Israel Institute of Technology\|Neuroscince	Technion - Israel Institute of Technology	2	0.01086	0.86383	0.0052	0.31674	0.98244	0.78309	0.39399	0.52299	28	56	T	B	sc-like readlen	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_generic	generic-scrnaseq-only	Israel	2023-09-21	Adult	Adult	Brain	Nervous System
26540	26540	SRR26130977	SRX21844390	SRS18942410	SRP462307	PRJNA1019490	Single Cell RNA seq of Zebrafish Hypothalamus	PRJNA1019490	Other	Brain nuclei are traditionally defined by their anatomy activity and expression of specific markers. The hypothalamus contains discrete neuronal populations that coordinate fundamental behavioral functions ranging from sleep and wakefulness to feeding stress and reward in all vertebrates.					10X39 2		breed:NA\|age:Adult\|collection date:2021\|geo loc name:Israel\|sex:not applicable\|tissue:Brain Hypothalamus\|sample type:single cell 2\|BioSampleModel:Model organism or animal									SC ZF Hypo2	10X39 2	10X39 2	we worked swiftly with cold well oxygenated solutions optimizing Papain incubation times for tissue age and brain region. We used caution with Ca2+ and Mg2+ in aCSF to avoid RNA extraction/RT interference favoring Ca2+/Mg2+ free aCSF if not diluted downstream. Modified aCSF had specific component concentrations and our materials included essential equipment and anesthesia. We prepared aCSF from an 8x stock with adjusted CaCl2 and MgSO4 concentrations kept it fresh and oxygenated it. The zebrafish procedure began with lethal anesthesia brain dissection in ice cold aCSF embedding in 1.5% gel and vibratome sectioning. Tissue was dissociated in the Papain vial triturated filtered and washed followed by centrifugation. The pellet was resuspended in aCSF with DNase assessed for cell viability counted and diluted for use.		RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	Oligo-dT	PAIRED	ILLUMINA	Illumina HiSeq 2000	SRP462307			10X39_2_S2_L001_R1_001.fastq.gz 10X39_2_S2_L001_R2_001.fastq.gz 10X39_2_S2_L002_R1_001.fastq.gz 10X39_2_S2_L002_R2_001.fastq.gz 10X39_2_S2_L003_R1_001.fastq.gz 10X39_2_S2_L003_R2_001.fastq.gz 10X39_2_S2_L004_R1_001.fastq.gz 10X39_2_S2_L004_R2_001.fastq.gz	fastq fastq fastq fastq fastq fastq fastq fastq	20594785932.0	245176023.0	10X39 2 S2 L001 R1 001.fastq.gz	0:28 1:56	A:5909286071;C:4378110318;G:4489721587;T:5804002561;N:13665395	28	56			5909286071	4378110318	4489721587	5804002561	13665395	SRX21844390	SRS18942410	SRA1717104	Technion - Israel Institute of Technology\|Neuroscince	Technion - Israel Institute of Technology	2	0.01117	0.90005	0.00416	0.25843	0.98056	0.77926	0.45338	0.53366	28	56	T	B	sc-like readlen	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_generic	generic-scrnaseq-only	Israel	2023-09-21	Adult	Adult	Brain	Nervous System
26541	26541	SRR26130978	SRX21844389	SRS18942405	SRP462307	PRJNA1019490	Single Cell RNA seq of Zebrafish Hypothalamus	PRJNA1019490	Other	Brain nuclei are traditionally defined by their anatomy activity and expression of specific markers. The hypothalamus contains discrete neuronal populations that coordinate fundamental behavioral functions ranging from sleep and wakefulness to feeding stress and reward in all vertebrates.					10X39 1		breed:NA\|age:Adult\|collection date:2021\|geo loc name:Israel\|sex:not applicable\|tissue:Brain Hypothalamus\|sample type:single cell 1\|BioSampleModel:Model organism or animal									SC ZF Hypo1	10X39 1	10X39 1	we worked swiftly with cold well oxygenated solutions optimizing Papain incubation times for tissue age and brain region. We used caution with Ca2+ and Mg2+ in aCSF to avoid RNA extraction/RT interference favoring Ca2+/Mg2+ free aCSF if not diluted downstream. Modified aCSF had specific component concentrations and our materials included essential equipment and anesthesia. We prepared aCSF from an 8x stock with adjusted CaCl2 and MgSO4 concentrations kept it fresh and oxygenated it. The zebrafish procedure began with lethal anesthesia brain dissection in ice cold aCSF embedding in 1.5% gel and vibratome sectioning. Tissue was dissociated in the Papain vial triturated filtered and washed followed by centrifugation. The pellet was resuspended in aCSF with DNase assessed for cell viability counted and diluted for use.		RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	Oligo-dT	PAIRED	ILLUMINA	Illumina HiSeq 2000	SRP462307			10X39_1_S1_L004_R2_001.fastq.gz 10X39_1_S1_L004_R1_001.fastq.gz 10X39_1_S1_L003_R2_001.fastq.gz 10X39_1_S1_L003_R1_001.fastq.gz 10X39_1_S1_L002_R2_001.fastq.gz 10X39_1_S1_L002_R1_001.fastq.gz 10X39_1_S1_L001_R2_001.fastq.gz 10X39_1_S1_L001_R1_001.fastq.gz	fastq fastq fastq fastq fastq fastq fastq fastq	13293718116.0	158258549.0	10X39 1 S1 L001 R1 001.fastq.gz	0:28 1:56	A:3791388201;C:2833705086;G:2863082386;T:3796683434;N:8859009	28	56			3791388201	2833705086	2863082386	3796683434	8859009	SRX21844389	SRS18942405	SRA1717104	Technion - Israel Institute of Technology\|Neuroscince	Technion - Israel Institute of Technology	2	0.01078	0.90504	0.00392	0.24179	0.98098	0.77741	0.42922	0.52858	28	56	T	B	sc-like readlen	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_generic	generic-scrnaseq-only	Israel	2023-09-21	Adult	Adult	Brain	Nervous System
28482	28482	SRR26266492	SRX21975998	SRS19051834	SRP464334	PRJNA1023540	ABCA7 dependent induction of neuropeptide Y is required for synaptic resilience in Alzheimer's disease through BDNF/NGFR signaling	GSE244550	Transcriptome Analysis	Genetic variants in ABCA7 an Alzheimer's disease AD associated gene elevate AD risk yet its functional relevance to the etiology is unclear. We generated a CRISPR Cas9 mediated abca7 knockout zebrafish to explore ABCA7's role in AD. Single cell transcriptomics in heterozygous abca7+/ knockout combined with Aß42 toxicity revealed that ABCA7 is crucial for neuropeptide Y NPY brain derived neurotrophic factor BDNF and nerve growth factor receptor NGFR expressions which are crucial for synaptic integrity astroglial proliferation and microglial prevalence. Impaired NPY induction decreased BDNF and synaptic density which are rescuable with ectopic NPY. In induced pluripotent stem cell derived human neurons exposed to Aß42 ABCA7 / suppresses NPY. Clinical data showed reduced NPY in AD correlated with elevated Braak stages genetic variants in NPY associated with AD and epigenetic changes in NPY NGFR and BDNF promoters linked to ABCA7 variants. Therefore ABCA7 dependent NPY signaling via BDNF NGFR maintains synaptic integrity implicating its impairment in increased AD risk through reduced brain resilience. Overall design: WT and abca7+/ zebrafish injected with Amyloid beta 42 peptide as described Bhatatrai et al. 2016 and cells were dissociated sorted by FACS as described Cosacak et al. 2019. The single cell encapsulation and cDNA synthesis done by following 10X Genomics' workflows. The reads were aligned to zebrafish genome GRChZ 11 v 105 was used for gene annotation and assigning reads to genes. Cellranger software version 6.1.2 was used to process the data		pubmed:39216475		telencephalon abca7 k/o Ab42 injected	GSM7819018		source name:telencephalon\|tissue:telencephalon\|genotype:abca7 +/ \|treatment:Ab42\|geo loc name:missing\|collection date:missing	telencephalon abca7 k/o Ab42 injected	The demultiplexing barcoded processing gene counting and aggregation were made using the 10x genomics' cellranger software version 6.1.2 https://support.10xgenomics.com/single cell gene expression/software/pipelines/latest/output/metrics The fastq files were aligned to zebrafish genome GRCz11 and ensemble transcripts from Ensembl Release 105 by using STAR. The BAM files were as input for Cell Ranger 10X genomics to generate processed data files that include gene names row names and cell names column names and counts. Further analysis done by using Seurat package in R. Assembly: GRCz11 Supplementary files format and content: filtered bc matrix outputs from Cell Ranger	telencephalon	WT AB and abca7 +/ knock out lines were injected with Amyloid beta 42 peptide and PBS as control as descibed Bhatatrai et al. 2016.	Cells from zebrafish telencephalon were dissociated. Viability indicator dyes Sytox Blue Invitrogen Cat No. S34857 and Dycle Ruby Invitrogen Cat. No. V10309 were used to sort the cells by FACS. The library preparation was performed by 10X Genomics as per manufacture's protocol. 10X genomics	Zebrafish were kept in the re circulating system on a 14/10 h light/dark cycle pH7.5 at 28°C ±1°C in groups of 20 animals per 2.8L.	tissue:telencephalon\|genotype:abca7 +/ \|treatment:Ab42	GSM7819018	GSM7819018: telencephalon abca7 k/o Ab42 injected; Danio rerio; RNA Seq	GSM7819018 r1	GSM7819018	1	Cells from zebrafish telencephalon were dissociated. Viability indicator dyes Sytox Blue Invitrogen Cat No. S34857 and Dycle Ruby Invitrogen Cat. No. V10309 were used to sort the cells by FACS. The library preparation was performed by 10X Genomics as per manufacture's protocol. 10X genomics	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP464334		loader:fastq load.py	CP021_S12_L001_I1_001.fastq.gz CP021_S12_L001_I2_001.fastq.gz CP021_S12_L001_R1_001.fastq.gz CP021_S12_L001_R2_001.fastq.gz	fastq fastq fastq fastq	46637839920.0	210080360.0	GSM7819018 r1	0:10 1:10 2:101 3:101	A:12160340644;C:7050177030;G:7302497483;T:15922643298;N:574265	10	10	101	101	12160340644	7050177030	7302497483	15922643298	574265	SRX21975998	SRS19051834	SRA1725563	Neurology & TAUB Institute, Columbia University	Neurology & TAUB Institute, Columbia University	2	0.00333	0.89749	0.00051	0.26345	0.99821	0.73539	0.54736	0.5015	101	101	T	B	mate1 technical by mapping diff	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2023-10-03	Undetermined	Undetermined	Brain	Nervous System
28483	28483	SRR26266493	SRX21975998	SRS19051834	SRP464334	PRJNA1023540	ABCA7 dependent induction of neuropeptide Y is required for synaptic resilience in Alzheimer's disease through BDNF/NGFR signaling	GSE244550	Transcriptome Analysis	Genetic variants in ABCA7 an Alzheimer's disease AD associated gene elevate AD risk yet its functional relevance to the etiology is unclear. We generated a CRISPR Cas9 mediated abca7 knockout zebrafish to explore ABCA7's role in AD. Single cell transcriptomics in heterozygous abca7+/ knockout combined with Aß42 toxicity revealed that ABCA7 is crucial for neuropeptide Y NPY brain derived neurotrophic factor BDNF and nerve growth factor receptor NGFR expressions which are crucial for synaptic integrity astroglial proliferation and microglial prevalence. Impaired NPY induction decreased BDNF and synaptic density which are rescuable with ectopic NPY. In induced pluripotent stem cell derived human neurons exposed to Aß42 ABCA7 / suppresses NPY. Clinical data showed reduced NPY in AD correlated with elevated Braak stages genetic variants in NPY associated with AD and epigenetic changes in NPY NGFR and BDNF promoters linked to ABCA7 variants. Therefore ABCA7 dependent NPY signaling via BDNF NGFR maintains synaptic integrity implicating its impairment in increased AD risk through reduced brain resilience. Overall design: WT and abca7+/ zebrafish injected with Amyloid beta 42 peptide as described Bhatatrai et al. 2016 and cells were dissociated sorted by FACS as described Cosacak et al. 2019. The single cell encapsulation and cDNA synthesis done by following 10X Genomics' workflows. The reads were aligned to zebrafish genome GRChZ 11 v 105 was used for gene annotation and assigning reads to genes. Cellranger software version 6.1.2 was used to process the data		pubmed:39216475		telencephalon abca7 k/o Ab42 injected	GSM7819018		source name:telencephalon\|tissue:telencephalon\|genotype:abca7 +/ \|treatment:Ab42\|geo loc name:missing\|collection date:missing	telencephalon abca7 k/o Ab42 injected	The demultiplexing barcoded processing gene counting and aggregation were made using the 10x genomics' cellranger software version 6.1.2 https://support.10xgenomics.com/single cell gene expression/software/pipelines/latest/output/metrics The fastq files were aligned to zebrafish genome GRCz11 and ensemble transcripts from Ensembl Release 105 by using STAR. The BAM files were as input for Cell Ranger 10X genomics to generate processed data files that include gene names row names and cell names column names and counts. Further analysis done by using Seurat package in R. Assembly: GRCz11 Supplementary files format and content: filtered bc matrix outputs from Cell Ranger	telencephalon	WT AB and abca7 +/ knock out lines were injected with Amyloid beta 42 peptide and PBS as control as descibed Bhatatrai et al. 2016.	Cells from zebrafish telencephalon were dissociated. Viability indicator dyes Sytox Blue Invitrogen Cat No. S34857 and Dycle Ruby Invitrogen Cat. No. V10309 were used to sort the cells by FACS. The library preparation was performed by 10X Genomics as per manufacture's protocol. 10X genomics	Zebrafish were kept in the re circulating system on a 14/10 h light/dark cycle pH7.5 at 28°C ±1°C in groups of 20 animals per 2.8L.	tissue:telencephalon\|genotype:abca7 +/ \|treatment:Ab42	GSM7819018	GSM7819018: telencephalon abca7 k/o Ab42 injected; Danio rerio; RNA Seq	GSM7819018 r1	GSM7819018	1	Cells from zebrafish telencephalon were dissociated. Viability indicator dyes Sytox Blue Invitrogen Cat No. S34857 and Dycle Ruby Invitrogen Cat. No. V10309 were used to sort the cells by FACS. The library preparation was performed by 10X Genomics as per manufacture's protocol. 10X genomics	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP464334		loader:fastq load.py	CP021_S12_L002_I1_001.fastq.gz CP021_S12_L002_I2_001.fastq.gz CP021_S12_L002_R1_001.fastq.gz CP021_S12_L002_R2_001.fastq.gz	fastq fastq fastq fastq	47673315186.0	214744663.0	GSM7819018 r2	0:10 1:10 2:101 3:101	A:12499321052;C:7231866994;G:7443419880;T:16203206561;N:607439	10	10	101	101	12499321052	7231866994	7443419880	16203206561	607439	SRX21975998	SRS19051834	SRA1725563	Neurology & TAUB Institute, Columbia University	Neurology & TAUB Institute, Columbia University	2	0.00305	0.89832	0.00064	0.26179	0.99851	0.73434	0.53932	0.50016	101	101	T	B	mate1 technical by mapping diff	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2023-10-03	Undetermined	Undetermined	Brain	Nervous System
28484	28484	SRR26266494	SRX21975997	SRS19051833	SRP464334	PRJNA1023540	ABCA7 dependent induction of neuropeptide Y is required for synaptic resilience in Alzheimer's disease through BDNF/NGFR signaling	GSE244550	Transcriptome Analysis	Genetic variants in ABCA7 an Alzheimer's disease AD associated gene elevate AD risk yet its functional relevance to the etiology is unclear. We generated a CRISPR Cas9 mediated abca7 knockout zebrafish to explore ABCA7's role in AD. Single cell transcriptomics in heterozygous abca7+/ knockout combined with Aß42 toxicity revealed that ABCA7 is crucial for neuropeptide Y NPY brain derived neurotrophic factor BDNF and nerve growth factor receptor NGFR expressions which are crucial for synaptic integrity astroglial proliferation and microglial prevalence. Impaired NPY induction decreased BDNF and synaptic density which are rescuable with ectopic NPY. In induced pluripotent stem cell derived human neurons exposed to Aß42 ABCA7 / suppresses NPY. Clinical data showed reduced NPY in AD correlated with elevated Braak stages genetic variants in NPY associated with AD and epigenetic changes in NPY NGFR and BDNF promoters linked to ABCA7 variants. Therefore ABCA7 dependent NPY signaling via BDNF NGFR maintains synaptic integrity implicating its impairment in increased AD risk through reduced brain resilience. Overall design: WT and abca7+/ zebrafish injected with Amyloid beta 42 peptide as described Bhatatrai et al. 2016 and cells were dissociated sorted by FACS as described Cosacak et al. 2019. The single cell encapsulation and cDNA synthesis done by following 10X Genomics' workflows. The reads were aligned to zebrafish genome GRChZ 11 v 105 was used for gene annotation and assigning reads to genes. Cellranger software version 6.1.2 was used to process the data		pubmed:39216475		telencephalon abca7 k/o PBS injected	GSM7819017		source name:telencephalon\|tissue:telencephalon\|genotype:abca7 +/ \|treatment:PBS\|geo loc name:missing\|collection date:missing	telencephalon abca7 k/o PBS injected	The demultiplexing barcoded processing gene counting and aggregation were made using the 10x genomics' cellranger software version 6.1.2 https://support.10xgenomics.com/single cell gene expression/software/pipelines/latest/output/metrics The fastq files were aligned to zebrafish genome GRCz11 and ensemble transcripts from Ensembl Release 105 by using STAR. The BAM files were as input for Cell Ranger 10X genomics to generate processed data files that include gene names row names and cell names column names and counts. Further analysis done by using Seurat package in R. Assembly: GRCz11 Supplementary files format and content: filtered bc matrix outputs from Cell Ranger	telencephalon	WT AB and abca7 +/ knock out lines were injected with Amyloid beta 42 peptide and PBS as control as descibed Bhatatrai et al. 2016.	Cells from zebrafish telencephalon were dissociated. Viability indicator dyes Sytox Blue Invitrogen Cat No. S34857 and Dycle Ruby Invitrogen Cat. No. V10309 were used to sort the cells by FACS. The library preparation was performed by 10X Genomics as per manufacture's protocol. 10X genomics	Zebrafish were kept in the re circulating system on a 14/10 h light/dark cycle pH7.5 at 28°C ±1°C in groups of 20 animals per 2.8L.	tissue:telencephalon\|genotype:abca7 +/ \|treatment:PBS	GSM7819017	GSM7819017: telencephalon abca7 k/o PBS injected; Danio rerio; RNA Seq	GSM7819017 r1	GSM7819017	1	Cells from zebrafish telencephalon were dissociated. Viability indicator dyes Sytox Blue Invitrogen Cat No. S34857 and Dycle Ruby Invitrogen Cat. No. V10309 were used to sort the cells by FACS. The library preparation was performed by 10X Genomics as per manufacture's protocol. 10X genomics	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP464334		loader:fastq load.py	CP020_S11_L001_I1_001.fastq.gz CP020_S11_L001_I2_001.fastq.gz CP020_S11_L001_R1_001.fastq.gz CP020_S11_L001_R2_001.fastq.gz	fastq fastq fastq fastq	45135900918.0	203314869.0	GSM7819017 r1	0:10 1:10 2:101 3:101	A:11807801920;C:6876592307;G:7115059785;T:15269592915;N:556611	10	10	101	101	11807801920	6876592307	7115059785	15269592915	556611	SRX21975997	SRS19051833	SRA1725563	Neurology & TAUB Institute, Columbia University	Neurology & TAUB Institute, Columbia University	2	0.00293	0.90111	0.00093	0.28713	0.99882	0.73687	0.58461	0.50013	101	101	T	B	mate1 technical by mapping diff	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2023-10-03	Undetermined	Undetermined	Brain	Nervous System
28485	28485	SRR26266495	SRX21975997	SRS19051833	SRP464334	PRJNA1023540	ABCA7 dependent induction of neuropeptide Y is required for synaptic resilience in Alzheimer's disease through BDNF/NGFR signaling	GSE244550	Transcriptome Analysis	Genetic variants in ABCA7 an Alzheimer's disease AD associated gene elevate AD risk yet its functional relevance to the etiology is unclear. We generated a CRISPR Cas9 mediated abca7 knockout zebrafish to explore ABCA7's role in AD. Single cell transcriptomics in heterozygous abca7+/ knockout combined with Aß42 toxicity revealed that ABCA7 is crucial for neuropeptide Y NPY brain derived neurotrophic factor BDNF and nerve growth factor receptor NGFR expressions which are crucial for synaptic integrity astroglial proliferation and microglial prevalence. Impaired NPY induction decreased BDNF and synaptic density which are rescuable with ectopic NPY. In induced pluripotent stem cell derived human neurons exposed to Aß42 ABCA7 / suppresses NPY. Clinical data showed reduced NPY in AD correlated with elevated Braak stages genetic variants in NPY associated with AD and epigenetic changes in NPY NGFR and BDNF promoters linked to ABCA7 variants. Therefore ABCA7 dependent NPY signaling via BDNF NGFR maintains synaptic integrity implicating its impairment in increased AD risk through reduced brain resilience. Overall design: WT and abca7+/ zebrafish injected with Amyloid beta 42 peptide as described Bhatatrai et al. 2016 and cells were dissociated sorted by FACS as described Cosacak et al. 2019. The single cell encapsulation and cDNA synthesis done by following 10X Genomics' workflows. The reads were aligned to zebrafish genome GRChZ 11 v 105 was used for gene annotation and assigning reads to genes. Cellranger software version 6.1.2 was used to process the data		pubmed:39216475		telencephalon abca7 k/o PBS injected	GSM7819017		source name:telencephalon\|tissue:telencephalon\|genotype:abca7 +/ \|treatment:PBS\|geo loc name:missing\|collection date:missing	telencephalon abca7 k/o PBS injected	The demultiplexing barcoded processing gene counting and aggregation were made using the 10x genomics' cellranger software version 6.1.2 https://support.10xgenomics.com/single cell gene expression/software/pipelines/latest/output/metrics The fastq files were aligned to zebrafish genome GRCz11 and ensemble transcripts from Ensembl Release 105 by using STAR. The BAM files were as input for Cell Ranger 10X genomics to generate processed data files that include gene names row names and cell names column names and counts. Further analysis done by using Seurat package in R. Assembly: GRCz11 Supplementary files format and content: filtered bc matrix outputs from Cell Ranger	telencephalon	WT AB and abca7 +/ knock out lines were injected with Amyloid beta 42 peptide and PBS as control as descibed Bhatatrai et al. 2016.	Cells from zebrafish telencephalon were dissociated. Viability indicator dyes Sytox Blue Invitrogen Cat No. S34857 and Dycle Ruby Invitrogen Cat. No. V10309 were used to sort the cells by FACS. The library preparation was performed by 10X Genomics as per manufacture's protocol. 10X genomics	Zebrafish were kept in the re circulating system on a 14/10 h light/dark cycle pH7.5 at 28°C ±1°C in groups of 20 animals per 2.8L.	tissue:telencephalon\|genotype:abca7 +/ \|treatment:PBS	GSM7819017	GSM7819017: telencephalon abca7 k/o PBS injected; Danio rerio; RNA Seq	GSM7819017 r1	GSM7819017	1	Cells from zebrafish telencephalon were dissociated. Viability indicator dyes Sytox Blue Invitrogen Cat No. S34857 and Dycle Ruby Invitrogen Cat. No. V10309 were used to sort the cells by FACS. The library preparation was performed by 10X Genomics as per manufacture's protocol. 10X genomics	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP464334		loader:fastq load.py	CP020_S11_L002_I1_001.fastq.gz CP020_S11_L002_I2_001.fastq.gz CP020_S11_L002_R1_001.fastq.gz CP020_S11_L002_R2_001.fastq.gz	fastq fastq fastq fastq	46689428280.0	210312740.0	GSM7819017 r2	0:10 1:10 2:101 3:101	A:12281435026;C:7136662243;G:7338982062;T:15725501987;N:592162	10	10	101	101	12281435026	7136662243	7338982062	15725501987	592162	SRX21975997	SRS19051833	SRA1725563	Neurology & TAUB Institute, Columbia University	Neurology & TAUB Institute, Columbia University	2	0.00317	0.90041	0.00069	0.28878	0.99819	0.73657	0.60869	0.49401	101	101	T	B	mate1 technical by mapping diff	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2023-10-03	Undetermined	Undetermined	Brain	Nervous System
28486	28486	SRR26266496	SRX21975996	SRS19051832	SRP464334	PRJNA1023540	ABCA7 dependent induction of neuropeptide Y is required for synaptic resilience in Alzheimer's disease through BDNF/NGFR signaling	GSE244550	Transcriptome Analysis	Genetic variants in ABCA7 an Alzheimer's disease AD associated gene elevate AD risk yet its functional relevance to the etiology is unclear. We generated a CRISPR Cas9 mediated abca7 knockout zebrafish to explore ABCA7's role in AD. Single cell transcriptomics in heterozygous abca7+/ knockout combined with Aß42 toxicity revealed that ABCA7 is crucial for neuropeptide Y NPY brain derived neurotrophic factor BDNF and nerve growth factor receptor NGFR expressions which are crucial for synaptic integrity astroglial proliferation and microglial prevalence. Impaired NPY induction decreased BDNF and synaptic density which are rescuable with ectopic NPY. In induced pluripotent stem cell derived human neurons exposed to Aß42 ABCA7 / suppresses NPY. Clinical data showed reduced NPY in AD correlated with elevated Braak stages genetic variants in NPY associated with AD and epigenetic changes in NPY NGFR and BDNF promoters linked to ABCA7 variants. Therefore ABCA7 dependent NPY signaling via BDNF NGFR maintains synaptic integrity implicating its impairment in increased AD risk through reduced brain resilience. Overall design: WT and abca7+/ zebrafish injected with Amyloid beta 42 peptide as described Bhatatrai et al. 2016 and cells were dissociated sorted by FACS as described Cosacak et al. 2019. The single cell encapsulation and cDNA synthesis done by following 10X Genomics' workflows. The reads were aligned to zebrafish genome GRChZ 11 v 105 was used for gene annotation and assigning reads to genes. Cellranger software version 6.1.2 was used to process the data		pubmed:39216475		telencephalon WT Ab42 injected	GSM7819016		source name:telencephalon\|tissue:telencephalon\|genotype:WT AB\|treatment:Ab42\|geo loc name:missing\|collection date:missing	telencephalon WT Ab42 injected	The demultiplexing barcoded processing gene counting and aggregation were made using the 10x genomics' cellranger software version 6.1.2 https://support.10xgenomics.com/single cell gene expression/software/pipelines/latest/output/metrics The fastq files were aligned to zebrafish genome GRCz11 and ensemble transcripts from Ensembl Release 105 by using STAR. The BAM files were as input for Cell Ranger 10X genomics to generate processed data files that include gene names row names and cell names column names and counts. Further analysis done by using Seurat package in R. Assembly: GRCz11 Supplementary files format and content: filtered bc matrix outputs from Cell Ranger	telencephalon	WT AB and abca7 +/ knock out lines were injected with Amyloid beta 42 peptide and PBS as control as descibed Bhatatrai et al. 2016.	Cells from zebrafish telencephalon were dissociated. Viability indicator dyes Sytox Blue Invitrogen Cat No. S34857 and Dycle Ruby Invitrogen Cat. No. V10309 were used to sort the cells by FACS. The library preparation was performed by 10X Genomics as per manufacture's protocol. 10X genomics	Zebrafish were kept in the re circulating system on a 14/10 h light/dark cycle pH7.5 at 28°C ±1°C in groups of 20 animals per 2.8L.	tissue:telencephalon\|genotype:WT AB\|treatment:Ab42	GSM7819016	GSM7819016: telencephalon WT Ab42 injected; Danio rerio; RNA Seq	GSM7819016 r1	GSM7819016	1	Cells from zebrafish telencephalon were dissociated. Viability indicator dyes Sytox Blue Invitrogen Cat No. S34857 and Dycle Ruby Invitrogen Cat. No. V10309 were used to sort the cells by FACS. The library preparation was performed by 10X Genomics as per manufacture's protocol. 10X genomics	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP464334		loader:fastq load.py	CP019_S10_L001_I1_001.fastq.gz CP019_S10_L001_I2_001.fastq.gz CP019_S10_L001_R1_001.fastq.gz CP019_S10_L001_R2_001.fastq.gz	fastq fastq fastq fastq	48132368784.0	216812472.0	GSM7819016 r1	0:10 1:10 2:101 3:101	A:12479944041;C:7377568938;G:7622029272;T:16315981376;N:595717	10	10	101	101	12479944041	7377568938	7622029272	16315981376	595717	SRX21975996	SRS19051832	SRA1725563	Neurology & TAUB Institute, Columbia University	Neurology & TAUB Institute, Columbia University	2	0.00237	0.90638	0.00049	0.23035	0.99876	0.73612	0.50793	0.50292	101	101	T	B	mate1 technical by mapping diff	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2023-10-03	Undetermined	Undetermined	Brain	Nervous System
28487	28487	SRR26266497	SRX21975996	SRS19051832	SRP464334	PRJNA1023540	ABCA7 dependent induction of neuropeptide Y is required for synaptic resilience in Alzheimer's disease through BDNF/NGFR signaling	GSE244550	Transcriptome Analysis	Genetic variants in ABCA7 an Alzheimer's disease AD associated gene elevate AD risk yet its functional relevance to the etiology is unclear. We generated a CRISPR Cas9 mediated abca7 knockout zebrafish to explore ABCA7's role in AD. Single cell transcriptomics in heterozygous abca7+/ knockout combined with Aß42 toxicity revealed that ABCA7 is crucial for neuropeptide Y NPY brain derived neurotrophic factor BDNF and nerve growth factor receptor NGFR expressions which are crucial for synaptic integrity astroglial proliferation and microglial prevalence. Impaired NPY induction decreased BDNF and synaptic density which are rescuable with ectopic NPY. In induced pluripotent stem cell derived human neurons exposed to Aß42 ABCA7 / suppresses NPY. Clinical data showed reduced NPY in AD correlated with elevated Braak stages genetic variants in NPY associated with AD and epigenetic changes in NPY NGFR and BDNF promoters linked to ABCA7 variants. Therefore ABCA7 dependent NPY signaling via BDNF NGFR maintains synaptic integrity implicating its impairment in increased AD risk through reduced brain resilience. Overall design: WT and abca7+/ zebrafish injected with Amyloid beta 42 peptide as described Bhatatrai et al. 2016 and cells were dissociated sorted by FACS as described Cosacak et al. 2019. The single cell encapsulation and cDNA synthesis done by following 10X Genomics' workflows. The reads were aligned to zebrafish genome GRChZ 11 v 105 was used for gene annotation and assigning reads to genes. Cellranger software version 6.1.2 was used to process the data		pubmed:39216475		telencephalon WT Ab42 injected	GSM7819016		source name:telencephalon\|tissue:telencephalon\|genotype:WT AB\|treatment:Ab42\|geo loc name:missing\|collection date:missing	telencephalon WT Ab42 injected	The demultiplexing barcoded processing gene counting and aggregation were made using the 10x genomics' cellranger software version 6.1.2 https://support.10xgenomics.com/single cell gene expression/software/pipelines/latest/output/metrics The fastq files were aligned to zebrafish genome GRCz11 and ensemble transcripts from Ensembl Release 105 by using STAR. The BAM files were as input for Cell Ranger 10X genomics to generate processed data files that include gene names row names and cell names column names and counts. Further analysis done by using Seurat package in R. Assembly: GRCz11 Supplementary files format and content: filtered bc matrix outputs from Cell Ranger	telencephalon	WT AB and abca7 +/ knock out lines were injected with Amyloid beta 42 peptide and PBS as control as descibed Bhatatrai et al. 2016.	Cells from zebrafish telencephalon were dissociated. Viability indicator dyes Sytox Blue Invitrogen Cat No. S34857 and Dycle Ruby Invitrogen Cat. No. V10309 were used to sort the cells by FACS. The library preparation was performed by 10X Genomics as per manufacture's protocol. 10X genomics	Zebrafish were kept in the re circulating system on a 14/10 h light/dark cycle pH7.5 at 28°C ±1°C in groups of 20 animals per 2.8L.	tissue:telencephalon\|genotype:WT AB\|treatment:Ab42	GSM7819016	GSM7819016: telencephalon WT Ab42 injected; Danio rerio; RNA Seq	GSM7819016 r1	GSM7819016	1	Cells from zebrafish telencephalon were dissociated. Viability indicator dyes Sytox Blue Invitrogen Cat No. S34857 and Dycle Ruby Invitrogen Cat. No. V10309 were used to sort the cells by FACS. The library preparation was performed by 10X Genomics as per manufacture's protocol. 10X genomics	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP464334		loader:fastq load.py	CP019_S10_L002_I1_001.fastq.gz CP019_S10_L002_I2_001.fastq.gz CP019_S10_L002_R1_001.fastq.gz CP019_S10_L002_R2_001.fastq.gz	fastq fastq fastq fastq	49675882836.0	223765238.0	GSM7819016 r2	0:10 1:10 2:101 3:101	A:12950211284;C:7640502677;G:7844712651;T:16764526831;N:624633	10	10	101	101	12950211284	7640502677	7844712651	16764526831	624633	SRX21975996	SRS19051832	SRA1725563	Neurology & TAUB Institute, Columbia University	Neurology & TAUB Institute, Columbia University	2	0.0034	0.9058	0.00062	0.22634	0.99825	0.73423	0.45714	0.49934	101	101	T	B	mate1 technical by mapping diff	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2023-10-03	Undetermined	Undetermined	Brain	Nervous System
28488	28488	SRR26266498	SRX21975995	SRS19051831	SRP464334	PRJNA1023540	ABCA7 dependent induction of neuropeptide Y is required for synaptic resilience in Alzheimer's disease through BDNF/NGFR signaling	GSE244550	Transcriptome Analysis	Genetic variants in ABCA7 an Alzheimer's disease AD associated gene elevate AD risk yet its functional relevance to the etiology is unclear. We generated a CRISPR Cas9 mediated abca7 knockout zebrafish to explore ABCA7's role in AD. Single cell transcriptomics in heterozygous abca7+/ knockout combined with Aß42 toxicity revealed that ABCA7 is crucial for neuropeptide Y NPY brain derived neurotrophic factor BDNF and nerve growth factor receptor NGFR expressions which are crucial for synaptic integrity astroglial proliferation and microglial prevalence. Impaired NPY induction decreased BDNF and synaptic density which are rescuable with ectopic NPY. In induced pluripotent stem cell derived human neurons exposed to Aß42 ABCA7 / suppresses NPY. Clinical data showed reduced NPY in AD correlated with elevated Braak stages genetic variants in NPY associated with AD and epigenetic changes in NPY NGFR and BDNF promoters linked to ABCA7 variants. Therefore ABCA7 dependent NPY signaling via BDNF NGFR maintains synaptic integrity implicating its impairment in increased AD risk through reduced brain resilience. Overall design: WT and abca7+/ zebrafish injected with Amyloid beta 42 peptide as described Bhatatrai et al. 2016 and cells were dissociated sorted by FACS as described Cosacak et al. 2019. The single cell encapsulation and cDNA synthesis done by following 10X Genomics' workflows. The reads were aligned to zebrafish genome GRChZ 11 v 105 was used for gene annotation and assigning reads to genes. Cellranger software version 6.1.2 was used to process the data		pubmed:39216475		telencephalon WT PBS injected	GSM7819015		source name:telencephalon\|tissue:telencephalon\|genotype:WT AB\|treatment:PBS\|geo loc name:missing\|collection date:missing	telencephalon WT PBS injected	The demultiplexing barcoded processing gene counting and aggregation were made using the 10x genomics' cellranger software version 6.1.2 https://support.10xgenomics.com/single cell gene expression/software/pipelines/latest/output/metrics The fastq files were aligned to zebrafish genome GRCz11 and ensemble transcripts from Ensembl Release 105 by using STAR. The BAM files were as input for Cell Ranger 10X genomics to generate processed data files that include gene names row names and cell names column names and counts. Further analysis done by using Seurat package in R. Assembly: GRCz11 Supplementary files format and content: filtered bc matrix outputs from Cell Ranger	telencephalon	WT AB and abca7 +/ knock out lines were injected with Amyloid beta 42 peptide and PBS as control as descibed Bhatatrai et al. 2016.	Cells from zebrafish telencephalon were dissociated. Viability indicator dyes Sytox Blue Invitrogen Cat No. S34857 and Dycle Ruby Invitrogen Cat. No. V10309 were used to sort the cells by FACS. The library preparation was performed by 10X Genomics as per manufacture's protocol. 10X genomics	Zebrafish were kept in the re circulating system on a 14/10 h light/dark cycle pH7.5 at 28°C ±1°C in groups of 20 animals per 2.8L.	tissue:telencephalon\|genotype:WT AB\|treatment:PBS	GSM7819015	GSM7819015: telencephalon WT PBS injected; Danio rerio; RNA Seq	GSM7819015 r1	GSM7819015	1	Cells from zebrafish telencephalon were dissociated. Viability indicator dyes Sytox Blue Invitrogen Cat No. S34857 and Dycle Ruby Invitrogen Cat. No. V10309 were used to sort the cells by FACS. The library preparation was performed by 10X Genomics as per manufacture's protocol. 10X genomics	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP464334		loader:fastq load.py	CP018_S9_L001_I1_001.fastq.gz CP018_S9_L001_I2_001.fastq.gz CP018_S9_L001_R1_001.fastq.gz CP018_S9_L001_R2_001.fastq.gz	fastq fastq fastq fastq	45948585420.0	206975610.0	GSM7819015 r1	0:10 1:10 2:101 3:101	A:12050390597;C:6986598890;G:7200535422;T:15570981408;N:566903	10	10	101	101	12050390597	6986598890	7200535422	15570981408	566903	SRX21975995	SRS19051831	SRA1725563	Neurology & TAUB Institute, Columbia University	Neurology & TAUB Institute, Columbia University	2	0.00353	0.89238	0.00096	0.30364	0.99841	0.73456	0.59523	0.49758	101	101	T	B	mate1 technical by mapping diff	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2023-10-03	Undetermined	Undetermined	Brain	Nervous System
28489	28489	SRR26266499	SRX21975995	SRS19051831	SRP464334	PRJNA1023540	ABCA7 dependent induction of neuropeptide Y is required for synaptic resilience in Alzheimer's disease through BDNF/NGFR signaling	GSE244550	Transcriptome Analysis	Genetic variants in ABCA7 an Alzheimer's disease AD associated gene elevate AD risk yet its functional relevance to the etiology is unclear. We generated a CRISPR Cas9 mediated abca7 knockout zebrafish to explore ABCA7's role in AD. Single cell transcriptomics in heterozygous abca7+/ knockout combined with Aß42 toxicity revealed that ABCA7 is crucial for neuropeptide Y NPY brain derived neurotrophic factor BDNF and nerve growth factor receptor NGFR expressions which are crucial for synaptic integrity astroglial proliferation and microglial prevalence. Impaired NPY induction decreased BDNF and synaptic density which are rescuable with ectopic NPY. In induced pluripotent stem cell derived human neurons exposed to Aß42 ABCA7 / suppresses NPY. Clinical data showed reduced NPY in AD correlated with elevated Braak stages genetic variants in NPY associated with AD and epigenetic changes in NPY NGFR and BDNF promoters linked to ABCA7 variants. Therefore ABCA7 dependent NPY signaling via BDNF NGFR maintains synaptic integrity implicating its impairment in increased AD risk through reduced brain resilience. Overall design: WT and abca7+/ zebrafish injected with Amyloid beta 42 peptide as described Bhatatrai et al. 2016 and cells were dissociated sorted by FACS as described Cosacak et al. 2019. The single cell encapsulation and cDNA synthesis done by following 10X Genomics' workflows. The reads were aligned to zebrafish genome GRChZ 11 v 105 was used for gene annotation and assigning reads to genes. Cellranger software version 6.1.2 was used to process the data		pubmed:39216475		telencephalon WT PBS injected	GSM7819015		source name:telencephalon\|tissue:telencephalon\|genotype:WT AB\|treatment:PBS\|geo loc name:missing\|collection date:missing	telencephalon WT PBS injected	The demultiplexing barcoded processing gene counting and aggregation were made using the 10x genomics' cellranger software version 6.1.2 https://support.10xgenomics.com/single cell gene expression/software/pipelines/latest/output/metrics The fastq files were aligned to zebrafish genome GRCz11 and ensemble transcripts from Ensembl Release 105 by using STAR. The BAM files were as input for Cell Ranger 10X genomics to generate processed data files that include gene names row names and cell names column names and counts. Further analysis done by using Seurat package in R. Assembly: GRCz11 Supplementary files format and content: filtered bc matrix outputs from Cell Ranger	telencephalon	WT AB and abca7 +/ knock out lines were injected with Amyloid beta 42 peptide and PBS as control as descibed Bhatatrai et al. 2016.	Cells from zebrafish telencephalon were dissociated. Viability indicator dyes Sytox Blue Invitrogen Cat No. S34857 and Dycle Ruby Invitrogen Cat. No. V10309 were used to sort the cells by FACS. The library preparation was performed by 10X Genomics as per manufacture's protocol. 10X genomics	Zebrafish were kept in the re circulating system on a 14/10 h light/dark cycle pH7.5 at 28°C ±1°C in groups of 20 animals per 2.8L.	tissue:telencephalon\|genotype:WT AB\|treatment:PBS	GSM7819015	GSM7819015: telencephalon WT PBS injected; Danio rerio; RNA Seq	GSM7819015 r1	GSM7819015	1	Cells from zebrafish telencephalon were dissociated. Viability indicator dyes Sytox Blue Invitrogen Cat No. S34857 and Dycle Ruby Invitrogen Cat. No. V10309 were used to sort the cells by FACS. The library preparation was performed by 10X Genomics as per manufacture's protocol. 10X genomics	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP464334		loader:fastq load.py	CP018_S9_L002_I1_001.fastq.gz CP018_S9_L002_I2_001.fastq.gz CP018_S9_L002_R1_001.fastq.gz CP018_S9_L002_R2_001.fastq.gz	fastq fastq fastq fastq	47434063566.0	213666953.0	GSM7819015 r2	0:10 1:10 2:101 3:101	A:12506355665;C:7237420299;G:7414157832;T:16002190524;N:600186	10	10	101	101	12506355665	7237420299	7414157832	16002190524	600186	SRX21975995	SRS19051831	SRA1725563	Neurology & TAUB Institute, Columbia University	Neurology & TAUB Institute, Columbia University	2	0.00327	0.8932	0.00092	0.30198	0.99831	0.73401	0.53488	0.50008	101	101	T	B	mate1 technical by mapping diff	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2023-10-03	Undetermined	Undetermined	Brain	Nervous System
28731	28731	SRR26623268	SRX22323915	SRS19374444	SRP469552	PRJNA1034159	Dissecting the spatiotemporal diversity of adult neural stem cells	GSE246714	Other	Adult stem cells are important for tissue turnover and regeneration. However in most adult systems it remains elusive how stem cells assume different functional states and support spatially patterned tissue architecture. Here we dissected the diversity of neural stem cells in the adult zebrafish brain an organ that is characterized by pronounced zonation and high regenerative capacity. We combined single cell transcriptomics of dissected brain regions with massively parallel lineage tracing and in vivo RNA metabolic labeling to analyze regulation of neural stem cells in space and time. We detected a large diversity of neural stem cells with some subtypes being restricted to a single brain region while others were found globally across the brain. Global stem cell states are linked to neurogenic differentiation with different states being involved in proliferative and non proliferative differentiation. Our work reveals principles of adult stem cell organization and establishes a resource for functional manipulation of neural stem cell subtypes. Overall design: Single cell RNA seq of adult zebrafish brain performed using 10x Genomics Gene Expression protocols to explore transcriptomic diversity of adult cell types. The samples were prepared either from whole brain FACS sorted cells GFP positive cells from gfap:GFP line or a dissected single brain region as indicated in the sample title. CRISPR based lineage tracing was performed for a subset of samples to dissect developmental lineage relationships between cells. ScSLAM seq was performed in combination with Notch pathway inhibition to assess response of stem cells to perturbation.		pubmed:38365956		Brain 20 sorted scRNAseq	GSM7875184		source name:adult brain\|tissue:adult brain\|tissue region:sorted\|cell type:mixed tissue dissociation\|genotype:Tg[gfap:GFP]\|geo loc name:missing\|collection date:missing	Brain 20 sorted scRNAseq	The transcriptome libraries were demultiplexed and mapped with CellRanger 6.1.1. In order to reduce batch effect the gene expression matrices were processed with the SoupX tool Young & Behjati 2020 for removing ambient RNA contamination. A subset of libraries was also mapped with Velocyto v0.17.17 La Manno et al 2018 to create count matrices for unspliced and spliced molecules. The targeted lineage tracing libraries were aligned using bwa mem3 v.0.7.12 to individual references of endogenous genes used in the lineage tracing experiment actb1 actb2 cfl1 cirbpb rpl39 and ube2e1. The scars were filtered with a custom pipeline to eliminate sequences that originate from PCR or sequencing errors. For custom code and further downstream analysis see: https://github.com/nimitic/radial glia. Assembly: GRCz11 Supplementary files format and content: Tab separated barcode files and matrix files along with the tab separated gene file supplementary file are the output of CellRanger mapping further processed by the SoupX package for ambient RNA removal. Supplementary files format and content: Loom files are the output of velocyto mapping distinguishing spliced and unspliced mRNAs. Supplementary files format and content: filtered scars.csv files contain the output of a custom scar filtering pipeline.	adult brain		Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.		tissue:adult brain\|tissue region:sorted\|cell type:mixed tissue dissociation\|genotype:Tg[gfap:GFP]	GSM7875184	GSM7875184: Brain 20 sorted scRNAseq; Danio rerio; RNA Seq	GSM7875184 r1	GSM7875184	1	Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP469552		loader:fastq load.py	b20_gfap_R1.fastq.gz b20_gfap_R2.fastq.gz	fastq fastq	7798133320.0	52690090.0	GSM7875184 r1	0:28 1:120	A:2399592536;C:1516740530;G:1752554415;T:2127715674;N:1530165	28	120			2399592536	1516740530	1752554415	2127715674	1530165	SRX22323915	SRS19374444	SRA1743007	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	2	0.0094	0.86649	0.00431	0.28296	0.9881	0.77607	0.40289	0.50506	28	120	T	B	sc-like readlen	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	Germany	2023-10-31	Adult	Adult	Brain	Nervous System
28732	28732	SRR26623269	SRX22323914	SRS19374443	SRP469552	PRJNA1034159	Dissecting the spatiotemporal diversity of adult neural stem cells	GSE246714	Other	Adult stem cells are important for tissue turnover and regeneration. However in most adult systems it remains elusive how stem cells assume different functional states and support spatially patterned tissue architecture. Here we dissected the diversity of neural stem cells in the adult zebrafish brain an organ that is characterized by pronounced zonation and high regenerative capacity. We combined single cell transcriptomics of dissected brain regions with massively parallel lineage tracing and in vivo RNA metabolic labeling to analyze regulation of neural stem cells in space and time. We detected a large diversity of neural stem cells with some subtypes being restricted to a single brain region while others were found globally across the brain. Global stem cell states are linked to neurogenic differentiation with different states being involved in proliferative and non proliferative differentiation. Our work reveals principles of adult stem cell organization and establishes a resource for functional manipulation of neural stem cell subtypes. Overall design: Single cell RNA seq of adult zebrafish brain performed using 10x Genomics Gene Expression protocols to explore transcriptomic diversity of adult cell types. The samples were prepared either from whole brain FACS sorted cells GFP positive cells from gfap:GFP line or a dissected single brain region as indicated in the sample title. CRISPR based lineage tracing was performed for a subset of samples to dissect developmental lineage relationships between cells. ScSLAM seq was performed in combination with Notch pathway inhibition to assess response of stem cells to perturbation.		pubmed:38365956		Brain 19 whole scRNAseq	GSM7875183		source name:adult brain\|tissue:adult brain\|tissue region:whole\|cell type:mixed tissue dissociation\|genotype:Tg[ubi:zebrabow M]\|geo loc name:missing\|collection date:missing	Brain 19 whole scRNAseq	The transcriptome libraries were demultiplexed and mapped with CellRanger 6.1.1. In order to reduce batch effect the gene expression matrices were processed with the SoupX tool Young & Behjati 2020 for removing ambient RNA contamination. A subset of libraries was also mapped with Velocyto v0.17.17 La Manno et al 2018 to create count matrices for unspliced and spliced molecules. The targeted lineage tracing libraries were aligned using bwa mem3 v.0.7.12 to individual references of endogenous genes used in the lineage tracing experiment actb1 actb2 cfl1 cirbpb rpl39 and ube2e1. The scars were filtered with a custom pipeline to eliminate sequences that originate from PCR or sequencing errors. For custom code and further downstream analysis see: https://github.com/nimitic/radial glia. Assembly: GRCz11 Supplementary files format and content: Tab separated barcode files and matrix files along with the tab separated gene file supplementary file are the output of CellRanger mapping further processed by the SoupX package for ambient RNA removal. Supplementary files format and content: Loom files are the output of velocyto mapping distinguishing spliced and unspliced mRNAs. Supplementary files format and content: filtered scars.csv files contain the output of a custom scar filtering pipeline.	adult brain		Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.		tissue:adult brain\|tissue region:whole\|cell type:mixed tissue dissociation\|genotype:Tg[ubi:zebrabow M]	GSM7875183	GSM7875183: Brain 19 whole scRNAseq; Danio rerio; RNA Seq	GSM7875183 r1	GSM7875183	1	Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP469552		loader:fastq load.py	b19_tdmr_seqrun1_R1.fastq.gz b19_tdmr_seqrun1_R2.fastq.gz	fastq fastq	17234149570.0	96821065.0	GSM7875183 r1	0:28 1:150	A:5205716192;C:3547964017;G:3688127103;T:4785052541;N:7289717	28	150			5205716192	3547964017	3688127103	4785052541	7289717	SRX22323914	SRS19374443	SRA1743007	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	2	0.0063	0.8972	0.00236	0.22454	0.99109	0.79123	0.52086	0.54601	28	150	T	B	sc-like readlen	illumina	nextseq	unknown	random_priming	unknown	sc	single_cell_droplet	10x	Germany	2023-10-31	Adult	Adult	Brain	Nervous System
28733	28733	SRR26623270	SRX22323914	SRS19374443	SRP469552	PRJNA1034159	Dissecting the spatiotemporal diversity of adult neural stem cells	GSE246714	Other	Adult stem cells are important for tissue turnover and regeneration. However in most adult systems it remains elusive how stem cells assume different functional states and support spatially patterned tissue architecture. Here we dissected the diversity of neural stem cells in the adult zebrafish brain an organ that is characterized by pronounced zonation and high regenerative capacity. We combined single cell transcriptomics of dissected brain regions with massively parallel lineage tracing and in vivo RNA metabolic labeling to analyze regulation of neural stem cells in space and time. We detected a large diversity of neural stem cells with some subtypes being restricted to a single brain region while others were found globally across the brain. Global stem cell states are linked to neurogenic differentiation with different states being involved in proliferative and non proliferative differentiation. Our work reveals principles of adult stem cell organization and establishes a resource for functional manipulation of neural stem cell subtypes. Overall design: Single cell RNA seq of adult zebrafish brain performed using 10x Genomics Gene Expression protocols to explore transcriptomic diversity of adult cell types. The samples were prepared either from whole brain FACS sorted cells GFP positive cells from gfap:GFP line or a dissected single brain region as indicated in the sample title. CRISPR based lineage tracing was performed for a subset of samples to dissect developmental lineage relationships between cells. ScSLAM seq was performed in combination with Notch pathway inhibition to assess response of stem cells to perturbation.		pubmed:38365956		Brain 19 whole scRNAseq	GSM7875183		source name:adult brain\|tissue:adult brain\|tissue region:whole\|cell type:mixed tissue dissociation\|genotype:Tg[ubi:zebrabow M]\|geo loc name:missing\|collection date:missing	Brain 19 whole scRNAseq	The transcriptome libraries were demultiplexed and mapped with CellRanger 6.1.1. In order to reduce batch effect the gene expression matrices were processed with the SoupX tool Young & Behjati 2020 for removing ambient RNA contamination. A subset of libraries was also mapped with Velocyto v0.17.17 La Manno et al 2018 to create count matrices for unspliced and spliced molecules. The targeted lineage tracing libraries were aligned using bwa mem3 v.0.7.12 to individual references of endogenous genes used in the lineage tracing experiment actb1 actb2 cfl1 cirbpb rpl39 and ube2e1. The scars were filtered with a custom pipeline to eliminate sequences that originate from PCR or sequencing errors. For custom code and further downstream analysis see: https://github.com/nimitic/radial glia. Assembly: GRCz11 Supplementary files format and content: Tab separated barcode files and matrix files along with the tab separated gene file supplementary file are the output of CellRanger mapping further processed by the SoupX package for ambient RNA removal. Supplementary files format and content: Loom files are the output of velocyto mapping distinguishing spliced and unspliced mRNAs. Supplementary files format and content: filtered scars.csv files contain the output of a custom scar filtering pipeline.	adult brain		Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.		tissue:adult brain\|tissue region:whole\|cell type:mixed tissue dissociation\|genotype:Tg[ubi:zebrabow M]	GSM7875183	GSM7875183: Brain 19 whole scRNAseq; Danio rerio; RNA Seq	GSM7875183 r1	GSM7875183	1	Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP469552		loader:fastq load.py	b19_tdmr_seqrun2_R1.fastq.gz b19_tdmr_seqrun2_R2.fastq.gz	fastq fastq	8080308788.0	54596681.0	GSM7875183 r2	0:28 1:120	A:2402417612;C:1698661627;G:1736701450;T:2240964763;N:1563336	28	120			2402417612	1698661627	1736701450	2240964763	1563336	SRX22323914	SRS19374443	SRA1743007	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	2	0.00651	0.88833	0.00255	0.2204	0.99121	0.7865	0.532	0.57621	28	120	T	B	sc-like readlen	illumina	nextseq	unknown	random_priming	unknown	sc	single_cell_droplet	10x	Germany	2023-10-31	Adult	Adult	Brain	Nervous System
28734	28734	SRR26623271	SRX22323913	SRS19374442	SRP469552	PRJNA1034159	Dissecting the spatiotemporal diversity of adult neural stem cells	GSE246714	Other	Adult stem cells are important for tissue turnover and regeneration. However in most adult systems it remains elusive how stem cells assume different functional states and support spatially patterned tissue architecture. Here we dissected the diversity of neural stem cells in the adult zebrafish brain an organ that is characterized by pronounced zonation and high regenerative capacity. We combined single cell transcriptomics of dissected brain regions with massively parallel lineage tracing and in vivo RNA metabolic labeling to analyze regulation of neural stem cells in space and time. We detected a large diversity of neural stem cells with some subtypes being restricted to a single brain region while others were found globally across the brain. Global stem cell states are linked to neurogenic differentiation with different states being involved in proliferative and non proliferative differentiation. Our work reveals principles of adult stem cell organization and establishes a resource for functional manipulation of neural stem cell subtypes. Overall design: Single cell RNA seq of adult zebrafish brain performed using 10x Genomics Gene Expression protocols to explore transcriptomic diversity of adult cell types. The samples were prepared either from whole brain FACS sorted cells GFP positive cells from gfap:GFP line or a dissected single brain region as indicated in the sample title. CRISPR based lineage tracing was performed for a subset of samples to dissect developmental lineage relationships between cells. ScSLAM seq was performed in combination with Notch pathway inhibition to assess response of stem cells to perturbation.		pubmed:38365956		Brain 18 rhombencephalon scRNAseq	GSM7875182		source name:adult brain\|tissue:adult brain\|tissue region:rhombencephalon\|cell type:mixed tissue dissociation\|genotype:wildtype Tg[ubi:zebrabow M]\|geo loc name:missing\|collection date:missing	Brain 18 rhombencephalon scRNAseq	The transcriptome libraries were demultiplexed and mapped with CellRanger 6.1.1. In order to reduce batch effect the gene expression matrices were processed with the SoupX tool Young & Behjati 2020 for removing ambient RNA contamination. A subset of libraries was also mapped with Velocyto v0.17.17 La Manno et al 2018 to create count matrices for unspliced and spliced molecules. The targeted lineage tracing libraries were aligned using bwa mem3 v.0.7.12 to individual references of endogenous genes used in the lineage tracing experiment actb1 actb2 cfl1 cirbpb rpl39 and ube2e1. The scars were filtered with a custom pipeline to eliminate sequences that originate from PCR or sequencing errors. For custom code and further downstream analysis see: https://github.com/nimitic/radial glia. Assembly: GRCz11 Supplementary files format and content: Tab separated barcode files and matrix files along with the tab separated gene file supplementary file are the output of CellRanger mapping further processed by the SoupX package for ambient RNA removal. Supplementary files format and content: Loom files are the output of velocyto mapping distinguishing spliced and unspliced mRNAs. Supplementary files format and content: filtered scars.csv files contain the output of a custom scar filtering pipeline.	adult brain		Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.		tissue:adult brain\|tissue region:rhombencephalon\|cell type:mixed tissue dissociation\|genotype:wildtype Tg[ubi:zebrabow M]	GSM7875182	GSM7875182: Brain 18 rhombencephalon scRNAseq; Danio rerio; RNA Seq	GSM7875182 r1	GSM7875182	1	Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP469552		loader:fastq load.py	b18_rhom_R1.fastq.gz b18_rhom_R2.fastq.gz	fastq fastq	18926303344.0	127880428.0	GSM7875182 r1	0:28 1:120	A:5713892455;C:3847687741;G:3928556839;T:5421348321;N:14817988	28	120			5713892455	3847687741	3928556839	5421348321	14817988	SRX22323913	SRS19374442	SRA1743007	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	2	0.00496	0.88436	0.00243	0.29801	0.99285	0.78433	0.50833	0.63318	28	120	T	B	sc-like readlen	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	Germany	2023-10-31	Adult	Adult	Brain	Nervous System
28735	28735	SRR26623272	SRX22323912	SRS19374441	SRP469552	PRJNA1034159	Dissecting the spatiotemporal diversity of adult neural stem cells	GSE246714	Other	Adult stem cells are important for tissue turnover and regeneration. However in most adult systems it remains elusive how stem cells assume different functional states and support spatially patterned tissue architecture. Here we dissected the diversity of neural stem cells in the adult zebrafish brain an organ that is characterized by pronounced zonation and high regenerative capacity. We combined single cell transcriptomics of dissected brain regions with massively parallel lineage tracing and in vivo RNA metabolic labeling to analyze regulation of neural stem cells in space and time. We detected a large diversity of neural stem cells with some subtypes being restricted to a single brain region while others were found globally across the brain. Global stem cell states are linked to neurogenic differentiation with different states being involved in proliferative and non proliferative differentiation. Our work reveals principles of adult stem cell organization and establishes a resource for functional manipulation of neural stem cell subtypes. Overall design: Single cell RNA seq of adult zebrafish brain performed using 10x Genomics Gene Expression protocols to explore transcriptomic diversity of adult cell types. The samples were prepared either from whole brain FACS sorted cells GFP positive cells from gfap:GFP line or a dissected single brain region as indicated in the sample title. CRISPR based lineage tracing was performed for a subset of samples to dissect developmental lineage relationships between cells. ScSLAM seq was performed in combination with Notch pathway inhibition to assess response of stem cells to perturbation.		pubmed:38365956		Brain 18 mesencephalon scRNAseq	GSM7875181		source name:adult brain\|tissue:adult brain\|tissue region:mesencephalon\|cell type:mixed tissue dissociation\|genotype:wildtype Tg[ubi:zebrabow M]\|geo loc name:missing\|collection date:missing	Brain 18 mesencephalon scRNAseq	The transcriptome libraries were demultiplexed and mapped with CellRanger 6.1.1. In order to reduce batch effect the gene expression matrices were processed with the SoupX tool Young & Behjati 2020 for removing ambient RNA contamination. A subset of libraries was also mapped with Velocyto v0.17.17 La Manno et al 2018 to create count matrices for unspliced and spliced molecules. The targeted lineage tracing libraries were aligned using bwa mem3 v.0.7.12 to individual references of endogenous genes used in the lineage tracing experiment actb1 actb2 cfl1 cirbpb rpl39 and ube2e1. The scars were filtered with a custom pipeline to eliminate sequences that originate from PCR or sequencing errors. For custom code and further downstream analysis see: https://github.com/nimitic/radial glia. Assembly: GRCz11 Supplementary files format and content: Tab separated barcode files and matrix files along with the tab separated gene file supplementary file are the output of CellRanger mapping further processed by the SoupX package for ambient RNA removal. Supplementary files format and content: Loom files are the output of velocyto mapping distinguishing spliced and unspliced mRNAs. Supplementary files format and content: filtered scars.csv files contain the output of a custom scar filtering pipeline.	adult brain		Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.		tissue:adult brain\|tissue region:mesencephalon\|cell type:mixed tissue dissociation\|genotype:wildtype Tg[ubi:zebrabow M]	GSM7875181	GSM7875181: Brain 18 mesencephalon scRNAseq; Danio rerio; RNA Seq	GSM7875181 r1	GSM7875181	1	Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP469552		loader:fastq load.py	b18_mes_R1.fastq.gz b18_mes_R2.fastq.gz	fastq fastq	18106862272.0	122343664.0	GSM7875181 r1	0:28 1:120	A:5459512927;C:3636958859;G:3755613924;T:5240531488;N:14245074	28	120			5459512927	3636958859	3755613924	5240531488	14245074	SRX22323912	SRS19374441	SRA1743007	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	2	0.00645	0.88033	0.00346	0.34147	0.99127	0.76934	0.48681	0.60464	28	120	T	B	sc-like readlen	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	Germany	2023-10-31	Adult	Adult	Brain	Nervous System
28736	28736	SRR26623273	SRX22323911	SRS19374440	SRP469552	PRJNA1034159	Dissecting the spatiotemporal diversity of adult neural stem cells	GSE246714	Other	Adult stem cells are important for tissue turnover and regeneration. However in most adult systems it remains elusive how stem cells assume different functional states and support spatially patterned tissue architecture. Here we dissected the diversity of neural stem cells in the adult zebrafish brain an organ that is characterized by pronounced zonation and high regenerative capacity. We combined single cell transcriptomics of dissected brain regions with massively parallel lineage tracing and in vivo RNA metabolic labeling to analyze regulation of neural stem cells in space and time. We detected a large diversity of neural stem cells with some subtypes being restricted to a single brain region while others were found globally across the brain. Global stem cell states are linked to neurogenic differentiation with different states being involved in proliferative and non proliferative differentiation. Our work reveals principles of adult stem cell organization and establishes a resource for functional manipulation of neural stem cell subtypes. Overall design: Single cell RNA seq of adult zebrafish brain performed using 10x Genomics Gene Expression protocols to explore transcriptomic diversity of adult cell types. The samples were prepared either from whole brain FACS sorted cells GFP positive cells from gfap:GFP line or a dissected single brain region as indicated in the sample title. CRISPR based lineage tracing was performed for a subset of samples to dissect developmental lineage relationships between cells. ScSLAM seq was performed in combination with Notch pathway inhibition to assess response of stem cells to perturbation.		pubmed:38365956		Brain 18 diencephalon scRNAseq	GSM7875180		source name:adult brain\|tissue:adult brain\|tissue region:diencephalon\|cell type:mixed tissue dissociation\|genotype:wildtype Tg[ubi:zebrabow M]\|geo loc name:missing\|collection date:missing	Brain 18 diencephalon scRNAseq	The transcriptome libraries were demultiplexed and mapped with CellRanger 6.1.1. In order to reduce batch effect the gene expression matrices were processed with the SoupX tool Young & Behjati 2020 for removing ambient RNA contamination. A subset of libraries was also mapped with Velocyto v0.17.17 La Manno et al 2018 to create count matrices for unspliced and spliced molecules. The targeted lineage tracing libraries were aligned using bwa mem3 v.0.7.12 to individual references of endogenous genes used in the lineage tracing experiment actb1 actb2 cfl1 cirbpb rpl39 and ube2e1. The scars were filtered with a custom pipeline to eliminate sequences that originate from PCR or sequencing errors. For custom code and further downstream analysis see: https://github.com/nimitic/radial glia. Assembly: GRCz11 Supplementary files format and content: Tab separated barcode files and matrix files along with the tab separated gene file supplementary file are the output of CellRanger mapping further processed by the SoupX package for ambient RNA removal. Supplementary files format and content: Loom files are the output of velocyto mapping distinguishing spliced and unspliced mRNAs. Supplementary files format and content: filtered scars.csv files contain the output of a custom scar filtering pipeline.	adult brain		Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.		tissue:adult brain\|tissue region:diencephalon\|cell type:mixed tissue dissociation\|genotype:wildtype Tg[ubi:zebrabow M]	GSM7875180	GSM7875180: Brain 18 diencephalon scRNAseq; Danio rerio; RNA Seq	GSM7875180 r1	GSM7875180	1	Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP469552		loader:fastq load.py	b18_dien_R1.fastq.gz b18_dien_R2.fastq.gz	fastq fastq	18653419612.0	126036619.0	GSM7875180 r1	0:28 1:120	A:5614496340;C:3825425595;G:3908771126;T:5290064867;N:14661684	28	120			5614496340	3825425595	3908771126	5290064867	14661684	SRX22323911	SRS19374440	SRA1743007	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	2	0.00521	0.89782	0.00244	0.25692	0.99302	0.77291	0.47528	0.62168	28	120	T	B	sc-like readlen	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	Germany	2023-10-31	Adult	Adult	Brain	Nervous System
28737	28737	SRR26623274	SRX22323910	SRS19374439	SRP469552	PRJNA1034159	Dissecting the spatiotemporal diversity of adult neural stem cells	GSE246714	Other	Adult stem cells are important for tissue turnover and regeneration. However in most adult systems it remains elusive how stem cells assume different functional states and support spatially patterned tissue architecture. Here we dissected the diversity of neural stem cells in the adult zebrafish brain an organ that is characterized by pronounced zonation and high regenerative capacity. We combined single cell transcriptomics of dissected brain regions with massively parallel lineage tracing and in vivo RNA metabolic labeling to analyze regulation of neural stem cells in space and time. We detected a large diversity of neural stem cells with some subtypes being restricted to a single brain region while others were found globally across the brain. Global stem cell states are linked to neurogenic differentiation with different states being involved in proliferative and non proliferative differentiation. Our work reveals principles of adult stem cell organization and establishes a resource for functional manipulation of neural stem cell subtypes. Overall design: Single cell RNA seq of adult zebrafish brain performed using 10x Genomics Gene Expression protocols to explore transcriptomic diversity of adult cell types. The samples were prepared either from whole brain FACS sorted cells GFP positive cells from gfap:GFP line or a dissected single brain region as indicated in the sample title. CRISPR based lineage tracing was performed for a subset of samples to dissect developmental lineage relationships between cells. ScSLAM seq was performed in combination with Notch pathway inhibition to assess response of stem cells to perturbation.		pubmed:38365956		Brain 17 whole scRNAseq	GSM7875179		source name:adult brain\|tissue:adult brain\|tissue region:whole\|cell type:mixed tissue dissociation\|genotype:wildtype\|geo loc name:missing\|collection date:missing	Brain 17 whole scRNAseq	The transcriptome libraries were demultiplexed and mapped with CellRanger 6.1.1. In order to reduce batch effect the gene expression matrices were processed with the SoupX tool Young & Behjati 2020 for removing ambient RNA contamination. A subset of libraries was also mapped with Velocyto v0.17.17 La Manno et al 2018 to create count matrices for unspliced and spliced molecules. The targeted lineage tracing libraries were aligned using bwa mem3 v.0.7.12 to individual references of endogenous genes used in the lineage tracing experiment actb1 actb2 cfl1 cirbpb rpl39 and ube2e1. The scars were filtered with a custom pipeline to eliminate sequences that originate from PCR or sequencing errors. For custom code and further downstream analysis see: https://github.com/nimitic/radial glia. Assembly: GRCz11 Supplementary files format and content: Tab separated barcode files and matrix files along with the tab separated gene file supplementary file are the output of CellRanger mapping further processed by the SoupX package for ambient RNA removal. Supplementary files format and content: Loom files are the output of velocyto mapping distinguishing spliced and unspliced mRNAs. Supplementary files format and content: filtered scars.csv files contain the output of a custom scar filtering pipeline.	adult brain		Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.		tissue:adult brain\|tissue region:whole\|cell type:mixed tissue dissociation\|genotype:wildtype	GSM7875179	GSM7875179: Brain 17 whole scRNAseq; Danio rerio; RNA Seq	GSM7875179 r1	GSM7875179	1	Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP469552		loader:fastq load.py	b17_tdmr_R1.fastq.gz b17_tdmr_R2.fastq.gz	fastq fastq	39604379236.0	267597157.0	GSM7875179 r1	0:28 1:120	A:12125317775;C:7792772449;G:8188608274;T:11493334367;N:4346371	28	120			12125317775	7792772449	8188608274	11493334367	4346371	SRX22323910	SRS19374439	SRA1743007	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	2	0.00523	0.88138	0.0024	0.31504	0.99162	0.75895	0.40373	0.49629	28	120	T	B	sc-like readlen	illumina	nextseq	unknown	random_priming	unknown	sc	single_cell_droplet	10x	Germany	2023-10-31	Adult	Adult	Brain	Nervous System
28738	28738	SRR26623275	SRX22323909	SRS19374438	SRP469552	PRJNA1034159	Dissecting the spatiotemporal diversity of adult neural stem cells	GSE246714	Other	Adult stem cells are important for tissue turnover and regeneration. However in most adult systems it remains elusive how stem cells assume different functional states and support spatially patterned tissue architecture. Here we dissected the diversity of neural stem cells in the adult zebrafish brain an organ that is characterized by pronounced zonation and high regenerative capacity. We combined single cell transcriptomics of dissected brain regions with massively parallel lineage tracing and in vivo RNA metabolic labeling to analyze regulation of neural stem cells in space and time. We detected a large diversity of neural stem cells with some subtypes being restricted to a single brain region while others were found globally across the brain. Global stem cell states are linked to neurogenic differentiation with different states being involved in proliferative and non proliferative differentiation. Our work reveals principles of adult stem cell organization and establishes a resource for functional manipulation of neural stem cell subtypes. Overall design: Single cell RNA seq of adult zebrafish brain performed using 10x Genomics Gene Expression protocols to explore transcriptomic diversity of adult cell types. The samples were prepared either from whole brain FACS sorted cells GFP positive cells from gfap:GFP line or a dissected single brain region as indicated in the sample title. CRISPR based lineage tracing was performed for a subset of samples to dissect developmental lineage relationships between cells. ScSLAM seq was performed in combination with Notch pathway inhibition to assess response of stem cells to perturbation.		pubmed:38365956		Brain 16 sorted scRNAseq	GSM7875178		source name:adult brain\|tissue:adult brain\|tissue region:sorted\|cell type:mixed tissue dissociation\|genotype:Tg[gfap:GFP]\|geo loc name:missing\|collection date:missing	Brain 16 sorted scRNAseq	The transcriptome libraries were demultiplexed and mapped with CellRanger 6.1.1. In order to reduce batch effect the gene expression matrices were processed with the SoupX tool Young & Behjati 2020 for removing ambient RNA contamination. A subset of libraries was also mapped with Velocyto v0.17.17 La Manno et al 2018 to create count matrices for unspliced and spliced molecules. The targeted lineage tracing libraries were aligned using bwa mem3 v.0.7.12 to individual references of endogenous genes used in the lineage tracing experiment actb1 actb2 cfl1 cirbpb rpl39 and ube2e1. The scars were filtered with a custom pipeline to eliminate sequences that originate from PCR or sequencing errors. For custom code and further downstream analysis see: https://github.com/nimitic/radial glia. Assembly: GRCz11 Supplementary files format and content: Tab separated barcode files and matrix files along with the tab separated gene file supplementary file are the output of CellRanger mapping further processed by the SoupX package for ambient RNA removal. Supplementary files format and content: Loom files are the output of velocyto mapping distinguishing spliced and unspliced mRNAs. Supplementary files format and content: filtered scars.csv files contain the output of a custom scar filtering pipeline.	adult brain		Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.		tissue:adult brain\|tissue region:sorted\|cell type:mixed tissue dissociation\|genotype:Tg[gfap:GFP]	GSM7875178	GSM7875178: Brain 16 sorted scRNAseq; Danio rerio; RNA Seq	GSM7875178 r1	GSM7875178	1	Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP469552		loader:fastq load.py	b16_gfap_R2.fastq.gz b16_gfap_R1.fastq.gz	fastq fastq	5443014500.0	36777125.0	GSM7875178 r1												SRX22323909	SRS19374438	SRA1743007	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	2	0.00627	0.90735	0.00227	0.18428	0.99115	0.77242	0.4456	0.61483	28	120	T	B	sc-like readlen	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	Germany	2023-10-31	Adult	Adult	Brain	Nervous System
28739	28739	SRR26623276	SRX22323908	SRS19374437	SRP469552	PRJNA1034159	Dissecting the spatiotemporal diversity of adult neural stem cells	GSE246714	Other	Adult stem cells are important for tissue turnover and regeneration. However in most adult systems it remains elusive how stem cells assume different functional states and support spatially patterned tissue architecture. Here we dissected the diversity of neural stem cells in the adult zebrafish brain an organ that is characterized by pronounced zonation and high regenerative capacity. We combined single cell transcriptomics of dissected brain regions with massively parallel lineage tracing and in vivo RNA metabolic labeling to analyze regulation of neural stem cells in space and time. We detected a large diversity of neural stem cells with some subtypes being restricted to a single brain region while others were found globally across the brain. Global stem cell states are linked to neurogenic differentiation with different states being involved in proliferative and non proliferative differentiation. Our work reveals principles of adult stem cell organization and establishes a resource for functional manipulation of neural stem cell subtypes. Overall design: Single cell RNA seq of adult zebrafish brain performed using 10x Genomics Gene Expression protocols to explore transcriptomic diversity of adult cell types. The samples were prepared either from whole brain FACS sorted cells GFP positive cells from gfap:GFP line or a dissected single brain region as indicated in the sample title. CRISPR based lineage tracing was performed for a subset of samples to dissect developmental lineage relationships between cells. ScSLAM seq was performed in combination with Notch pathway inhibition to assess response of stem cells to perturbation.		pubmed:38365956		Brain 15 whole scRNAseq	GSM7875177		source name:adult brain\|tissue:adult brain\|tissue region:whole\|cell type:mixed tissue dissociation\|genotype:wildtype\|geo loc name:missing\|collection date:missing	Brain 15 whole scRNAseq	The transcriptome libraries were demultiplexed and mapped with CellRanger 6.1.1. In order to reduce batch effect the gene expression matrices were processed with the SoupX tool Young & Behjati 2020 for removing ambient RNA contamination. A subset of libraries was also mapped with Velocyto v0.17.17 La Manno et al 2018 to create count matrices for unspliced and spliced molecules. The targeted lineage tracing libraries were aligned using bwa mem3 v.0.7.12 to individual references of endogenous genes used in the lineage tracing experiment actb1 actb2 cfl1 cirbpb rpl39 and ube2e1. The scars were filtered with a custom pipeline to eliminate sequences that originate from PCR or sequencing errors. For custom code and further downstream analysis see: https://github.com/nimitic/radial glia. Assembly: GRCz11 Supplementary files format and content: Tab separated barcode files and matrix files along with the tab separated gene file supplementary file are the output of CellRanger mapping further processed by the SoupX package for ambient RNA removal. Supplementary files format and content: Loom files are the output of velocyto mapping distinguishing spliced and unspliced mRNAs. Supplementary files format and content: filtered scars.csv files contain the output of a custom scar filtering pipeline.	adult brain		Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.		tissue:adult brain\|tissue region:whole\|cell type:mixed tissue dissociation\|genotype:wildtype	GSM7875177	GSM7875177: Brain 15 whole scRNAseq; Danio rerio; RNA Seq	GSM7875177 r1	GSM7875177	1	Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP469552		loader:fastq load.py	b15_mult_R2.fastq.gz b15_mult_R1.fastq.gz	fastq fastq	11845962180.0	80040285.0	GSM7875177 r1	0:28 1:120	A:2976260508;C:2811030160;G:2912422943;T:3143400974;N:2847595	28	120			2976260508	2811030160	2912422943	3143400974	2847595	SRX22323908	SRS19374437	SRA1743007	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	2	0.08396	0.93662	0.02595	0.16615	0.93744	0.71364	0.29067	0.56326	28	120	T	B	sc-like readlen	illumina	nextseq	unknown	random_priming	unknown	sc	single_cell_droplet	10x	Germany	2023-10-31	Adult	Adult	Brain	Nervous System
28740	28740	SRR26623277	SRX22323907	SRS19374436	SRP469552	PRJNA1034159	Dissecting the spatiotemporal diversity of adult neural stem cells	GSE246714	Other	Adult stem cells are important for tissue turnover and regeneration. However in most adult systems it remains elusive how stem cells assume different functional states and support spatially patterned tissue architecture. Here we dissected the diversity of neural stem cells in the adult zebrafish brain an organ that is characterized by pronounced zonation and high regenerative capacity. We combined single cell transcriptomics of dissected brain regions with massively parallel lineage tracing and in vivo RNA metabolic labeling to analyze regulation of neural stem cells in space and time. We detected a large diversity of neural stem cells with some subtypes being restricted to a single brain region while others were found globally across the brain. Global stem cell states are linked to neurogenic differentiation with different states being involved in proliferative and non proliferative differentiation. Our work reveals principles of adult stem cell organization and establishes a resource for functional manipulation of neural stem cell subtypes. Overall design: Single cell RNA seq of adult zebrafish brain performed using 10x Genomics Gene Expression protocols to explore transcriptomic diversity of adult cell types. The samples were prepared either from whole brain FACS sorted cells GFP positive cells from gfap:GFP line or a dissected single brain region as indicated in the sample title. CRISPR based lineage tracing was performed for a subset of samples to dissect developmental lineage relationships between cells. ScSLAM seq was performed in combination with Notch pathway inhibition to assess response of stem cells to perturbation.		pubmed:38365956		Brain 14 sorted scRNAseq	GSM7875176		source name:adult brain\|tissue:adult brain\|tissue region:sorted\|cell type:mixed tissue dissociation\|genotype:Tg[gfap:GFP]\|geo loc name:missing\|collection date:missing	Brain 14 sorted scRNAseq	The transcriptome libraries were demultiplexed and mapped with CellRanger 6.1.1. In order to reduce batch effect the gene expression matrices were processed with the SoupX tool Young & Behjati 2020 for removing ambient RNA contamination. A subset of libraries was also mapped with Velocyto v0.17.17 La Manno et al 2018 to create count matrices for unspliced and spliced molecules. The targeted lineage tracing libraries were aligned using bwa mem3 v.0.7.12 to individual references of endogenous genes used in the lineage tracing experiment actb1 actb2 cfl1 cirbpb rpl39 and ube2e1. The scars were filtered with a custom pipeline to eliminate sequences that originate from PCR or sequencing errors. For custom code and further downstream analysis see: https://github.com/nimitic/radial glia. Assembly: GRCz11 Supplementary files format and content: Tab separated barcode files and matrix files along with the tab separated gene file supplementary file are the output of CellRanger mapping further processed by the SoupX package for ambient RNA removal. Supplementary files format and content: Loom files are the output of velocyto mapping distinguishing spliced and unspliced mRNAs. Supplementary files format and content: filtered scars.csv files contain the output of a custom scar filtering pipeline.	adult brain		Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.		tissue:adult brain\|tissue region:sorted\|cell type:mixed tissue dissociation\|genotype:Tg[gfap:GFP]	GSM7875176	GSM7875176: Brain 14 sorted scRNAseq; Danio rerio; RNA Seq	GSM7875176 r1	GSM7875176	1	Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP469552		loader:fastq load.py	b14_gfap_R2.fastq.gz b14_gfap_R1.fastq.gz	fastq fastq	17138451800.0	115800350.0	GSM7875176 r1	0:28 1:120	A:4079957203;C:3974923538;G:4289276957;T:4791971757;N:2322345	28	120			4079957203	3974923538	4289276957	4791971757	2322345	SRX22323907	SRS19374436	SRA1743007	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	2	0.10093	0.95317	0.0314	0.10551	0.97104	0.82487	0.39909	0.4491	28	120	T	B	sc-like readlen	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	Germany	2023-10-31	Adult	Adult	Brain	Nervous System
28741	28741	SRR26623278	SRX22323906	SRS19374435	SRP469552	PRJNA1034159	Dissecting the spatiotemporal diversity of adult neural stem cells	GSE246714	Other	Adult stem cells are important for tissue turnover and regeneration. However in most adult systems it remains elusive how stem cells assume different functional states and support spatially patterned tissue architecture. Here we dissected the diversity of neural stem cells in the adult zebrafish brain an organ that is characterized by pronounced zonation and high regenerative capacity. We combined single cell transcriptomics of dissected brain regions with massively parallel lineage tracing and in vivo RNA metabolic labeling to analyze regulation of neural stem cells in space and time. We detected a large diversity of neural stem cells with some subtypes being restricted to a single brain region while others were found globally across the brain. Global stem cell states are linked to neurogenic differentiation with different states being involved in proliferative and non proliferative differentiation. Our work reveals principles of adult stem cell organization and establishes a resource for functional manipulation of neural stem cell subtypes. Overall design: Single cell RNA seq of adult zebrafish brain performed using 10x Genomics Gene Expression protocols to explore transcriptomic diversity of adult cell types. The samples were prepared either from whole brain FACS sorted cells GFP positive cells from gfap:GFP line or a dissected single brain region as indicated in the sample title. CRISPR based lineage tracing was performed for a subset of samples to dissect developmental lineage relationships between cells. ScSLAM seq was performed in combination with Notch pathway inhibition to assess response of stem cells to perturbation.		pubmed:38365956		Brain 13 whole scRNAseq	GSM7875175		source name:adult brain\|tissue:adult brain\|tissue region:whole\|cell type:mixed tissue dissociation\|genotype:wildtype\|geo loc name:missing\|collection date:missing	Brain 13 whole scRNAseq	The transcriptome libraries were demultiplexed and mapped with CellRanger 6.1.1. In order to reduce batch effect the gene expression matrices were processed with the SoupX tool Young & Behjati 2020 for removing ambient RNA contamination. A subset of libraries was also mapped with Velocyto v0.17.17 La Manno et al 2018 to create count matrices for unspliced and spliced molecules. The targeted lineage tracing libraries were aligned using bwa mem3 v.0.7.12 to individual references of endogenous genes used in the lineage tracing experiment actb1 actb2 cfl1 cirbpb rpl39 and ube2e1. The scars were filtered with a custom pipeline to eliminate sequences that originate from PCR or sequencing errors. For custom code and further downstream analysis see: https://github.com/nimitic/radial glia. Assembly: GRCz11 Supplementary files format and content: Tab separated barcode files and matrix files along with the tab separated gene file supplementary file are the output of CellRanger mapping further processed by the SoupX package for ambient RNA removal. Supplementary files format and content: Loom files are the output of velocyto mapping distinguishing spliced and unspliced mRNAs. Supplementary files format and content: filtered scars.csv files contain the output of a custom scar filtering pipeline.	adult brain		Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.		tissue:adult brain\|tissue region:whole\|cell type:mixed tissue dissociation\|genotype:wildtype	GSM7875175	GSM7875175: Brain 13 whole scRNAseq; Danio rerio; RNA Seq	GSM7875175 r1	GSM7875175	1	Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP469552		loader:fastq load.py	b13_mult_R2.fastq.gz b13_mult_R1.fastq.gz	fastq fastq	14716484640.0	94336440.0	GSM7875175 r1	0:28 1:128	A:3656679229;C:3244551762;G:3483547888;T:4325660472;N:6045289	28	128			3656679229	3244551762	3483547888	4325660472	6045289	SRX22323906	SRS19374435	SRA1743007	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	2	0.0334	0.93779	0.01344	0.20291	0.97654	0.72991	0.35896	0.56645	28	128	T	B	sc-like readlen	illumina	nextseq	unknown	random_priming	unknown	sc	single_cell_droplet	10x	Germany	2023-10-31	Adult	Adult	Brain	Nervous System
28742	28742	SRR26623279	SRX22323905	SRS19374434	SRP469552	PRJNA1034159	Dissecting the spatiotemporal diversity of adult neural stem cells	GSE246714	Other	Adult stem cells are important for tissue turnover and regeneration. However in most adult systems it remains elusive how stem cells assume different functional states and support spatially patterned tissue architecture. Here we dissected the diversity of neural stem cells in the adult zebrafish brain an organ that is characterized by pronounced zonation and high regenerative capacity. We combined single cell transcriptomics of dissected brain regions with massively parallel lineage tracing and in vivo RNA metabolic labeling to analyze regulation of neural stem cells in space and time. We detected a large diversity of neural stem cells with some subtypes being restricted to a single brain region while others were found globally across the brain. Global stem cell states are linked to neurogenic differentiation with different states being involved in proliferative and non proliferative differentiation. Our work reveals principles of adult stem cell organization and establishes a resource for functional manipulation of neural stem cell subtypes. Overall design: Single cell RNA seq of adult zebrafish brain performed using 10x Genomics Gene Expression protocols to explore transcriptomic diversity of adult cell types. The samples were prepared either from whole brain FACS sorted cells GFP positive cells from gfap:GFP line or a dissected single brain region as indicated in the sample title. CRISPR based lineage tracing was performed for a subset of samples to dissect developmental lineage relationships between cells. ScSLAM seq was performed in combination with Notch pathway inhibition to assess response of stem cells to perturbation.		pubmed:38365956		Brain 12 whole scRNAseq	GSM7875174		source name:adult brain\|tissue:adult brain\|tissue region:whole\|cell type:mixed tissue dissociation\|genotype:wildtype\|geo loc name:missing\|collection date:missing	Brain 12 whole scRNAseq	The transcriptome libraries were demultiplexed and mapped with CellRanger 6.1.1. In order to reduce batch effect the gene expression matrices were processed with the SoupX tool Young & Behjati 2020 for removing ambient RNA contamination. A subset of libraries was also mapped with Velocyto v0.17.17 La Manno et al 2018 to create count matrices for unspliced and spliced molecules. The targeted lineage tracing libraries were aligned using bwa mem3 v.0.7.12 to individual references of endogenous genes used in the lineage tracing experiment actb1 actb2 cfl1 cirbpb rpl39 and ube2e1. The scars were filtered with a custom pipeline to eliminate sequences that originate from PCR or sequencing errors. For custom code and further downstream analysis see: https://github.com/nimitic/radial glia. Assembly: GRCz11 Supplementary files format and content: Tab separated barcode files and matrix files along with the tab separated gene file supplementary file are the output of CellRanger mapping further processed by the SoupX package for ambient RNA removal. Supplementary files format and content: Loom files are the output of velocyto mapping distinguishing spliced and unspliced mRNAs. Supplementary files format and content: filtered scars.csv files contain the output of a custom scar filtering pipeline.	adult brain		Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.		tissue:adult brain\|tissue region:whole\|cell type:mixed tissue dissociation\|genotype:wildtype	GSM7875174	GSM7875174: Brain 12 whole scRNAseq; Danio rerio; RNA Seq	GSM7875174 r1	GSM7875174	1	Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP469552		loader:fastq load.py	b12_mult_R2.fastq.gz b12_mult_R1.fastq.gz	fastq fastq	12967118112.0	83122552.0	GSM7875174 r1	0:28 1:128	A:3152750696;C:2922178338;G:3166672580;T:3720207530;N:5308968	28	128			3152750696	2922178338	3166672580	3720207530	5308968	SRX22323905	SRS19374434	SRA1743007	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	2	0.06196	0.94967	0.02426	0.19522	0.97108	0.73886	0.33644	0.62119	28	128	T	B	sc-like readlen	illumina	nextseq	unknown	random_priming	unknown	sc	single_cell_droplet	10x	Germany	2023-10-31	Adult	Adult	Brain	Nervous System
28743	28743	SRR26623280	SRX22323904	SRS19374433	SRP469552	PRJNA1034159	Dissecting the spatiotemporal diversity of adult neural stem cells	GSE246714	Other	Adult stem cells are important for tissue turnover and regeneration. However in most adult systems it remains elusive how stem cells assume different functional states and support spatially patterned tissue architecture. Here we dissected the diversity of neural stem cells in the adult zebrafish brain an organ that is characterized by pronounced zonation and high regenerative capacity. We combined single cell transcriptomics of dissected brain regions with massively parallel lineage tracing and in vivo RNA metabolic labeling to analyze regulation of neural stem cells in space and time. We detected a large diversity of neural stem cells with some subtypes being restricted to a single brain region while others were found globally across the brain. Global stem cell states are linked to neurogenic differentiation with different states being involved in proliferative and non proliferative differentiation. Our work reveals principles of adult stem cell organization and establishes a resource for functional manipulation of neural stem cell subtypes. Overall design: Single cell RNA seq of adult zebrafish brain performed using 10x Genomics Gene Expression protocols to explore transcriptomic diversity of adult cell types. The samples were prepared either from whole brain FACS sorted cells GFP positive cells from gfap:GFP line or a dissected single brain region as indicated in the sample title. CRISPR based lineage tracing was performed for a subset of samples to dissect developmental lineage relationships between cells. ScSLAM seq was performed in combination with Notch pathway inhibition to assess response of stem cells to perturbation.		pubmed:38365956		Brain 11 whole scRNAseq	GSM7875173		source name:adult brain\|tissue:adult brain\|tissue region:whole\|cell type:mixed tissue dissociation\|genotype:wildtype\|geo loc name:missing\|collection date:missing	Brain 11 whole scRNAseq	The transcriptome libraries were demultiplexed and mapped with CellRanger 6.1.1. In order to reduce batch effect the gene expression matrices were processed with the SoupX tool Young & Behjati 2020 for removing ambient RNA contamination. A subset of libraries was also mapped with Velocyto v0.17.17 La Manno et al 2018 to create count matrices for unspliced and spliced molecules. The targeted lineage tracing libraries were aligned using bwa mem3 v.0.7.12 to individual references of endogenous genes used in the lineage tracing experiment actb1 actb2 cfl1 cirbpb rpl39 and ube2e1. The scars were filtered with a custom pipeline to eliminate sequences that originate from PCR or sequencing errors. For custom code and further downstream analysis see: https://github.com/nimitic/radial glia. Assembly: GRCz11 Supplementary files format and content: Tab separated barcode files and matrix files along with the tab separated gene file supplementary file are the output of CellRanger mapping further processed by the SoupX package for ambient RNA removal. Supplementary files format and content: Loom files are the output of velocyto mapping distinguishing spliced and unspliced mRNAs. Supplementary files format and content: filtered scars.csv files contain the output of a custom scar filtering pipeline.	adult brain		Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.		tissue:adult brain\|tissue region:whole\|cell type:mixed tissue dissociation\|genotype:wildtype	GSM7875173	GSM7875173: Brain 11 whole scRNAseq; Danio rerio; RNA Seq	GSM7875173 r1	GSM7875173	1	Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP469552		loader:fastq load.py	b11_mult_R1.fastq.gz b11_mult_R2.fastq.gz	fastq fastq	14974963824.0	101182188.0	GSM7875173 r1	0:28 1:120	A:3753936293;C:3687961330;G:3650849763;T:3879258880;N:2957558	28	120			3753936293	3687961330	3650849763	3879258880	2957558	SRX22323904	SRS19374433	SRA1743007	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	2	0.16926	0.9633	0.06452	0.20524	0.93545	0.76274	0.26732	0.59389	28	120	T	B	sc-like readlen	illumina	nextseq	unknown	random_priming	unknown	sc	single_cell_droplet	10x	Germany	2023-10-31	Adult	Adult	Brain	Nervous System
28744	28744	SRR26623281	SRX22323903	SRS19374431	SRP469552	PRJNA1034159	Dissecting the spatiotemporal diversity of adult neural stem cells	GSE246714	Other	Adult stem cells are important for tissue turnover and regeneration. However in most adult systems it remains elusive how stem cells assume different functional states and support spatially patterned tissue architecture. Here we dissected the diversity of neural stem cells in the adult zebrafish brain an organ that is characterized by pronounced zonation and high regenerative capacity. We combined single cell transcriptomics of dissected brain regions with massively parallel lineage tracing and in vivo RNA metabolic labeling to analyze regulation of neural stem cells in space and time. We detected a large diversity of neural stem cells with some subtypes being restricted to a single brain region while others were found globally across the brain. Global stem cell states are linked to neurogenic differentiation with different states being involved in proliferative and non proliferative differentiation. Our work reveals principles of adult stem cell organization and establishes a resource for functional manipulation of neural stem cell subtypes. Overall design: Single cell RNA seq of adult zebrafish brain performed using 10x Genomics Gene Expression protocols to explore transcriptomic diversity of adult cell types. The samples were prepared either from whole brain FACS sorted cells GFP positive cells from gfap:GFP line or a dissected single brain region as indicated in the sample title. CRISPR based lineage tracing was performed for a subset of samples to dissect developmental lineage relationships between cells. ScSLAM seq was performed in combination with Notch pathway inhibition to assess response of stem cells to perturbation.		pubmed:38365956		Brain 10 telencephalon scRNAseq	GSM7875172		source name:adult brain\|tissue:adult brain\|tissue region:telencephalon\|cell type:mixed tissue dissociation\|genotype:wildtype\|geo loc name:missing\|collection date:missing	Brain 10 telencephalon scRNAseq	The transcriptome libraries were demultiplexed and mapped with CellRanger 6.1.1. In order to reduce batch effect the gene expression matrices were processed with the SoupX tool Young & Behjati 2020 for removing ambient RNA contamination. A subset of libraries was also mapped with Velocyto v0.17.17 La Manno et al 2018 to create count matrices for unspliced and spliced molecules. The targeted lineage tracing libraries were aligned using bwa mem3 v.0.7.12 to individual references of endogenous genes used in the lineage tracing experiment actb1 actb2 cfl1 cirbpb rpl39 and ube2e1. The scars were filtered with a custom pipeline to eliminate sequences that originate from PCR or sequencing errors. For custom code and further downstream analysis see: https://github.com/nimitic/radial glia. Assembly: GRCz11 Supplementary files format and content: Tab separated barcode files and matrix files along with the tab separated gene file supplementary file are the output of CellRanger mapping further processed by the SoupX package for ambient RNA removal. Supplementary files format and content: Loom files are the output of velocyto mapping distinguishing spliced and unspliced mRNAs. Supplementary files format and content: filtered scars.csv files contain the output of a custom scar filtering pipeline.	adult brain		Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.		tissue:adult brain\|tissue region:telencephalon\|cell type:mixed tissue dissociation\|genotype:wildtype	GSM7875172	GSM7875172: Brain 10 telencephalon scRNAseq; Danio rerio; RNA Seq	GSM7875172 r1	GSM7875172	1	Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP469552		loader:fastq load.py	b10_tel_seqrun1_R2.fastq.gz b10_tel_seqrun1_R1.fastq.gz	fastq fastq	3731199140.0	25210805.0	GSM7875172 r1	0:28 1:120	A:1133663247;C:801786454;G:811411935;T:982912952;N:1424552	28	120			1133663247	801786454	811411935	982912952	1424552	SRX22323903	SRS19374431	SRA1743007	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	2	0.01267	0.92045	0.00689	0.20316	0.99101	0.80876	0.4565	0.44433	28	120	T	B	sc-like readlen	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	Germany	2023-10-31	Adult	Adult	Brain	Nervous System
28745	28745	SRR26623282	SRX22323903	SRS19374431	SRP469552	PRJNA1034159	Dissecting the spatiotemporal diversity of adult neural stem cells	GSE246714	Other	Adult stem cells are important for tissue turnover and regeneration. However in most adult systems it remains elusive how stem cells assume different functional states and support spatially patterned tissue architecture. Here we dissected the diversity of neural stem cells in the adult zebrafish brain an organ that is characterized by pronounced zonation and high regenerative capacity. We combined single cell transcriptomics of dissected brain regions with massively parallel lineage tracing and in vivo RNA metabolic labeling to analyze regulation of neural stem cells in space and time. We detected a large diversity of neural stem cells with some subtypes being restricted to a single brain region while others were found globally across the brain. Global stem cell states are linked to neurogenic differentiation with different states being involved in proliferative and non proliferative differentiation. Our work reveals principles of adult stem cell organization and establishes a resource for functional manipulation of neural stem cell subtypes. Overall design: Single cell RNA seq of adult zebrafish brain performed using 10x Genomics Gene Expression protocols to explore transcriptomic diversity of adult cell types. The samples were prepared either from whole brain FACS sorted cells GFP positive cells from gfap:GFP line or a dissected single brain region as indicated in the sample title. CRISPR based lineage tracing was performed for a subset of samples to dissect developmental lineage relationships between cells. ScSLAM seq was performed in combination with Notch pathway inhibition to assess response of stem cells to perturbation.		pubmed:38365956		Brain 10 telencephalon scRNAseq	GSM7875172		source name:adult brain\|tissue:adult brain\|tissue region:telencephalon\|cell type:mixed tissue dissociation\|genotype:wildtype\|geo loc name:missing\|collection date:missing	Brain 10 telencephalon scRNAseq	The transcriptome libraries were demultiplexed and mapped with CellRanger 6.1.1. In order to reduce batch effect the gene expression matrices were processed with the SoupX tool Young & Behjati 2020 for removing ambient RNA contamination. A subset of libraries was also mapped with Velocyto v0.17.17 La Manno et al 2018 to create count matrices for unspliced and spliced molecules. The targeted lineage tracing libraries were aligned using bwa mem3 v.0.7.12 to individual references of endogenous genes used in the lineage tracing experiment actb1 actb2 cfl1 cirbpb rpl39 and ube2e1. The scars were filtered with a custom pipeline to eliminate sequences that originate from PCR or sequencing errors. For custom code and further downstream analysis see: https://github.com/nimitic/radial glia. Assembly: GRCz11 Supplementary files format and content: Tab separated barcode files and matrix files along with the tab separated gene file supplementary file are the output of CellRanger mapping further processed by the SoupX package for ambient RNA removal. Supplementary files format and content: Loom files are the output of velocyto mapping distinguishing spliced and unspliced mRNAs. Supplementary files format and content: filtered scars.csv files contain the output of a custom scar filtering pipeline.	adult brain		Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.		tissue:adult brain\|tissue region:telencephalon\|cell type:mixed tissue dissociation\|genotype:wildtype	GSM7875172	GSM7875172: Brain 10 telencephalon scRNAseq; Danio rerio; RNA Seq	GSM7875172 r1	GSM7875172	1	Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP469552		loader:fastq load.py	b10_tel_seqrun2_R2.fastq.gz b10_tel_seqrun2_R1.fastq.gz	fastq fastq	506663940.0	3423405.0	GSM7875172 r2												SRX22323903	SRS19374431	SRA1743007	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	2	0.01234	0.92119	0.00661	0.20424	0.99176	0.81156	0.50821	0.7283	28	120	T	B	sc-like readlen	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	Germany	2023-10-31	Adult	Adult	Brain	Nervous System
28746	28746	SRR26623283	SRX22323902	SRS19374432	SRP469552	PRJNA1034159	Dissecting the spatiotemporal diversity of adult neural stem cells	GSE246714	Other	Adult stem cells are important for tissue turnover and regeneration. However in most adult systems it remains elusive how stem cells assume different functional states and support spatially patterned tissue architecture. Here we dissected the diversity of neural stem cells in the adult zebrafish brain an organ that is characterized by pronounced zonation and high regenerative capacity. We combined single cell transcriptomics of dissected brain regions with massively parallel lineage tracing and in vivo RNA metabolic labeling to analyze regulation of neural stem cells in space and time. We detected a large diversity of neural stem cells with some subtypes being restricted to a single brain region while others were found globally across the brain. Global stem cell states are linked to neurogenic differentiation with different states being involved in proliferative and non proliferative differentiation. Our work reveals principles of adult stem cell organization and establishes a resource for functional manipulation of neural stem cell subtypes. Overall design: Single cell RNA seq of adult zebrafish brain performed using 10x Genomics Gene Expression protocols to explore transcriptomic diversity of adult cell types. The samples were prepared either from whole brain FACS sorted cells GFP positive cells from gfap:GFP line or a dissected single brain region as indicated in the sample title. CRISPR based lineage tracing was performed for a subset of samples to dissect developmental lineage relationships between cells. ScSLAM seq was performed in combination with Notch pathway inhibition to assess response of stem cells to perturbation.		pubmed:38365956		Brain 10 mesencephalon scRNAseq	GSM7875171		source name:adult brain\|tissue:adult brain\|tissue region:mesencephalon\|cell type:mixed tissue dissociation\|genotype:wildtype\|geo loc name:missing\|collection date:missing	Brain 10 mesencephalon scRNAseq	The transcriptome libraries were demultiplexed and mapped with CellRanger 6.1.1. In order to reduce batch effect the gene expression matrices were processed with the SoupX tool Young & Behjati 2020 for removing ambient RNA contamination. A subset of libraries was also mapped with Velocyto v0.17.17 La Manno et al 2018 to create count matrices for unspliced and spliced molecules. The targeted lineage tracing libraries were aligned using bwa mem3 v.0.7.12 to individual references of endogenous genes used in the lineage tracing experiment actb1 actb2 cfl1 cirbpb rpl39 and ube2e1. The scars were filtered with a custom pipeline to eliminate sequences that originate from PCR or sequencing errors. For custom code and further downstream analysis see: https://github.com/nimitic/radial glia. Assembly: GRCz11 Supplementary files format and content: Tab separated barcode files and matrix files along with the tab separated gene file supplementary file are the output of CellRanger mapping further processed by the SoupX package for ambient RNA removal. Supplementary files format and content: Loom files are the output of velocyto mapping distinguishing spliced and unspliced mRNAs. Supplementary files format and content: filtered scars.csv files contain the output of a custom scar filtering pipeline.	adult brain		Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.		tissue:adult brain\|tissue region:mesencephalon\|cell type:mixed tissue dissociation\|genotype:wildtype	GSM7875171	GSM7875171: Brain 10 mesencephalon scRNAseq; Danio rerio; RNA Seq	GSM7875171 r1	GSM7875171	1	Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP469552		loader:fastq load.py	b10_ot_seqrun1_R1.fastq.gz b10_ot_seqrun1_R2.fastq.gz	fastq fastq	13285400412.0	89766219.0	GSM7875171 r1	0:28 1:120	A:4046617952;C:2711660606;G:2795963083;T:3726083915;N:5074856	28	120			4046617952	2711660606	2795963083	3726083915	5074856	SRX22323902	SRS19374432	SRA1743007	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	2	0.01072	0.91211	0.00629	0.2341	0.99111	0.78985	0.46996	0.63777	28	120	T	B	sc-like readlen	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	Germany	2023-10-31	Adult	Adult	Brain	Nervous System
28747	28747	SRR26623284	SRX22323902	SRS19374432	SRP469552	PRJNA1034159	Dissecting the spatiotemporal diversity of adult neural stem cells	GSE246714	Other	Adult stem cells are important for tissue turnover and regeneration. However in most adult systems it remains elusive how stem cells assume different functional states and support spatially patterned tissue architecture. Here we dissected the diversity of neural stem cells in the adult zebrafish brain an organ that is characterized by pronounced zonation and high regenerative capacity. We combined single cell transcriptomics of dissected brain regions with massively parallel lineage tracing and in vivo RNA metabolic labeling to analyze regulation of neural stem cells in space and time. We detected a large diversity of neural stem cells with some subtypes being restricted to a single brain region while others were found globally across the brain. Global stem cell states are linked to neurogenic differentiation with different states being involved in proliferative and non proliferative differentiation. Our work reveals principles of adult stem cell organization and establishes a resource for functional manipulation of neural stem cell subtypes. Overall design: Single cell RNA seq of adult zebrafish brain performed using 10x Genomics Gene Expression protocols to explore transcriptomic diversity of adult cell types. The samples were prepared either from whole brain FACS sorted cells GFP positive cells from gfap:GFP line or a dissected single brain region as indicated in the sample title. CRISPR based lineage tracing was performed for a subset of samples to dissect developmental lineage relationships between cells. ScSLAM seq was performed in combination with Notch pathway inhibition to assess response of stem cells to perturbation.		pubmed:38365956		Brain 10 mesencephalon scRNAseq	GSM7875171		source name:adult brain\|tissue:adult brain\|tissue region:mesencephalon\|cell type:mixed tissue dissociation\|genotype:wildtype\|geo loc name:missing\|collection date:missing	Brain 10 mesencephalon scRNAseq	The transcriptome libraries were demultiplexed and mapped with CellRanger 6.1.1. In order to reduce batch effect the gene expression matrices were processed with the SoupX tool Young & Behjati 2020 for removing ambient RNA contamination. A subset of libraries was also mapped with Velocyto v0.17.17 La Manno et al 2018 to create count matrices for unspliced and spliced molecules. The targeted lineage tracing libraries were aligned using bwa mem3 v.0.7.12 to individual references of endogenous genes used in the lineage tracing experiment actb1 actb2 cfl1 cirbpb rpl39 and ube2e1. The scars were filtered with a custom pipeline to eliminate sequences that originate from PCR or sequencing errors. For custom code and further downstream analysis see: https://github.com/nimitic/radial glia. Assembly: GRCz11 Supplementary files format and content: Tab separated barcode files and matrix files along with the tab separated gene file supplementary file are the output of CellRanger mapping further processed by the SoupX package for ambient RNA removal. Supplementary files format and content: Loom files are the output of velocyto mapping distinguishing spliced and unspliced mRNAs. Supplementary files format and content: filtered scars.csv files contain the output of a custom scar filtering pipeline.	adult brain		Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.		tissue:adult brain\|tissue region:mesencephalon\|cell type:mixed tissue dissociation\|genotype:wildtype	GSM7875171	GSM7875171: Brain 10 mesencephalon scRNAseq; Danio rerio; RNA Seq	GSM7875171 r1	GSM7875171	1	Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP469552		loader:fastq load.py	b10_ot_seqrun2_R1.fastq.gz b10_ot_seqrun2_R2.fastq.gz	fastq fastq	1804356800.0	12191600.0	GSM7875171 r2	0:28 1:120	A:547173169;C:367866083;G:382757407;T:506285738;N:274403	28	120			547173169	367866083	382757407	506285738	274403	SRX22323902	SRS19374432	SRA1743007	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	2	0.0107	0.91103	0.00617	0.23408	0.99058	0.79178	0.4579	0.63098	28	120	T	B	sc-like readlen	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	Germany	2023-10-31	Adult	Adult	Brain	Nervous System
28748	28748	SRR26623285	SRX22323901	SRS19374430	SRP469552	PRJNA1034159	Dissecting the spatiotemporal diversity of adult neural stem cells	GSE246714	Other	Adult stem cells are important for tissue turnover and regeneration. However in most adult systems it remains elusive how stem cells assume different functional states and support spatially patterned tissue architecture. Here we dissected the diversity of neural stem cells in the adult zebrafish brain an organ that is characterized by pronounced zonation and high regenerative capacity. We combined single cell transcriptomics of dissected brain regions with massively parallel lineage tracing and in vivo RNA metabolic labeling to analyze regulation of neural stem cells in space and time. We detected a large diversity of neural stem cells with some subtypes being restricted to a single brain region while others were found globally across the brain. Global stem cell states are linked to neurogenic differentiation with different states being involved in proliferative and non proliferative differentiation. Our work reveals principles of adult stem cell organization and establishes a resource for functional manipulation of neural stem cell subtypes. Overall design: Single cell RNA seq of adult zebrafish brain performed using 10x Genomics Gene Expression protocols to explore transcriptomic diversity of adult cell types. The samples were prepared either from whole brain FACS sorted cells GFP positive cells from gfap:GFP line or a dissected single brain region as indicated in the sample title. CRISPR based lineage tracing was performed for a subset of samples to dissect developmental lineage relationships between cells. ScSLAM seq was performed in combination with Notch pathway inhibition to assess response of stem cells to perturbation.		pubmed:38365956		Brain 10 diencephalon scRNAseq	GSM7875170		source name:adult brain\|tissue:adult brain\|tissue region:diencephalon\|cell type:mixed tissue dissociation\|genotype:wildtype\|geo loc name:missing\|collection date:missing	Brain 10 diencephalon scRNAseq	The transcriptome libraries were demultiplexed and mapped with CellRanger 6.1.1. In order to reduce batch effect the gene expression matrices were processed with the SoupX tool Young & Behjati 2020 for removing ambient RNA contamination. A subset of libraries was also mapped with Velocyto v0.17.17 La Manno et al 2018 to create count matrices for unspliced and spliced molecules. The targeted lineage tracing libraries were aligned using bwa mem3 v.0.7.12 to individual references of endogenous genes used in the lineage tracing experiment actb1 actb2 cfl1 cirbpb rpl39 and ube2e1. The scars were filtered with a custom pipeline to eliminate sequences that originate from PCR or sequencing errors. For custom code and further downstream analysis see: https://github.com/nimitic/radial glia. Assembly: GRCz11 Supplementary files format and content: Tab separated barcode files and matrix files along with the tab separated gene file supplementary file are the output of CellRanger mapping further processed by the SoupX package for ambient RNA removal. Supplementary files format and content: Loom files are the output of velocyto mapping distinguishing spliced and unspliced mRNAs. Supplementary files format and content: filtered scars.csv files contain the output of a custom scar filtering pipeline.	adult brain		Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.		tissue:adult brain\|tissue region:diencephalon\|cell type:mixed tissue dissociation\|genotype:wildtype	GSM7875170	GSM7875170: Brain 10 diencephalon scRNAseq; Danio rerio; RNA Seq	GSM7875170 r1	GSM7875170	1	Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP469552		loader:fastq load.py	b10_dien_seqrun1_R1.fastq.gz b10_dien_seqrun1_R2.fastq.gz	fastq fastq	16775453532.0	113347659.0	GSM7875170 r1	0:28 1:120	A:5122230488;C:3380526476;G:3500039522;T:4766209405;N:6447641	28	120			5122230488	3380526476	3500039522	4766209405	6447641	SRX22323901	SRS19374430	SRA1743007	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	2	0.01031	0.90264	0.0062	0.26938	0.99107	0.78283	0.45373	0.61666	28	120	T	B	sc-like readlen	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	Germany	2023-10-31	Adult	Adult	Brain	Nervous System
28749	28749	SRR26623286	SRX22323901	SRS19374430	SRP469552	PRJNA1034159	Dissecting the spatiotemporal diversity of adult neural stem cells	GSE246714	Other	Adult stem cells are important for tissue turnover and regeneration. However in most adult systems it remains elusive how stem cells assume different functional states and support spatially patterned tissue architecture. Here we dissected the diversity of neural stem cells in the adult zebrafish brain an organ that is characterized by pronounced zonation and high regenerative capacity. We combined single cell transcriptomics of dissected brain regions with massively parallel lineage tracing and in vivo RNA metabolic labeling to analyze regulation of neural stem cells in space and time. We detected a large diversity of neural stem cells with some subtypes being restricted to a single brain region while others were found globally across the brain. Global stem cell states are linked to neurogenic differentiation with different states being involved in proliferative and non proliferative differentiation. Our work reveals principles of adult stem cell organization and establishes a resource for functional manipulation of neural stem cell subtypes. Overall design: Single cell RNA seq of adult zebrafish brain performed using 10x Genomics Gene Expression protocols to explore transcriptomic diversity of adult cell types. The samples were prepared either from whole brain FACS sorted cells GFP positive cells from gfap:GFP line or a dissected single brain region as indicated in the sample title. CRISPR based lineage tracing was performed for a subset of samples to dissect developmental lineage relationships between cells. ScSLAM seq was performed in combination with Notch pathway inhibition to assess response of stem cells to perturbation.		pubmed:38365956		Brain 10 diencephalon scRNAseq	GSM7875170		source name:adult brain\|tissue:adult brain\|tissue region:diencephalon\|cell type:mixed tissue dissociation\|genotype:wildtype\|geo loc name:missing\|collection date:missing	Brain 10 diencephalon scRNAseq	The transcriptome libraries were demultiplexed and mapped with CellRanger 6.1.1. In order to reduce batch effect the gene expression matrices were processed with the SoupX tool Young & Behjati 2020 for removing ambient RNA contamination. A subset of libraries was also mapped with Velocyto v0.17.17 La Manno et al 2018 to create count matrices for unspliced and spliced molecules. The targeted lineage tracing libraries were aligned using bwa mem3 v.0.7.12 to individual references of endogenous genes used in the lineage tracing experiment actb1 actb2 cfl1 cirbpb rpl39 and ube2e1. The scars were filtered with a custom pipeline to eliminate sequences that originate from PCR or sequencing errors. For custom code and further downstream analysis see: https://github.com/nimitic/radial glia. Assembly: GRCz11 Supplementary files format and content: Tab separated barcode files and matrix files along with the tab separated gene file supplementary file are the output of CellRanger mapping further processed by the SoupX package for ambient RNA removal. Supplementary files format and content: Loom files are the output of velocyto mapping distinguishing spliced and unspliced mRNAs. Supplementary files format and content: filtered scars.csv files contain the output of a custom scar filtering pipeline.	adult brain		Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.		tissue:adult brain\|tissue region:diencephalon\|cell type:mixed tissue dissociation\|genotype:wildtype	GSM7875170	GSM7875170: Brain 10 diencephalon scRNAseq; Danio rerio; RNA Seq	GSM7875170 r1	GSM7875170	1	Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP469552		loader:fastq load.py	b10_dien_seqrun2_R1.fastq.gz b10_dien_seqrun2_R2.fastq.gz	fastq fastq	2278985844.0	15398553.0	GSM7875170 r2	0:28 1:120	A:693086062;C:458642995;G:479031763;T:647875888;N:349136	28	120			693086062	458642995	479031763	647875888	349136	SRX22323901	SRS19374430	SRA1743007	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	2	0.01062	0.90395	0.0066	0.27264	0.99131	0.78524	0.45789	0.61679	28	120	T	B	sc-like readlen	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	Germany	2023-10-31	Adult	Adult	Brain	Nervous System
28750	28750	SRR26623287	SRX22323900	SRS19374428	SRP469552	PRJNA1034159	Dissecting the spatiotemporal diversity of adult neural stem cells	GSE246714	Other	Adult stem cells are important for tissue turnover and regeneration. However in most adult systems it remains elusive how stem cells assume different functional states and support spatially patterned tissue architecture. Here we dissected the diversity of neural stem cells in the adult zebrafish brain an organ that is characterized by pronounced zonation and high regenerative capacity. We combined single cell transcriptomics of dissected brain regions with massively parallel lineage tracing and in vivo RNA metabolic labeling to analyze regulation of neural stem cells in space and time. We detected a large diversity of neural stem cells with some subtypes being restricted to a single brain region while others were found globally across the brain. Global stem cell states are linked to neurogenic differentiation with different states being involved in proliferative and non proliferative differentiation. Our work reveals principles of adult stem cell organization and establishes a resource for functional manipulation of neural stem cell subtypes. Overall design: Single cell RNA seq of adult zebrafish brain performed using 10x Genomics Gene Expression protocols to explore transcriptomic diversity of adult cell types. The samples were prepared either from whole brain FACS sorted cells GFP positive cells from gfap:GFP line or a dissected single brain region as indicated in the sample title. CRISPR based lineage tracing was performed for a subset of samples to dissect developmental lineage relationships between cells. ScSLAM seq was performed in combination with Notch pathway inhibition to assess response of stem cells to perturbation.		pubmed:38365956		Brain 10 rhombencephalon scRNAseq	GSM7875169		source name:adult brain\|tissue:adult brain\|tissue region:rhombencephalon\|cell type:mixed tissue dissociation\|genotype:wildtype\|geo loc name:missing\|collection date:missing	Brain 10 rhombencephalon scRNAseq	The transcriptome libraries were demultiplexed and mapped with CellRanger 6.1.1. In order to reduce batch effect the gene expression matrices were processed with the SoupX tool Young & Behjati 2020 for removing ambient RNA contamination. A subset of libraries was also mapped with Velocyto v0.17.17 La Manno et al 2018 to create count matrices for unspliced and spliced molecules. The targeted lineage tracing libraries were aligned using bwa mem3 v.0.7.12 to individual references of endogenous genes used in the lineage tracing experiment actb1 actb2 cfl1 cirbpb rpl39 and ube2e1. The scars were filtered with a custom pipeline to eliminate sequences that originate from PCR or sequencing errors. For custom code and further downstream analysis see: https://github.com/nimitic/radial glia. Assembly: GRCz11 Supplementary files format and content: Tab separated barcode files and matrix files along with the tab separated gene file supplementary file are the output of CellRanger mapping further processed by the SoupX package for ambient RNA removal. Supplementary files format and content: Loom files are the output of velocyto mapping distinguishing spliced and unspliced mRNAs. Supplementary files format and content: filtered scars.csv files contain the output of a custom scar filtering pipeline.	adult brain		Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.		tissue:adult brain\|tissue region:rhombencephalon\|cell type:mixed tissue dissociation\|genotype:wildtype	GSM7875169	GSM7875169: Brain 10 rhombencephalon scRNAseq; Danio rerio; RNA Seq	GSM7875169 r1	GSM7875169	1	Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP469552		loader:fastq load.py	b10_cer_seqrun1_R1.fastq.gz b10_cer_seqrun1_R2.fastq.gz	fastq fastq	16240869244.0	109735603.0	GSM7875169 r1	0:28 1:120	A:4994572796;C:3251585988;G:3395902822;T:4592558542;N:6249096	28	120			4994572796	3251585988	3395902822	4592558542	6249096	SRX22323900	SRS19374428	SRA1743007	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	2	0.0128	0.89159	0.00813	0.3597	0.98991	0.82278	0.44977	0.60211	28	120	T	B	sc-like readlen	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	Germany	2023-10-31	Adult	Adult	Brain	Nervous System
28751	28751	SRR26623288	SRX22323900	SRS19374428	SRP469552	PRJNA1034159	Dissecting the spatiotemporal diversity of adult neural stem cells	GSE246714	Other	Adult stem cells are important for tissue turnover and regeneration. However in most adult systems it remains elusive how stem cells assume different functional states and support spatially patterned tissue architecture. Here we dissected the diversity of neural stem cells in the adult zebrafish brain an organ that is characterized by pronounced zonation and high regenerative capacity. We combined single cell transcriptomics of dissected brain regions with massively parallel lineage tracing and in vivo RNA metabolic labeling to analyze regulation of neural stem cells in space and time. We detected a large diversity of neural stem cells with some subtypes being restricted to a single brain region while others were found globally across the brain. Global stem cell states are linked to neurogenic differentiation with different states being involved in proliferative and non proliferative differentiation. Our work reveals principles of adult stem cell organization and establishes a resource for functional manipulation of neural stem cell subtypes. Overall design: Single cell RNA seq of adult zebrafish brain performed using 10x Genomics Gene Expression protocols to explore transcriptomic diversity of adult cell types. The samples were prepared either from whole brain FACS sorted cells GFP positive cells from gfap:GFP line or a dissected single brain region as indicated in the sample title. CRISPR based lineage tracing was performed for a subset of samples to dissect developmental lineage relationships between cells. ScSLAM seq was performed in combination with Notch pathway inhibition to assess response of stem cells to perturbation.		pubmed:38365956		Brain 10 rhombencephalon scRNAseq	GSM7875169		source name:adult brain\|tissue:adult brain\|tissue region:rhombencephalon\|cell type:mixed tissue dissociation\|genotype:wildtype\|geo loc name:missing\|collection date:missing	Brain 10 rhombencephalon scRNAseq	The transcriptome libraries were demultiplexed and mapped with CellRanger 6.1.1. In order to reduce batch effect the gene expression matrices were processed with the SoupX tool Young & Behjati 2020 for removing ambient RNA contamination. A subset of libraries was also mapped with Velocyto v0.17.17 La Manno et al 2018 to create count matrices for unspliced and spliced molecules. The targeted lineage tracing libraries were aligned using bwa mem3 v.0.7.12 to individual references of endogenous genes used in the lineage tracing experiment actb1 actb2 cfl1 cirbpb rpl39 and ube2e1. The scars were filtered with a custom pipeline to eliminate sequences that originate from PCR or sequencing errors. For custom code and further downstream analysis see: https://github.com/nimitic/radial glia. Assembly: GRCz11 Supplementary files format and content: Tab separated barcode files and matrix files along with the tab separated gene file supplementary file are the output of CellRanger mapping further processed by the SoupX package for ambient RNA removal. Supplementary files format and content: Loom files are the output of velocyto mapping distinguishing spliced and unspliced mRNAs. Supplementary files format and content: filtered scars.csv files contain the output of a custom scar filtering pipeline.	adult brain		Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.		tissue:adult brain\|tissue region:rhombencephalon\|cell type:mixed tissue dissociation\|genotype:wildtype	GSM7875169	GSM7875169: Brain 10 rhombencephalon scRNAseq; Danio rerio; RNA Seq	GSM7875169 r1	GSM7875169	1	Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP469552		loader:fastq load.py	b10_cer_seqrun2_R1.fastq.gz b10_cer_seqrun2_R2.fastq.gz	fastq fastq	2208762212.0	14924069.0	GSM7875169 r2	0:28 1:120	A:677215802;C:441481145;G:464737322;T:624989898;N:338045	28	120			677215802	441481145	464737322	624989898	338045	SRX22323900	SRS19374428	SRA1743007	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	2	0.0127	0.89091	0.00771	0.35998	0.9893	0.82432	0.41448	0.59902	28	120	T	B	sc-like readlen	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	Germany	2023-10-31	Adult	Adult	Brain	Nervous System
28752	28752	SRR26623289	SRX22323899	SRS19374429	SRP469552	PRJNA1034159	Dissecting the spatiotemporal diversity of adult neural stem cells	GSE246714	Other	Adult stem cells are important for tissue turnover and regeneration. However in most adult systems it remains elusive how stem cells assume different functional states and support spatially patterned tissue architecture. Here we dissected the diversity of neural stem cells in the adult zebrafish brain an organ that is characterized by pronounced zonation and high regenerative capacity. We combined single cell transcriptomics of dissected brain regions with massively parallel lineage tracing and in vivo RNA metabolic labeling to analyze regulation of neural stem cells in space and time. We detected a large diversity of neural stem cells with some subtypes being restricted to a single brain region while others were found globally across the brain. Global stem cell states are linked to neurogenic differentiation with different states being involved in proliferative and non proliferative differentiation. Our work reveals principles of adult stem cell organization and establishes a resource for functional manipulation of neural stem cell subtypes. Overall design: Single cell RNA seq of adult zebrafish brain performed using 10x Genomics Gene Expression protocols to explore transcriptomic diversity of adult cell types. The samples were prepared either from whole brain FACS sorted cells GFP positive cells from gfap:GFP line or a dissected single brain region as indicated in the sample title. CRISPR based lineage tracing was performed for a subset of samples to dissect developmental lineage relationships between cells. ScSLAM seq was performed in combination with Notch pathway inhibition to assess response of stem cells to perturbation.		pubmed:38365956		Brain 9 telencephalon scRNAseq	GSM7875168		source name:adult brain\|tissue:adult brain\|tissue region:telencephalon\|cell type:mixed tissue dissociation\|genotype:Tg[ubi:zebrabow M]\|geo loc name:missing\|collection date:missing	Brain 9 telencephalon scRNAseq	The transcriptome libraries were demultiplexed and mapped with CellRanger 6.1.1. In order to reduce batch effect the gene expression matrices were processed with the SoupX tool Young & Behjati 2020 for removing ambient RNA contamination. A subset of libraries was also mapped with Velocyto v0.17.17 La Manno et al 2018 to create count matrices for unspliced and spliced molecules. The targeted lineage tracing libraries were aligned using bwa mem3 v.0.7.12 to individual references of endogenous genes used in the lineage tracing experiment actb1 actb2 cfl1 cirbpb rpl39 and ube2e1. The scars were filtered with a custom pipeline to eliminate sequences that originate from PCR or sequencing errors. For custom code and further downstream analysis see: https://github.com/nimitic/radial glia. Assembly: GRCz11 Supplementary files format and content: Tab separated barcode files and matrix files along with the tab separated gene file supplementary file are the output of CellRanger mapping further processed by the SoupX package for ambient RNA removal. Supplementary files format and content: Loom files are the output of velocyto mapping distinguishing spliced and unspliced mRNAs. Supplementary files format and content: filtered scars.csv files contain the output of a custom scar filtering pipeline.	adult brain		Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.		tissue:adult brain\|tissue region:telencephalon\|cell type:mixed tissue dissociation\|genotype:Tg[ubi:zebrabow M]	GSM7875168	GSM7875168: Brain 9 telencephalon scRNAseq; Danio rerio; RNA Seq	GSM7875168 r1	GSM7875168	1	Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 4000	SRP469552		loader:fastq load.py	b9_tel_R1.fastq.gz b9_tel_R2.fastq.gz	fastq fastq	15193441000.0	122527750.0	GSM7875168 r1	0:26 1:98	A:4477414579;C:3090884741;G:3307200604;T:4310709839;N:7231237	26	98			4477414579	3090884741	3307200604	4310709839	7231237	SRX22323899	SRS19374429	SRA1743007	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	2	0.00277	0.88718	0.00117	0.25579	0.99586	0.79657	0.30868	0.52408	26	98	T	B	sc-like readlen	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	Germany	2023-10-31	Adult	Adult	Brain	Nervous System
28753	28753	SRR26623290	SRX22323898	SRS19374427	SRP469552	PRJNA1034159	Dissecting the spatiotemporal diversity of adult neural stem cells	GSE246714	Other	Adult stem cells are important for tissue turnover and regeneration. However in most adult systems it remains elusive how stem cells assume different functional states and support spatially patterned tissue architecture. Here we dissected the diversity of neural stem cells in the adult zebrafish brain an organ that is characterized by pronounced zonation and high regenerative capacity. We combined single cell transcriptomics of dissected brain regions with massively parallel lineage tracing and in vivo RNA metabolic labeling to analyze regulation of neural stem cells in space and time. We detected a large diversity of neural stem cells with some subtypes being restricted to a single brain region while others were found globally across the brain. Global stem cell states are linked to neurogenic differentiation with different states being involved in proliferative and non proliferative differentiation. Our work reveals principles of adult stem cell organization and establishes a resource for functional manipulation of neural stem cell subtypes. Overall design: Single cell RNA seq of adult zebrafish brain performed using 10x Genomics Gene Expression protocols to explore transcriptomic diversity of adult cell types. The samples were prepared either from whole brain FACS sorted cells GFP positive cells from gfap:GFP line or a dissected single brain region as indicated in the sample title. CRISPR based lineage tracing was performed for a subset of samples to dissect developmental lineage relationships between cells. ScSLAM seq was performed in combination with Notch pathway inhibition to assess response of stem cells to perturbation.		pubmed:38365956		Brain 8 whole scRNAseq	GSM7875167		source name:adult brain\|tissue:adult brain\|tissue region:whole\|cell type:mixed tissue dissociation\|genotype:Tg[ubi:zebrabow M]\|geo loc name:missing\|collection date:missing	Brain 8 whole scRNAseq	The transcriptome libraries were demultiplexed and mapped with CellRanger 6.1.1. In order to reduce batch effect the gene expression matrices were processed with the SoupX tool Young & Behjati 2020 for removing ambient RNA contamination. A subset of libraries was also mapped with Velocyto v0.17.17 La Manno et al 2018 to create count matrices for unspliced and spliced molecules. The targeted lineage tracing libraries were aligned using bwa mem3 v.0.7.12 to individual references of endogenous genes used in the lineage tracing experiment actb1 actb2 cfl1 cirbpb rpl39 and ube2e1. The scars were filtered with a custom pipeline to eliminate sequences that originate from PCR or sequencing errors. For custom code and further downstream analysis see: https://github.com/nimitic/radial glia. Assembly: GRCz11 Supplementary files format and content: Tab separated barcode files and matrix files along with the tab separated gene file supplementary file are the output of CellRanger mapping further processed by the SoupX package for ambient RNA removal. Supplementary files format and content: Loom files are the output of velocyto mapping distinguishing spliced and unspliced mRNAs. Supplementary files format and content: filtered scars.csv files contain the output of a custom scar filtering pipeline.	adult brain		Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.		tissue:adult brain\|tissue region:whole\|cell type:mixed tissue dissociation\|genotype:Tg[ubi:zebrabow M]	GSM7875167	GSM7875167: Brain 8 whole scRNAseq; Danio rerio; RNA Seq	GSM7875167 r1	GSM7875167	1	Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP469552		loader:fastq load.py	b8_mult_R1.fastq.gz b8_mult_R2.fastq.gz	fastq fastq	16275377550.0	108502517.0	GSM7875167 r1	0:26 1:124	A:5027003801;C:3172670099;G:3435240300;T:4638692244;N:1771106	26	124			5027003801	3172670099	3435240300	4638692244	1771106	SRX22323898	SRS19374427	SRA1743007	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	2	0.02156	0.88716	0.00827	0.36741	0.97224	0.83228	0.41427	0.52965	26	124	T	B	sc-like readlen	illumina	nextseq	unknown	random_priming	unknown	sc	single_cell_droplet	10x	Germany	2023-10-31	Adult	Adult	Brain	Nervous System
28760	28760	SRR26623297	SRX22323891	SRS19374420	SRP469552	PRJNA1034159	Dissecting the spatiotemporal diversity of adult neural stem cells	GSE246714	Other	Adult stem cells are important for tissue turnover and regeneration. However in most adult systems it remains elusive how stem cells assume different functional states and support spatially patterned tissue architecture. Here we dissected the diversity of neural stem cells in the adult zebrafish brain an organ that is characterized by pronounced zonation and high regenerative capacity. We combined single cell transcriptomics of dissected brain regions with massively parallel lineage tracing and in vivo RNA metabolic labeling to analyze regulation of neural stem cells in space and time. We detected a large diversity of neural stem cells with some subtypes being restricted to a single brain region while others were found globally across the brain. Global stem cell states are linked to neurogenic differentiation with different states being involved in proliferative and non proliferative differentiation. Our work reveals principles of adult stem cell organization and establishes a resource for functional manipulation of neural stem cell subtypes. Overall design: Single cell RNA seq of adult zebrafish brain performed using 10x Genomics Gene Expression protocols to explore transcriptomic diversity of adult cell types. The samples were prepared either from whole brain FACS sorted cells GFP positive cells from gfap:GFP line or a dissected single brain region as indicated in the sample title. CRISPR based lineage tracing was performed for a subset of samples to dissect developmental lineage relationships between cells. ScSLAM seq was performed in combination with Notch pathway inhibition to assess response of stem cells to perturbation.		pubmed:38365956		Brain 7 telencephalon scRNAseq	GSM7875166		source name:adult brain\|tissue:adult brain\|tissue region:telencephalon\|cell type:mixed tissue dissociation\|genotype:Tg[ubi:zebrabow M]\|geo loc name:missing\|collection date:missing	Brain 7 telencephalon scRNAseq	The transcriptome libraries were demultiplexed and mapped with CellRanger 6.1.1. In order to reduce batch effect the gene expression matrices were processed with the SoupX tool Young & Behjati 2020 for removing ambient RNA contamination. A subset of libraries was also mapped with Velocyto v0.17.17 La Manno et al 2018 to create count matrices for unspliced and spliced molecules. The targeted lineage tracing libraries were aligned using bwa mem3 v.0.7.12 to individual references of endogenous genes used in the lineage tracing experiment actb1 actb2 cfl1 cirbpb rpl39 and ube2e1. The scars were filtered with a custom pipeline to eliminate sequences that originate from PCR or sequencing errors. For custom code and further downstream analysis see: https://github.com/nimitic/radial glia. Assembly: GRCz11 Supplementary files format and content: Tab separated barcode files and matrix files along with the tab separated gene file supplementary file are the output of CellRanger mapping further processed by the SoupX package for ambient RNA removal. Supplementary files format and content: Loom files are the output of velocyto mapping distinguishing spliced and unspliced mRNAs. Supplementary files format and content: filtered scars.csv files contain the output of a custom scar filtering pipeline.	adult brain		Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.		tissue:adult brain\|tissue region:telencephalon\|cell type:mixed tissue dissociation\|genotype:Tg[ubi:zebrabow M]	GSM7875166	GSM7875166: Brain 7 telencephalon scRNAseq; Danio rerio; RNA Seq	GSM7875166 r1	GSM7875166	1	Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 4000	SRP469552		loader:fastq load.py	b7_tel_R1.fastq.gz b7_tel_R2.fastq.gz	fastq fastq	7764380900.0	62615975.0	GSM7875166 r1	0:26 1:98	A:2261256925;C:1693767854;G:1688226491;T:2120472828;N:656802	26	98			2261256925	1693767854	1688226491	2120472828	656802	SRX22323891	SRS19374420	SRA1743007	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	2	0.01116	0.89516	0.0091	0.16599	0.99356	0.80499	0.47969	0.71564	26	98	T	B	sc-like readlen	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	Germany	2023-10-31	Adult	Adult	Brain	Nervous System
28761	28761	SRR26623298	SRX22323890	SRS19374418	SRP469552	PRJNA1034159	Dissecting the spatiotemporal diversity of adult neural stem cells	GSE246714	Other	Adult stem cells are important for tissue turnover and regeneration. However in most adult systems it remains elusive how stem cells assume different functional states and support spatially patterned tissue architecture. Here we dissected the diversity of neural stem cells in the adult zebrafish brain an organ that is characterized by pronounced zonation and high regenerative capacity. We combined single cell transcriptomics of dissected brain regions with massively parallel lineage tracing and in vivo RNA metabolic labeling to analyze regulation of neural stem cells in space and time. We detected a large diversity of neural stem cells with some subtypes being restricted to a single brain region while others were found globally across the brain. Global stem cell states are linked to neurogenic differentiation with different states being involved in proliferative and non proliferative differentiation. Our work reveals principles of adult stem cell organization and establishes a resource for functional manipulation of neural stem cell subtypes. Overall design: Single cell RNA seq of adult zebrafish brain performed using 10x Genomics Gene Expression protocols to explore transcriptomic diversity of adult cell types. The samples were prepared either from whole brain FACS sorted cells GFP positive cells from gfap:GFP line or a dissected single brain region as indicated in the sample title. CRISPR based lineage tracing was performed for a subset of samples to dissect developmental lineage relationships between cells. ScSLAM seq was performed in combination with Notch pathway inhibition to assess response of stem cells to perturbation.		pubmed:38365956		Brain 7 diencephalon scRNAseq	GSM7875165		source name:adult brain\|tissue:adult brain\|tissue region:diencephalon\|cell type:mixed tissue dissociation\|genotype:Tg[ubi:zebrabow M]\|geo loc name:missing\|collection date:missing	Brain 7 diencephalon scRNAseq	The transcriptome libraries were demultiplexed and mapped with CellRanger 6.1.1. In order to reduce batch effect the gene expression matrices were processed with the SoupX tool Young & Behjati 2020 for removing ambient RNA contamination. A subset of libraries was also mapped with Velocyto v0.17.17 La Manno et al 2018 to create count matrices for unspliced and spliced molecules. The targeted lineage tracing libraries were aligned using bwa mem3 v.0.7.12 to individual references of endogenous genes used in the lineage tracing experiment actb1 actb2 cfl1 cirbpb rpl39 and ube2e1. The scars were filtered with a custom pipeline to eliminate sequences that originate from PCR or sequencing errors. For custom code and further downstream analysis see: https://github.com/nimitic/radial glia. Assembly: GRCz11 Supplementary files format and content: Tab separated barcode files and matrix files along with the tab separated gene file supplementary file are the output of CellRanger mapping further processed by the SoupX package for ambient RNA removal. Supplementary files format and content: Loom files are the output of velocyto mapping distinguishing spliced and unspliced mRNAs. Supplementary files format and content: filtered scars.csv files contain the output of a custom scar filtering pipeline.	adult brain		Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.		tissue:adult brain\|tissue region:diencephalon\|cell type:mixed tissue dissociation\|genotype:Tg[ubi:zebrabow M]	GSM7875165	GSM7875165: Brain 7 diencephalon scRNAseq; Danio rerio; RNA Seq	GSM7875165 r1	GSM7875165	1	Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 4000	SRP469552		loader:fastq load.py	b7_dien_R1.fastq.gz b7_dien_R2.fastq.gz	fastq fastq	7513293052.0	60591073.0	GSM7875165 r1	0:26 1:98	A:2197597087;C:1625633976;G:1631364985;T:2058064795;N:632209	26	98			2197597087	1625633976	1631364985	2058064795	632209	SRX22323890	SRS19374418	SRA1743007	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	2	0.00898	0.89596	0.00758	0.17001	0.99588	0.81235	0.32967	0.59095	26	98	T	B	sc-like readlen	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	Germany	2023-10-31	Adult	Adult	Brain	Nervous System
28762	28762	SRR26623299	SRX22323889	SRS19374417	SRP469552	PRJNA1034159	Dissecting the spatiotemporal diversity of adult neural stem cells	GSE246714	Other	Adult stem cells are important for tissue turnover and regeneration. However in most adult systems it remains elusive how stem cells assume different functional states and support spatially patterned tissue architecture. Here we dissected the diversity of neural stem cells in the adult zebrafish brain an organ that is characterized by pronounced zonation and high regenerative capacity. We combined single cell transcriptomics of dissected brain regions with massively parallel lineage tracing and in vivo RNA metabolic labeling to analyze regulation of neural stem cells in space and time. We detected a large diversity of neural stem cells with some subtypes being restricted to a single brain region while others were found globally across the brain. Global stem cell states are linked to neurogenic differentiation with different states being involved in proliferative and non proliferative differentiation. Our work reveals principles of adult stem cell organization and establishes a resource for functional manipulation of neural stem cell subtypes. Overall design: Single cell RNA seq of adult zebrafish brain performed using 10x Genomics Gene Expression protocols to explore transcriptomic diversity of adult cell types. The samples were prepared either from whole brain FACS sorted cells GFP positive cells from gfap:GFP line or a dissected single brain region as indicated in the sample title. CRISPR based lineage tracing was performed for a subset of samples to dissect developmental lineage relationships between cells. ScSLAM seq was performed in combination with Notch pathway inhibition to assess response of stem cells to perturbation.		pubmed:38365956		Brain 7 rhombencephalon scRNAseq	GSM7875164		source name:adult brain\|tissue:adult brain\|tissue region:rhombencephalon\|cell type:mixed tissue dissociation\|genotype:Tg[ubi:zebrabow M]\|geo loc name:missing\|collection date:missing	Brain 7 rhombencephalon scRNAseq	The transcriptome libraries were demultiplexed and mapped with CellRanger 6.1.1. In order to reduce batch effect the gene expression matrices were processed with the SoupX tool Young & Behjati 2020 for removing ambient RNA contamination. A subset of libraries was also mapped with Velocyto v0.17.17 La Manno et al 2018 to create count matrices for unspliced and spliced molecules. The targeted lineage tracing libraries were aligned using bwa mem3 v.0.7.12 to individual references of endogenous genes used in the lineage tracing experiment actb1 actb2 cfl1 cirbpb rpl39 and ube2e1. The scars were filtered with a custom pipeline to eliminate sequences that originate from PCR or sequencing errors. For custom code and further downstream analysis see: https://github.com/nimitic/radial glia. Assembly: GRCz11 Supplementary files format and content: Tab separated barcode files and matrix files along with the tab separated gene file supplementary file are the output of CellRanger mapping further processed by the SoupX package for ambient RNA removal. Supplementary files format and content: Loom files are the output of velocyto mapping distinguishing spliced and unspliced mRNAs. Supplementary files format and content: filtered scars.csv files contain the output of a custom scar filtering pipeline.	adult brain		Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.		tissue:adult brain\|tissue region:rhombencephalon\|cell type:mixed tissue dissociation\|genotype:Tg[ubi:zebrabow M]	GSM7875164	GSM7875164: Brain 7 rhombencephalon scRNAseq; Danio rerio; RNA Seq	GSM7875164 r1	GSM7875164	1	Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 4000	SRP469552		loader:fastq load.py	b7_cer_R1.fastq.gz b7_cer_R2.fastq.gz	fastq fastq	4549622496.0	36690504.0	GSM7875164 r1	0:26 1:98	A:1326792866;C:971674770;G:1022429173;T:1227318552;N:1407135	26	98			1326792866	971674770	1022429173	1227318552	1407135	SRX22323889	SRS19374417	SRA1743007	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	2	0.02024	0.89648	0.01794	0.19303	0.99283	0.81542	0.39821	0.6673	26	98	T	B	sc-like readlen	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	Germany	2023-10-31	Adult	Adult	Brain	Nervous System
28763	28763	SRR26623300	SRX22323888	SRS19374416	SRP469552	PRJNA1034159	Dissecting the spatiotemporal diversity of adult neural stem cells	GSE246714	Other	Adult stem cells are important for tissue turnover and regeneration. However in most adult systems it remains elusive how stem cells assume different functional states and support spatially patterned tissue architecture. Here we dissected the diversity of neural stem cells in the adult zebrafish brain an organ that is characterized by pronounced zonation and high regenerative capacity. We combined single cell transcriptomics of dissected brain regions with massively parallel lineage tracing and in vivo RNA metabolic labeling to analyze regulation of neural stem cells in space and time. We detected a large diversity of neural stem cells with some subtypes being restricted to a single brain region while others were found globally across the brain. Global stem cell states are linked to neurogenic differentiation with different states being involved in proliferative and non proliferative differentiation. Our work reveals principles of adult stem cell organization and establishes a resource for functional manipulation of neural stem cell subtypes. Overall design: Single cell RNA seq of adult zebrafish brain performed using 10x Genomics Gene Expression protocols to explore transcriptomic diversity of adult cell types. The samples were prepared either from whole brain FACS sorted cells GFP positive cells from gfap:GFP line or a dissected single brain region as indicated in the sample title. CRISPR based lineage tracing was performed for a subset of samples to dissect developmental lineage relationships between cells. ScSLAM seq was performed in combination with Notch pathway inhibition to assess response of stem cells to perturbation.		pubmed:38365956		Brain 6 telencephalon scRNAseq	GSM7875163		source name:adult brain\|tissue:adult brain\|tissue region:telencephalon\|cell type:mixed tissue dissociation\|genotype:Tg[ubi:zebrabow M]\|geo loc name:missing\|collection date:missing	Brain 6 telencephalon scRNAseq	The transcriptome libraries were demultiplexed and mapped with CellRanger 6.1.1. In order to reduce batch effect the gene expression matrices were processed with the SoupX tool Young & Behjati 2020 for removing ambient RNA contamination. A subset of libraries was also mapped with Velocyto v0.17.17 La Manno et al 2018 to create count matrices for unspliced and spliced molecules. The targeted lineage tracing libraries were aligned using bwa mem3 v.0.7.12 to individual references of endogenous genes used in the lineage tracing experiment actb1 actb2 cfl1 cirbpb rpl39 and ube2e1. The scars were filtered with a custom pipeline to eliminate sequences that originate from PCR or sequencing errors. For custom code and further downstream analysis see: https://github.com/nimitic/radial glia. Assembly: GRCz11 Supplementary files format and content: Tab separated barcode files and matrix files along with the tab separated gene file supplementary file are the output of CellRanger mapping further processed by the SoupX package for ambient RNA removal. Supplementary files format and content: Loom files are the output of velocyto mapping distinguishing spliced and unspliced mRNAs. Supplementary files format and content: filtered scars.csv files contain the output of a custom scar filtering pipeline.	adult brain		Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.		tissue:adult brain\|tissue region:telencephalon\|cell type:mixed tissue dissociation\|genotype:Tg[ubi:zebrabow M]	GSM7875163	GSM7875163: Brain 6 telencephalon scRNAseq; Danio rerio; RNA Seq	GSM7875163 r1	GSM7875163	1	Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 4000	SRP469552		loader:fastq load.py	b6_tel_R2.fastq.gz b6_tel_R1.fastq.gz	fastq fastq	35200219264.0	283872736.0	GSM7875163 r1	0:26 1:98	A:10338159874;C:7412176847;G:7655217994;T:9778922063;N:15742486	26	98			10338159874	7412176847	7655217994	9778922063	15742486	SRX22323888	SRS19374416	SRA1743007	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	2	0.00528	0.8891	0.00408	0.20496	0.99577	0.78567	0.41949	0.62904	26	98	T	B	sc-like readlen	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	Germany	2023-10-31	Adult	Adult	Brain	Nervous System
28764	28764	SRR26623301	SRX22323887	SRS19374415	SRP469552	PRJNA1034159	Dissecting the spatiotemporal diversity of adult neural stem cells	GSE246714	Other	Adult stem cells are important for tissue turnover and regeneration. However in most adult systems it remains elusive how stem cells assume different functional states and support spatially patterned tissue architecture. Here we dissected the diversity of neural stem cells in the adult zebrafish brain an organ that is characterized by pronounced zonation and high regenerative capacity. We combined single cell transcriptomics of dissected brain regions with massively parallel lineage tracing and in vivo RNA metabolic labeling to analyze regulation of neural stem cells in space and time. We detected a large diversity of neural stem cells with some subtypes being restricted to a single brain region while others were found globally across the brain. Global stem cell states are linked to neurogenic differentiation with different states being involved in proliferative and non proliferative differentiation. Our work reveals principles of adult stem cell organization and establishes a resource for functional manipulation of neural stem cell subtypes. Overall design: Single cell RNA seq of adult zebrafish brain performed using 10x Genomics Gene Expression protocols to explore transcriptomic diversity of adult cell types. The samples were prepared either from whole brain FACS sorted cells GFP positive cells from gfap:GFP line or a dissected single brain region as indicated in the sample title. CRISPR based lineage tracing was performed for a subset of samples to dissect developmental lineage relationships between cells. ScSLAM seq was performed in combination with Notch pathway inhibition to assess response of stem cells to perturbation.		pubmed:38365956		Brain 5 telencephalon scRNAseq	GSM7875162		source name:adult brain\|tissue:adult brain\|tissue region:telencephalon\|cell type:mixed tissue dissociation\|genotype:Tg[ubi:zebrabow M]\|geo loc name:missing\|collection date:missing	Brain 5 telencephalon scRNAseq	The transcriptome libraries were demultiplexed and mapped with CellRanger 6.1.1. In order to reduce batch effect the gene expression matrices were processed with the SoupX tool Young & Behjati 2020 for removing ambient RNA contamination. A subset of libraries was also mapped with Velocyto v0.17.17 La Manno et al 2018 to create count matrices for unspliced and spliced molecules. The targeted lineage tracing libraries were aligned using bwa mem3 v.0.7.12 to individual references of endogenous genes used in the lineage tracing experiment actb1 actb2 cfl1 cirbpb rpl39 and ube2e1. The scars were filtered with a custom pipeline to eliminate sequences that originate from PCR or sequencing errors. For custom code and further downstream analysis see: https://github.com/nimitic/radial glia. Assembly: GRCz11 Supplementary files format and content: Tab separated barcode files and matrix files along with the tab separated gene file supplementary file are the output of CellRanger mapping further processed by the SoupX package for ambient RNA removal. Supplementary files format and content: Loom files are the output of velocyto mapping distinguishing spliced and unspliced mRNAs. Supplementary files format and content: filtered scars.csv files contain the output of a custom scar filtering pipeline.	adult brain		Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.		tissue:adult brain\|tissue region:telencephalon\|cell type:mixed tissue dissociation\|genotype:Tg[ubi:zebrabow M]	GSM7875162	GSM7875162: Brain 5 telencephalon scRNAseq; Danio rerio; RNA Seq	GSM7875162 r1	GSM7875162	1	Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP469552		loader:fastq load.py	b5_tel_R1.fastq.gz b5_tel_R2.fastq.gz	fastq fastq	15272326692.0	110669034.0	GSM7875162 r1	0:28 1:110	A:4657813514;C:3027716754;G:3480263590;T:4105516942;N:1015892	28	110			4657813514	3027716754	3480263590	4105516942	1015892	SRX22323887	SRS19374415	SRA1743007	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	2	0.00158	0.89454	0.00083	0.25984	0.99752	0.80413	0.57553	0.62731	28	110	T	B	sc-like readlen	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	Germany	2023-10-31	Adult	Adult	Brain	Nervous System
28765	28765	SRR26623302	SRX22323886	SRS19374419	SRP469552	PRJNA1034159	Dissecting the spatiotemporal diversity of adult neural stem cells	GSE246714	Other	Adult stem cells are important for tissue turnover and regeneration. However in most adult systems it remains elusive how stem cells assume different functional states and support spatially patterned tissue architecture. Here we dissected the diversity of neural stem cells in the adult zebrafish brain an organ that is characterized by pronounced zonation and high regenerative capacity. We combined single cell transcriptomics of dissected brain regions with massively parallel lineage tracing and in vivo RNA metabolic labeling to analyze regulation of neural stem cells in space and time. We detected a large diversity of neural stem cells with some subtypes being restricted to a single brain region while others were found globally across the brain. Global stem cell states are linked to neurogenic differentiation with different states being involved in proliferative and non proliferative differentiation. Our work reveals principles of adult stem cell organization and establishes a resource for functional manipulation of neural stem cell subtypes. Overall design: Single cell RNA seq of adult zebrafish brain performed using 10x Genomics Gene Expression protocols to explore transcriptomic diversity of adult cell types. The samples were prepared either from whole brain FACS sorted cells GFP positive cells from gfap:GFP line or a dissected single brain region as indicated in the sample title. CRISPR based lineage tracing was performed for a subset of samples to dissect developmental lineage relationships between cells. ScSLAM seq was performed in combination with Notch pathway inhibition to assess response of stem cells to perturbation.		pubmed:38365956		Brain 4 telencephalon scRNAseq	GSM7875161		source name:adult brain\|tissue:adult brain\|tissue region:telencephalon\|cell type:mixed tissue dissociation\|genotype:Tg[ubi:zebrabow M]\|geo loc name:missing\|collection date:missing	Brain 4 telencephalon scRNAseq	The transcriptome libraries were demultiplexed and mapped with CellRanger 6.1.1. In order to reduce batch effect the gene expression matrices were processed with the SoupX tool Young & Behjati 2020 for removing ambient RNA contamination. A subset of libraries was also mapped with Velocyto v0.17.17 La Manno et al 2018 to create count matrices for unspliced and spliced molecules. The targeted lineage tracing libraries were aligned using bwa mem3 v.0.7.12 to individual references of endogenous genes used in the lineage tracing experiment actb1 actb2 cfl1 cirbpb rpl39 and ube2e1. The scars were filtered with a custom pipeline to eliminate sequences that originate from PCR or sequencing errors. For custom code and further downstream analysis see: https://github.com/nimitic/radial glia. Assembly: GRCz11 Supplementary files format and content: Tab separated barcode files and matrix files along with the tab separated gene file supplementary file are the output of CellRanger mapping further processed by the SoupX package for ambient RNA removal. Supplementary files format and content: Loom files are the output of velocyto mapping distinguishing spliced and unspliced mRNAs. Supplementary files format and content: filtered scars.csv files contain the output of a custom scar filtering pipeline.	adult brain		Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.		tissue:adult brain\|tissue region:telencephalon\|cell type:mixed tissue dissociation\|genotype:Tg[ubi:zebrabow M]	GSM7875161	GSM7875161: Brain 4 telencephalon scRNAseq; Danio rerio; RNA Seq	GSM7875161 r1	GSM7875161	1	Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina MiniSeq	SRP469552		loader:fastq load.py	b4_tel_R1.fastq.gz b4_tel_R2.fastq.gz	fastq fastq	4538898000.0	36023000.0	GSM7875161 r1	0:26 1:100	A:1403578459;C:926366830;G:979609921;T:1228675807;N:666983	26	100			1403578459	926366830	979609921	1228675807	666983	SRX22323886	SRS19374419	SRA1743007	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	2	0.0031	0.90947	0.0017	0.32332	0.99592	0.82881	0.4664	0.6686	26	100	T	B	sc-like readlen	illumina	miseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	Germany	2023-10-31	Adult	Adult	Brain	Nervous System
28766	28766	SRR26623303	SRX22323885	SRS19374414	SRP469552	PRJNA1034159	Dissecting the spatiotemporal diversity of adult neural stem cells	GSE246714	Other	Adult stem cells are important for tissue turnover and regeneration. However in most adult systems it remains elusive how stem cells assume different functional states and support spatially patterned tissue architecture. Here we dissected the diversity of neural stem cells in the adult zebrafish brain an organ that is characterized by pronounced zonation and high regenerative capacity. We combined single cell transcriptomics of dissected brain regions with massively parallel lineage tracing and in vivo RNA metabolic labeling to analyze regulation of neural stem cells in space and time. We detected a large diversity of neural stem cells with some subtypes being restricted to a single brain region while others were found globally across the brain. Global stem cell states are linked to neurogenic differentiation with different states being involved in proliferative and non proliferative differentiation. Our work reveals principles of adult stem cell organization and establishes a resource for functional manipulation of neural stem cell subtypes. Overall design: Single cell RNA seq of adult zebrafish brain performed using 10x Genomics Gene Expression protocols to explore transcriptomic diversity of adult cell types. The samples were prepared either from whole brain FACS sorted cells GFP positive cells from gfap:GFP line or a dissected single brain region as indicated in the sample title. CRISPR based lineage tracing was performed for a subset of samples to dissect developmental lineage relationships between cells. ScSLAM seq was performed in combination with Notch pathway inhibition to assess response of stem cells to perturbation.		pubmed:38365956		Brain 3 telencephalon scRNAseq	GSM7875160		source name:adult brain\|tissue:adult brain\|tissue region:telencephalon\|cell type:mixed tissue dissociation\|genotype:Tg[ubi:zebrabow M]\|geo loc name:missing\|collection date:missing	Brain 3 telencephalon scRNAseq	The transcriptome libraries were demultiplexed and mapped with CellRanger 6.1.1. In order to reduce batch effect the gene expression matrices were processed with the SoupX tool Young & Behjati 2020 for removing ambient RNA contamination. A subset of libraries was also mapped with Velocyto v0.17.17 La Manno et al 2018 to create count matrices for unspliced and spliced molecules. The targeted lineage tracing libraries were aligned using bwa mem3 v.0.7.12 to individual references of endogenous genes used in the lineage tracing experiment actb1 actb2 cfl1 cirbpb rpl39 and ube2e1. The scars were filtered with a custom pipeline to eliminate sequences that originate from PCR or sequencing errors. For custom code and further downstream analysis see: https://github.com/nimitic/radial glia. Assembly: GRCz11 Supplementary files format and content: Tab separated barcode files and matrix files along with the tab separated gene file supplementary file are the output of CellRanger mapping further processed by the SoupX package for ambient RNA removal. Supplementary files format and content: Loom files are the output of velocyto mapping distinguishing spliced and unspliced mRNAs. Supplementary files format and content: filtered scars.csv files contain the output of a custom scar filtering pipeline.	adult brain		Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.		tissue:adult brain\|tissue region:telencephalon\|cell type:mixed tissue dissociation\|genotype:Tg[ubi:zebrabow M]	GSM7875160	GSM7875160: Brain 3 telencephalon scRNAseq; Danio rerio; RNA Seq	GSM7875160 r1	GSM7875160	1	Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP469552		loader:fastq load.py	b3_tel_R2.fastq.gz b3_tel_R1.fastq.gz	fastq fastq	14555700180.0	173282145.0	GSM7875160 r1	0:26 1:58	A:4218664834;C:3011617868;G:3387306043;T:3936116224;N:1995211	26	58			4218664834	3011617868	3387306043	3936116224	1995211	SRX22323885	SRS19374414	SRA1743007	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	2	0.00416	0.90236	0.00175	0.29743	0.99247	0.79539	0.34888	0.56327	26	58	T	B	sc-like readlen	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	Germany	2023-10-31	Adult	Adult	Brain	Nervous System
28767	28767	SRR26623304	SRX22323884	SRS19374412	SRP469552	PRJNA1034159	Dissecting the spatiotemporal diversity of adult neural stem cells	GSE246714	Other	Adult stem cells are important for tissue turnover and regeneration. However in most adult systems it remains elusive how stem cells assume different functional states and support spatially patterned tissue architecture. Here we dissected the diversity of neural stem cells in the adult zebrafish brain an organ that is characterized by pronounced zonation and high regenerative capacity. We combined single cell transcriptomics of dissected brain regions with massively parallel lineage tracing and in vivo RNA metabolic labeling to analyze regulation of neural stem cells in space and time. We detected a large diversity of neural stem cells with some subtypes being restricted to a single brain region while others were found globally across the brain. Global stem cell states are linked to neurogenic differentiation with different states being involved in proliferative and non proliferative differentiation. Our work reveals principles of adult stem cell organization and establishes a resource for functional manipulation of neural stem cell subtypes. Overall design: Single cell RNA seq of adult zebrafish brain performed using 10x Genomics Gene Expression protocols to explore transcriptomic diversity of adult cell types. The samples were prepared either from whole brain FACS sorted cells GFP positive cells from gfap:GFP line or a dissected single brain region as indicated in the sample title. CRISPR based lineage tracing was performed for a subset of samples to dissect developmental lineage relationships between cells. ScSLAM seq was performed in combination with Notch pathway inhibition to assess response of stem cells to perturbation.		pubmed:38365956		Brain 2 telencephalon scRNAseq	GSM7875159		source name:adult brain\|tissue:adult brain\|tissue region:telencephalon\|cell type:mixed tissue dissociation\|genotype:Tg[ubi:zebrabow M]\|geo loc name:missing\|collection date:missing	Brain 2 telencephalon scRNAseq	The transcriptome libraries were demultiplexed and mapped with CellRanger 6.1.1. In order to reduce batch effect the gene expression matrices were processed with the SoupX tool Young & Behjati 2020 for removing ambient RNA contamination. A subset of libraries was also mapped with Velocyto v0.17.17 La Manno et al 2018 to create count matrices for unspliced and spliced molecules. The targeted lineage tracing libraries were aligned using bwa mem3 v.0.7.12 to individual references of endogenous genes used in the lineage tracing experiment actb1 actb2 cfl1 cirbpb rpl39 and ube2e1. The scars were filtered with a custom pipeline to eliminate sequences that originate from PCR or sequencing errors. For custom code and further downstream analysis see: https://github.com/nimitic/radial glia. Assembly: GRCz11 Supplementary files format and content: Tab separated barcode files and matrix files along with the tab separated gene file supplementary file are the output of CellRanger mapping further processed by the SoupX package for ambient RNA removal. Supplementary files format and content: Loom files are the output of velocyto mapping distinguishing spliced and unspliced mRNAs. Supplementary files format and content: filtered scars.csv files contain the output of a custom scar filtering pipeline.	adult brain		Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.		tissue:adult brain\|tissue region:telencephalon\|cell type:mixed tissue dissociation\|genotype:Tg[ubi:zebrabow M]	GSM7875159	GSM7875159: Brain 2 telencephalon scRNAseq; Danio rerio; RNA Seq	GSM7875159 r1	GSM7875159	1	Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP469552		loader:fastq load.py	b2_tel_I1.fastq.gz b2_tel_R1.fastq.gz b2_tel_R2.fastq.gz	fastq fastq fastq	18703678137.0	144989753.0	GSM7875159 r1	0:14 1:95 2:20	A:4322399040;C:2535898192;G:2691972122;T:4223349713;N:407468	14	95	20		4322399040	2535898192	2691972122	4223349713	407468	SRX22323884	SRS19374412	SRA1743007	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	1	0.91473		0.25102		0.79231		0.54865		95		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	Germany	2023-10-31	Adult	Adult	Brain	Nervous System
28768	28768	SRR26623305	SRX22323883	SRS19374413	SRP469552	PRJNA1034159	Dissecting the spatiotemporal diversity of adult neural stem cells	GSE246714	Other	Adult stem cells are important for tissue turnover and regeneration. However in most adult systems it remains elusive how stem cells assume different functional states and support spatially patterned tissue architecture. Here we dissected the diversity of neural stem cells in the adult zebrafish brain an organ that is characterized by pronounced zonation and high regenerative capacity. We combined single cell transcriptomics of dissected brain regions with massively parallel lineage tracing and in vivo RNA metabolic labeling to analyze regulation of neural stem cells in space and time. We detected a large diversity of neural stem cells with some subtypes being restricted to a single brain region while others were found globally across the brain. Global stem cell states are linked to neurogenic differentiation with different states being involved in proliferative and non proliferative differentiation. Our work reveals principles of adult stem cell organization and establishes a resource for functional manipulation of neural stem cell subtypes. Overall design: Single cell RNA seq of adult zebrafish brain performed using 10x Genomics Gene Expression protocols to explore transcriptomic diversity of adult cell types. The samples were prepared either from whole brain FACS sorted cells GFP positive cells from gfap:GFP line or a dissected single brain region as indicated in the sample title. CRISPR based lineage tracing was performed for a subset of samples to dissect developmental lineage relationships between cells. ScSLAM seq was performed in combination with Notch pathway inhibition to assess response of stem cells to perturbation.		pubmed:38365956		Brain 1 telencephalon scRNAseq	GSM7875158		source name:adult brain\|tissue:adult brain\|tissue region:telencephalon\|cell type:mixed tissue dissociation\|genotype:Tg[ubi:zebrabow M]\|geo loc name:missing\|collection date:missing	Brain 1 telencephalon scRNAseq	The transcriptome libraries were demultiplexed and mapped with CellRanger 6.1.1. In order to reduce batch effect the gene expression matrices were processed with the SoupX tool Young & Behjati 2020 for removing ambient RNA contamination. A subset of libraries was also mapped with Velocyto v0.17.17 La Manno et al 2018 to create count matrices for unspliced and spliced molecules. The targeted lineage tracing libraries were aligned using bwa mem3 v.0.7.12 to individual references of endogenous genes used in the lineage tracing experiment actb1 actb2 cfl1 cirbpb rpl39 and ube2e1. The scars were filtered with a custom pipeline to eliminate sequences that originate from PCR or sequencing errors. For custom code and further downstream analysis see: https://github.com/nimitic/radial glia. Assembly: GRCz11 Supplementary files format and content: Tab separated barcode files and matrix files along with the tab separated gene file supplementary file are the output of CellRanger mapping further processed by the SoupX package for ambient RNA removal. Supplementary files format and content: Loom files are the output of velocyto mapping distinguishing spliced and unspliced mRNAs. Supplementary files format and content: filtered scars.csv files contain the output of a custom scar filtering pipeline.	adult brain		Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.		tissue:adult brain\|tissue region:telencephalon\|cell type:mixed tissue dissociation\|genotype:Tg[ubi:zebrabow M]	GSM7875158	GSM7875158: Brain 1 telencephalon scRNAseq; Danio rerio; RNA Seq	GSM7875158 r1	GSM7875158	1	Adult zebrafish brain tissue was extracted optionally dissected to select a specific region of interest telencephalon diencephalon mesencephalon or rhombencephalon and then dissociated with a trypsin protocol. Briefly the samples were incubated in 750 µl of HBSS glucose solution and dissocated with 15 µl of 0.05% trypsin EDTA Gibco for 30 minutes at 37°C with intermittent mixing. The disociation was stopped by addition of 750 µl of a BSA EBSS HEPES solution. Further sample handling steps were carried out on ice and for centrifugation at 4°C. The sample was filtered through a 100 µm filter washed with cold HBSS and resuspended in 100 200 µl HBSS with 0.05% BSA then filtered through a 35 µm filter and loaded on the 10x Chromium Controller. For the scSLAM seq samples a papain dissociation protocol Worthington kit according to manufecturer's instructions was used followed by an adapted scSLAM seq protocol for labeling nascent transcripts see sample specific entry. The standard transcriptome libraries were constructed according to the manufacturer's protocol 10X Genomics. For targeted libraries of scars used for lineage tracing the cDNA obtained during the 10x protocol was used to set up individual PCR reactions for each target specifically amplifying the sgRNA target site. The libraries for targeted PCR were constructed with primers compatible with the 10X Genomics kit so they could be sequenced on the same platform.	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP469552		loader:fastq load.py	b1_tel_R2.fastq.gz b1_tel_R1.fastq.gz b1_tel_I1.fastq.gz	fastq fastq fastq	21073338957.0	132536723.0	GSM7875158 r1	0:14 1:95 2:50	A:4785729675;C:2770008572;G:5684239548;T:5977128662;N:718378	14	95	50		4785729675	2770008572	5684239548	5977128662	718378	SRX22323883	SRS19374413	SRA1743007	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	Junker Lab, Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine	2	0.90262	0.10312	0.25979	0.09812	0.81182	0.99951	0.5478	0.24137	95	50	B	T	mate2 technical by mapping diff	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	Germany	2023-10-31	Adult	Adult	Brain	Nervous System
30256	30256	SRR27747506	SRX23412819	SRS20268140	SRP486180	PRJNA1069776	Molecular characterization of hindbrain vestibular neurons in the larval zebrafish scRNA Seq	GSE254346	Transcriptome Analysis	The molecular logic that specifies and assembles closely related subtypes of neurons into functional sensorimotor circuits remains unclear. The goal of this study was to characterize the molecular profiles of hindbrain vestibular neurons in the larval zebrafish to identify candidate molecular programs that specify their subtype fate topography and circuit assembly. We used single cell RNA sequencing to generate a comprehensive atlas of hindbrain vestibular neurons and fluorecent in situ hybridization to annotate profiled neurons. Our dataset serves as a reference for evaluating developmental changes in molecular profiles following perturbations and identifies new candidate molecular solutions that assemble closely related subtypes into functional circuits. Overall design: Hindbrain vestibular neurons labeled by Tg 6.7Tru.Hcrtr2:GAL4 VP16;TgUAS:E1b Kaede harvested from zebrafish embryos between 72 hpf 74 hpf. Fluorescent neurons were isolated by fluorescence activated cell sorting FACS according to Kaede fluorescence. Three samples contained all hindbrain vestibular neurons sorted. One sample had two conditions: neurons born before or post a previously identified "midpoint" in hindbrain vestibular neuron development 36 hpf labeled using Kaede photoconversions. Neurons were sequenced with 10x Genomics.				Late born vestibular neurons replicate 2	GSM8038041		tissue:Hindbrain vestibular neurons\|time:72 hpf 74 hpf type:Hindbrain vestibular neurons\|genotype:Tg 6.7Tru.Hcrtr2:GAL4 VP16; TgUAS:E1b Kaede\|treatment:Neurons born post 36 hpf green unconverted Kaede\|geo loc name:missing\|collection date:missing	Late born vestibular neurons replicate 2	Cell Ranger v7.0.0 Assembly: GRCz11 Supplementary files format and content: Tab separated values files and matrix files	Hindbrain vestibular neurons	Three replicates were untreated. One replicate was photoconverted at 36 hpf to isolate early born red converted Kaede from late born green unconverted Kaede neurons.	Harvested neurons were sorted to isolate single cells resuspended in L15+2% FBS and kept on ice until cDNA synthesis Performed using manufacturer's instructions; 10x Genomics three prime V3.1		time:72 hpf 74 hpf type:Hindbrain vestibular neurons\|genotype:Tg 6.7Tru.Hcrtr2:GAL4 VP16; TgUAS:E1b Kaede\|treatment:Neurons born post 36 hpf green unconverted Kaede	GSM8038041	GSM8038041: Late born vestibular neurons replicate 2; Danio rerio; RNA Seq	GSM8038041 r1	GSM8038041	1	Harvested neurons were sorted to isolate single cells resuspended in L15+2% FBS and kept on ice until cDNA synthesis Performed using manufacturer's instructions; 10x Genomics three prime V3.1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP486180		loader:fastq load.py	Green_S19_L001_I1_001.fastq.gz Green_S19_L001_I2_001.fastq.gz Green_S19_L001_R1_001.fastq.gz Green_S19_L001_R2_001.fastq.gz	fastq fastq fastq fastq	4923159660.0	35675070.0	GSM8038041 r1	0:10 1:10 2:28 3:90	A:1637293866;C:391317121;G:716609880;T:465465343;N:70090	10	10	28	90	1637293866	391317121	716609880	465465343	70090	SRX23412819	SRS20268140	SRA1792542	Neuroscience Institute, New York University Grossman School of Medicine	Neuroscience Institute, New York University Grossman School of Medicine												B		usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2024-01-26	Multi-stage	Multi-stage	Brain	Nervous System
30257	30257	SRR27747507	SRX23412819	SRS20268140	SRP486180	PRJNA1069776	Molecular characterization of hindbrain vestibular neurons in the larval zebrafish scRNA Seq	GSE254346	Transcriptome Analysis	The molecular logic that specifies and assembles closely related subtypes of neurons into functional sensorimotor circuits remains unclear. The goal of this study was to characterize the molecular profiles of hindbrain vestibular neurons in the larval zebrafish to identify candidate molecular programs that specify their subtype fate topography and circuit assembly. We used single cell RNA sequencing to generate a comprehensive atlas of hindbrain vestibular neurons and fluorecent in situ hybridization to annotate profiled neurons. Our dataset serves as a reference for evaluating developmental changes in molecular profiles following perturbations and identifies new candidate molecular solutions that assemble closely related subtypes into functional circuits. Overall design: Hindbrain vestibular neurons labeled by Tg 6.7Tru.Hcrtr2:GAL4 VP16;TgUAS:E1b Kaede harvested from zebrafish embryos between 72 hpf 74 hpf. Fluorescent neurons were isolated by fluorescence activated cell sorting FACS according to Kaede fluorescence. Three samples contained all hindbrain vestibular neurons sorted. One sample had two conditions: neurons born before or post a previously identified "midpoint" in hindbrain vestibular neuron development 36 hpf labeled using Kaede photoconversions. Neurons were sequenced with 10x Genomics.				Late born vestibular neurons replicate 2	GSM8038041		tissue:Hindbrain vestibular neurons\|time:72 hpf 74 hpf type:Hindbrain vestibular neurons\|genotype:Tg 6.7Tru.Hcrtr2:GAL4 VP16; TgUAS:E1b Kaede\|treatment:Neurons born post 36 hpf green unconverted Kaede\|geo loc name:missing\|collection date:missing	Late born vestibular neurons replicate 2	Cell Ranger v7.0.0 Assembly: GRCz11 Supplementary files format and content: Tab separated values files and matrix files	Hindbrain vestibular neurons	Three replicates were untreated. One replicate was photoconverted at 36 hpf to isolate early born red converted Kaede from late born green unconverted Kaede neurons.	Harvested neurons were sorted to isolate single cells resuspended in L15+2% FBS and kept on ice until cDNA synthesis Performed using manufacturer's instructions; 10x Genomics three prime V3.1		time:72 hpf 74 hpf type:Hindbrain vestibular neurons\|genotype:Tg 6.7Tru.Hcrtr2:GAL4 VP16; TgUAS:E1b Kaede\|treatment:Neurons born post 36 hpf green unconverted Kaede	GSM8038041	GSM8038041: Late born vestibular neurons replicate 2; Danio rerio; RNA Seq	GSM8038041 r1	GSM8038041	1	Harvested neurons were sorted to isolate single cells resuspended in L15+2% FBS and kept on ice until cDNA synthesis Performed using manufacturer's instructions; 10x Genomics three prime V3.1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP486180		loader:fastq load.py	Green_S19_L002_I1_001.fastq.gz Green_S19_L002_I2_001.fastq.gz Green_S19_L002_R1_001.fastq.gz Green_S19_L002_R2_001.fastq.gz	fastq fastq fastq fastq	4858633206.0	35207487.0	GSM8038041 r2	0:10 1:10 2:28 3:90	A:1614338875;C:386568724;G:706765488;T:460927318;N:73425	10	10	28	90	1614338875	386568724	706765488	460927318	73425	SRX23412819	SRS20268140	SRA1792542	Neuroscience Institute, New York University Grossman School of Medicine	Neuroscience Institute, New York University Grossman School of Medicine												B		usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2024-01-26	Multi-stage	Multi-stage	Brain	Nervous System
30258	30258	SRR27747508	SRX23412819	SRS20268140	SRP486180	PRJNA1069776	Molecular characterization of hindbrain vestibular neurons in the larval zebrafish scRNA Seq	GSE254346	Transcriptome Analysis	The molecular logic that specifies and assembles closely related subtypes of neurons into functional sensorimotor circuits remains unclear. The goal of this study was to characterize the molecular profiles of hindbrain vestibular neurons in the larval zebrafish to identify candidate molecular programs that specify their subtype fate topography and circuit assembly. We used single cell RNA sequencing to generate a comprehensive atlas of hindbrain vestibular neurons and fluorecent in situ hybridization to annotate profiled neurons. Our dataset serves as a reference for evaluating developmental changes in molecular profiles following perturbations and identifies new candidate molecular solutions that assemble closely related subtypes into functional circuits. Overall design: Hindbrain vestibular neurons labeled by Tg 6.7Tru.Hcrtr2:GAL4 VP16;TgUAS:E1b Kaede harvested from zebrafish embryos between 72 hpf 74 hpf. Fluorescent neurons were isolated by fluorescence activated cell sorting FACS according to Kaede fluorescence. Three samples contained all hindbrain vestibular neurons sorted. One sample had two conditions: neurons born before or post a previously identified "midpoint" in hindbrain vestibular neuron development 36 hpf labeled using Kaede photoconversions. Neurons were sequenced with 10x Genomics.				Late born vestibular neurons replicate 2	GSM8038041		tissue:Hindbrain vestibular neurons\|time:72 hpf 74 hpf type:Hindbrain vestibular neurons\|genotype:Tg 6.7Tru.Hcrtr2:GAL4 VP16; TgUAS:E1b Kaede\|treatment:Neurons born post 36 hpf green unconverted Kaede\|geo loc name:missing\|collection date:missing	Late born vestibular neurons replicate 2	Cell Ranger v7.0.0 Assembly: GRCz11 Supplementary files format and content: Tab separated values files and matrix files	Hindbrain vestibular neurons	Three replicates were untreated. One replicate was photoconverted at 36 hpf to isolate early born red converted Kaede from late born green unconverted Kaede neurons.	Harvested neurons were sorted to isolate single cells resuspended in L15+2% FBS and kept on ice until cDNA synthesis Performed using manufacturer's instructions; 10x Genomics three prime V3.1		time:72 hpf 74 hpf type:Hindbrain vestibular neurons\|genotype:Tg 6.7Tru.Hcrtr2:GAL4 VP16; TgUAS:E1b Kaede\|treatment:Neurons born post 36 hpf green unconverted Kaede	GSM8038041	GSM8038041: Late born vestibular neurons replicate 2; Danio rerio; RNA Seq	GSM8038041 r1	GSM8038041	1	Harvested neurons were sorted to isolate single cells resuspended in L15+2% FBS and kept on ice until cDNA synthesis Performed using manufacturer's instructions; 10x Genomics three prime V3.1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP486180		loader:fastq load.py	Green_S19_L003_I1_001.fastq.gz Green_S19_L003_I2_001.fastq.gz Green_S19_L003_R1_001.fastq.gz Green_S19_L003_R2_001.fastq.gz	fastq fastq fastq fastq	4458723696.0	32309592.0	GSM8038041 r3	0:10 1:10 2:28 3:90	A:1463412697;C:359363166;G:655814899;T:429192204;N:80314	10	10	28	90	1463412697	359363166	655814899	429192204	80314	SRX23412819	SRS20268140	SRA1792542	Neuroscience Institute, New York University Grossman School of Medicine	Neuroscience Institute, New York University Grossman School of Medicine												B		usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2024-01-26	Multi-stage	Multi-stage	Brain	Nervous System
30259	30259	SRR27747509	SRX23412819	SRS20268140	SRP486180	PRJNA1069776	Molecular characterization of hindbrain vestibular neurons in the larval zebrafish scRNA Seq	GSE254346	Transcriptome Analysis	The molecular logic that specifies and assembles closely related subtypes of neurons into functional sensorimotor circuits remains unclear. The goal of this study was to characterize the molecular profiles of hindbrain vestibular neurons in the larval zebrafish to identify candidate molecular programs that specify their subtype fate topography and circuit assembly. We used single cell RNA sequencing to generate a comprehensive atlas of hindbrain vestibular neurons and fluorecent in situ hybridization to annotate profiled neurons. Our dataset serves as a reference for evaluating developmental changes in molecular profiles following perturbations and identifies new candidate molecular solutions that assemble closely related subtypes into functional circuits. Overall design: Hindbrain vestibular neurons labeled by Tg 6.7Tru.Hcrtr2:GAL4 VP16;TgUAS:E1b Kaede harvested from zebrafish embryos between 72 hpf 74 hpf. Fluorescent neurons were isolated by fluorescence activated cell sorting FACS according to Kaede fluorescence. Three samples contained all hindbrain vestibular neurons sorted. One sample had two conditions: neurons born before or post a previously identified "midpoint" in hindbrain vestibular neuron development 36 hpf labeled using Kaede photoconversions. Neurons were sequenced with 10x Genomics.				Late born vestibular neurons replicate 2	GSM8038041		tissue:Hindbrain vestibular neurons\|time:72 hpf 74 hpf type:Hindbrain vestibular neurons\|genotype:Tg 6.7Tru.Hcrtr2:GAL4 VP16; TgUAS:E1b Kaede\|treatment:Neurons born post 36 hpf green unconverted Kaede\|geo loc name:missing\|collection date:missing	Late born vestibular neurons replicate 2	Cell Ranger v7.0.0 Assembly: GRCz11 Supplementary files format and content: Tab separated values files and matrix files	Hindbrain vestibular neurons	Three replicates were untreated. One replicate was photoconverted at 36 hpf to isolate early born red converted Kaede from late born green unconverted Kaede neurons.	Harvested neurons were sorted to isolate single cells resuspended in L15+2% FBS and kept on ice until cDNA synthesis Performed using manufacturer's instructions; 10x Genomics three prime V3.1		time:72 hpf 74 hpf type:Hindbrain vestibular neurons\|genotype:Tg 6.7Tru.Hcrtr2:GAL4 VP16; TgUAS:E1b Kaede\|treatment:Neurons born post 36 hpf green unconverted Kaede	GSM8038041	GSM8038041: Late born vestibular neurons replicate 2; Danio rerio; RNA Seq	GSM8038041 r1	GSM8038041	1	Harvested neurons were sorted to isolate single cells resuspended in L15+2% FBS and kept on ice until cDNA synthesis Performed using manufacturer's instructions; 10x Genomics three prime V3.1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP486180		loader:fastq load.py	Green_S19_L004_I1_001.fastq.gz Green_S19_L004_I2_001.fastq.gz Green_S19_L004_R1_001.fastq.gz Green_S19_L004_R2_001.fastq.gz	fastq fastq fastq fastq	4425208602.0	32066729.0	GSM8038041 r4	0:10 1:10 2:28 3:90	A:1452148554;C:355763806;G:651302168;T:426718847;N:72235	10	10	28	90	1452148554	355763806	651302168	426718847	72235	SRX23412819	SRS20268140	SRA1792542	Neuroscience Institute, New York University Grossman School of Medicine	Neuroscience Institute, New York University Grossman School of Medicine												B		usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2024-01-26	Multi-stage	Multi-stage	Brain	Nervous System
30260	30260	SRR27747510	SRX23412818	SRS20268139	SRP486180	PRJNA1069776	Molecular characterization of hindbrain vestibular neurons in the larval zebrafish scRNA Seq	GSE254346	Transcriptome Analysis	The molecular logic that specifies and assembles closely related subtypes of neurons into functional sensorimotor circuits remains unclear. The goal of this study was to characterize the molecular profiles of hindbrain vestibular neurons in the larval zebrafish to identify candidate molecular programs that specify their subtype fate topography and circuit assembly. We used single cell RNA sequencing to generate a comprehensive atlas of hindbrain vestibular neurons and fluorecent in situ hybridization to annotate profiled neurons. Our dataset serves as a reference for evaluating developmental changes in molecular profiles following perturbations and identifies new candidate molecular solutions that assemble closely related subtypes into functional circuits. Overall design: Hindbrain vestibular neurons labeled by Tg 6.7Tru.Hcrtr2:GAL4 VP16;TgUAS:E1b Kaede harvested from zebrafish embryos between 72 hpf 74 hpf. Fluorescent neurons were isolated by fluorescence activated cell sorting FACS according to Kaede fluorescence. Three samples contained all hindbrain vestibular neurons sorted. One sample had two conditions: neurons born before or post a previously identified "midpoint" in hindbrain vestibular neuron development 36 hpf labeled using Kaede photoconversions. Neurons were sequenced with 10x Genomics.				Early born vestibular neurons replicate 1	GSM8038040		tissue:Hindbrain vestibular neurons\|time:72 hpf 74 hpf type:Hindbrain vestibular neurons\|genotype:Tg 6.7Tru.Hcrtr2:GAL4 VP16; TgUAS:E1b Kaede\|treatment:Neurons born before 36 hpf red photoconverted Kaede\|geo loc name:missing\|collection date:missing	Early born vestibular neurons replicate 1	Cell Ranger v7.0.0 Assembly: GRCz11 Supplementary files format and content: Tab separated values files and matrix files	Hindbrain vestibular neurons	Three replicates were untreated. One replicate was photoconverted at 36 hpf to isolate early born red converted Kaede from late born green unconverted Kaede neurons.	Harvested neurons were sorted to isolate single cells resuspended in L15+2% FBS and kept on ice until cDNA synthesis Performed using manufacturer's instructions; 10x Genomics three prime V3.1		time:72 hpf 74 hpf type:Hindbrain vestibular neurons\|genotype:Tg 6.7Tru.Hcrtr2:GAL4 VP16; TgUAS:E1b Kaede\|treatment:Neurons born before 36 hpf red photoconverted Kaede	GSM8038040	GSM8038040: Early born vestibular neurons replicate 1; Danio rerio; RNA Seq	GSM8038040 r1	GSM8038040	1	Harvested neurons were sorted to isolate single cells resuspended in L15+2% FBS and kept on ice until cDNA synthesis Performed using manufacturer's instructions; 10x Genomics three prime V3.1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP486180		loader:fastq load.py	Red_S20_L001_I1_001.fastq.gz Red_S20_L001_I2_001.fastq.gz Red_S20_L001_R1_001.fastq.gz Red_S20_L001_R2_001.fastq.gz	fastq fastq fastq fastq	5032560816.0	36467832.0	GSM8038040 r1	0:10 1:10 2:28 3:90	A:1626033872;C:414606578;G:755475703;T:485911557;N:77170	10	10	28	90	1626033872	414606578	755475703	485911557	77170	SRX23412818	SRS20268139	SRA1792542	Neuroscience Institute, New York University Grossman School of Medicine	Neuroscience Institute, New York University Grossman School of Medicine												B		usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2024-01-26	Multi-stage	Multi-stage	Brain	Nervous System
30261	30261	SRR27747511	SRX23412818	SRS20268139	SRP486180	PRJNA1069776	Molecular characterization of hindbrain vestibular neurons in the larval zebrafish scRNA Seq	GSE254346	Transcriptome Analysis	The molecular logic that specifies and assembles closely related subtypes of neurons into functional sensorimotor circuits remains unclear. The goal of this study was to characterize the molecular profiles of hindbrain vestibular neurons in the larval zebrafish to identify candidate molecular programs that specify their subtype fate topography and circuit assembly. We used single cell RNA sequencing to generate a comprehensive atlas of hindbrain vestibular neurons and fluorecent in situ hybridization to annotate profiled neurons. Our dataset serves as a reference for evaluating developmental changes in molecular profiles following perturbations and identifies new candidate molecular solutions that assemble closely related subtypes into functional circuits. Overall design: Hindbrain vestibular neurons labeled by Tg 6.7Tru.Hcrtr2:GAL4 VP16;TgUAS:E1b Kaede harvested from zebrafish embryos between 72 hpf 74 hpf. Fluorescent neurons were isolated by fluorescence activated cell sorting FACS according to Kaede fluorescence. Three samples contained all hindbrain vestibular neurons sorted. One sample had two conditions: neurons born before or post a previously identified "midpoint" in hindbrain vestibular neuron development 36 hpf labeled using Kaede photoconversions. Neurons were sequenced with 10x Genomics.				Early born vestibular neurons replicate 1	GSM8038040		tissue:Hindbrain vestibular neurons\|time:72 hpf 74 hpf type:Hindbrain vestibular neurons\|genotype:Tg 6.7Tru.Hcrtr2:GAL4 VP16; TgUAS:E1b Kaede\|treatment:Neurons born before 36 hpf red photoconverted Kaede\|geo loc name:missing\|collection date:missing	Early born vestibular neurons replicate 1	Cell Ranger v7.0.0 Assembly: GRCz11 Supplementary files format and content: Tab separated values files and matrix files	Hindbrain vestibular neurons	Three replicates were untreated. One replicate was photoconverted at 36 hpf to isolate early born red converted Kaede from late born green unconverted Kaede neurons.	Harvested neurons were sorted to isolate single cells resuspended in L15+2% FBS and kept on ice until cDNA synthesis Performed using manufacturer's instructions; 10x Genomics three prime V3.1		time:72 hpf 74 hpf type:Hindbrain vestibular neurons\|genotype:Tg 6.7Tru.Hcrtr2:GAL4 VP16; TgUAS:E1b Kaede\|treatment:Neurons born before 36 hpf red photoconverted Kaede	GSM8038040	GSM8038040: Early born vestibular neurons replicate 1; Danio rerio; RNA Seq	GSM8038040 r1	GSM8038040	1	Harvested neurons were sorted to isolate single cells resuspended in L15+2% FBS and kept on ice until cDNA synthesis Performed using manufacturer's instructions; 10x Genomics three prime V3.1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP486180		loader:fastq load.py	Red_S20_L002_I1_001.fastq.gz Red_S20_L002_I2_001.fastq.gz Red_S20_L002_R1_001.fastq.gz Red_S20_L002_R2_001.fastq.gz	fastq fastq fastq fastq	4998616680.0	36221860.0	GSM8038040 r2	0:10 1:10 2:28 3:90	A:1613203224;C:412246760;G:750087642;T:484348061;N:81713	10	10	28	90	1613203224	412246760	750087642	484348061	81713	SRX23412818	SRS20268139	SRA1792542	Neuroscience Institute, New York University Grossman School of Medicine	Neuroscience Institute, New York University Grossman School of Medicine												B		usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2024-01-26	Multi-stage	Multi-stage	Brain	Nervous System
30262	30262	SRR27747512	SRX23412818	SRS20268139	SRP486180	PRJNA1069776	Molecular characterization of hindbrain vestibular neurons in the larval zebrafish scRNA Seq	GSE254346	Transcriptome Analysis	The molecular logic that specifies and assembles closely related subtypes of neurons into functional sensorimotor circuits remains unclear. The goal of this study was to characterize the molecular profiles of hindbrain vestibular neurons in the larval zebrafish to identify candidate molecular programs that specify their subtype fate topography and circuit assembly. We used single cell RNA sequencing to generate a comprehensive atlas of hindbrain vestibular neurons and fluorecent in situ hybridization to annotate profiled neurons. Our dataset serves as a reference for evaluating developmental changes in molecular profiles following perturbations and identifies new candidate molecular solutions that assemble closely related subtypes into functional circuits. Overall design: Hindbrain vestibular neurons labeled by Tg 6.7Tru.Hcrtr2:GAL4 VP16;TgUAS:E1b Kaede harvested from zebrafish embryos between 72 hpf 74 hpf. Fluorescent neurons were isolated by fluorescence activated cell sorting FACS according to Kaede fluorescence. Three samples contained all hindbrain vestibular neurons sorted. One sample had two conditions: neurons born before or post a previously identified "midpoint" in hindbrain vestibular neuron development 36 hpf labeled using Kaede photoconversions. Neurons were sequenced with 10x Genomics.				Early born vestibular neurons replicate 1	GSM8038040		tissue:Hindbrain vestibular neurons\|time:72 hpf 74 hpf type:Hindbrain vestibular neurons\|genotype:Tg 6.7Tru.Hcrtr2:GAL4 VP16; TgUAS:E1b Kaede\|treatment:Neurons born before 36 hpf red photoconverted Kaede\|geo loc name:missing\|collection date:missing	Early born vestibular neurons replicate 1	Cell Ranger v7.0.0 Assembly: GRCz11 Supplementary files format and content: Tab separated values files and matrix files	Hindbrain vestibular neurons	Three replicates were untreated. One replicate was photoconverted at 36 hpf to isolate early born red converted Kaede from late born green unconverted Kaede neurons.	Harvested neurons were sorted to isolate single cells resuspended in L15+2% FBS and kept on ice until cDNA synthesis Performed using manufacturer's instructions; 10x Genomics three prime V3.1		time:72 hpf 74 hpf type:Hindbrain vestibular neurons\|genotype:Tg 6.7Tru.Hcrtr2:GAL4 VP16; TgUAS:E1b Kaede\|treatment:Neurons born before 36 hpf red photoconverted Kaede	GSM8038040	GSM8038040: Early born vestibular neurons replicate 1; Danio rerio; RNA Seq	GSM8038040 r1	GSM8038040	1	Harvested neurons were sorted to isolate single cells resuspended in L15+2% FBS and kept on ice until cDNA synthesis Performed using manufacturer's instructions; 10x Genomics three prime V3.1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP486180		loader:fastq load.py	Red_S20_L003_I1_001.fastq.gz Red_S20_L003_I2_001.fastq.gz Red_S20_L003_R1_001.fastq.gz Red_S20_L003_R2_001.fastq.gz	fastq fastq fastq fastq	4628879490.0	33542605.0	GSM8038040 r3	0:10 1:10 2:28 3:90	A:1475662550;C:386397974;G:701772418;T:454914612;N:86896	10	10	28	90	1475662550	386397974	701772418	454914612	86896	SRX23412818	SRS20268139	SRA1792542	Neuroscience Institute, New York University Grossman School of Medicine	Neuroscience Institute, New York University Grossman School of Medicine												B		usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2024-01-26	Multi-stage	Multi-stage	Brain	Nervous System
30263	30263	SRR27747513	SRX23412818	SRS20268139	SRP486180	PRJNA1069776	Molecular characterization of hindbrain vestibular neurons in the larval zebrafish scRNA Seq	GSE254346	Transcriptome Analysis	The molecular logic that specifies and assembles closely related subtypes of neurons into functional sensorimotor circuits remains unclear. The goal of this study was to characterize the molecular profiles of hindbrain vestibular neurons in the larval zebrafish to identify candidate molecular programs that specify their subtype fate topography and circuit assembly. We used single cell RNA sequencing to generate a comprehensive atlas of hindbrain vestibular neurons and fluorecent in situ hybridization to annotate profiled neurons. Our dataset serves as a reference for evaluating developmental changes in molecular profiles following perturbations and identifies new candidate molecular solutions that assemble closely related subtypes into functional circuits. Overall design: Hindbrain vestibular neurons labeled by Tg 6.7Tru.Hcrtr2:GAL4 VP16;TgUAS:E1b Kaede harvested from zebrafish embryos between 72 hpf 74 hpf. Fluorescent neurons were isolated by fluorescence activated cell sorting FACS according to Kaede fluorescence. Three samples contained all hindbrain vestibular neurons sorted. One sample had two conditions: neurons born before or post a previously identified "midpoint" in hindbrain vestibular neuron development 36 hpf labeled using Kaede photoconversions. Neurons were sequenced with 10x Genomics.				Early born vestibular neurons replicate 1	GSM8038040		tissue:Hindbrain vestibular neurons\|time:72 hpf 74 hpf type:Hindbrain vestibular neurons\|genotype:Tg 6.7Tru.Hcrtr2:GAL4 VP16; TgUAS:E1b Kaede\|treatment:Neurons born before 36 hpf red photoconverted Kaede\|geo loc name:missing\|collection date:missing	Early born vestibular neurons replicate 1	Cell Ranger v7.0.0 Assembly: GRCz11 Supplementary files format and content: Tab separated values files and matrix files	Hindbrain vestibular neurons	Three replicates were untreated. One replicate was photoconverted at 36 hpf to isolate early born red converted Kaede from late born green unconverted Kaede neurons.	Harvested neurons were sorted to isolate single cells resuspended in L15+2% FBS and kept on ice until cDNA synthesis Performed using manufacturer's instructions; 10x Genomics three prime V3.1		time:72 hpf 74 hpf type:Hindbrain vestibular neurons\|genotype:Tg 6.7Tru.Hcrtr2:GAL4 VP16; TgUAS:E1b Kaede\|treatment:Neurons born before 36 hpf red photoconverted Kaede	GSM8038040	GSM8038040: Early born vestibular neurons replicate 1; Danio rerio; RNA Seq	GSM8038040 r1	GSM8038040	1	Harvested neurons were sorted to isolate single cells resuspended in L15+2% FBS and kept on ice until cDNA synthesis Performed using manufacturer's instructions; 10x Genomics three prime V3.1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP486180		loader:fastq load.py	Red_S20_L004_I1_001.fastq.gz Red_S20_L004_I2_001.fastq.gz Red_S20_L004_R1_001.fastq.gz Red_S20_L004_R2_001.fastq.gz	fastq fastq fastq fastq	4582808190.0	33208755.0	GSM8038040 r4	0:10 1:10 2:28 3:90	A:1460627048;C:381772307;G:695044521;T:451264941;N:79133	10	10	28	90	1460627048	381772307	695044521	451264941	79133	SRX23412818	SRS20268139	SRA1792542	Neuroscience Institute, New York University Grossman School of Medicine	Neuroscience Institute, New York University Grossman School of Medicine												B		usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2024-01-26	Multi-stage	Multi-stage	Brain	Nervous System
30264	30264	SRR27747514	SRX23412817	SRS20268138	SRP486180	PRJNA1069776	Molecular characterization of hindbrain vestibular neurons in the larval zebrafish scRNA Seq	GSE254346	Transcriptome Analysis	The molecular logic that specifies and assembles closely related subtypes of neurons into functional sensorimotor circuits remains unclear. The goal of this study was to characterize the molecular profiles of hindbrain vestibular neurons in the larval zebrafish to identify candidate molecular programs that specify their subtype fate topography and circuit assembly. We used single cell RNA sequencing to generate a comprehensive atlas of hindbrain vestibular neurons and fluorecent in situ hybridization to annotate profiled neurons. Our dataset serves as a reference for evaluating developmental changes in molecular profiles following perturbations and identifies new candidate molecular solutions that assemble closely related subtypes into functional circuits. Overall design: Hindbrain vestibular neurons labeled by Tg 6.7Tru.Hcrtr2:GAL4 VP16;TgUAS:E1b Kaede harvested from zebrafish embryos between 72 hpf 74 hpf. Fluorescent neurons were isolated by fluorescence activated cell sorting FACS according to Kaede fluorescence. Three samples contained all hindbrain vestibular neurons sorted. One sample had two conditions: neurons born before or post a previously identified "midpoint" in hindbrain vestibular neuron development 36 hpf labeled using Kaede photoconversions. Neurons were sequenced with 10x Genomics.				All vestibular neurons replicate 3	GSM8038039		tissue:Hindbrain vestibular neurons\|time:72 hpf 74 hpf type:Hindbrain vestibular neurons\|genotype:Tg 6.7Tru.Hcrtr2:GAL4 VP16; TgUAS:E1b Kaede\|treatment:n/a\|geo loc name:missing\|collection date:missing	All vestibular neurons replicate 3	Cell Ranger v7.0.0 Assembly: GRCz11 Supplementary files format and content: Tab separated values files and matrix files	Hindbrain vestibular neurons	Three replicates were untreated. One replicate was photoconverted at 36 hpf to isolate early born red converted Kaede from late born green unconverted Kaede neurons.	Harvested neurons were sorted to isolate single cells resuspended in L15+2% FBS and kept on ice until cDNA synthesis Performed using manufacturer's instructions; 10x Genomics three prime V3.1		time:72 hpf 74 hpf type:Hindbrain vestibular neurons\|genotype:Tg 6.7Tru.Hcrtr2:GAL4 VP16; TgUAS:E1b Kaede\|treatment:n/a	GSM8038039	GSM8038039: All vestibular neurons replicate 3; Danio rerio; RNA Seq	GSM8038039 r1	GSM8038039	1	Harvested neurons were sorted to isolate single cells resuspended in L15+2% FBS and kept on ice until cDNA synthesis Performed using manufacturer's instructions; 10x Genomics three prime V3.1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP486180		loader:fastq load.py	Zebrafish-Replicate3_S3_L001_I1_001.fastq.gz Zebrafish-Replicate3_S3_L001_I2_001.fastq.gz Zebrafish-Replicate3_S3_L001_R1_001.fastq.gz Zebrafish-Replicate3_S3_L001_R2_001.fastq.gz	fastq fastq fastq fastq	10560652880.0	75975920.0	GSM8038039 r1	0:10 1:10 2:28 3:91	A:2623816838;C:1175510072;G:1638990770;T:1474946754;N:544286	10	10	28	91	2623816838	1175510072	1638990770	1474946754	544286	SRX23412817	SRS20268138	SRA1792542	Neuroscience Institute, New York University Grossman School of Medicine	Neuroscience Institute, New York University Grossman School of Medicine												B		usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2024-01-26	Multi-stage	Multi-stage	Brain	Nervous System
30265	30265	SRR27747515	SRX23412817	SRS20268138	SRP486180	PRJNA1069776	Molecular characterization of hindbrain vestibular neurons in the larval zebrafish scRNA Seq	GSE254346	Transcriptome Analysis	The molecular logic that specifies and assembles closely related subtypes of neurons into functional sensorimotor circuits remains unclear. The goal of this study was to characterize the molecular profiles of hindbrain vestibular neurons in the larval zebrafish to identify candidate molecular programs that specify their subtype fate topography and circuit assembly. We used single cell RNA sequencing to generate a comprehensive atlas of hindbrain vestibular neurons and fluorecent in situ hybridization to annotate profiled neurons. Our dataset serves as a reference for evaluating developmental changes in molecular profiles following perturbations and identifies new candidate molecular solutions that assemble closely related subtypes into functional circuits. Overall design: Hindbrain vestibular neurons labeled by Tg 6.7Tru.Hcrtr2:GAL4 VP16;TgUAS:E1b Kaede harvested from zebrafish embryos between 72 hpf 74 hpf. Fluorescent neurons were isolated by fluorescence activated cell sorting FACS according to Kaede fluorescence. Three samples contained all hindbrain vestibular neurons sorted. One sample had two conditions: neurons born before or post a previously identified "midpoint" in hindbrain vestibular neuron development 36 hpf labeled using Kaede photoconversions. Neurons were sequenced with 10x Genomics.				All vestibular neurons replicate 3	GSM8038039		tissue:Hindbrain vestibular neurons\|time:72 hpf 74 hpf type:Hindbrain vestibular neurons\|genotype:Tg 6.7Tru.Hcrtr2:GAL4 VP16; TgUAS:E1b Kaede\|treatment:n/a\|geo loc name:missing\|collection date:missing	All vestibular neurons replicate 3	Cell Ranger v7.0.0 Assembly: GRCz11 Supplementary files format and content: Tab separated values files and matrix files	Hindbrain vestibular neurons	Three replicates were untreated. One replicate was photoconverted at 36 hpf to isolate early born red converted Kaede from late born green unconverted Kaede neurons.	Harvested neurons were sorted to isolate single cells resuspended in L15+2% FBS and kept on ice until cDNA synthesis Performed using manufacturer's instructions; 10x Genomics three prime V3.1		time:72 hpf 74 hpf type:Hindbrain vestibular neurons\|genotype:Tg 6.7Tru.Hcrtr2:GAL4 VP16; TgUAS:E1b Kaede\|treatment:n/a	GSM8038039	GSM8038039: All vestibular neurons replicate 3; Danio rerio; RNA Seq	GSM8038039 r1	GSM8038039	1	Harvested neurons were sorted to isolate single cells resuspended in L15+2% FBS and kept on ice until cDNA synthesis Performed using manufacturer's instructions; 10x Genomics three prime V3.1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP486180		loader:fastq load.py	Zebrafish-Replicate3_S3_L002_I1_001.fastq.gz Zebrafish-Replicate3_S3_L002_I2_001.fastq.gz Zebrafish-Replicate3_S3_L002_R1_001.fastq.gz Zebrafish-Replicate3_S3_L002_R2_001.fastq.gz	fastq fastq fastq fastq	10571317933.0	76052647.0	GSM8038039 r2	0:10 1:10 2:28 3:91	A:2631345994;C:1175630391;G:1641110007;T:1472183634;N:520851	10	10	28	91	2631345994	1175630391	1641110007	1472183634	520851	SRX23412817	SRS20268138	SRA1792542	Neuroscience Institute, New York University Grossman School of Medicine	Neuroscience Institute, New York University Grossman School of Medicine												B		usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2024-01-26	Multi-stage	Multi-stage	Brain	Nervous System
30266	30266	SRR27747516	SRX23412817	SRS20268138	SRP486180	PRJNA1069776	Molecular characterization of hindbrain vestibular neurons in the larval zebrafish scRNA Seq	GSE254346	Transcriptome Analysis	The molecular logic that specifies and assembles closely related subtypes of neurons into functional sensorimotor circuits remains unclear. The goal of this study was to characterize the molecular profiles of hindbrain vestibular neurons in the larval zebrafish to identify candidate molecular programs that specify their subtype fate topography and circuit assembly. We used single cell RNA sequencing to generate a comprehensive atlas of hindbrain vestibular neurons and fluorecent in situ hybridization to annotate profiled neurons. Our dataset serves as a reference for evaluating developmental changes in molecular profiles following perturbations and identifies new candidate molecular solutions that assemble closely related subtypes into functional circuits. Overall design: Hindbrain vestibular neurons labeled by Tg 6.7Tru.Hcrtr2:GAL4 VP16;TgUAS:E1b Kaede harvested from zebrafish embryos between 72 hpf 74 hpf. Fluorescent neurons were isolated by fluorescence activated cell sorting FACS according to Kaede fluorescence. Three samples contained all hindbrain vestibular neurons sorted. One sample had two conditions: neurons born before or post a previously identified "midpoint" in hindbrain vestibular neuron development 36 hpf labeled using Kaede photoconversions. Neurons were sequenced with 10x Genomics.				All vestibular neurons replicate 3	GSM8038039		tissue:Hindbrain vestibular neurons\|time:72 hpf 74 hpf type:Hindbrain vestibular neurons\|genotype:Tg 6.7Tru.Hcrtr2:GAL4 VP16; TgUAS:E1b Kaede\|treatment:n/a\|geo loc name:missing\|collection date:missing	All vestibular neurons replicate 3	Cell Ranger v7.0.0 Assembly: GRCz11 Supplementary files format and content: Tab separated values files and matrix files	Hindbrain vestibular neurons	Three replicates were untreated. One replicate was photoconverted at 36 hpf to isolate early born red converted Kaede from late born green unconverted Kaede neurons.	Harvested neurons were sorted to isolate single cells resuspended in L15+2% FBS and kept on ice until cDNA synthesis Performed using manufacturer's instructions; 10x Genomics three prime V3.1		time:72 hpf 74 hpf type:Hindbrain vestibular neurons\|genotype:Tg 6.7Tru.Hcrtr2:GAL4 VP16; TgUAS:E1b Kaede\|treatment:n/a	GSM8038039	GSM8038039: All vestibular neurons replicate 3; Danio rerio; RNA Seq	GSM8038039 r1	GSM8038039	1	Harvested neurons were sorted to isolate single cells resuspended in L15+2% FBS and kept on ice until cDNA synthesis Performed using manufacturer's instructions; 10x Genomics three prime V3.1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP486180		loader:fastq load.py	Zebrafish-Replicate3_S3_L003_I1_001.fastq.gz Zebrafish-Replicate3_S3_L003_I2_001.fastq.gz Zebrafish-Replicate3_S3_L003_R1_001.fastq.gz Zebrafish-Replicate3_S3_L003_R2_001.fastq.gz	fastq fastq fastq fastq	10457106081.0	75230979.0	GSM8038039 r3	0:10 1:10 2:28 3:91	A:2588687752;C:1168371662;G:1623033341;T:1465362298;N:564036	10	10	28	91	2588687752	1168371662	1623033341	1465362298	564036	SRX23412817	SRS20268138	SRA1792542	Neuroscience Institute, New York University Grossman School of Medicine	Neuroscience Institute, New York University Grossman School of Medicine												B		usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2024-01-26	Multi-stage	Multi-stage	Brain	Nervous System
30267	30267	SRR27747517	SRX23412817	SRS20268138	SRP486180	PRJNA1069776	Molecular characterization of hindbrain vestibular neurons in the larval zebrafish scRNA Seq	GSE254346	Transcriptome Analysis	The molecular logic that specifies and assembles closely related subtypes of neurons into functional sensorimotor circuits remains unclear. The goal of this study was to characterize the molecular profiles of hindbrain vestibular neurons in the larval zebrafish to identify candidate molecular programs that specify their subtype fate topography and circuit assembly. We used single cell RNA sequencing to generate a comprehensive atlas of hindbrain vestibular neurons and fluorecent in situ hybridization to annotate profiled neurons. Our dataset serves as a reference for evaluating developmental changes in molecular profiles following perturbations and identifies new candidate molecular solutions that assemble closely related subtypes into functional circuits. Overall design: Hindbrain vestibular neurons labeled by Tg 6.7Tru.Hcrtr2:GAL4 VP16;TgUAS:E1b Kaede harvested from zebrafish embryos between 72 hpf 74 hpf. Fluorescent neurons were isolated by fluorescence activated cell sorting FACS according to Kaede fluorescence. Three samples contained all hindbrain vestibular neurons sorted. One sample had two conditions: neurons born before or post a previously identified "midpoint" in hindbrain vestibular neuron development 36 hpf labeled using Kaede photoconversions. Neurons were sequenced with 10x Genomics.				All vestibular neurons replicate 3	GSM8038039		tissue:Hindbrain vestibular neurons\|time:72 hpf 74 hpf type:Hindbrain vestibular neurons\|genotype:Tg 6.7Tru.Hcrtr2:GAL4 VP16; TgUAS:E1b Kaede\|treatment:n/a\|geo loc name:missing\|collection date:missing	All vestibular neurons replicate 3	Cell Ranger v7.0.0 Assembly: GRCz11 Supplementary files format and content: Tab separated values files and matrix files	Hindbrain vestibular neurons	Three replicates were untreated. One replicate was photoconverted at 36 hpf to isolate early born red converted Kaede from late born green unconverted Kaede neurons.	Harvested neurons were sorted to isolate single cells resuspended in L15+2% FBS and kept on ice until cDNA synthesis Performed using manufacturer's instructions; 10x Genomics three prime V3.1		time:72 hpf 74 hpf type:Hindbrain vestibular neurons\|genotype:Tg 6.7Tru.Hcrtr2:GAL4 VP16; TgUAS:E1b Kaede\|treatment:n/a	GSM8038039	GSM8038039: All vestibular neurons replicate 3; Danio rerio; RNA Seq	GSM8038039 r1	GSM8038039	1	Harvested neurons were sorted to isolate single cells resuspended in L15+2% FBS and kept on ice until cDNA synthesis Performed using manufacturer's instructions; 10x Genomics three prime V3.1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP486180		loader:fastq load.py	Zebrafish-Replicate3_S3_L004_I1_001.fastq.gz Zebrafish-Replicate3_S3_L004_I2_001.fastq.gz Zebrafish-Replicate3_S3_L004_R1_001.fastq.gz Zebrafish-Replicate3_S3_L004_R2_001.fastq.gz	fastq fastq fastq fastq	10455949462.0	75222658.0	GSM8038039 r4	0:10 1:10 2:28 3:91	A:2581792541;C:1170458560;G:1624194611;T:1468248274;N:567892	10	10	28	91	2581792541	1170458560	1624194611	1468248274	567892	SRX23412817	SRS20268138	SRA1792542	Neuroscience Institute, New York University Grossman School of Medicine	Neuroscience Institute, New York University Grossman School of Medicine												B		usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2024-01-26	Multi-stage	Multi-stage	Brain	Nervous System
30268	30268	SRR27747518	SRX23412816	SRS20268137	SRP486180	PRJNA1069776	Molecular characterization of hindbrain vestibular neurons in the larval zebrafish scRNA Seq	GSE254346	Transcriptome Analysis	The molecular logic that specifies and assembles closely related subtypes of neurons into functional sensorimotor circuits remains unclear. The goal of this study was to characterize the molecular profiles of hindbrain vestibular neurons in the larval zebrafish to identify candidate molecular programs that specify their subtype fate topography and circuit assembly. We used single cell RNA sequencing to generate a comprehensive atlas of hindbrain vestibular neurons and fluorecent in situ hybridization to annotate profiled neurons. Our dataset serves as a reference for evaluating developmental changes in molecular profiles following perturbations and identifies new candidate molecular solutions that assemble closely related subtypes into functional circuits. Overall design: Hindbrain vestibular neurons labeled by Tg 6.7Tru.Hcrtr2:GAL4 VP16;TgUAS:E1b Kaede harvested from zebrafish embryos between 72 hpf 74 hpf. Fluorescent neurons were isolated by fluorescence activated cell sorting FACS according to Kaede fluorescence. Three samples contained all hindbrain vestibular neurons sorted. One sample had two conditions: neurons born before or post a previously identified "midpoint" in hindbrain vestibular neuron development 36 hpf labeled using Kaede photoconversions. Neurons were sequenced with 10x Genomics.				All vestibular neurons replicate 2	GSM8038038		tissue:Hindbrain vestibular neurons\|time:72 hpf 74 hpf type:Hindbrain vestibular neurons\|genotype:Tg 6.7Tru.Hcrtr2:GAL4 VP16; TgUAS:E1b Kaede\|treatment:n/a\|geo loc name:missing\|collection date:missing	All vestibular neurons replicate 2	Cell Ranger v7.0.0 Assembly: GRCz11 Supplementary files format and content: Tab separated values files and matrix files	Hindbrain vestibular neurons	Three replicates were untreated. One replicate was photoconverted at 36 hpf to isolate early born red converted Kaede from late born green unconverted Kaede neurons.	Harvested neurons were sorted to isolate single cells resuspended in L15+2% FBS and kept on ice until cDNA synthesis Performed using manufacturer's instructions; 10x Genomics three prime V3.1		time:72 hpf 74 hpf type:Hindbrain vestibular neurons\|genotype:Tg 6.7Tru.Hcrtr2:GAL4 VP16; TgUAS:E1b Kaede\|treatment:n/a	GSM8038038	GSM8038038: All vestibular neurons replicate 2; Danio rerio; RNA Seq	GSM8038038 r1	GSM8038038	1	Harvested neurons were sorted to isolate single cells resuspended in L15+2% FBS and kept on ice until cDNA synthesis Performed using manufacturer's instructions; 10x Genomics three prime V3.1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP486180		loader:fastq load.py	Zebrafish-Replicate2_S2_L001_I1_001.fastq.gz Zebrafish-Replicate2_S2_L001_I2_001.fastq.gz Zebrafish-Replicate2_S2_L001_R1_001.fastq.gz Zebrafish-Replicate2_S2_L001_R2_001.fastq.gz	fastq fastq fastq fastq	9414131535.0	67727565.0	GSM8038038 r1	0:10 1:10 2:28 3:91	A:2659651693;C:894536960;G:1598721159;T:1009819179;N:479424	10	10	28	91	2659651693	894536960	1598721159	1009819179	479424	SRX23412816	SRS20268137	SRA1792542	Neuroscience Institute, New York University Grossman School of Medicine	Neuroscience Institute, New York University Grossman School of Medicine												B		usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2024-01-26	Multi-stage	Multi-stage	Brain	Nervous System
30269	30269	SRR27747519	SRX23412816	SRS20268137	SRP486180	PRJNA1069776	Molecular characterization of hindbrain vestibular neurons in the larval zebrafish scRNA Seq	GSE254346	Transcriptome Analysis	The molecular logic that specifies and assembles closely related subtypes of neurons into functional sensorimotor circuits remains unclear. The goal of this study was to characterize the molecular profiles of hindbrain vestibular neurons in the larval zebrafish to identify candidate molecular programs that specify their subtype fate topography and circuit assembly. We used single cell RNA sequencing to generate a comprehensive atlas of hindbrain vestibular neurons and fluorecent in situ hybridization to annotate profiled neurons. Our dataset serves as a reference for evaluating developmental changes in molecular profiles following perturbations and identifies new candidate molecular solutions that assemble closely related subtypes into functional circuits. Overall design: Hindbrain vestibular neurons labeled by Tg 6.7Tru.Hcrtr2:GAL4 VP16;TgUAS:E1b Kaede harvested from zebrafish embryos between 72 hpf 74 hpf. Fluorescent neurons were isolated by fluorescence activated cell sorting FACS according to Kaede fluorescence. Three samples contained all hindbrain vestibular neurons sorted. One sample had two conditions: neurons born before or post a previously identified "midpoint" in hindbrain vestibular neuron development 36 hpf labeled using Kaede photoconversions. Neurons were sequenced with 10x Genomics.				All vestibular neurons replicate 2	GSM8038038		tissue:Hindbrain vestibular neurons\|time:72 hpf 74 hpf type:Hindbrain vestibular neurons\|genotype:Tg 6.7Tru.Hcrtr2:GAL4 VP16; TgUAS:E1b Kaede\|treatment:n/a\|geo loc name:missing\|collection date:missing	All vestibular neurons replicate 2	Cell Ranger v7.0.0 Assembly: GRCz11 Supplementary files format and content: Tab separated values files and matrix files	Hindbrain vestibular neurons	Three replicates were untreated. One replicate was photoconverted at 36 hpf to isolate early born red converted Kaede from late born green unconverted Kaede neurons.	Harvested neurons were sorted to isolate single cells resuspended in L15+2% FBS and kept on ice until cDNA synthesis Performed using manufacturer's instructions; 10x Genomics three prime V3.1		time:72 hpf 74 hpf type:Hindbrain vestibular neurons\|genotype:Tg 6.7Tru.Hcrtr2:GAL4 VP16; TgUAS:E1b Kaede\|treatment:n/a	GSM8038038	GSM8038038: All vestibular neurons replicate 2; Danio rerio; RNA Seq	GSM8038038 r1	GSM8038038	1	Harvested neurons were sorted to isolate single cells resuspended in L15+2% FBS and kept on ice until cDNA synthesis Performed using manufacturer's instructions; 10x Genomics three prime V3.1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP486180		loader:fastq load.py	Zebrafish-Replicate2_S2_L002_I1_001.fastq.gz Zebrafish-Replicate2_S2_L002_I2_001.fastq.gz Zebrafish-Replicate2_S2_L002_R1_001.fastq.gz Zebrafish-Replicate2_S2_L002_R2_001.fastq.gz	fastq fastq fastq fastq	9495760675.0	68314825.0	GSM8038038 r2	0:10 1:10 2:28 3:91	A:2685940540;C:901627244;G:1612080998;T:1016532106;N:468187	10	10	28	91	2685940540	901627244	1612080998	1016532106	468187	SRX23412816	SRS20268137	SRA1792542	Neuroscience Institute, New York University Grossman School of Medicine	Neuroscience Institute, New York University Grossman School of Medicine												B		usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2024-01-26	Multi-stage	Multi-stage	Brain	Nervous System
30270	30270	SRR27747520	SRX23412816	SRS20268137	SRP486180	PRJNA1069776	Molecular characterization of hindbrain vestibular neurons in the larval zebrafish scRNA Seq	GSE254346	Transcriptome Analysis	The molecular logic that specifies and assembles closely related subtypes of neurons into functional sensorimotor circuits remains unclear. The goal of this study was to characterize the molecular profiles of hindbrain vestibular neurons in the larval zebrafish to identify candidate molecular programs that specify their subtype fate topography and circuit assembly. We used single cell RNA sequencing to generate a comprehensive atlas of hindbrain vestibular neurons and fluorecent in situ hybridization to annotate profiled neurons. Our dataset serves as a reference for evaluating developmental changes in molecular profiles following perturbations and identifies new candidate molecular solutions that assemble closely related subtypes into functional circuits. Overall design: Hindbrain vestibular neurons labeled by Tg 6.7Tru.Hcrtr2:GAL4 VP16;TgUAS:E1b Kaede harvested from zebrafish embryos between 72 hpf 74 hpf. Fluorescent neurons were isolated by fluorescence activated cell sorting FACS according to Kaede fluorescence. Three samples contained all hindbrain vestibular neurons sorted. One sample had two conditions: neurons born before or post a previously identified "midpoint" in hindbrain vestibular neuron development 36 hpf labeled using Kaede photoconversions. Neurons were sequenced with 10x Genomics.				All vestibular neurons replicate 2	GSM8038038		tissue:Hindbrain vestibular neurons\|time:72 hpf 74 hpf type:Hindbrain vestibular neurons\|genotype:Tg 6.7Tru.Hcrtr2:GAL4 VP16; TgUAS:E1b Kaede\|treatment:n/a\|geo loc name:missing\|collection date:missing	All vestibular neurons replicate 2	Cell Ranger v7.0.0 Assembly: GRCz11 Supplementary files format and content: Tab separated values files and matrix files	Hindbrain vestibular neurons	Three replicates were untreated. One replicate was photoconverted at 36 hpf to isolate early born red converted Kaede from late born green unconverted Kaede neurons.	Harvested neurons were sorted to isolate single cells resuspended in L15+2% FBS and kept on ice until cDNA synthesis Performed using manufacturer's instructions; 10x Genomics three prime V3.1		time:72 hpf 74 hpf type:Hindbrain vestibular neurons\|genotype:Tg 6.7Tru.Hcrtr2:GAL4 VP16; TgUAS:E1b Kaede\|treatment:n/a	GSM8038038	GSM8038038: All vestibular neurons replicate 2; Danio rerio; RNA Seq	GSM8038038 r1	GSM8038038	1	Harvested neurons were sorted to isolate single cells resuspended in L15+2% FBS and kept on ice until cDNA synthesis Performed using manufacturer's instructions; 10x Genomics three prime V3.1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP486180		loader:fastq load.py	Zebrafish-Replicate2_S2_L003_I1_001.fastq.gz Zebrafish-Replicate2_S2_L003_I2_001.fastq.gz Zebrafish-Replicate2_S2_L003_R1_001.fastq.gz Zebrafish-Replicate2_S2_L003_R2_001.fastq.gz	fastq fastq fastq fastq	9299053574.0	66899666.0	GSM8038038 r3	0:10 1:10 2:28 3:91	A:2619668178;C:887003175;G:1580306677;T:1000391033;N:500543	10	10	28	91	2619668178	887003175	1580306677	1000391033	500543	SRX23412816	SRS20268137	SRA1792542	Neuroscience Institute, New York University Grossman School of Medicine	Neuroscience Institute, New York University Grossman School of Medicine												B		usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2024-01-26	Multi-stage	Multi-stage	Brain	Nervous System
30271	30271	SRR27747521	SRX23412816	SRS20268137	SRP486180	PRJNA1069776	Molecular characterization of hindbrain vestibular neurons in the larval zebrafish scRNA Seq	GSE254346	Transcriptome Analysis	The molecular logic that specifies and assembles closely related subtypes of neurons into functional sensorimotor circuits remains unclear. The goal of this study was to characterize the molecular profiles of hindbrain vestibular neurons in the larval zebrafish to identify candidate molecular programs that specify their subtype fate topography and circuit assembly. We used single cell RNA sequencing to generate a comprehensive atlas of hindbrain vestibular neurons and fluorecent in situ hybridization to annotate profiled neurons. Our dataset serves as a reference for evaluating developmental changes in molecular profiles following perturbations and identifies new candidate molecular solutions that assemble closely related subtypes into functional circuits. Overall design: Hindbrain vestibular neurons labeled by Tg 6.7Tru.Hcrtr2:GAL4 VP16;TgUAS:E1b Kaede harvested from zebrafish embryos between 72 hpf 74 hpf. Fluorescent neurons were isolated by fluorescence activated cell sorting FACS according to Kaede fluorescence. Three samples contained all hindbrain vestibular neurons sorted. One sample had two conditions: neurons born before or post a previously identified "midpoint" in hindbrain vestibular neuron development 36 hpf labeled using Kaede photoconversions. Neurons were sequenced with 10x Genomics.				All vestibular neurons replicate 2	GSM8038038		tissue:Hindbrain vestibular neurons\|time:72 hpf 74 hpf type:Hindbrain vestibular neurons\|genotype:Tg 6.7Tru.Hcrtr2:GAL4 VP16; TgUAS:E1b Kaede\|treatment:n/a\|geo loc name:missing\|collection date:missing	All vestibular neurons replicate 2	Cell Ranger v7.0.0 Assembly: GRCz11 Supplementary files format and content: Tab separated values files and matrix files	Hindbrain vestibular neurons	Three replicates were untreated. One replicate was photoconverted at 36 hpf to isolate early born red converted Kaede from late born green unconverted Kaede neurons.	Harvested neurons were sorted to isolate single cells resuspended in L15+2% FBS and kept on ice until cDNA synthesis Performed using manufacturer's instructions; 10x Genomics three prime V3.1		time:72 hpf 74 hpf type:Hindbrain vestibular neurons\|genotype:Tg 6.7Tru.Hcrtr2:GAL4 VP16; TgUAS:E1b Kaede\|treatment:n/a	GSM8038038	GSM8038038: All vestibular neurons replicate 2; Danio rerio; RNA Seq	GSM8038038 r1	GSM8038038	1	Harvested neurons were sorted to isolate single cells resuspended in L15+2% FBS and kept on ice until cDNA synthesis Performed using manufacturer's instructions; 10x Genomics three prime V3.1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP486180		loader:fastq load.py	Zebrafish-Replicate2_S2_L004_I1_001.fastq.gz Zebrafish-Replicate2_S2_L004_I2_001.fastq.gz Zebrafish-Replicate2_S2_L004_R1_001.fastq.gz Zebrafish-Replicate2_S2_L004_R2_001.fastq.gz	fastq fastq fastq fastq	9269439763.0	66686617.0	GSM8038038 r4	0:10 1:10 2:28 3:91	A:2605497678;C:885933483;G:1577360287;T:999190994;N:499705	10	10	28	91	2605497678	885933483	1577360287	999190994	499705	SRX23412816	SRS20268137	SRA1792542	Neuroscience Institute, New York University Grossman School of Medicine	Neuroscience Institute, New York University Grossman School of Medicine												B		usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2024-01-26	Multi-stage	Multi-stage	Brain	Nervous System
30272	30272	SRR27747522	SRX23412815	SRS20268136	SRP486180	PRJNA1069776	Molecular characterization of hindbrain vestibular neurons in the larval zebrafish scRNA Seq	GSE254346	Transcriptome Analysis	The molecular logic that specifies and assembles closely related subtypes of neurons into functional sensorimotor circuits remains unclear. The goal of this study was to characterize the molecular profiles of hindbrain vestibular neurons in the larval zebrafish to identify candidate molecular programs that specify their subtype fate topography and circuit assembly. We used single cell RNA sequencing to generate a comprehensive atlas of hindbrain vestibular neurons and fluorecent in situ hybridization to annotate profiled neurons. Our dataset serves as a reference for evaluating developmental changes in molecular profiles following perturbations and identifies new candidate molecular solutions that assemble closely related subtypes into functional circuits. Overall design: Hindbrain vestibular neurons labeled by Tg 6.7Tru.Hcrtr2:GAL4 VP16;TgUAS:E1b Kaede harvested from zebrafish embryos between 72 hpf 74 hpf. Fluorescent neurons were isolated by fluorescence activated cell sorting FACS according to Kaede fluorescence. Three samples contained all hindbrain vestibular neurons sorted. One sample had two conditions: neurons born before or post a previously identified "midpoint" in hindbrain vestibular neuron development 36 hpf labeled using Kaede photoconversions. Neurons were sequenced with 10x Genomics.				All vestibular neurons replicate 1	GSM8038037		tissue:Hindbrain vestibular neurons\|time:72 hpf 74 hpf type:Hindbrain vestibular neurons\|genotype:Tg 6.7Tru.Hcrtr2:GAL4 VP16; TgUAS:E1b Kaede\|treatment:n/a\|geo loc name:missing\|collection date:missing	All vestibular neurons replicate 1	Cell Ranger v7.0.0 Assembly: GRCz11 Supplementary files format and content: Tab separated values files and matrix files	Hindbrain vestibular neurons	Three replicates were untreated. One replicate was photoconverted at 36 hpf to isolate early born red converted Kaede from late born green unconverted Kaede neurons.	Harvested neurons were sorted to isolate single cells resuspended in L15+2% FBS and kept on ice until cDNA synthesis Performed using manufacturer's instructions; 10x Genomics three prime V3.1		time:72 hpf 74 hpf type:Hindbrain vestibular neurons\|genotype:Tg 6.7Tru.Hcrtr2:GAL4 VP16; TgUAS:E1b Kaede\|treatment:n/a	GSM8038037	GSM8038037: All vestibular neurons replicate 1; Danio rerio; RNA Seq	GSM8038037 r1	GSM8038037	1	Harvested neurons were sorted to isolate single cells resuspended in L15+2% FBS and kept on ice until cDNA synthesis Performed using manufacturer's instructions; 10x Genomics three prime V3.1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP486180		loader:fastq load.py	Zebrafish-Replicate1_S1_L001_I1_001.fastq.gz Zebrafish-Replicate1_S1_L001_I2_001.fastq.gz Zebrafish-Replicate1_S1_L001_R1_001.fastq.gz Zebrafish-Replicate1_S1_L001_R2_001.fastq.gz	fastq fastq fastq fastq	11844241708.0	85210372.0	GSM8038037 r1	0:10 1:10 2:28 3:91	A:3114181870;C:1253864519;G:2080987238;T:1304504811;N:605414	10	10	28	91	3114181870	1253864519	2080987238	1304504811	605414	SRX23412815	SRS20268136	SRA1792542	Neuroscience Institute, New York University Grossman School of Medicine	Neuroscience Institute, New York University Grossman School of Medicine												B		usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2024-01-26	Multi-stage	Multi-stage	Brain	Nervous System
30273	30273	SRR27747523	SRX23412815	SRS20268136	SRP486180	PRJNA1069776	Molecular characterization of hindbrain vestibular neurons in the larval zebrafish scRNA Seq	GSE254346	Transcriptome Analysis	The molecular logic that specifies and assembles closely related subtypes of neurons into functional sensorimotor circuits remains unclear. The goal of this study was to characterize the molecular profiles of hindbrain vestibular neurons in the larval zebrafish to identify candidate molecular programs that specify their subtype fate topography and circuit assembly. We used single cell RNA sequencing to generate a comprehensive atlas of hindbrain vestibular neurons and fluorecent in situ hybridization to annotate profiled neurons. Our dataset serves as a reference for evaluating developmental changes in molecular profiles following perturbations and identifies new candidate molecular solutions that assemble closely related subtypes into functional circuits. Overall design: Hindbrain vestibular neurons labeled by Tg 6.7Tru.Hcrtr2:GAL4 VP16;TgUAS:E1b Kaede harvested from zebrafish embryos between 72 hpf 74 hpf. Fluorescent neurons were isolated by fluorescence activated cell sorting FACS according to Kaede fluorescence. Three samples contained all hindbrain vestibular neurons sorted. One sample had two conditions: neurons born before or post a previously identified "midpoint" in hindbrain vestibular neuron development 36 hpf labeled using Kaede photoconversions. Neurons were sequenced with 10x Genomics.				All vestibular neurons replicate 1	GSM8038037		tissue:Hindbrain vestibular neurons\|time:72 hpf 74 hpf type:Hindbrain vestibular neurons\|genotype:Tg 6.7Tru.Hcrtr2:GAL4 VP16; TgUAS:E1b Kaede\|treatment:n/a\|geo loc name:missing\|collection date:missing	All vestibular neurons replicate 1	Cell Ranger v7.0.0 Assembly: GRCz11 Supplementary files format and content: Tab separated values files and matrix files	Hindbrain vestibular neurons	Three replicates were untreated. One replicate was photoconverted at 36 hpf to isolate early born red converted Kaede from late born green unconverted Kaede neurons.	Harvested neurons were sorted to isolate single cells resuspended in L15+2% FBS and kept on ice until cDNA synthesis Performed using manufacturer's instructions; 10x Genomics three prime V3.1		time:72 hpf 74 hpf type:Hindbrain vestibular neurons\|genotype:Tg 6.7Tru.Hcrtr2:GAL4 VP16; TgUAS:E1b Kaede\|treatment:n/a	GSM8038037	GSM8038037: All vestibular neurons replicate 1; Danio rerio; RNA Seq	GSM8038037 r1	GSM8038037	1	Harvested neurons were sorted to isolate single cells resuspended in L15+2% FBS and kept on ice until cDNA synthesis Performed using manufacturer's instructions; 10x Genomics three prime V3.1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP486180		loader:fastq load.py	Zebrafish-Replicate1_S1_L002_I1_001.fastq.gz Zebrafish-Replicate1_S1_L002_I2_001.fastq.gz Zebrafish-Replicate1_S1_L002_R1_001.fastq.gz Zebrafish-Replicate1_S1_L002_R2_001.fastq.gz	fastq fastq fastq fastq	11897506230.0	85593570.0	GSM8038037 r2	0:10 1:10 2:28 3:91	A:3132719148;C:1257962906;G:2089627351;T:1308117927;N:587538	10	10	28	91	3132719148	1257962906	2089627351	1308117927	587538	SRX23412815	SRS20268136	SRA1792542	Neuroscience Institute, New York University Grossman School of Medicine	Neuroscience Institute, New York University Grossman School of Medicine												B		usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2024-01-26	Multi-stage	Multi-stage	Brain	Nervous System
30274	30274	SRR27747524	SRX23412815	SRS20268136	SRP486180	PRJNA1069776	Molecular characterization of hindbrain vestibular neurons in the larval zebrafish scRNA Seq	GSE254346	Transcriptome Analysis	The molecular logic that specifies and assembles closely related subtypes of neurons into functional sensorimotor circuits remains unclear. The goal of this study was to characterize the molecular profiles of hindbrain vestibular neurons in the larval zebrafish to identify candidate molecular programs that specify their subtype fate topography and circuit assembly. We used single cell RNA sequencing to generate a comprehensive atlas of hindbrain vestibular neurons and fluorecent in situ hybridization to annotate profiled neurons. Our dataset serves as a reference for evaluating developmental changes in molecular profiles following perturbations and identifies new candidate molecular solutions that assemble closely related subtypes into functional circuits. Overall design: Hindbrain vestibular neurons labeled by Tg 6.7Tru.Hcrtr2:GAL4 VP16;TgUAS:E1b Kaede harvested from zebrafish embryos between 72 hpf 74 hpf. Fluorescent neurons were isolated by fluorescence activated cell sorting FACS according to Kaede fluorescence. Three samples contained all hindbrain vestibular neurons sorted. One sample had two conditions: neurons born before or post a previously identified "midpoint" in hindbrain vestibular neuron development 36 hpf labeled using Kaede photoconversions. Neurons were sequenced with 10x Genomics.				All vestibular neurons replicate 1	GSM8038037		tissue:Hindbrain vestibular neurons\|time:72 hpf 74 hpf type:Hindbrain vestibular neurons\|genotype:Tg 6.7Tru.Hcrtr2:GAL4 VP16; TgUAS:E1b Kaede\|treatment:n/a\|geo loc name:missing\|collection date:missing	All vestibular neurons replicate 1	Cell Ranger v7.0.0 Assembly: GRCz11 Supplementary files format and content: Tab separated values files and matrix files	Hindbrain vestibular neurons	Three replicates were untreated. One replicate was photoconverted at 36 hpf to isolate early born red converted Kaede from late born green unconverted Kaede neurons.	Harvested neurons were sorted to isolate single cells resuspended in L15+2% FBS and kept on ice until cDNA synthesis Performed using manufacturer's instructions; 10x Genomics three prime V3.1		time:72 hpf 74 hpf type:Hindbrain vestibular neurons\|genotype:Tg 6.7Tru.Hcrtr2:GAL4 VP16; TgUAS:E1b Kaede\|treatment:n/a	GSM8038037	GSM8038037: All vestibular neurons replicate 1; Danio rerio; RNA Seq	GSM8038037 r1	GSM8038037	1	Harvested neurons were sorted to isolate single cells resuspended in L15+2% FBS and kept on ice until cDNA synthesis Performed using manufacturer's instructions; 10x Genomics three prime V3.1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP486180		loader:fastq load.py	Zebrafish-Replicate1_S1_L003_I1_001.fastq.gz Zebrafish-Replicate1_S1_L003_I2_001.fastq.gz Zebrafish-Replicate1_S1_L003_R1_001.fastq.gz Zebrafish-Replicate1_S1_L003_R2_001.fastq.gz	fastq fastq fastq fastq	11710536913.0	84248467.0	GSM8038037 r3	0:10 1:10 2:28 3:91	A:3071431897;C:1243257065;G:2058561915;T:1292732765;N:626855	10	10	28	91	3071431897	1243257065	2058561915	1292732765	626855	SRX23412815	SRS20268136	SRA1792542	Neuroscience Institute, New York University Grossman School of Medicine	Neuroscience Institute, New York University Grossman School of Medicine												B		usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2024-01-26	Multi-stage	Multi-stage	Brain	Nervous System
30275	30275	SRR27747525	SRX23412815	SRS20268136	SRP486180	PRJNA1069776	Molecular characterization of hindbrain vestibular neurons in the larval zebrafish scRNA Seq	GSE254346	Transcriptome Analysis	The molecular logic that specifies and assembles closely related subtypes of neurons into functional sensorimotor circuits remains unclear. The goal of this study was to characterize the molecular profiles of hindbrain vestibular neurons in the larval zebrafish to identify candidate molecular programs that specify their subtype fate topography and circuit assembly. We used single cell RNA sequencing to generate a comprehensive atlas of hindbrain vestibular neurons and fluorecent in situ hybridization to annotate profiled neurons. Our dataset serves as a reference for evaluating developmental changes in molecular profiles following perturbations and identifies new candidate molecular solutions that assemble closely related subtypes into functional circuits. Overall design: Hindbrain vestibular neurons labeled by Tg 6.7Tru.Hcrtr2:GAL4 VP16;TgUAS:E1b Kaede harvested from zebrafish embryos between 72 hpf 74 hpf. Fluorescent neurons were isolated by fluorescence activated cell sorting FACS according to Kaede fluorescence. Three samples contained all hindbrain vestibular neurons sorted. One sample had two conditions: neurons born before or post a previously identified "midpoint" in hindbrain vestibular neuron development 36 hpf labeled using Kaede photoconversions. Neurons were sequenced with 10x Genomics.				All vestibular neurons replicate 1	GSM8038037		tissue:Hindbrain vestibular neurons\|time:72 hpf 74 hpf type:Hindbrain vestibular neurons\|genotype:Tg 6.7Tru.Hcrtr2:GAL4 VP16; TgUAS:E1b Kaede\|treatment:n/a\|geo loc name:missing\|collection date:missing	All vestibular neurons replicate 1	Cell Ranger v7.0.0 Assembly: GRCz11 Supplementary files format and content: Tab separated values files and matrix files	Hindbrain vestibular neurons	Three replicates were untreated. One replicate was photoconverted at 36 hpf to isolate early born red converted Kaede from late born green unconverted Kaede neurons.	Harvested neurons were sorted to isolate single cells resuspended in L15+2% FBS and kept on ice until cDNA synthesis Performed using manufacturer's instructions; 10x Genomics three prime V3.1		time:72 hpf 74 hpf type:Hindbrain vestibular neurons\|genotype:Tg 6.7Tru.Hcrtr2:GAL4 VP16; TgUAS:E1b Kaede\|treatment:n/a	GSM8038037	GSM8038037: All vestibular neurons replicate 1; Danio rerio; RNA Seq	GSM8038037 r1	GSM8038037	1	Harvested neurons were sorted to isolate single cells resuspended in L15+2% FBS and kept on ice until cDNA synthesis Performed using manufacturer's instructions; 10x Genomics three prime V3.1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP486180		loader:fastq load.py	Zebrafish-Replicate1_S1_L004_I1_001.fastq.gz Zebrafish-Replicate1_S1_L004_I2_001.fastq.gz Zebrafish-Replicate1_S1_L004_R1_001.fastq.gz Zebrafish-Replicate1_S1_L004_R2_001.fastq.gz	fastq fastq fastq fastq	11691727294.0	84113146.0	GSM8038037 r4	0:10 1:10 2:28 3:91	A:3060624267;C:1243160034;G:2057238308;T:1292649886;N:623791	10	10	28	91	3060624267	1243160034	2057238308	1292649886	623791	SRX23412815	SRS20268136	SRA1792542	Neuroscience Institute, New York University Grossman School of Medicine	Neuroscience Institute, New York University Grossman School of Medicine												B		usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2024-01-26	Multi-stage	Multi-stage	Brain	Nervous System
30586	30586	SRR27848608	SRX23511536	SRS20362004	SRP487839	PRJNA1072736	Transgenic tools targeting striatal and pallidal subpopulations reveal both evolutionary conservation and specialization of cortico basal ganglia circuits in zebrafish	GSE254980	Other	The cortico basal ganglia circuit mediates decision making. Here we generated transgenic tools for adult zebrafish targeting specific subpopulations of the components of this circuit and utilized them to identify evolutionary homologs of the mammalian direct and indirect pathway striatal neurons which respectively project to the homologs of the internal and external segment of the globus pallidus dEN and Vl as in mammals. Unlike in mammals the Vl mainly projected to the dEN directly not by way of the subthalamic nucleus. Further single cell RNA sequencing analysis revealed two pallidal output pathways: a major shortcut pathway directly connecting the dEN with the pallium and the evolutionarily conserved closed loop by way of the thalamus. Our resources and circuit map provide the common basis for the functional study of the basal ganglia in a small and optically tractable zebrafish brain for the comprehensive mechanistic understanding of the cortico basal ganglia circuit. Overall design: To identify genetic markers of the npy negative thalamus projecting neurons in the dEN we conducted single cell RNA sequencing analysis. We dissected the dEN and its surrounding regions from six adult individuals of TgBACnpy:GAL4VP16;TgUAS:GFP. We then dissociated the dissected tissue and used the droplet based three primeend scRNAseq system Chromium 10x Genomics. We obtained transcriptomic data from 3 381 cells and performed unbiased clustering by Seurat.		pubmed:38484735		zebrafish dEN dissected tissue	GSM8061694		source name:dorsal entopeduncular nucleus and its surrounding brain tissue\|tissue:dorsal entopeduncular nucleus and its surrounding brain tissue\|cell type:Neurons/glia/blood cells from telencephalon\|genotype:TgBACnpy:GAL4VP16;TgUAS:GFP\|treatment:regular laboratory cultivation condition\|geo loc name:missing\|collection date:missing	zebrafish dEN dissected tissue	The obtained scRNAseq data of 3 381 cells were analyzed by Seurat.47 As a quality control cells with more than 6% mitochondrial genes less than 200 unique genes and more than 17500 UMIs were removed. Barcodes with less than 500 UMIs had been already removed by cellranger count pipeline. The remaining 3 043 cells were then data normalized by LogNormalize method with scale.factor = 10000. For further calculation of UMAP and clustering variable genes were determined with FindVariableFeatures function with selection.method = “vst” and the top 2000 most highly variable genes were used for further clustering. The expression of each gene was shifted so that the mean expression across cells is 0 and scaled so that the variance across cells is 1 by ScaleData function. PCA was run on the scaled data and then UMAP and clustering were performed with the FindNeighbors function with the top 35 PCs the FindClusters function with resolution = 0.5 and the RunUMAP function with the top 35 PCs. Dot plots and violin plots were generated by Seurat and cell types were determined by the expression of marker genes that define specific cell types. Assembly: GRCz11 Supplementary files format and content: Tab separated values files and matrix files Supplementary files format and content: HTML output file obtained from Seurat analysis using R markdown	dorsal entopeduncular nucleus and its surrounding brain tissue		Dissection was performed on 6 individuals of TgBACnpy:GAL4VP16;TgUAS:GFP fish and 12 dissected tissue pieces from the left and right hemispheres were obtained in total. The dEN and its surrounding regions were carefully dissected with micro scissors and fine forceps in ice cold and oxygenized Neurobasal medium ThermoFisher Scientific 21103049 supplemented with 1x B 27 ThermoFisher Scientific 17504044 under a fluorescent dissection microscope as shown in the Figure S5A. The dissected tissue was dissociated with the Papain Dissociation Kit Worthington; LK003150 with 0.1% 2 mercaptoethanol for 15 minutes with gentle shaking at 28.5 degrees Celsius. Then the cells were dissociated by gentle trituration 15 times with a glass Pasteur pipet coated with 2% BSA in PBS and spun at 300xg for 5 minutes. The cells were resuspended in papain inhibitor solution Worthington and incubated for 10 minutes with gentle shaking at 28.5 degrees Celsius. Then the cells were further dissociated by gentle trituration 20 times with a glass Pasteur pipet attached with a regular 200 µl tip coated with 2% BSA in PBS. The dissociated cell suspension was then filtered with pluriStrainer Mini 40 µm pluriSelect coated with 2% BSA in PBS and spun at 300xg for 5 minutes. The resulting cell suspension was resuspended in 2% BSA in PBS and then cell debris and dead cells were removed by FACS FACSAria SORP BD Biosciences using Hoechst to sort out cells from cell debris and Propidium Iodide to sort out living cells from dead cells. post FACS sorting a small fraction of the cell suspension was used to estimate the total number of the cells and their viability using a dead cell stain Trypan Blue elabscience. The obtained suspension contained 16 000 cells with 85.0% viability. The resulting single cell suspension was loaded on the Chromium Next GEM Single Cell 3’ Reagent Kits v3.1 10x Genomics PN 1000269 and the cDNA library was prepared according to the manufacturer’s instructions. The obtained cDNA library underwent Next generation sequencing by …	regular laboratory cultivation condition	tissue:dorsal entopeduncular nucleus and its surrounding brain tissue\|cell type:Neurons/glia/blood cells from telencephalon\|genotype:TgBACnpy:GAL4VP16;TgUAS:GFP\|treatment:regular laboratory cultivation condition	GSM8061694	GSM8061694: zebrafish dEN dissected tissue; Danio rerio; RNA Seq	GSM8061694 r1	GSM8061694	1	Dissection was performed on 6 individuals of TgBACnpy:GAL4VP16;TgUAS:GFP fish and 12 dissected tissue pieces from the left and right hemispheres were obtained in total. The dEN and its surrounding regions were carefully dissected with micro scissors and fine forceps in ice cold and oxygenized Neurobasal medium ThermoFisher Scientific 21103049 supplemented with 1x B 27 ThermoFisher Scientific 17504044 under a fluorescent dissection microscope as shown in the Figure S5A. The dissected tissue was dissociated with the Papain Dissociation Kit Worthington; LK003150 with 0.1% 2 mercaptoethanol for 15 minutes with gentle shaking at 28.5 degrees Celsius. Then the cells were dissociated by gentle trituration 15 times with a glass Pasteur pipet coated with 2% BSA in PBS and spun at 300xg for 5 minutes. The cells were resuspended in papain inhibitor solution Worthington and incubated for 10 minutes with gentle shaking at 28.5 degrees Celsius. Then the cells were further dissociated by gentle trituration 20 times with a glass Pasteur pipet attached with a regular 200 µl tip coated with 2% BSA in PBS. The dissociated cell suspension was then filtered with pluriStrainer Mini 40 µm pluriSelect coated with 2% BSA in PBS and spun at 300xg for 5 minutes. The resulting cell suspension was resuspended in 2% BSA in PBS and then cell debris and dead cells were removed by FACS FACSAria SORP BD Biosciences using Hoechst to sort out cells from cell debris and Propidium Iodide to sort out living cells from dead cells. post FACS sorting a small fraction of the cell suspension was used to estimate the total number of the cells and their viability using a dead cell stain Trypan Blue elabscience. The obtained suspension contained 16 000 cells with 85.0% viability. The resulting single cell suspension was loaded on the Chromium Next GEM Single Cell three prime Reagent Kits v3.1 10x Genomics PN 1000269 and the cDNA library was prepared according to the manufacturer's instructions. The obtained cDNA library underwent Next generation seque…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	HiSeq X Ten	SRP487839		loader:fastq load.py	ENcDNALibrary20210701_S1_L002_I1_001.fastq.gz ENcDNALibrary20210701_S1_L002_I2_001.fastq.gz ENcDNALibrary20210701_S1_L002_R1_001.fastq.gz ENcDNALibrary20210701_S1_L002_R2_001.fastq.gz	fastq fastq fastq fastq	53657581944.0	400429716.0	GSM8061694 r1	0:8 1:8 2:28 3:90	A:10793191703;C:7078696830;G:7719702279;T:10444591093;N:2492535	8	8	28	90	10793191703	7078696830	7719702279	10444591093	2492535	SRX23511536	SRS20362004	SRA1796958	CBS, RIKEN	CBS, RIKEN												B		usable mapping rate	illumina	hiseq_era	3prime	cdna_unspecified	unknown	sc	single_cell_droplet	10x	Japan	2024-02-02	Undetermined	Adult	Brain	Nervous System
31871	31871	SRR33650039	SRX28877239	SRS25103945	SRP502657	PRJNA1101966	Pioneer neurons are molecularly distinct and their axon targeting is regulated by retinoic acid signaling	GSE264323	Transcriptome Analysis	During nervous system development pioneer neurons are the first to extend their axons into target tissues creating a scaffold for follower neurons. Despite years of study whether pioneer neurons are a molecularly distinct population is unknown. Analysis of zebrafish posterior lateral line pLL sensory neurons during axon growth using single cell RNA sequencing scRNA seq revealed that pioneer and follower neurons are transcriptionally distinct. Expression profiling of differentiating pLL progenitors defined follower as the ground state whereas “pioneer” is a later developmental state. The scRNA seq data revealed active retinoic acid RA signaling in followers but not in pioneers. Modulation of RA signaling within single pLL neurons showed that its downregulation in pioneers is necessary for expression of neurotrophic factor receptor ret which is required for correct targeting of pioneer axons. Our study provided insights into the molecular landscape of pioneer neurons and revealed the regulatory role of RA signaling in their development. Overall design: Fourteen hpf eighteen hpf twenty two hpf forty eight hpf TgBACneurod1:EGFPnl1 zebrafish embryos were collected and euthanized in 1.7 ml microcentrifuge tubes. Embryos were deyolked using a calcium free Ringer's solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 by gently pipetting up and down with a P200 pipet. Embryos were incubated for 5 minutes in Ringer's solution. Embryos were transferred to pre warmed protease solutions 0.25% trypsin 1 mM EDTA pH 8.0 PBS and collagenase P/HBSS 100 mg/mL was added. Embryos were incubated at 28° C for 15 minutes and were homogenized every 5 minutes using a P1000 pipet. The Stop solution 6X 30% calf serum 6 mM CaCl2 PBS was added and samples were centrifuged 350xg 4° C for 5 minutes. Supernatant was removed and 1 mL of chilled suspension solution was added 1% FBS 0.8 mM CaCl2 50 U/mL penicillin 0.05 mg/mL streptomycin DMEM. Samples were centrifuged again 350g 4° C for 5 minutes and supernatant was removed. 7…				WT zebrafish neurons	GSM8997253		source name:neuron\|tissue:neuron\|genotype:mixed\|geo loc name:missing\|collection date:missing	WT zebrafish neurons	using Cell Ranger version 3.1.0; 10X Genomics Pleasanton CA. USA Assembly: ZebraFishGRCz11 Supplementary files format and content: Tab separated values files and matrix files	neuron		Twenty two old TgBACneurod1:EGFPnl1 zebrafish embryos were collected and euthanized in 1.7 ml microcentrifuge tubes. Embryos were deyolked using a calcium free Ringer’s solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 by gently pipetting up and down with a P200 pipet. Embryos were incubated for 5 minutes in Ringer’s solution. Embryos were transferred to pre warmed protease solutions 0.25% trypsin 1 mM EDTA pH 8.0 PBS and collagenase P/HBSS 100 mg/mL was added. Embryos were incubated at 28° C for 15 minutes and were homogenized every 5 minutes using a P1000 pipet. The Stop solution 6X 30% calf serum 6 mM CaCl2 PBS was added and samples were centrifuged 350xg 4° C for 5 minutes. Supernatant was removed and 1 mL of chilled suspension solution was added 1% FBS 0.8 mM CaCl2 50 U/mL penicillin 0.05 mg/mL streptomycin DMEM. Samples were centrifuged again 350g 4° C for 5 minutes and supernatant was removed. 700 μl of chilled suspension solution was added and cells were resuspended by pipetting. Cells were passed through a 40 μm cell strainer into a FACs tube and kept on ice. GFP and RFP+ cells were FAC sorted on a BD Symphony cell sorter into sorting buffer 50 μl PBS/ 2% BSA in a siliconized 1.5mL tube. Library was performed according to the manufacter’s instructions single cell 3’ v3 protocol 10x Genomics.		tissue:neuron\|genotype:mixed	GSM8997253	GSM8997253: WT zebrafish neurons; Danio rerio; RNA Seq	GSM8997253 r1	GSM8997253	1	Twenty two old TgBACneurod1:EGFPnl1 zebrafish embryos were collected and euthanized in 1.7 ml microcentrifuge tubes. Embryos were deyolked using a calcium free Ringer's solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 by gently pipetting up and down with a P200 pipet. Embryos were incubated for 5 minutes in Ringer's solution. Embryos were transferred to pre warmed protease solutions 0.25% trypsin 1 mM EDTA pH 8.0 PBS and collagenase P/HBSS 100 mg/mL was added. Embryos were incubated at 28° C for 15 minutes and were homogenized every 5 minutes using a P1000 pipet. The Stop solution 6X 30% calf serum 6 mM CaCl2 PBS was added and samples were centrifuged 350xg 4° C for 5 minutes. Supernatant was removed and 1 mL of chilled suspension solution was added 1% FBS 0.8 mM CaCl2 50 U/mL penicillin 0.05 mg/mL streptomycin DMEM. Samples were centrifuged again 350g 4° C for 5 minutes and supernatant was removed. 700 μl of chilled suspension solution was added and cells were resuspended by pipetting. Cells were passed through a 40 μm cell strainer into a FACs tube and kept on ice. GFP and RFP+ cells were FAC sorted on a BD Symphony cell sorter into sorting buffer 50 μl PBS/ 2% BSA in a siliconized 1.5mL tube. Library was performed according to the manufacter's instructions single cell three prime v3 protocol 10x Genomics.	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP502657			CEL221031AN_WT_18s_S3_L001_I1_001.fastq.gz CEL221031AN_WT_18s_S3_L001_I2_001.fastq.gz CEL221031AN_WT_18s_S3_L001_R1_001.fastq.gz CEL221031AN_WT_18s_S3_L001_R2_001.fastq.gz	fastq fastq fastq fastq	76460696208.0	554063016.0	GSM8997253 r1	0:10 1:10 2:28 3:90	A:15627919564;C:9793027889;G:11041478751;T:13400880335;N:2364901	10	10	28	90	15627919564	9793027889	11041478751	13400880335	2364901	SRX28877239	SRS25103945	SRA2133742	Oregon Health and Science Univ	Oregon Health and Science Univ												B		usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2025-05-20	Undetermined	Embryo	Brain	Nervous System
32373	32373	SRR29181693	SRX24701872	SRS21429401	SRP509892	PRJNA1116548	Barcoding Notch signaling in the developing brain	GSE268356	Other	Developmental signaling inputs are fundamental for shaping cell fates and behavior. However traditional fluorescent based signaling reporters have limitations in scalability and molecular resolution of cell types. We present SABER seq a CRISPR Cas molecular recorder that stores transient developmental signaling cues as permanent mutations in cellular genomes for deconstruction at later stages via single cell transcriptomics. We applied SABER seq to record Notch signaling in developing zebrafish brains. SABER seq has two components: a signaling sensor and a barcode recorder. The sensor activates Cas9 in a Notch dependent manner with inducible control while the recorder obtains mutations in ancestral cells where Notch is active. We combine SABER seq with an expanded juvenile brain atlas to identify cell types derived from Notch active founders. Our data reveals rare examples where differential Notch activity in ancestral progenitors is detected in terminally differentiated neuronal subtypes. SABER seq is a novel platform for rapid scalable and high resolution mapping of signaling activity during development. Overall design: 10x Genomics libraries of single cell transcriptomes and SABER seq data and genomic DNA SABER data		pubmed:39575683		SABERb4 linB2.2 14.124.2 brain4 SABER Seq	GSM8290063		source name:zebrafish whole brain\|tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB\|geo loc name:missing\|collection date:missing	SABERb4 linB2.2 14.124.2 brain4 SABER Seq	Raw FASTQ reads were aligned against zebrafish genome built from GRCz.109.gtf and the GRCz11.fa files using the Cell Ranger count pipeline to generate gene by cell count matrices filtered barcode matrix. The count matrices were processed using the standard workflow of the Seurat v5.0.2 R package with modifications. Briefly all count matrices were separately loaded into R. Seurat objects were then created with modified parameters requiring features to be detected in at least 3 cells and cells to contain at least 300 genes. Subsequently the Seurat objects were merged to create a single Seurat object. Cells with RNA counts between 300 and 4000 and a mitochondrial gene percentage of less than 9% were selected for downstream analysis. Gene expression values were log normalized with the default parameters and scaled for the top 3000 variable genes. The scaled data was then used to compute the 50 principal components. Cells were iteratively clustered using the Louvain algorithm post identifying neighboring cells. Differentially expressed genes for each cluster were identified using genes that are detected in at least 10% of cells in either of the two clusters and genes showing a minimum difference of 10% between the two clusters. Cell types were annotated using known marker genes. The SABER seq FASTQ reads were processed using the Cell Ranger count pipeline similar to the transcriptomic reads. A bash script was then used to generate a text file containing all FASTQ headers and error corrected cell barcodes for SABER seq data. post loading filtered barcode matrices into R error corrected cell barcodes from transcriptomic reads were isolated and matched against those in the text file to identify common cell barcode that are shared between the transcriptomic and SABER seq datasets. The resulting text file contained redundant error corrected cell barcodes associated with different UMIs for the same cell. Thus unique error corrected cell barcodes were isolated to create a text file containing unique FASTQ headers an…	zebrafish whole brain		Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer’s instructions Single Cell 3’ v3 kit. Transcriptome libraries were sequenced using HiSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads used initially and supernatant was rebound with 1.5…	This work was performed under protocol numbers 807110 and 807259 which were approved by the University of Pennsylvania’s Office of Animal Welfare of Institutional Animal Care and Use Committee IACUC. All zebrafish work in this study follows the University of Pennsylvania Institutional Animal Care and Use Committee regulations.	tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB	GSM8290063	GSM8290063: SABERb4 linB2.2 14.124.2 brain4 SABER Seq; Danio rerio; RNA Seq	GSM8290063 r1	GSM8290063	1	Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer's instructions Single Cell three prime v3 kit. Transcriptome libraries were sequenced using HiSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads used initially and supernatant was rebound…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP509892		loader:fastq load.py	SABERb4_linB2.2-14.124.2_S2_L002_I1_001.fastq.gz SABERb4_linB2.2-14.124.2_S2_L002_I2_001.fastq.gz SABERb4_linB2.2-14.124.2_S2_L002_R1_001.fastq.gz SABERb4_linB2.2-14.124.2_S2_L002_R2_001.fastq.gz	fastq fastq fastq fastq	28009093188.0	140749212.0	GSM8290063 r1	0:10 1:10 2:28 3:151	A:5808319224;C:5111068156;G:5728880143;T:4604800178;N:63311	10	10	28	151	5808319224	5111068156	5728880143	4604800178	63311	SRX24701872	SRS21429401	SRA1878107	University of Pennsylvania	University of Pennsylvania	1	0.03458		0.03418		0.99959		0.4035		151		B		usable mapping rate	illumina	novaseq_era	full_length	random_priming	unknown	sc	single_cell_droplet	10x	United States	2024-05-25	Larval	Larval	Brain	Nervous System
32374	32374	SRR29181692	SRX24701871	SRS21429400	SRP509892	PRJNA1116548	Barcoding Notch signaling in the developing brain	GSE268356	Other	Developmental signaling inputs are fundamental for shaping cell fates and behavior. However traditional fluorescent based signaling reporters have limitations in scalability and molecular resolution of cell types. We present SABER seq a CRISPR Cas molecular recorder that stores transient developmental signaling cues as permanent mutations in cellular genomes for deconstruction at later stages via single cell transcriptomics. We applied SABER seq to record Notch signaling in developing zebrafish brains. SABER seq has two components: a signaling sensor and a barcode recorder. The sensor activates Cas9 in a Notch dependent manner with inducible control while the recorder obtains mutations in ancestral cells where Notch is active. We combine SABER seq with an expanded juvenile brain atlas to identify cell types derived from Notch active founders. Our data reveals rare examples where differential Notch activity in ancestral progenitors is detected in terminally differentiated neuronal subtypes. SABER seq is a novel platform for rapid scalable and high resolution mapping of signaling activity during development. Overall design: 10x Genomics libraries of single cell transcriptomes and SABER seq data and genomic DNA SABER data		pubmed:39575683		SABERb4 linB2.1 13.123.2 brain4 SABER Seq	GSM8290062		source name:zebrafish whole brain\|tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB\|geo loc name:missing\|collection date:missing	SABERb4 linB2.1 13.123.2 brain4 SABER Seq	Raw FASTQ reads were aligned against zebrafish genome built from GRCz.109.gtf and the GRCz11.fa files using the Cell Ranger count pipeline to generate gene by cell count matrices filtered barcode matrix. The count matrices were processed using the standard workflow of the Seurat v5.0.2 R package with modifications. Briefly all count matrices were separately loaded into R. Seurat objects were then created with modified parameters requiring features to be detected in at least 3 cells and cells to contain at least 300 genes. Subsequently the Seurat objects were merged to create a single Seurat object. Cells with RNA counts between 300 and 4000 and a mitochondrial gene percentage of less than 9% were selected for downstream analysis. Gene expression values were log normalized with the default parameters and scaled for the top 3000 variable genes. The scaled data was then used to compute the 50 principal components. Cells were iteratively clustered using the Louvain algorithm post identifying neighboring cells. Differentially expressed genes for each cluster were identified using genes that are detected in at least 10% of cells in either of the two clusters and genes showing a minimum difference of 10% between the two clusters. Cell types were annotated using known marker genes. The SABER seq FASTQ reads were processed using the Cell Ranger count pipeline similar to the transcriptomic reads. A bash script was then used to generate a text file containing all FASTQ headers and error corrected cell barcodes for SABER seq data. post loading filtered barcode matrices into R error corrected cell barcodes from transcriptomic reads were isolated and matched against those in the text file to identify common cell barcode that are shared between the transcriptomic and SABER seq datasets. The resulting text file contained redundant error corrected cell barcodes associated with different UMIs for the same cell. Thus unique error corrected cell barcodes were isolated to create a text file containing unique FASTQ headers an…	zebrafish whole brain		Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer’s instructions Single Cell 3’ v3 kit. Transcriptome libraries were sequenced using HiSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads used initially and supernatant was rebound with 1.5…	This work was performed under protocol numbers 807110 and 807259 which were approved by the University of Pennsylvania’s Office of Animal Welfare of Institutional Animal Care and Use Committee IACUC. All zebrafish work in this study follows the University of Pennsylvania Institutional Animal Care and Use Committee regulations.	tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB	GSM8290062	GSM8290062: SABERb4 linB2.1 13.123.2 brain4 SABER Seq; Danio rerio; RNA Seq	GSM8290062 r1	GSM8290062	1	Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer's instructions Single Cell three prime v3 kit. Transcriptome libraries were sequenced using HiSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads used initially and supernatant was rebound…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP509892		loader:fastq load.py	SABERb4_linB2.1-13.123.2_S1_L002_R2_001.fastq.gz SABERb4_linB2.1-13.123.2_S1_L002_R1_001.fastq.gz SABERb4_linB2.1-13.123.2_S1_L002_I2_001.fastq.gz SABERb4_linB2.1-13.123.2_S1_L002_I1_001.fastq.gz	fastq fastq fastq fastq	22391839991.0	112521809.0	GSM8290062 r1	0:10 1:10 2:28 3:151	A:4658062266;C:4632110229;G:4512962055;T:3187608704;N:49905	10	10	28	151	4658062266	4632110229	4512962055	3187608704	49905	SRX24701871	SRS21429400	SRA1878107	University of Pennsylvania	University of Pennsylvania	1	0.00192		0.00168		0.99951		0.67647		151		T		under 1.2% mapping rate	illumina	novaseq_era	full_length	random_priming	unknown	sc	single_cell_droplet	10x	United States	2024-05-25	Larval	Larval	Brain	Nervous System
32375	32375	SRR29181679	SRX24701870	SRS21429399	SRP509892	PRJNA1116548	Barcoding Notch signaling in the developing brain	GSE268356	Other	Developmental signaling inputs are fundamental for shaping cell fates and behavior. However traditional fluorescent based signaling reporters have limitations in scalability and molecular resolution of cell types. We present SABER seq a CRISPR Cas molecular recorder that stores transient developmental signaling cues as permanent mutations in cellular genomes for deconstruction at later stages via single cell transcriptomics. We applied SABER seq to record Notch signaling in developing zebrafish brains. SABER seq has two components: a signaling sensor and a barcode recorder. The sensor activates Cas9 in a Notch dependent manner with inducible control while the recorder obtains mutations in ancestral cells where Notch is active. We combine SABER seq with an expanded juvenile brain atlas to identify cell types derived from Notch active founders. Our data reveals rare examples where differential Notch activity in ancestral progenitors is detected in terminally differentiated neuronal subtypes. SABER seq is a novel platform for rapid scalable and high resolution mapping of signaling activity during development. Overall design: 10x Genomics libraries of single cell transcriptomes and SABER seq data and genomic DNA SABER data		pubmed:39575683		SABERb4 brainB2 2 brain4 transcriptome	GSM8290056		source name:zebrafish whole brain\|tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB\|geo loc name:missing\|collection date:missing	SABERb4 brainB2 2 brain4 transcriptome	Raw FASTQ reads were aligned against zebrafish genome built from GRCz.109.gtf and the GRCz11.fa files using the Cell Ranger count pipeline to generate gene by cell count matrices filtered barcode matrix. The count matrices were processed using the standard workflow of the Seurat v5.0.2 R package with modifications. Briefly all count matrices were separately loaded into R. Seurat objects were then created with modified parameters requiring features to be detected in at least 3 cells and cells to contain at least 300 genes. Subsequently the Seurat objects were merged to create a single Seurat object. Cells with RNA counts between 300 and 4000 and a mitochondrial gene percentage of less than 9% were selected for downstream analysis. Gene expression values were log normalized with the default parameters and scaled for the top 3000 variable genes. The scaled data was then used to compute the 50 principal components. Cells were iteratively clustered using the Louvain algorithm post identifying neighboring cells. Differentially expressed genes for each cluster were identified using genes that are detected in at least 10% of cells in either of the two clusters and genes showing a minimum difference of 10% between the two clusters. Cell types were annotated using known marker genes. The SABER seq FASTQ reads were processed using the Cell Ranger count pipeline similar to the transcriptomic reads. A bash script was then used to generate a text file containing all FASTQ headers and error corrected cell barcodes for SABER seq data. post loading filtered barcode matrices into R error corrected cell barcodes from transcriptomic reads were isolated and matched against those in the text file to identify common cell barcode that are shared between the transcriptomic and SABER seq datasets. The resulting text file contained redundant error corrected cell barcodes associated with different UMIs for the same cell. Thus unique error corrected cell barcodes were isolated to create a text file containing unique FASTQ headers an…	zebrafish whole brain		Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer’s instructions Single Cell 3’ v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads used initi…	This work was performed under protocol numbers 807110 and 807259 which were approved by the University of Pennsylvania’s Office of Animal Welfare of Institutional Animal Care and Use Committee IACUC. All zebrafish work in this study follows the University of Pennsylvania Institutional Animal Care and Use Committee regulations.	tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB	GSM8290056	GSM8290056: SABERb4 brainB2 2 brain4 transcriptome; Danio rerio; RNA Seq	GSM8290056 r1	GSM8290056	1	Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer's instructions Single Cell three prime v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads u…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP509892		loader:fastq load.py	SABERb4_brainB2_2_S4_L001_R2_001.fastq.gz SABERb4_brainB2_2_S4_L001_R1_001.fastq.gz SABERb4_brainB2_2_S4_L001_I2_001.fastq.gz SABERb4_brainB2_2_S4_L001_I1_001.fastq.gz	fastq fastq fastq fastq	22587540571.0	113505229.0	GSM8290056 r1	0:10 1:10 2:28 3:151	A:5299086616;C:3418923384;G:3717477937;T:4703769200;N:32442	10	10	28	151	5299086616	3418923384	3717477937	4703769200	32442	SRX24701870	SRS21429399	SRA1989588	University of Pennsylvania	University of Pennsylvania	1	0.88382		0.22459		0.76524		0.54792		151		B		usable mapping rate	illumina	novaseq_era	full_length	random_priming	unknown	sc	single_cell_droplet	10x	United States	2024-05-25	Larval	Larval	Brain	Nervous System
32376	32376	SRR29181684	SRX24701869	SRS21429398	SRP509892	PRJNA1116548	Barcoding Notch signaling in the developing brain	GSE268356	Other	Developmental signaling inputs are fundamental for shaping cell fates and behavior. However traditional fluorescent based signaling reporters have limitations in scalability and molecular resolution of cell types. We present SABER seq a CRISPR Cas molecular recorder that stores transient developmental signaling cues as permanent mutations in cellular genomes for deconstruction at later stages via single cell transcriptomics. We applied SABER seq to record Notch signaling in developing zebrafish brains. SABER seq has two components: a signaling sensor and a barcode recorder. The sensor activates Cas9 in a Notch dependent manner with inducible control while the recorder obtains mutations in ancestral cells where Notch is active. We combine SABER seq with an expanded juvenile brain atlas to identify cell types derived from Notch active founders. Our data reveals rare examples where differential Notch activity in ancestral progenitors is detected in terminally differentiated neuronal subtypes. SABER seq is a novel platform for rapid scalable and high resolution mapping of signaling activity during development. Overall design: 10x Genomics libraries of single cell transcriptomes and SABER seq data and genomic DNA SABER data		pubmed:39575683		SABERb4 brainB2 1 brain4 transcriptome	GSM8290055		source name:zebrafish whole brain\|tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB\|geo loc name:missing\|collection date:missing	SABERb4 brainB2 1 brain4 transcriptome	Raw FASTQ reads were aligned against zebrafish genome built from GRCz.109.gtf and the GRCz11.fa files using the Cell Ranger count pipeline to generate gene by cell count matrices filtered barcode matrix. The count matrices were processed using the standard workflow of the Seurat v5.0.2 R package with modifications. Briefly all count matrices were separately loaded into R. Seurat objects were then created with modified parameters requiring features to be detected in at least 3 cells and cells to contain at least 300 genes. Subsequently the Seurat objects were merged to create a single Seurat object. Cells with RNA counts between 300 and 4000 and a mitochondrial gene percentage of less than 9% were selected for downstream analysis. Gene expression values were log normalized with the default parameters and scaled for the top 3000 variable genes. The scaled data was then used to compute the 50 principal components. Cells were iteratively clustered using the Louvain algorithm post identifying neighboring cells. Differentially expressed genes for each cluster were identified using genes that are detected in at least 10% of cells in either of the two clusters and genes showing a minimum difference of 10% between the two clusters. Cell types were annotated using known marker genes. The SABER seq FASTQ reads were processed using the Cell Ranger count pipeline similar to the transcriptomic reads. A bash script was then used to generate a text file containing all FASTQ headers and error corrected cell barcodes for SABER seq data. post loading filtered barcode matrices into R error corrected cell barcodes from transcriptomic reads were isolated and matched against those in the text file to identify common cell barcode that are shared between the transcriptomic and SABER seq datasets. The resulting text file contained redundant error corrected cell barcodes associated with different UMIs for the same cell. Thus unique error corrected cell barcodes were isolated to create a text file containing unique FASTQ headers an…	zebrafish whole brain		Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer’s instructions Single Cell 3’ v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads used initi…	This work was performed under protocol numbers 807110 and 807259 which were approved by the University of Pennsylvania’s Office of Animal Welfare of Institutional Animal Care and Use Committee IACUC. All zebrafish work in this study follows the University of Pennsylvania Institutional Animal Care and Use Committee regulations.	tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB	GSM8290055	GSM8290055: SABERb4 brainB2 1 brain4 transcriptome; Danio rerio; RNA Seq	GSM8290055 r1	GSM8290055	1	Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer's instructions Single Cell three prime v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads u…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP509892		loader:fastq load.py	SABERb4_brainB2_1_S3_L001_I1_001.fastq.gz SABERb4_brainB2_1_S3_L001_I2_001.fastq.gz SABERb4_brainB2_1_S3_L001_R1_001.fastq.gz SABERb4_brainB2_1_S3_L001_R2_001.fastq.gz	fastq fastq fastq fastq	20888284944.0	104966256.0	GSM8290055 r1	0:10 1:10 2:28 3:151	A:4874988462;C:3170609788;G:3451838907;T:4352436953;N:30546	10	10	28	151	4874988462	3170609788	3451838907	4352436953	30546	SRX24701869	SRS21429398	SRA1989588	University of Pennsylvania	University of Pennsylvania	1	0.88685		0.21914		0.76171		0.54873		151		B		usable mapping rate	illumina	novaseq_era	full_length	random_priming	unknown	sc	single_cell_droplet	10x	United States	2024-05-25	Larval	Larval	Brain	Nervous System
32377	32377	SRR29181683	SRX24701868	SRS21429397	SRP509892	PRJNA1116548	Barcoding Notch signaling in the developing brain	GSE268356	Other	Developmental signaling inputs are fundamental for shaping cell fates and behavior. However traditional fluorescent based signaling reporters have limitations in scalability and molecular resolution of cell types. We present SABER seq a CRISPR Cas molecular recorder that stores transient developmental signaling cues as permanent mutations in cellular genomes for deconstruction at later stages via single cell transcriptomics. We applied SABER seq to record Notch signaling in developing zebrafish brains. SABER seq has two components: a signaling sensor and a barcode recorder. The sensor activates Cas9 in a Notch dependent manner with inducible control while the recorder obtains mutations in ancestral cells where Notch is active. We combine SABER seq with an expanded juvenile brain atlas to identify cell types derived from Notch active founders. Our data reveals rare examples where differential Notch activity in ancestral progenitors is detected in terminally differentiated neuronal subtypes. SABER seq is a novel platform for rapid scalable and high resolution mapping of signaling activity during development. Overall design: 10x Genomics libraries of single cell transcriptomes and SABER seq data and genomic DNA SABER data		pubmed:39575683		SABERb3 brainB1 2 brain3 transcriptome	GSM8290054		source name:zebrafish whole brain\|tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB\|geo loc name:missing\|collection date:missing	SABERb3 brainB1 2 brain3 transcriptome	Raw FASTQ reads were aligned against zebrafish genome built from GRCz.109.gtf and the GRCz11.fa files using the Cell Ranger count pipeline to generate gene by cell count matrices filtered barcode matrix. The count matrices were processed using the standard workflow of the Seurat v5.0.2 R package with modifications. Briefly all count matrices were separately loaded into R. Seurat objects were then created with modified parameters requiring features to be detected in at least 3 cells and cells to contain at least 300 genes. Subsequently the Seurat objects were merged to create a single Seurat object. Cells with RNA counts between 300 and 4000 and a mitochondrial gene percentage of less than 9% were selected for downstream analysis. Gene expression values were log normalized with the default parameters and scaled for the top 3000 variable genes. The scaled data was then used to compute the 50 principal components. Cells were iteratively clustered using the Louvain algorithm post identifying neighboring cells. Differentially expressed genes for each cluster were identified using genes that are detected in at least 10% of cells in either of the two clusters and genes showing a minimum difference of 10% between the two clusters. Cell types were annotated using known marker genes. The SABER seq FASTQ reads were processed using the Cell Ranger count pipeline similar to the transcriptomic reads. A bash script was then used to generate a text file containing all FASTQ headers and error corrected cell barcodes for SABER seq data. post loading filtered barcode matrices into R error corrected cell barcodes from transcriptomic reads were isolated and matched against those in the text file to identify common cell barcode that are shared between the transcriptomic and SABER seq datasets. The resulting text file contained redundant error corrected cell barcodes associated with different UMIs for the same cell. Thus unique error corrected cell barcodes were isolated to create a text file containing unique FASTQ headers an…	zebrafish whole brain		Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer’s instructions Single Cell 3’ v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads used initi…	This work was performed under protocol numbers 807110 and 807259 which were approved by the University of Pennsylvania’s Office of Animal Welfare of Institutional Animal Care and Use Committee IACUC. All zebrafish work in this study follows the University of Pennsylvania Institutional Animal Care and Use Committee regulations.	tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB	GSM8290054	GSM8290054: SABERb3 brainB1 2 brain3 transcriptome; Danio rerio; RNA Seq	GSM8290054 r1	GSM8290054	1	Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer's instructions Single Cell three prime v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads u…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP509892		loader:fastq load.py	SABERb3_brainB1_2_S2_L001_I1_001.fastq.gz SABERb3_brainB1_2_S2_L001_I2_001.fastq.gz SABERb3_brainB1_2_S2_L001_R1_001.fastq.gz SABERb3_brainB1_2_S2_L001_R2_001.fastq.gz	fastq fastq fastq fastq	20587460226.0	103454574.0	GSM8290054 r1	0:10 1:10 2:28 3:151	A:4824812347;C:3103279976;G:3383117839;T:4310400919;N:29593	10	10	28	151	4824812347	3103279976	3383117839	4310400919	29593	SRX24701868	SRS21429397	SRA1989588	University of Pennsylvania	University of Pennsylvania	1	0.87976		0.21404		0.77433		0.52975		151		B		usable mapping rate	illumina	novaseq_era	full_length	random_priming	unknown	sc	single_cell_droplet	10x	United States	2024-05-25	Larval	Larval	Brain	Nervous System
32378	32378	SRR29181682	SRX24701867	SRS21429396	SRP509892	PRJNA1116548	Barcoding Notch signaling in the developing brain	GSE268356	Other	Developmental signaling inputs are fundamental for shaping cell fates and behavior. However traditional fluorescent based signaling reporters have limitations in scalability and molecular resolution of cell types. We present SABER seq a CRISPR Cas molecular recorder that stores transient developmental signaling cues as permanent mutations in cellular genomes for deconstruction at later stages via single cell transcriptomics. We applied SABER seq to record Notch signaling in developing zebrafish brains. SABER seq has two components: a signaling sensor and a barcode recorder. The sensor activates Cas9 in a Notch dependent manner with inducible control while the recorder obtains mutations in ancestral cells where Notch is active. We combine SABER seq with an expanded juvenile brain atlas to identify cell types derived from Notch active founders. Our data reveals rare examples where differential Notch activity in ancestral progenitors is detected in terminally differentiated neuronal subtypes. SABER seq is a novel platform for rapid scalable and high resolution mapping of signaling activity during development. Overall design: 10x Genomics libraries of single cell transcriptomes and SABER seq data and genomic DNA SABER data		pubmed:39575683		SABERb3 brainB1 1 brain3 transcriptome	GSM8290053		source name:zebrafish whole brain\|tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB\|geo loc name:missing\|collection date:missing	SABERb3 brainB1 1 brain3 transcriptome	Raw FASTQ reads were aligned against zebrafish genome built from GRCz.109.gtf and the GRCz11.fa files using the Cell Ranger count pipeline to generate gene by cell count matrices filtered barcode matrix. The count matrices were processed using the standard workflow of the Seurat v5.0.2 R package with modifications. Briefly all count matrices were separately loaded into R. Seurat objects were then created with modified parameters requiring features to be detected in at least 3 cells and cells to contain at least 300 genes. Subsequently the Seurat objects were merged to create a single Seurat object. Cells with RNA counts between 300 and 4000 and a mitochondrial gene percentage of less than 9% were selected for downstream analysis. Gene expression values were log normalized with the default parameters and scaled for the top 3000 variable genes. The scaled data was then used to compute the 50 principal components. Cells were iteratively clustered using the Louvain algorithm post identifying neighboring cells. Differentially expressed genes for each cluster were identified using genes that are detected in at least 10% of cells in either of the two clusters and genes showing a minimum difference of 10% between the two clusters. Cell types were annotated using known marker genes. The SABER seq FASTQ reads were processed using the Cell Ranger count pipeline similar to the transcriptomic reads. A bash script was then used to generate a text file containing all FASTQ headers and error corrected cell barcodes for SABER seq data. post loading filtered barcode matrices into R error corrected cell barcodes from transcriptomic reads were isolated and matched against those in the text file to identify common cell barcode that are shared between the transcriptomic and SABER seq datasets. The resulting text file contained redundant error corrected cell barcodes associated with different UMIs for the same cell. Thus unique error corrected cell barcodes were isolated to create a text file containing unique FASTQ headers an…	zebrafish whole brain		Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer’s instructions Single Cell 3’ v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads used initi…	This work was performed under protocol numbers 807110 and 807259 which were approved by the University of Pennsylvania’s Office of Animal Welfare of Institutional Animal Care and Use Committee IACUC. All zebrafish work in this study follows the University of Pennsylvania Institutional Animal Care and Use Committee regulations.	tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB	GSM8290053	GSM8290053: SABERb3 brainB1 1 brain3 transcriptome; Danio rerio; RNA Seq	GSM8290053 r1	GSM8290053	1	Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer's instructions Single Cell three prime v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads u…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP509892		loader:fastq load.py	SABERb3_brainB1_1_S1_L001_I1_001.fastq.gz SABERb3_brainB1_1_S1_L001_I2_001.fastq.gz SABERb3_brainB1_1_S1_L001_R1_001.fastq.gz SABERb3_brainB1_1_S1_L001_R2_001.fastq.gz	fastq fastq fastq fastq	23045577279.0	115806921.0	GSM8290053 r1	0:10 1:10 2:28 3:151	A:5424649891;C:3461670114;G:3767563304;T:4832928748;N:33014	10	10	28	151	5424649891	3461670114	3767563304	4832928748	33014	SRX24701867	SRS21429396	SRA1989588	University of Pennsylvania	University of Pennsylvania	1	0.87779		0.21879		0.76934		0.52923		151		B		usable mapping rate	illumina	novaseq_era	full_length	random_priming	unknown	sc	single_cell_droplet	10x	United States	2024-05-25	Larval	Larval	Brain	Nervous System
32379	32379	SRR29181681	SRX24701866	SRS21429395	SRP509892	PRJNA1116548	Barcoding Notch signaling in the developing brain	GSE268356	Other	Developmental signaling inputs are fundamental for shaping cell fates and behavior. However traditional fluorescent based signaling reporters have limitations in scalability and molecular resolution of cell types. We present SABER seq a CRISPR Cas molecular recorder that stores transient developmental signaling cues as permanent mutations in cellular genomes for deconstruction at later stages via single cell transcriptomics. We applied SABER seq to record Notch signaling in developing zebrafish brains. SABER seq has two components: a signaling sensor and a barcode recorder. The sensor activates Cas9 in a Notch dependent manner with inducible control while the recorder obtains mutations in ancestral cells where Notch is active. We combine SABER seq with an expanded juvenile brain atlas to identify cell types derived from Notch active founders. Our data reveals rare examples where differential Notch activity in ancestral progenitors is detected in terminally differentiated neuronal subtypes. SABER seq is a novel platform for rapid scalable and high resolution mapping of signaling activity during development. Overall design: 10x Genomics libraries of single cell transcriptomes and SABER seq data and genomic DNA SABER data		pubmed:39575683		SABERb2 brainD3091523wk3 Novogene Run1 brain2 transcriptome	GSM8290052		source name:zebrafish whole brain\|tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB\|geo loc name:missing\|collection date:missing	SABERb2 brainD3091523wk3 Novogene Run1 brain2 transcriptome	Raw FASTQ reads were aligned against zebrafish genome built from GRCz.109.gtf and the GRCz11.fa files using the Cell Ranger count pipeline to generate gene by cell count matrices filtered barcode matrix. The count matrices were processed using the standard workflow of the Seurat v5.0.2 R package with modifications. Briefly all count matrices were separately loaded into R. Seurat objects were then created with modified parameters requiring features to be detected in at least 3 cells and cells to contain at least 300 genes. Subsequently the Seurat objects were merged to create a single Seurat object. Cells with RNA counts between 300 and 4000 and a mitochondrial gene percentage of less than 9% were selected for downstream analysis. Gene expression values were log normalized with the default parameters and scaled for the top 3000 variable genes. The scaled data was then used to compute the 50 principal components. Cells were iteratively clustered using the Louvain algorithm post identifying neighboring cells. Differentially expressed genes for each cluster were identified using genes that are detected in at least 10% of cells in either of the two clusters and genes showing a minimum difference of 10% between the two clusters. Cell types were annotated using known marker genes. The SABER seq FASTQ reads were processed using the Cell Ranger count pipeline similar to the transcriptomic reads. A bash script was then used to generate a text file containing all FASTQ headers and error corrected cell barcodes for SABER seq data. post loading filtered barcode matrices into R error corrected cell barcodes from transcriptomic reads were isolated and matched against those in the text file to identify common cell barcode that are shared between the transcriptomic and SABER seq datasets. The resulting text file contained redundant error corrected cell barcodes associated with different UMIs for the same cell. Thus unique error corrected cell barcodes were isolated to create a text file containing unique FASTQ headers an…	zebrafish whole brain		Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer’s instructions Single Cell 3’ v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads used initi…	This work was performed under protocol numbers 807110 and 807259 which were approved by the University of Pennsylvania’s Office of Animal Welfare of Institutional Animal Care and Use Committee IACUC. All zebrafish work in this study follows the University of Pennsylvania Institutional Animal Care and Use Committee regulations.	tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB	GSM8290052	GSM8290052: SABERb2 brainD3091523wk3 Novogene Run1 brain2 transcriptome; Danio rerio; RNA Seq	GSM8290052 r1	GSM8290052	1	Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer's instructions Single Cell three prime v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads u…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP509892		loader:fastq load.py	SABERb2_brainD3091523wk3_CKDL230038569-1A_HHVLTDSX7_S6_L002_I1_001.fastq.gz SABERb2_brainD3091523wk3_CKDL230038569-1A_HHVLTDSX7_S6_L002_I2_001.fastq.gz SABERb2_brainD3091523wk3_CKDL230038569-1A_HHVLTDSX7_S6_L002_R1_001.fastq.gz SABERb2_brainD3091523wk3_CKDL230038569-1A_HHVLTDSX7_S6_L002_R2_001.fastq.gz	fastq fastq fastq fastq	14986744960.0	46833578.0	GSM8290052 r1	0:10 1:10 2:150 3:150	A:4103966301;C:2123224314;G:2431703551;T:5390322981;N:856253	10	10	150	150	4103966301	2123224314	2431703551	5390322981	856253	SRX24701866	SRS21429395	SRA1989588	University of Pennsylvania	University of Pennsylvania	2	0.31404	0.88682	0.119	0.21308	0.96812	0.76295	0.52318	0.54494	150	150	T	B	mate1 technical by mapping diff	illumina	novaseq_era	full_length	random_priming	unknown	sc	single_cell_droplet	10x	United States	2024-05-25	Larval	Larval	Brain	Nervous System
32380	32380	SRR29181680	SRX24701865	SRS21429394	SRP509892	PRJNA1116548	Barcoding Notch signaling in the developing brain	GSE268356	Other	Developmental signaling inputs are fundamental for shaping cell fates and behavior. However traditional fluorescent based signaling reporters have limitations in scalability and molecular resolution of cell types. We present SABER seq a CRISPR Cas molecular recorder that stores transient developmental signaling cues as permanent mutations in cellular genomes for deconstruction at later stages via single cell transcriptomics. We applied SABER seq to record Notch signaling in developing zebrafish brains. SABER seq has two components: a signaling sensor and a barcode recorder. The sensor activates Cas9 in a Notch dependent manner with inducible control while the recorder obtains mutations in ancestral cells where Notch is active. We combine SABER seq with an expanded juvenile brain atlas to identify cell types derived from Notch active founders. Our data reveals rare examples where differential Notch activity in ancestral progenitors is detected in terminally differentiated neuronal subtypes. SABER seq is a novel platform for rapid scalable and high resolution mapping of signaling activity during development. Overall design: 10x Genomics libraries of single cell transcriptomes and SABER seq data and genomic DNA SABER data		pubmed:39575683		SABERb2 brainD2091523wk3 Novogene Run1 brain2 transcriptome	GSM8290051		source name:zebrafish whole brain\|tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB\|geo loc name:missing\|collection date:missing	SABERb2 brainD2091523wk3 Novogene Run1 brain2 transcriptome	Raw FASTQ reads were aligned against zebrafish genome built from GRCz.109.gtf and the GRCz11.fa files using the Cell Ranger count pipeline to generate gene by cell count matrices filtered barcode matrix. The count matrices were processed using the standard workflow of the Seurat v5.0.2 R package with modifications. Briefly all count matrices were separately loaded into R. Seurat objects were then created with modified parameters requiring features to be detected in at least 3 cells and cells to contain at least 300 genes. Subsequently the Seurat objects were merged to create a single Seurat object. Cells with RNA counts between 300 and 4000 and a mitochondrial gene percentage of less than 9% were selected for downstream analysis. Gene expression values were log normalized with the default parameters and scaled for the top 3000 variable genes. The scaled data was then used to compute the 50 principal components. Cells were iteratively clustered using the Louvain algorithm post identifying neighboring cells. Differentially expressed genes for each cluster were identified using genes that are detected in at least 10% of cells in either of the two clusters and genes showing a minimum difference of 10% between the two clusters. Cell types were annotated using known marker genes. The SABER seq FASTQ reads were processed using the Cell Ranger count pipeline similar to the transcriptomic reads. A bash script was then used to generate a text file containing all FASTQ headers and error corrected cell barcodes for SABER seq data. post loading filtered barcode matrices into R error corrected cell barcodes from transcriptomic reads were isolated and matched against those in the text file to identify common cell barcode that are shared between the transcriptomic and SABER seq datasets. The resulting text file contained redundant error corrected cell barcodes associated with different UMIs for the same cell. Thus unique error corrected cell barcodes were isolated to create a text file containing unique FASTQ headers an…	zebrafish whole brain		Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer’s instructions Single Cell 3’ v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads used initi…	This work was performed under protocol numbers 807110 and 807259 which were approved by the University of Pennsylvania’s Office of Animal Welfare of Institutional Animal Care and Use Committee IACUC. All zebrafish work in this study follows the University of Pennsylvania Institutional Animal Care and Use Committee regulations.	tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB	GSM8290051	GSM8290051: SABERb2 brainD2091523wk3 Novogene Run1 brain2 transcriptome; Danio rerio; RNA Seq	GSM8290051 r1	GSM8290051	1	Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer's instructions Single Cell three prime v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads u…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP509892		loader:fastq load.py	SABERb2_brainD2091523wk3_CKDL230038569-1A_HHVLTDSX7_S1_L002_I1_001.fastq.gz SABERb2_brainD2091523wk3_CKDL230038569-1A_HHVLTDSX7_S1_L002_I2_001.fastq.gz SABERb2_brainD2091523wk3_CKDL230038569-1A_HHVLTDSX7_S1_L002_R1_001.fastq.gz SABERb2_brainD2091523wk3_CKDL230038569-1A_HHVLTDSX7_S1_L002_R2_001.fastq.gz	fastq fastq fastq fastq	13432883520.0	41977761.0	GSM8290051 r1	0:10 1:10 2:150 3:150	A:3699233635;C:1894101532;G:2175321862;T:4823892315;N:778956	10	10	150	150	3699233635	1894101532	2175321862	4823892315	778956	SRX24701865	SRS21429394	SRA1989588	University of Pennsylvania	University of Pennsylvania	2	0.32482	0.8828	0.12828	0.21873	0.96668	0.76534	0.51473	0.5505	150	150	T	B	mate1 technical by mapping diff	illumina	novaseq_era	full_length	random_priming	unknown	sc	single_cell_droplet	10x	United States	2024-05-25	Larval	Larval	Brain	Nervous System
32381	32381	SRR29181685	SRX24701864	SRS21429393	SRP509892	PRJNA1116548	Barcoding Notch signaling in the developing brain	GSE268356	Other	Developmental signaling inputs are fundamental for shaping cell fates and behavior. However traditional fluorescent based signaling reporters have limitations in scalability and molecular resolution of cell types. We present SABER seq a CRISPR Cas molecular recorder that stores transient developmental signaling cues as permanent mutations in cellular genomes for deconstruction at later stages via single cell transcriptomics. We applied SABER seq to record Notch signaling in developing zebrafish brains. SABER seq has two components: a signaling sensor and a barcode recorder. The sensor activates Cas9 in a Notch dependent manner with inducible control while the recorder obtains mutations in ancestral cells where Notch is active. We combine SABER seq with an expanded juvenile brain atlas to identify cell types derived from Notch active founders. Our data reveals rare examples where differential Notch activity in ancestral progenitors is detected in terminally differentiated neuronal subtypes. SABER seq is a novel platform for rapid scalable and high resolution mapping of signaling activity during development. Overall design: 10x Genomics libraries of single cell transcriptomes and SABER seq data and genomic DNA SABER data		pubmed:39575683		SABERb2 brainD1091523wk3 Novogene Run1 brain2 transcriptome	GSM8290050		source name:zebrafish whole brain\|tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB\|geo loc name:missing\|collection date:missing	SABERb2 brainD1091523wk3 Novogene Run1 brain2 transcriptome	Raw FASTQ reads were aligned against zebrafish genome built from GRCz.109.gtf and the GRCz11.fa files using the Cell Ranger count pipeline to generate gene by cell count matrices filtered barcode matrix. The count matrices were processed using the standard workflow of the Seurat v5.0.2 R package with modifications. Briefly all count matrices were separately loaded into R. Seurat objects were then created with modified parameters requiring features to be detected in at least 3 cells and cells to contain at least 300 genes. Subsequently the Seurat objects were merged to create a single Seurat object. Cells with RNA counts between 300 and 4000 and a mitochondrial gene percentage of less than 9% were selected for downstream analysis. Gene expression values were log normalized with the default parameters and scaled for the top 3000 variable genes. The scaled data was then used to compute the 50 principal components. Cells were iteratively clustered using the Louvain algorithm post identifying neighboring cells. Differentially expressed genes for each cluster were identified using genes that are detected in at least 10% of cells in either of the two clusters and genes showing a minimum difference of 10% between the two clusters. Cell types were annotated using known marker genes. The SABER seq FASTQ reads were processed using the Cell Ranger count pipeline similar to the transcriptomic reads. A bash script was then used to generate a text file containing all FASTQ headers and error corrected cell barcodes for SABER seq data. post loading filtered barcode matrices into R error corrected cell barcodes from transcriptomic reads were isolated and matched against those in the text file to identify common cell barcode that are shared between the transcriptomic and SABER seq datasets. The resulting text file contained redundant error corrected cell barcodes associated with different UMIs for the same cell. Thus unique error corrected cell barcodes were isolated to create a text file containing unique FASTQ headers an…	zebrafish whole brain		Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer’s instructions Single Cell 3’ v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads used initi…	This work was performed under protocol numbers 807110 and 807259 which were approved by the University of Pennsylvania’s Office of Animal Welfare of Institutional Animal Care and Use Committee IACUC. All zebrafish work in this study follows the University of Pennsylvania Institutional Animal Care and Use Committee regulations.	tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB	GSM8290050	GSM8290050: SABERb2 brainD1091523wk3 Novogene Run1 brain2 transcriptome; Danio rerio; RNA Seq	GSM8290050 r1	GSM8290050	1	Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer's instructions Single Cell three prime v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads u…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP509892		loader:fastq load.py	SABERb2_brainD1091523wk3_CKDL230038569-1A_HHVLTDSX7_S2_L002_I1_001.fastq.gz SABERb2_brainD1091523wk3_CKDL230038569-1A_HHVLTDSX7_S2_L002_I2_001.fastq.gz SABERb2_brainD1091523wk3_CKDL230038569-1A_HHVLTDSX7_S2_L002_R1_001.fastq.gz SABERb2_brainD1091523wk3_CKDL230038569-1A_HHVLTDSX7_S2_L002_R2_001.fastq.gz	fastq fastq fastq fastq	17465671680.0	54580224.0	GSM8290050 r1	0:10 1:10 2:150 3:150	A:4799554780;C:2476125093;G:2831285237;T:6266103981;N:998109	10	10	150	150	4799554780	2476125093	2831285237	6266103981	998109	SRX24701864	SRS21429393	SRA1989588	University of Pennsylvania	University of Pennsylvania	2	0.32322	0.88514	0.12316	0.2147	0.96644	0.76378	0.54067	0.54053	150	150	T	B	mate1 technical by mapping diff	illumina	novaseq_era	full_length	random_priming	unknown	sc	single_cell_droplet	10x	United States	2024-05-25	Larval	Larval	Brain	Nervous System
32382	32382	SRR29181686	SRX24701863	SRS21429392	SRP509892	PRJNA1116548	Barcoding Notch signaling in the developing brain	GSE268356	Other	Developmental signaling inputs are fundamental for shaping cell fates and behavior. However traditional fluorescent based signaling reporters have limitations in scalability and molecular resolution of cell types. We present SABER seq a CRISPR Cas molecular recorder that stores transient developmental signaling cues as permanent mutations in cellular genomes for deconstruction at later stages via single cell transcriptomics. We applied SABER seq to record Notch signaling in developing zebrafish brains. SABER seq has two components: a signaling sensor and a barcode recorder. The sensor activates Cas9 in a Notch dependent manner with inducible control while the recorder obtains mutations in ancestral cells where Notch is active. We combine SABER seq with an expanded juvenile brain atlas to identify cell types derived from Notch active founders. Our data reveals rare examples where differential Notch activity in ancestral progenitors is detected in terminally differentiated neuronal subtypes. SABER seq is a novel platform for rapid scalable and high resolution mapping of signaling activity during development. Overall design: 10x Genomics libraries of single cell transcriptomes and SABER seq data and genomic DNA SABER data		pubmed:39575683		SABERb2 brainD3 Medgenome Run2 brain2 transcriptome	GSM8290049		source name:zebrafish whole brain\|tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB\|geo loc name:missing\|collection date:missing	SABERb2 brainD3 Medgenome Run2 brain2 transcriptome	Raw FASTQ reads were aligned against zebrafish genome built from GRCz.109.gtf and the GRCz11.fa files using the Cell Ranger count pipeline to generate gene by cell count matrices filtered barcode matrix. The count matrices were processed using the standard workflow of the Seurat v5.0.2 R package with modifications. Briefly all count matrices were separately loaded into R. Seurat objects were then created with modified parameters requiring features to be detected in at least 3 cells and cells to contain at least 300 genes. Subsequently the Seurat objects were merged to create a single Seurat object. Cells with RNA counts between 300 and 4000 and a mitochondrial gene percentage of less than 9% were selected for downstream analysis. Gene expression values were log normalized with the default parameters and scaled for the top 3000 variable genes. The scaled data was then used to compute the 50 principal components. Cells were iteratively clustered using the Louvain algorithm post identifying neighboring cells. Differentially expressed genes for each cluster were identified using genes that are detected in at least 10% of cells in either of the two clusters and genes showing a minimum difference of 10% between the two clusters. Cell types were annotated using known marker genes. The SABER seq FASTQ reads were processed using the Cell Ranger count pipeline similar to the transcriptomic reads. A bash script was then used to generate a text file containing all FASTQ headers and error corrected cell barcodes for SABER seq data. post loading filtered barcode matrices into R error corrected cell barcodes from transcriptomic reads were isolated and matched against those in the text file to identify common cell barcode that are shared between the transcriptomic and SABER seq datasets. The resulting text file contained redundant error corrected cell barcodes associated with different UMIs for the same cell. Thus unique error corrected cell barcodes were isolated to create a text file containing unique FASTQ headers an…	zebrafish whole brain		Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer’s instructions Single Cell 3’ v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads used initi…	This work was performed under protocol numbers 807110 and 807259 which were approved by the University of Pennsylvania’s Office of Animal Welfare of Institutional Animal Care and Use Committee IACUC. All zebrafish work in this study follows the University of Pennsylvania Institutional Animal Care and Use Committee regulations.	tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB	GSM8290049	GSM8290049: SABERb2 brainD3 Medgenome Run2 brain2 transcriptome; Danio rerio; RNA Seq	GSM8290049 r1	GSM8290049	1	Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer's instructions Single Cell three prime v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads u…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP509892		loader:fastq load.py	SABERb2_brainD3_S5_L002_I1_001.fastq.gz SABERb2_brainD3_S5_L002_I2_001.fastq.gz SABERb2_brainD3_S5_L002_R1_001.fastq.gz SABERb2_brainD3_S5_L002_R2_001.fastq.gz	fastq fastq fastq fastq	3868768652.0	27832868.0	GSM8290049 r1	0:10 1:10 2:28 3:91	A:764050790;C:511319919;G:550304072;T:707108210;N:7997	10	10	28	91	764050790	511319919	550304072	707108210	7997	SRX24701863	SRS21429392	SRA1989588	University of Pennsylvania	University of Pennsylvania	1	0.91168		0.2331		0.75933		0.55432		91		B		usable mapping rate	illumina	novaseq_era	full_length	random_priming	unknown	sc	single_cell_droplet	10x	United States	2024-05-25	Larval	Larval	Brain	Nervous System
32383	32383	SRR29181687	SRX24701863	SRS21429392	SRP509892	PRJNA1116548	Barcoding Notch signaling in the developing brain	GSE268356	Other	Developmental signaling inputs are fundamental for shaping cell fates and behavior. However traditional fluorescent based signaling reporters have limitations in scalability and molecular resolution of cell types. We present SABER seq a CRISPR Cas molecular recorder that stores transient developmental signaling cues as permanent mutations in cellular genomes for deconstruction at later stages via single cell transcriptomics. We applied SABER seq to record Notch signaling in developing zebrafish brains. SABER seq has two components: a signaling sensor and a barcode recorder. The sensor activates Cas9 in a Notch dependent manner with inducible control while the recorder obtains mutations in ancestral cells where Notch is active. We combine SABER seq with an expanded juvenile brain atlas to identify cell types derived from Notch active founders. Our data reveals rare examples where differential Notch activity in ancestral progenitors is detected in terminally differentiated neuronal subtypes. SABER seq is a novel platform for rapid scalable and high resolution mapping of signaling activity during development. Overall design: 10x Genomics libraries of single cell transcriptomes and SABER seq data and genomic DNA SABER data		pubmed:39575683		SABERb2 brainD3 Medgenome Run2 brain2 transcriptome	GSM8290049		source name:zebrafish whole brain\|tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB\|geo loc name:missing\|collection date:missing	SABERb2 brainD3 Medgenome Run2 brain2 transcriptome	Raw FASTQ reads were aligned against zebrafish genome built from GRCz.109.gtf and the GRCz11.fa files using the Cell Ranger count pipeline to generate gene by cell count matrices filtered barcode matrix. The count matrices were processed using the standard workflow of the Seurat v5.0.2 R package with modifications. Briefly all count matrices were separately loaded into R. Seurat objects were then created with modified parameters requiring features to be detected in at least 3 cells and cells to contain at least 300 genes. Subsequently the Seurat objects were merged to create a single Seurat object. Cells with RNA counts between 300 and 4000 and a mitochondrial gene percentage of less than 9% were selected for downstream analysis. Gene expression values were log normalized with the default parameters and scaled for the top 3000 variable genes. The scaled data was then used to compute the 50 principal components. Cells were iteratively clustered using the Louvain algorithm post identifying neighboring cells. Differentially expressed genes for each cluster were identified using genes that are detected in at least 10% of cells in either of the two clusters and genes showing a minimum difference of 10% between the two clusters. Cell types were annotated using known marker genes. The SABER seq FASTQ reads were processed using the Cell Ranger count pipeline similar to the transcriptomic reads. A bash script was then used to generate a text file containing all FASTQ headers and error corrected cell barcodes for SABER seq data. post loading filtered barcode matrices into R error corrected cell barcodes from transcriptomic reads were isolated and matched against those in the text file to identify common cell barcode that are shared between the transcriptomic and SABER seq datasets. The resulting text file contained redundant error corrected cell barcodes associated with different UMIs for the same cell. Thus unique error corrected cell barcodes were isolated to create a text file containing unique FASTQ headers an…	zebrafish whole brain		Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer’s instructions Single Cell 3’ v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads used initi…	This work was performed under protocol numbers 807110 and 807259 which were approved by the University of Pennsylvania’s Office of Animal Welfare of Institutional Animal Care and Use Committee IACUC. All zebrafish work in this study follows the University of Pennsylvania Institutional Animal Care and Use Committee regulations.	tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB	GSM8290049	GSM8290049: SABERb2 brainD3 Medgenome Run2 brain2 transcriptome; Danio rerio; RNA Seq	GSM8290049 r1	GSM8290049	1	Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer's instructions Single Cell three prime v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads u…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP509892		loader:fastq load.py	SABERb2_brainD3_S10_L002_I1_001.fastq.gz SABERb2_brainD3_S10_L002_I2_001.fastq.gz SABERb2_brainD3_S10_L002_R1_001.fastq.gz SABERb2_brainD3_S10_L002_R2_001.fastq.gz	fastq fastq fastq fastq	13116158150.0	94360850.0	GSM8290049 r2	0:10 1:10 2:28 3:91	A:2577084188;C:1740165795;G:1880702045;T:2388863291;N:22031	10	10	28	91	2577084188	1740165795	1880702045	2388863291	22031	SRX24701863	SRS21429392	SRA1989588	University of Pennsylvania	University of Pennsylvania	1	0.91186		0.23328		0.76088		0.55129		91		B		usable mapping rate	illumina	novaseq_era	full_length	random_priming	unknown	sc	single_cell_droplet	10x	United States	2024-05-25	Larval	Larval	Brain	Nervous System
32384	32384	SRR29181688	SRX24701862	SRS21429391	SRP509892	PRJNA1116548	Barcoding Notch signaling in the developing brain	GSE268356	Other	Developmental signaling inputs are fundamental for shaping cell fates and behavior. However traditional fluorescent based signaling reporters have limitations in scalability and molecular resolution of cell types. We present SABER seq a CRISPR Cas molecular recorder that stores transient developmental signaling cues as permanent mutations in cellular genomes for deconstruction at later stages via single cell transcriptomics. We applied SABER seq to record Notch signaling in developing zebrafish brains. SABER seq has two components: a signaling sensor and a barcode recorder. The sensor activates Cas9 in a Notch dependent manner with inducible control while the recorder obtains mutations in ancestral cells where Notch is active. We combine SABER seq with an expanded juvenile brain atlas to identify cell types derived from Notch active founders. Our data reveals rare examples where differential Notch activity in ancestral progenitors is detected in terminally differentiated neuronal subtypes. SABER seq is a novel platform for rapid scalable and high resolution mapping of signaling activity during development. Overall design: 10x Genomics libraries of single cell transcriptomes and SABER seq data and genomic DNA SABER data		pubmed:39575683		SABERb2 brainD2 Medgenome Run2 brain2 transcriptome	GSM8290048		source name:zebrafish whole brain\|tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB\|geo loc name:missing\|collection date:missing	SABERb2 brainD2 Medgenome Run2 brain2 transcriptome	Raw FASTQ reads were aligned against zebrafish genome built from GRCz.109.gtf and the GRCz11.fa files using the Cell Ranger count pipeline to generate gene by cell count matrices filtered barcode matrix. The count matrices were processed using the standard workflow of the Seurat v5.0.2 R package with modifications. Briefly all count matrices were separately loaded into R. Seurat objects were then created with modified parameters requiring features to be detected in at least 3 cells and cells to contain at least 300 genes. Subsequently the Seurat objects were merged to create a single Seurat object. Cells with RNA counts between 300 and 4000 and a mitochondrial gene percentage of less than 9% were selected for downstream analysis. Gene expression values were log normalized with the default parameters and scaled for the top 3000 variable genes. The scaled data was then used to compute the 50 principal components. Cells were iteratively clustered using the Louvain algorithm post identifying neighboring cells. Differentially expressed genes for each cluster were identified using genes that are detected in at least 10% of cells in either of the two clusters and genes showing a minimum difference of 10% between the two clusters. Cell types were annotated using known marker genes. The SABER seq FASTQ reads were processed using the Cell Ranger count pipeline similar to the transcriptomic reads. A bash script was then used to generate a text file containing all FASTQ headers and error corrected cell barcodes for SABER seq data. post loading filtered barcode matrices into R error corrected cell barcodes from transcriptomic reads were isolated and matched against those in the text file to identify common cell barcode that are shared between the transcriptomic and SABER seq datasets. The resulting text file contained redundant error corrected cell barcodes associated with different UMIs for the same cell. Thus unique error corrected cell barcodes were isolated to create a text file containing unique FASTQ headers an…	zebrafish whole brain		Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer’s instructions Single Cell 3’ v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads used initi…	This work was performed under protocol numbers 807110 and 807259 which were approved by the University of Pennsylvania’s Office of Animal Welfare of Institutional Animal Care and Use Committee IACUC. All zebrafish work in this study follows the University of Pennsylvania Institutional Animal Care and Use Committee regulations.	tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB	GSM8290048	GSM8290048: SABERb2 brainD2 Medgenome Run2 brain2 transcriptome; Danio rerio; RNA Seq	GSM8290048 r1	GSM8290048	1	Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer's instructions Single Cell three prime v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads u…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP509892		loader:fastq load.py	SABERb2_brainD2_S9_L002_I1_001.fastq.gz SABERb2_brainD2_S9_L002_I2_001.fastq.gz SABERb2_brainD2_S9_L002_R1_001.fastq.gz SABERb2_brainD2_S9_L002_R2_001.fastq.gz	fastq fastq fastq fastq	11592953894.0	83402546.0	GSM8290048 r2	0:10 1:10 2:28 3:91	A:2297377264;C:1526045472;G:1656319764;T:2109869221;N:19965	10	10	28	91	2297377264	1526045472	1656319764	2109869221	19965	SRX24701862	SRS21429391	SRA1989588	University of Pennsylvania	University of Pennsylvania	1	0.90894		0.24209		0.76106		0.55154		91		B		usable mapping rate	illumina	novaseq_era	full_length	random_priming	unknown	sc	single_cell_droplet	10x	United States	2024-05-25	Larval	Larval	Brain	Nervous System
32385	32385	SRR29181700	SRX24701862	SRS21429391	SRP509892	PRJNA1116548	Barcoding Notch signaling in the developing brain	GSE268356	Other	Developmental signaling inputs are fundamental for shaping cell fates and behavior. However traditional fluorescent based signaling reporters have limitations in scalability and molecular resolution of cell types. We present SABER seq a CRISPR Cas molecular recorder that stores transient developmental signaling cues as permanent mutations in cellular genomes for deconstruction at later stages via single cell transcriptomics. We applied SABER seq to record Notch signaling in developing zebrafish brains. SABER seq has two components: a signaling sensor and a barcode recorder. The sensor activates Cas9 in a Notch dependent manner with inducible control while the recorder obtains mutations in ancestral cells where Notch is active. We combine SABER seq with an expanded juvenile brain atlas to identify cell types derived from Notch active founders. Our data reveals rare examples where differential Notch activity in ancestral progenitors is detected in terminally differentiated neuronal subtypes. SABER seq is a novel platform for rapid scalable and high resolution mapping of signaling activity during development. Overall design: 10x Genomics libraries of single cell transcriptomes and SABER seq data and genomic DNA SABER data		pubmed:39575683		SABERb2 brainD2 Medgenome Run2 brain2 transcriptome	GSM8290048		source name:zebrafish whole brain\|tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB\|geo loc name:missing\|collection date:missing	SABERb2 brainD2 Medgenome Run2 brain2 transcriptome	Raw FASTQ reads were aligned against zebrafish genome built from GRCz.109.gtf and the GRCz11.fa files using the Cell Ranger count pipeline to generate gene by cell count matrices filtered barcode matrix. The count matrices were processed using the standard workflow of the Seurat v5.0.2 R package with modifications. Briefly all count matrices were separately loaded into R. Seurat objects were then created with modified parameters requiring features to be detected in at least 3 cells and cells to contain at least 300 genes. Subsequently the Seurat objects were merged to create a single Seurat object. Cells with RNA counts between 300 and 4000 and a mitochondrial gene percentage of less than 9% were selected for downstream analysis. Gene expression values were log normalized with the default parameters and scaled for the top 3000 variable genes. The scaled data was then used to compute the 50 principal components. Cells were iteratively clustered using the Louvain algorithm post identifying neighboring cells. Differentially expressed genes for each cluster were identified using genes that are detected in at least 10% of cells in either of the two clusters and genes showing a minimum difference of 10% between the two clusters. Cell types were annotated using known marker genes. The SABER seq FASTQ reads were processed using the Cell Ranger count pipeline similar to the transcriptomic reads. A bash script was then used to generate a text file containing all FASTQ headers and error corrected cell barcodes for SABER seq data. post loading filtered barcode matrices into R error corrected cell barcodes from transcriptomic reads were isolated and matched against those in the text file to identify common cell barcode that are shared between the transcriptomic and SABER seq datasets. The resulting text file contained redundant error corrected cell barcodes associated with different UMIs for the same cell. Thus unique error corrected cell barcodes were isolated to create a text file containing unique FASTQ headers an…	zebrafish whole brain		Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer’s instructions Single Cell 3’ v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads used initi…	This work was performed under protocol numbers 807110 and 807259 which were approved by the University of Pennsylvania’s Office of Animal Welfare of Institutional Animal Care and Use Committee IACUC. All zebrafish work in this study follows the University of Pennsylvania Institutional Animal Care and Use Committee regulations.	tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB	GSM8290048	GSM8290048: SABERb2 brainD2 Medgenome Run2 brain2 transcriptome; Danio rerio; RNA Seq	GSM8290048 r1	GSM8290048	1	Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer's instructions Single Cell three prime v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads u…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP509892		loader:fastq load.py	SABERb2_brainD2_S4_L002_R2_001.fastq.gz SABERb2_brainD2_S4_L002_R1_001.fastq.gz SABERb2_brainD2_S4_L002_I2_001.fastq.gz SABERb2_brainD2_S4_L002_I1_001.fastq.gz	fastq fastq fastq fastq	3703512386.0	26643974.0	GSM8290048 r1	0:10 1:10 2:28 3:91	A:738064510;C:484883852;G:525588346;T:676057082;N:7844	10	10	28	91	738064510	484883852	525588346	676057082	7844	SRX24701862	SRS21429391	SRA1989588	University of Pennsylvania	University of Pennsylvania	1	0.90684		0.24166		0.75982		0.55283		91		B		usable mapping rate	illumina	novaseq_era	full_length	random_priming	unknown	sc	single_cell_droplet	10x	United States	2024-05-25	Larval	Larval	Brain	Nervous System
32386	32386	SRR29181698	SRX24701861	SRS21429390	SRP509892	PRJNA1116548	Barcoding Notch signaling in the developing brain	GSE268356	Other	Developmental signaling inputs are fundamental for shaping cell fates and behavior. However traditional fluorescent based signaling reporters have limitations in scalability and molecular resolution of cell types. We present SABER seq a CRISPR Cas molecular recorder that stores transient developmental signaling cues as permanent mutations in cellular genomes for deconstruction at later stages via single cell transcriptomics. We applied SABER seq to record Notch signaling in developing zebrafish brains. SABER seq has two components: a signaling sensor and a barcode recorder. The sensor activates Cas9 in a Notch dependent manner with inducible control while the recorder obtains mutations in ancestral cells where Notch is active. We combine SABER seq with an expanded juvenile brain atlas to identify cell types derived from Notch active founders. Our data reveals rare examples where differential Notch activity in ancestral progenitors is detected in terminally differentiated neuronal subtypes. SABER seq is a novel platform for rapid scalable and high resolution mapping of signaling activity during development. Overall design: 10x Genomics libraries of single cell transcriptomes and SABER seq data and genomic DNA SABER data		pubmed:39575683		SABERb2 brainD1 Medgenome Run2 brain2 transcriptome	GSM8290047		source name:zebrafish whole brain\|tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB\|geo loc name:missing\|collection date:missing	SABERb2 brainD1 Medgenome Run2 brain2 transcriptome	Raw FASTQ reads were aligned against zebrafish genome built from GRCz.109.gtf and the GRCz11.fa files using the Cell Ranger count pipeline to generate gene by cell count matrices filtered barcode matrix. The count matrices were processed using the standard workflow of the Seurat v5.0.2 R package with modifications. Briefly all count matrices were separately loaded into R. Seurat objects were then created with modified parameters requiring features to be detected in at least 3 cells and cells to contain at least 300 genes. Subsequently the Seurat objects were merged to create a single Seurat object. Cells with RNA counts between 300 and 4000 and a mitochondrial gene percentage of less than 9% were selected for downstream analysis. Gene expression values were log normalized with the default parameters and scaled for the top 3000 variable genes. The scaled data was then used to compute the 50 principal components. Cells were iteratively clustered using the Louvain algorithm post identifying neighboring cells. Differentially expressed genes for each cluster were identified using genes that are detected in at least 10% of cells in either of the two clusters and genes showing a minimum difference of 10% between the two clusters. Cell types were annotated using known marker genes. The SABER seq FASTQ reads were processed using the Cell Ranger count pipeline similar to the transcriptomic reads. A bash script was then used to generate a text file containing all FASTQ headers and error corrected cell barcodes for SABER seq data. post loading filtered barcode matrices into R error corrected cell barcodes from transcriptomic reads were isolated and matched against those in the text file to identify common cell barcode that are shared between the transcriptomic and SABER seq datasets. The resulting text file contained redundant error corrected cell barcodes associated with different UMIs for the same cell. Thus unique error corrected cell barcodes were isolated to create a text file containing unique FASTQ headers an…	zebrafish whole brain		Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer’s instructions Single Cell 3’ v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads used initi…	This work was performed under protocol numbers 807110 and 807259 which were approved by the University of Pennsylvania’s Office of Animal Welfare of Institutional Animal Care and Use Committee IACUC. All zebrafish work in this study follows the University of Pennsylvania Institutional Animal Care and Use Committee regulations.	tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB	GSM8290047	GSM8290047: SABERb2 brainD1 Medgenome Run2 brain2 transcriptome; Danio rerio; RNA Seq	GSM8290047 r1	GSM8290047	1	Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer's instructions Single Cell three prime v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads u…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP509892		loader:fastq load.py	SABERb2_brainD1_S3_L002_R2_001.fastq.gz SABERb2_brainD1_S3_L002_R1_001.fastq.gz SABERb2_brainD1_S3_L002_I2_001.fastq.gz SABERb2_brainD1_S3_L002_I1_001.fastq.gz	fastq fastq fastq fastq	4228010816.0	30417344.0	GSM8290047 r1	0:10 1:10 2:28 3:91	A:837646182;C:556752228;G:601753997;T:771817125;N:8772	10	10	28	91	837646182	556752228	601753997	771817125	8772	SRX24701861	SRS21429390	SRA1989588	University of Pennsylvania	University of Pennsylvania	1	0.90883		0.23676		0.75885		0.54147		91		B		usable mapping rate	illumina	novaseq_era	full_length	random_priming	unknown	sc	single_cell_droplet	10x	United States	2024-05-25	Larval	Larval	Brain	Nervous System
32387	32387	SRR29181699	SRX24701861	SRS21429390	SRP509892	PRJNA1116548	Barcoding Notch signaling in the developing brain	GSE268356	Other	Developmental signaling inputs are fundamental for shaping cell fates and behavior. However traditional fluorescent based signaling reporters have limitations in scalability and molecular resolution of cell types. We present SABER seq a CRISPR Cas molecular recorder that stores transient developmental signaling cues as permanent mutations in cellular genomes for deconstruction at later stages via single cell transcriptomics. We applied SABER seq to record Notch signaling in developing zebrafish brains. SABER seq has two components: a signaling sensor and a barcode recorder. The sensor activates Cas9 in a Notch dependent manner with inducible control while the recorder obtains mutations in ancestral cells where Notch is active. We combine SABER seq with an expanded juvenile brain atlas to identify cell types derived from Notch active founders. Our data reveals rare examples where differential Notch activity in ancestral progenitors is detected in terminally differentiated neuronal subtypes. SABER seq is a novel platform for rapid scalable and high resolution mapping of signaling activity during development. Overall design: 10x Genomics libraries of single cell transcriptomes and SABER seq data and genomic DNA SABER data		pubmed:39575683		SABERb2 brainD1 Medgenome Run2 brain2 transcriptome	GSM8290047		source name:zebrafish whole brain\|tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB\|geo loc name:missing\|collection date:missing	SABERb2 brainD1 Medgenome Run2 brain2 transcriptome	Raw FASTQ reads were aligned against zebrafish genome built from GRCz.109.gtf and the GRCz11.fa files using the Cell Ranger count pipeline to generate gene by cell count matrices filtered barcode matrix. The count matrices were processed using the standard workflow of the Seurat v5.0.2 R package with modifications. Briefly all count matrices were separately loaded into R. Seurat objects were then created with modified parameters requiring features to be detected in at least 3 cells and cells to contain at least 300 genes. Subsequently the Seurat objects were merged to create a single Seurat object. Cells with RNA counts between 300 and 4000 and a mitochondrial gene percentage of less than 9% were selected for downstream analysis. Gene expression values were log normalized with the default parameters and scaled for the top 3000 variable genes. The scaled data was then used to compute the 50 principal components. Cells were iteratively clustered using the Louvain algorithm post identifying neighboring cells. Differentially expressed genes for each cluster were identified using genes that are detected in at least 10% of cells in either of the two clusters and genes showing a minimum difference of 10% between the two clusters. Cell types were annotated using known marker genes. The SABER seq FASTQ reads were processed using the Cell Ranger count pipeline similar to the transcriptomic reads. A bash script was then used to generate a text file containing all FASTQ headers and error corrected cell barcodes for SABER seq data. post loading filtered barcode matrices into R error corrected cell barcodes from transcriptomic reads were isolated and matched against those in the text file to identify common cell barcode that are shared between the transcriptomic and SABER seq datasets. The resulting text file contained redundant error corrected cell barcodes associated with different UMIs for the same cell. Thus unique error corrected cell barcodes were isolated to create a text file containing unique FASTQ headers an…	zebrafish whole brain		Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer’s instructions Single Cell 3’ v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads used initi…	This work was performed under protocol numbers 807110 and 807259 which were approved by the University of Pennsylvania’s Office of Animal Welfare of Institutional Animal Care and Use Committee IACUC. All zebrafish work in this study follows the University of Pennsylvania Institutional Animal Care and Use Committee regulations.	tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB	GSM8290047	GSM8290047: SABERb2 brainD1 Medgenome Run2 brain2 transcriptome; Danio rerio; RNA Seq	GSM8290047 r1	GSM8290047	1	Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer's instructions Single Cell three prime v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads u…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP509892		loader:fastq load.py	SABERb2_brainD1_S8_L002_R2_001.fastq.gz SABERb2_brainD1_S8_L002_R1_001.fastq.gz SABERb2_brainD1_S8_L002_I2_001.fastq.gz SABERb2_brainD1_S8_L002_I1_001.fastq.gz	fastq fastq fastq fastq	13317155486.0	95806874.0	GSM8290047 r2	0:10 1:10 2:28 3:91	A:2627361333;C:1762774581;G:1907012086;T:2421255352;N:22182	10	10	28	91	2627361333	1762774581	1907012086	2421255352	22182	SRX24701861	SRS21429390	SRA1989588	University of Pennsylvania	University of Pennsylvania	1	0.91093		0.23629		0.75913		0.55525		91		B		usable mapping rate	illumina	novaseq_era	full_length	random_priming	unknown	sc	single_cell_droplet	10x	United States	2024-05-25	Larval	Larval	Brain	Nervous System
32388	32388	SRR29181697	SRX24701860	SRS21429389	SRP509892	PRJNA1116548	Barcoding Notch signaling in the developing brain	GSE268356	Other	Developmental signaling inputs are fundamental for shaping cell fates and behavior. However traditional fluorescent based signaling reporters have limitations in scalability and molecular resolution of cell types. We present SABER seq a CRISPR Cas molecular recorder that stores transient developmental signaling cues as permanent mutations in cellular genomes for deconstruction at later stages via single cell transcriptomics. We applied SABER seq to record Notch signaling in developing zebrafish brains. SABER seq has two components: a signaling sensor and a barcode recorder. The sensor activates Cas9 in a Notch dependent manner with inducible control while the recorder obtains mutations in ancestral cells where Notch is active. We combine SABER seq with an expanded juvenile brain atlas to identify cell types derived from Notch active founders. Our data reveals rare examples where differential Notch activity in ancestral progenitors is detected in terminally differentiated neuronal subtypes. SABER seq is a novel platform for rapid scalable and high resolution mapping of signaling activity during development. Overall design: 10x Genomics libraries of single cell transcriptomes and SABER seq data and genomic DNA SABER data		pubmed:39575683		SABERb1 brainC2091523wk3 Novogene Run1 brain1 transcriptome	GSM8290046		source name:zebrafish whole brain\|tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB\|geo loc name:missing\|collection date:missing	SABERb1 brainC2091523wk3 Novogene Run1 brain1 transcriptome	Raw FASTQ reads were aligned against zebrafish genome built from GRCz.109.gtf and the GRCz11.fa files using the Cell Ranger count pipeline to generate gene by cell count matrices filtered barcode matrix. The count matrices were processed using the standard workflow of the Seurat v5.0.2 R package with modifications. Briefly all count matrices were separately loaded into R. Seurat objects were then created with modified parameters requiring features to be detected in at least 3 cells and cells to contain at least 300 genes. Subsequently the Seurat objects were merged to create a single Seurat object. Cells with RNA counts between 300 and 4000 and a mitochondrial gene percentage of less than 9% were selected for downstream analysis. Gene expression values were log normalized with the default parameters and scaled for the top 3000 variable genes. The scaled data was then used to compute the 50 principal components. Cells were iteratively clustered using the Louvain algorithm post identifying neighboring cells. Differentially expressed genes for each cluster were identified using genes that are detected in at least 10% of cells in either of the two clusters and genes showing a minimum difference of 10% between the two clusters. Cell types were annotated using known marker genes. The SABER seq FASTQ reads were processed using the Cell Ranger count pipeline similar to the transcriptomic reads. A bash script was then used to generate a text file containing all FASTQ headers and error corrected cell barcodes for SABER seq data. post loading filtered barcode matrices into R error corrected cell barcodes from transcriptomic reads were isolated and matched against those in the text file to identify common cell barcode that are shared between the transcriptomic and SABER seq datasets. The resulting text file contained redundant error corrected cell barcodes associated with different UMIs for the same cell. Thus unique error corrected cell barcodes were isolated to create a text file containing unique FASTQ headers an…	zebrafish whole brain		Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer’s instructions Single Cell 3’ v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads used initi…	This work was performed under protocol numbers 807110 and 807259 which were approved by the University of Pennsylvania’s Office of Animal Welfare of Institutional Animal Care and Use Committee IACUC. All zebrafish work in this study follows the University of Pennsylvania Institutional Animal Care and Use Committee regulations.	tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB	GSM8290046	GSM8290046: SABERb1 brainC2091523wk3 Novogene Run1 brain1 transcriptome; Danio rerio; RNA Seq	GSM8290046 r1	GSM8290046	1	Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer's instructions Single Cell three prime v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads u…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP509892		loader:fastq load.py	SABERb1_brainC2091523wk3_CKDL230038568-1A_HHVLTDSX7_S1_L003_I1_001.fastq.gz SABERb1_brainC2091523wk3_CKDL230038568-1A_HHVLTDSX7_S1_L003_I2_001.fastq.gz SABERb1_brainC2091523wk3_CKDL230038568-1A_HHVLTDSX7_S1_L003_R1_001.fastq.gz SABERb1_brainC2091523wk3_CKDL230038568-1A_HHVLTDSX7_S1_L003_R2_001.fastq.gz	fastq fastq fastq fastq	11765562880.0	36767384.0	GSM8290046 r1	0:10 1:10 2:150 3:150	A:3147712431;C:1679368969;G:1942592895;T:4259959905;N:581000	10	10	150	150	3147712431	1679368969	1942592895	4259959905	581000	SRX24701860	SRS21429389	SRA1989588	University of Pennsylvania	University of Pennsylvania	2	0.30773	0.88409	0.11212	0.21315	0.968	0.77344	0.54045	0.54846	150	150	T	B	mate1 technical by mapping diff	illumina	novaseq_era	full_length	random_priming	unknown	sc	single_cell_droplet	10x	United States	2024-05-25	Larval	Larval	Brain	Nervous System
32389	32389	SRR29181691	SRX24701859	SRS21429388	SRP509892	PRJNA1116548	Barcoding Notch signaling in the developing brain	GSE268356	Other	Developmental signaling inputs are fundamental for shaping cell fates and behavior. However traditional fluorescent based signaling reporters have limitations in scalability and molecular resolution of cell types. We present SABER seq a CRISPR Cas molecular recorder that stores transient developmental signaling cues as permanent mutations in cellular genomes for deconstruction at later stages via single cell transcriptomics. We applied SABER seq to record Notch signaling in developing zebrafish brains. SABER seq has two components: a signaling sensor and a barcode recorder. The sensor activates Cas9 in a Notch dependent manner with inducible control while the recorder obtains mutations in ancestral cells where Notch is active. We combine SABER seq with an expanded juvenile brain atlas to identify cell types derived from Notch active founders. Our data reveals rare examples where differential Notch activity in ancestral progenitors is detected in terminally differentiated neuronal subtypes. SABER seq is a novel platform for rapid scalable and high resolution mapping of signaling activity during development. Overall design: 10x Genomics libraries of single cell transcriptomes and SABER seq data and genomic DNA SABER data		pubmed:39575683		SABERb2 linD3 brain2 SABER Seq	GSM8290061		source name:zebrafish whole brain\|tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB\|geo loc name:missing\|collection date:missing	SABERb2 linD3 brain2 SABER Seq	Raw FASTQ reads were aligned against zebrafish genome built from GRCz.109.gtf and the GRCz11.fa files using the Cell Ranger count pipeline to generate gene by cell count matrices filtered barcode matrix. The count matrices were processed using the standard workflow of the Seurat v5.0.2 R package with modifications. Briefly all count matrices were separately loaded into R. Seurat objects were then created with modified parameters requiring features to be detected in at least 3 cells and cells to contain at least 300 genes. Subsequently the Seurat objects were merged to create a single Seurat object. Cells with RNA counts between 300 and 4000 and a mitochondrial gene percentage of less than 9% were selected for downstream analysis. Gene expression values were log normalized with the default parameters and scaled for the top 3000 variable genes. The scaled data was then used to compute the 50 principal components. Cells were iteratively clustered using the Louvain algorithm post identifying neighboring cells. Differentially expressed genes for each cluster were identified using genes that are detected in at least 10% of cells in either of the two clusters and genes showing a minimum difference of 10% between the two clusters. Cell types were annotated using known marker genes. The SABER seq FASTQ reads were processed using the Cell Ranger count pipeline similar to the transcriptomic reads. A bash script was then used to generate a text file containing all FASTQ headers and error corrected cell barcodes for SABER seq data. post loading filtered barcode matrices into R error corrected cell barcodes from transcriptomic reads were isolated and matched against those in the text file to identify common cell barcode that are shared between the transcriptomic and SABER seq datasets. The resulting text file contained redundant error corrected cell barcodes associated with different UMIs for the same cell. Thus unique error corrected cell barcodes were isolated to create a text file containing unique FASTQ headers an…	zebrafish whole brain		Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer’s instructions Single Cell 3’ v3 kit. Transcriptome libraries were sequenced using HiSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads used initially and supernatant was rebound with 1.5…	This work was performed under protocol numbers 807110 and 807259 which were approved by the University of Pennsylvania’s Office of Animal Welfare of Institutional Animal Care and Use Committee IACUC. All zebrafish work in this study follows the University of Pennsylvania Institutional Animal Care and Use Committee regulations.	tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB	GSM8290061	GSM8290061: SABERb2 linD3 brain2 SABER Seq; Danio rerio; RNA Seq	GSM8290061 r1	GSM8290061	1	Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer's instructions Single Cell three prime v3 kit. Transcriptome libraries were sequenced using HiSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads used initially and supernatant was rebound…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP509892		loader:fastq load.py	SABERb2_linD3_S3_L001_I1_001.fastq.gz SABERb2_linD3_S3_L001_I2_001.fastq.gz SABERb2_linD3_S3_L001_R1_001.fastq.gz SABERb2_linD3_S3_L001_R2_001.fastq.gz	fastq fastq fastq fastq	6191572570.0	31113430.0	GSM8290061 r1	0:10 1:10 2:28 3:151	A:1332572499;C:1250769086;G:1304188511;T:810567656;N:30178	10	10	28	151	1332572499	1250769086	1304188511	810567656	30178	SRX24701859	SRS21429388	SRA1878107	University of Pennsylvania	University of Pennsylvania	1	0.00992		0.00222		0.98762		0.5329		151		T		under 1.2% mapping rate	illumina	novaseq_era	full_length	random_priming	unknown	sc	single_cell_droplet	10x	United States	2024-05-25	Larval	Larval	Brain	Nervous System
32390	32390	SRR29181690	SRX24701858	SRS21429387	SRP509892	PRJNA1116548	Barcoding Notch signaling in the developing brain	GSE268356	Other	Developmental signaling inputs are fundamental for shaping cell fates and behavior. However traditional fluorescent based signaling reporters have limitations in scalability and molecular resolution of cell types. We present SABER seq a CRISPR Cas molecular recorder that stores transient developmental signaling cues as permanent mutations in cellular genomes for deconstruction at later stages via single cell transcriptomics. We applied SABER seq to record Notch signaling in developing zebrafish brains. SABER seq has two components: a signaling sensor and a barcode recorder. The sensor activates Cas9 in a Notch dependent manner with inducible control while the recorder obtains mutations in ancestral cells where Notch is active. We combine SABER seq with an expanded juvenile brain atlas to identify cell types derived from Notch active founders. Our data reveals rare examples where differential Notch activity in ancestral progenitors is detected in terminally differentiated neuronal subtypes. SABER seq is a novel platform for rapid scalable and high resolution mapping of signaling activity during development. Overall design: 10x Genomics libraries of single cell transcriptomes and SABER seq data and genomic DNA SABER data		pubmed:39575683		SABERb2 linD2 brain2 SABER Seq	GSM8290060		source name:zebrafish whole brain\|tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB\|geo loc name:missing\|collection date:missing	SABERb2 linD2 brain2 SABER Seq	Raw FASTQ reads were aligned against zebrafish genome built from GRCz.109.gtf and the GRCz11.fa files using the Cell Ranger count pipeline to generate gene by cell count matrices filtered barcode matrix. The count matrices were processed using the standard workflow of the Seurat v5.0.2 R package with modifications. Briefly all count matrices were separately loaded into R. Seurat objects were then created with modified parameters requiring features to be detected in at least 3 cells and cells to contain at least 300 genes. Subsequently the Seurat objects were merged to create a single Seurat object. Cells with RNA counts between 300 and 4000 and a mitochondrial gene percentage of less than 9% were selected for downstream analysis. Gene expression values were log normalized with the default parameters and scaled for the top 3000 variable genes. The scaled data was then used to compute the 50 principal components. Cells were iteratively clustered using the Louvain algorithm post identifying neighboring cells. Differentially expressed genes for each cluster were identified using genes that are detected in at least 10% of cells in either of the two clusters and genes showing a minimum difference of 10% between the two clusters. Cell types were annotated using known marker genes. The SABER seq FASTQ reads were processed using the Cell Ranger count pipeline similar to the transcriptomic reads. A bash script was then used to generate a text file containing all FASTQ headers and error corrected cell barcodes for SABER seq data. post loading filtered barcode matrices into R error corrected cell barcodes from transcriptomic reads were isolated and matched against those in the text file to identify common cell barcode that are shared between the transcriptomic and SABER seq datasets. The resulting text file contained redundant error corrected cell barcodes associated with different UMIs for the same cell. Thus unique error corrected cell barcodes were isolated to create a text file containing unique FASTQ headers an…	zebrafish whole brain		Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer’s instructions Single Cell 3’ v3 kit. Transcriptome libraries were sequenced using HiSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads used initially and supernatant was rebound with 1.5…	This work was performed under protocol numbers 807110 and 807259 which were approved by the University of Pennsylvania’s Office of Animal Welfare of Institutional Animal Care and Use Committee IACUC. All zebrafish work in this study follows the University of Pennsylvania Institutional Animal Care and Use Committee regulations.	tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB	GSM8290060	GSM8290060: SABERb2 linD2 brain2 SABER Seq; Danio rerio; RNA Seq	GSM8290060 r1	GSM8290060	1	Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer's instructions Single Cell three prime v3 kit. Transcriptome libraries were sequenced using HiSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads used initially and supernatant was rebound…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP509892		loader:fastq load.py	SABERb2_linD2_S2_L001_I1_001.fastq.gz SABERb2_linD2_S2_L001_I2_001.fastq.gz SABERb2_linD2_S2_L001_R1_001.fastq.gz SABERb2_linD2_S2_L001_R2_001.fastq.gz	fastq fastq fastq fastq	4643470776.0	23334024.0	GSM8290060 r1	0:10 1:10 2:28 3:151	A:780662288;C:1082797960;G:929037112;T:730916888;N:23376	10	10	28	151	780662288	1082797960	929037112	730916888	23376	SRX24701858	SRS21429387	SRA1878107	University of Pennsylvania	University of Pennsylvania	1	0.01556		0.00414		0.98571		0.48742		151		B		usable mapping rate	illumina	novaseq_era	full_length	random_priming	unknown	sc	single_cell_droplet	10x	United States	2024-05-25	Larval	Larval	Brain	Nervous System
32391	32391	SRR29181689	SRX24701857	SRS21429386	SRP509892	PRJNA1116548	Barcoding Notch signaling in the developing brain	GSE268356	Other	Developmental signaling inputs are fundamental for shaping cell fates and behavior. However traditional fluorescent based signaling reporters have limitations in scalability and molecular resolution of cell types. We present SABER seq a CRISPR Cas molecular recorder that stores transient developmental signaling cues as permanent mutations in cellular genomes for deconstruction at later stages via single cell transcriptomics. We applied SABER seq to record Notch signaling in developing zebrafish brains. SABER seq has two components: a signaling sensor and a barcode recorder. The sensor activates Cas9 in a Notch dependent manner with inducible control while the recorder obtains mutations in ancestral cells where Notch is active. We combine SABER seq with an expanded juvenile brain atlas to identify cell types derived from Notch active founders. Our data reveals rare examples where differential Notch activity in ancestral progenitors is detected in terminally differentiated neuronal subtypes. SABER seq is a novel platform for rapid scalable and high resolution mapping of signaling activity during development. Overall design: 10x Genomics libraries of single cell transcriptomes and SABER seq data and genomic DNA SABER data		pubmed:39575683		SABERb2 linD1 brain2 SABER Seq	GSM8290059		source name:zebrafish whole brain\|tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB\|geo loc name:missing\|collection date:missing	SABERb2 linD1 brain2 SABER Seq	Raw FASTQ reads were aligned against zebrafish genome built from GRCz.109.gtf and the GRCz11.fa files using the Cell Ranger count pipeline to generate gene by cell count matrices filtered barcode matrix. The count matrices were processed using the standard workflow of the Seurat v5.0.2 R package with modifications. Briefly all count matrices were separately loaded into R. Seurat objects were then created with modified parameters requiring features to be detected in at least 3 cells and cells to contain at least 300 genes. Subsequently the Seurat objects were merged to create a single Seurat object. Cells with RNA counts between 300 and 4000 and a mitochondrial gene percentage of less than 9% were selected for downstream analysis. Gene expression values were log normalized with the default parameters and scaled for the top 3000 variable genes. The scaled data was then used to compute the 50 principal components. Cells were iteratively clustered using the Louvain algorithm post identifying neighboring cells. Differentially expressed genes for each cluster were identified using genes that are detected in at least 10% of cells in either of the two clusters and genes showing a minimum difference of 10% between the two clusters. Cell types were annotated using known marker genes. The SABER seq FASTQ reads were processed using the Cell Ranger count pipeline similar to the transcriptomic reads. A bash script was then used to generate a text file containing all FASTQ headers and error corrected cell barcodes for SABER seq data. post loading filtered barcode matrices into R error corrected cell barcodes from transcriptomic reads were isolated and matched against those in the text file to identify common cell barcode that are shared between the transcriptomic and SABER seq datasets. The resulting text file contained redundant error corrected cell barcodes associated with different UMIs for the same cell. Thus unique error corrected cell barcodes were isolated to create a text file containing unique FASTQ headers an…	zebrafish whole brain		Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer’s instructions Single Cell 3’ v3 kit. Transcriptome libraries were sequenced using HiSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads used initially and supernatant was rebound with 1.5…	This work was performed under protocol numbers 807110 and 807259 which were approved by the University of Pennsylvania’s Office of Animal Welfare of Institutional Animal Care and Use Committee IACUC. All zebrafish work in this study follows the University of Pennsylvania Institutional Animal Care and Use Committee regulations.	tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB	GSM8290059	GSM8290059: SABERb2 linD1 brain2 SABER Seq; Danio rerio; RNA Seq	GSM8290059 r1	GSM8290059	1	Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer's instructions Single Cell three prime v3 kit. Transcriptome libraries were sequenced using HiSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads used initially and supernatant was rebound…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP509892		loader:fastq load.py	SABERb2_linD1_S1_L001_I1_001.fastq.gz SABERb2_linD1_S1_L001_I2_001.fastq.gz SABERb2_linD1_S1_L001_R1_001.fastq.gz SABERb2_linD1_S1_L001_R2_001.fastq.gz	fastq fastq fastq fastq	1567865877.0	7878723.0	GSM8290059 r1	0:10 1:10 2:28 3:151	A:285711189;C:311873916;G:350305565;T:241788400;N:8103	10	10	28	151	285711189	311873916	350305565	241788400	8103	SRX24701857	SRS21429386	SRA1878107	University of Pennsylvania	University of Pennsylvania	1	0.04511		0.013		0.96644		0.48124		151		B		usable mapping rate	illumina	novaseq_era	full_length	random_priming	unknown	sc	single_cell_droplet	10x	United States	2024-05-25	Larval	Larval	Brain	Nervous System
32392	32392	SRR29181694	SRX24701856	SRS21429385	SRP509892	PRJNA1116548	Barcoding Notch signaling in the developing brain	GSE268356	Other	Developmental signaling inputs are fundamental for shaping cell fates and behavior. However traditional fluorescent based signaling reporters have limitations in scalability and molecular resolution of cell types. We present SABER seq a CRISPR Cas molecular recorder that stores transient developmental signaling cues as permanent mutations in cellular genomes for deconstruction at later stages via single cell transcriptomics. We applied SABER seq to record Notch signaling in developing zebrafish brains. SABER seq has two components: a signaling sensor and a barcode recorder. The sensor activates Cas9 in a Notch dependent manner with inducible control while the recorder obtains mutations in ancestral cells where Notch is active. We combine SABER seq with an expanded juvenile brain atlas to identify cell types derived from Notch active founders. Our data reveals rare examples where differential Notch activity in ancestral progenitors is detected in terminally differentiated neuronal subtypes. SABER seq is a novel platform for rapid scalable and high resolution mapping of signaling activity during development. Overall design: 10x Genomics libraries of single cell transcriptomes and SABER seq data and genomic DNA SABER data		pubmed:39575683		SABERb1 linC2 brain1 SABER Seq	GSM8290058		source name:zebrafish whole brain\|tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB\|geo loc name:missing\|collection date:missing	SABERb1 linC2 brain1 SABER Seq	Raw FASTQ reads were aligned against zebrafish genome built from GRCz.109.gtf and the GRCz11.fa files using the Cell Ranger count pipeline to generate gene by cell count matrices filtered barcode matrix. The count matrices were processed using the standard workflow of the Seurat v5.0.2 R package with modifications. Briefly all count matrices were separately loaded into R. Seurat objects were then created with modified parameters requiring features to be detected in at least 3 cells and cells to contain at least 300 genes. Subsequently the Seurat objects were merged to create a single Seurat object. Cells with RNA counts between 300 and 4000 and a mitochondrial gene percentage of less than 9% were selected for downstream analysis. Gene expression values were log normalized with the default parameters and scaled for the top 3000 variable genes. The scaled data was then used to compute the 50 principal components. Cells were iteratively clustered using the Louvain algorithm post identifying neighboring cells. Differentially expressed genes for each cluster were identified using genes that are detected in at least 10% of cells in either of the two clusters and genes showing a minimum difference of 10% between the two clusters. Cell types were annotated using known marker genes. The SABER seq FASTQ reads were processed using the Cell Ranger count pipeline similar to the transcriptomic reads. A bash script was then used to generate a text file containing all FASTQ headers and error corrected cell barcodes for SABER seq data. post loading filtered barcode matrices into R error corrected cell barcodes from transcriptomic reads were isolated and matched against those in the text file to identify common cell barcode that are shared between the transcriptomic and SABER seq datasets. The resulting text file contained redundant error corrected cell barcodes associated with different UMIs for the same cell. Thus unique error corrected cell barcodes were isolated to create a text file containing unique FASTQ headers an…	zebrafish whole brain		Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer’s instructions Single Cell 3’ v3 kit. Transcriptome libraries were sequenced using HiSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads used initially and supernatant was rebound with 1.5…	This work was performed under protocol numbers 807110 and 807259 which were approved by the University of Pennsylvania’s Office of Animal Welfare of Institutional Animal Care and Use Committee IACUC. All zebrafish work in this study follows the University of Pennsylvania Institutional Animal Care and Use Committee regulations.	tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB	GSM8290058	GSM8290058: SABERb1 linC2 brain1 SABER Seq; Danio rerio; RNA Seq	GSM8290058 r1	GSM8290058	1	Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer's instructions Single Cell three prime v3 kit. Transcriptome libraries were sequenced using HiSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads used initially and supernatant was rebound…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP509892		loader:fastq load.py	SABERb1_linC2_S5_L001_I1_001.fastq.gz SABERb1_linC2_S5_L001_I2_001.fastq.gz SABERb1_linC2_S5_L001_R1_001.fastq.gz SABERb1_linC2_S5_L001_R2_001.fastq.gz	fastq fastq fastq fastq	5550858638.0	27893762.0	GSM8290058 r1	0:10 1:10 2:28 3:151	A:1146922069;C:1156473192;G:1103601022;T:804934064;N:27715	10	10	28	151	1146922069	1156473192	1103601022	804934064	27715	SRX24701856	SRS21429385	SRA1878107	University of Pennsylvania	University of Pennsylvania	1	0.01311		0.00298		0.98762		0.53959		151		B		usable mapping rate	illumina	novaseq_era	full_length	random_priming	unknown	sc	single_cell_droplet	10x	United States	2024-05-25	Larval	Larval	Brain	Nervous System
32393	32393	SRR29181695	SRX24701855	SRS21429384	SRP509892	PRJNA1116548	Barcoding Notch signaling in the developing brain	GSE268356	Other	Developmental signaling inputs are fundamental for shaping cell fates and behavior. However traditional fluorescent based signaling reporters have limitations in scalability and molecular resolution of cell types. We present SABER seq a CRISPR Cas molecular recorder that stores transient developmental signaling cues as permanent mutations in cellular genomes for deconstruction at later stages via single cell transcriptomics. We applied SABER seq to record Notch signaling in developing zebrafish brains. SABER seq has two components: a signaling sensor and a barcode recorder. The sensor activates Cas9 in a Notch dependent manner with inducible control while the recorder obtains mutations in ancestral cells where Notch is active. We combine SABER seq with an expanded juvenile brain atlas to identify cell types derived from Notch active founders. Our data reveals rare examples where differential Notch activity in ancestral progenitors is detected in terminally differentiated neuronal subtypes. SABER seq is a novel platform for rapid scalable and high resolution mapping of signaling activity during development. Overall design: 10x Genomics libraries of single cell transcriptomes and SABER seq data and genomic DNA SABER data		pubmed:39575683		SABERb1 linC1 brain1 SABER Seq	GSM8290057		source name:zebrafish whole brain\|tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB\|geo loc name:missing\|collection date:missing	SABERb1 linC1 brain1 SABER Seq	Raw FASTQ reads were aligned against zebrafish genome built from GRCz.109.gtf and the GRCz11.fa files using the Cell Ranger count pipeline to generate gene by cell count matrices filtered barcode matrix. The count matrices were processed using the standard workflow of the Seurat v5.0.2 R package with modifications. Briefly all count matrices were separately loaded into R. Seurat objects were then created with modified parameters requiring features to be detected in at least 3 cells and cells to contain at least 300 genes. Subsequently the Seurat objects were merged to create a single Seurat object. Cells with RNA counts between 300 and 4000 and a mitochondrial gene percentage of less than 9% were selected for downstream analysis. Gene expression values were log normalized with the default parameters and scaled for the top 3000 variable genes. The scaled data was then used to compute the 50 principal components. Cells were iteratively clustered using the Louvain algorithm post identifying neighboring cells. Differentially expressed genes for each cluster were identified using genes that are detected in at least 10% of cells in either of the two clusters and genes showing a minimum difference of 10% between the two clusters. Cell types were annotated using known marker genes. The SABER seq FASTQ reads were processed using the Cell Ranger count pipeline similar to the transcriptomic reads. A bash script was then used to generate a text file containing all FASTQ headers and error corrected cell barcodes for SABER seq data. post loading filtered barcode matrices into R error corrected cell barcodes from transcriptomic reads were isolated and matched against those in the text file to identify common cell barcode that are shared between the transcriptomic and SABER seq datasets. The resulting text file contained redundant error corrected cell barcodes associated with different UMIs for the same cell. Thus unique error corrected cell barcodes were isolated to create a text file containing unique FASTQ headers an…	zebrafish whole brain		Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer’s instructions Single Cell 3’ v3 kit. Transcriptome libraries were sequenced using HiSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads used initially and supernatant was rebound with 1.5…	This work was performed under protocol numbers 807110 and 807259 which were approved by the University of Pennsylvania’s Office of Animal Welfare of Institutional Animal Care and Use Committee IACUC. All zebrafish work in this study follows the University of Pennsylvania Institutional Animal Care and Use Committee regulations.	tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB	GSM8290057	GSM8290057: SABERb1 linC1 brain1 SABER Seq; Danio rerio; RNA Seq	GSM8290057 r1	GSM8290057	1	Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer's instructions Single Cell three prime v3 kit. Transcriptome libraries were sequenced using HiSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads used initially and supernatant was rebound…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP509892		loader:fastq load.py	SABERb1_linC1_S4_L001_I1_001.fastq.gz SABERb1_linC1_S4_L001_I2_001.fastq.gz SABERb1_linC1_S4_L001_R1_001.fastq.gz SABERb1_linC1_S4_L001_R2_001.fastq.gz	fastq fastq fastq fastq	6470197047.0	32513553.0	GSM8290057 r1	0:10 1:10 2:28 3:151	A:1299285410;C:1322983894;G:1431353449;T:855891198;N:32552	10	10	28	151	1299285410	1322983894	1431353449	855891198	32552	SRX24701855	SRS21429384	SRA1878107	University of Pennsylvania	University of Pennsylvania	1	0.01874		0.00435		0.98334		0.48429		151		B		usable mapping rate	illumina	novaseq_era	full_length	random_priming	unknown	sc	single_cell_droplet	10x	United States	2024-05-25	Larval	Larval	Brain	Nervous System
32394	32394	SRR29181696	SRX24701854	SRS21429383	SRP509892	PRJNA1116548	Barcoding Notch signaling in the developing brain	GSE268356	Other	Developmental signaling inputs are fundamental for shaping cell fates and behavior. However traditional fluorescent based signaling reporters have limitations in scalability and molecular resolution of cell types. We present SABER seq a CRISPR Cas molecular recorder that stores transient developmental signaling cues as permanent mutations in cellular genomes for deconstruction at later stages via single cell transcriptomics. We applied SABER seq to record Notch signaling in developing zebrafish brains. SABER seq has two components: a signaling sensor and a barcode recorder. The sensor activates Cas9 in a Notch dependent manner with inducible control while the recorder obtains mutations in ancestral cells where Notch is active. We combine SABER seq with an expanded juvenile brain atlas to identify cell types derived from Notch active founders. Our data reveals rare examples where differential Notch activity in ancestral progenitors is detected in terminally differentiated neuronal subtypes. SABER seq is a novel platform for rapid scalable and high resolution mapping of signaling activity during development. Overall design: 10x Genomics libraries of single cell transcriptomes and SABER seq data and genomic DNA SABER data		pubmed:39575683		SABERb1 brainC1091523wk3 Novogene Run1 brain1 transcriptome	GSM8290045		source name:zebrafish whole brain\|tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB\|geo loc name:missing\|collection date:missing	SABERb1 brainC1091523wk3 Novogene Run1 brain1 transcriptome	Raw FASTQ reads were aligned against zebrafish genome built from GRCz.109.gtf and the GRCz11.fa files using the Cell Ranger count pipeline to generate gene by cell count matrices filtered barcode matrix. The count matrices were processed using the standard workflow of the Seurat v5.0.2 R package with modifications. Briefly all count matrices were separately loaded into R. Seurat objects were then created with modified parameters requiring features to be detected in at least 3 cells and cells to contain at least 300 genes. Subsequently the Seurat objects were merged to create a single Seurat object. Cells with RNA counts between 300 and 4000 and a mitochondrial gene percentage of less than 9% were selected for downstream analysis. Gene expression values were log normalized with the default parameters and scaled for the top 3000 variable genes. The scaled data was then used to compute the 50 principal components. Cells were iteratively clustered using the Louvain algorithm post identifying neighboring cells. Differentially expressed genes for each cluster were identified using genes that are detected in at least 10% of cells in either of the two clusters and genes showing a minimum difference of 10% between the two clusters. Cell types were annotated using known marker genes. The SABER seq FASTQ reads were processed using the Cell Ranger count pipeline similar to the transcriptomic reads. A bash script was then used to generate a text file containing all FASTQ headers and error corrected cell barcodes for SABER seq data. post loading filtered barcode matrices into R error corrected cell barcodes from transcriptomic reads were isolated and matched against those in the text file to identify common cell barcode that are shared between the transcriptomic and SABER seq datasets. The resulting text file contained redundant error corrected cell barcodes associated with different UMIs for the same cell. Thus unique error corrected cell barcodes were isolated to create a text file containing unique FASTQ headers an…	zebrafish whole brain		Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer’s instructions Single Cell 3’ v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads used initi…	This work was performed under protocol numbers 807110 and 807259 which were approved by the University of Pennsylvania’s Office of Animal Welfare of Institutional Animal Care and Use Committee IACUC. All zebrafish work in this study follows the University of Pennsylvania Institutional Animal Care and Use Committee regulations.	tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB	GSM8290045	GSM8290045: SABERb1 brainC1091523wk3 Novogene Run1 brain1 transcriptome; Danio rerio; RNA Seq	GSM8290045 r1	GSM8290045	1	Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer's instructions Single Cell three prime v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads u…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP509892		loader:fastq load.py	SABERb1_brainC1091523wk3_CKDL230038568-1A_HHVLTDSX7_S3_L003_I1_001.fastq.gz SABERb1_brainC1091523wk3_CKDL230038568-1A_HHVLTDSX7_S3_L003_I2_001.fastq.gz SABERb1_brainC1091523wk3_CKDL230038568-1A_HHVLTDSX7_S3_L003_R1_001.fastq.gz SABERb1_brainC1091523wk3_CKDL230038568-1A_HHVLTDSX7_S3_L003_R2_001.fastq.gz	fastq fastq fastq fastq	13715941760.0	42862318.0	GSM8290045 r1	0:10 1:10 2:150 3:150	A:3643210069;C:2019746784;G:2321631965;T:4873417599;N:688983	10	10	150	150	3643210069	2019746784	2321631965	4873417599	688983	SRX24701854	SRS21429383	SRA1989588	University of Pennsylvania	University of Pennsylvania	2	0.38679	0.89762	0.1285	0.20804	0.95881	0.76877	0.53381	0.54347	150	150	T	B	mate1 technical by mapping diff	illumina	novaseq_era	full_length	random_priming	unknown	sc	single_cell_droplet	10x	United States	2024-05-25	Larval	Larval	Brain	Nervous System
32395	32395	SRR29181704	SRX24701853	SRS21429382	SRP509892	PRJNA1116548	Barcoding Notch signaling in the developing brain	GSE268356	Other	Developmental signaling inputs are fundamental for shaping cell fates and behavior. However traditional fluorescent based signaling reporters have limitations in scalability and molecular resolution of cell types. We present SABER seq a CRISPR Cas molecular recorder that stores transient developmental signaling cues as permanent mutations in cellular genomes for deconstruction at later stages via single cell transcriptomics. We applied SABER seq to record Notch signaling in developing zebrafish brains. SABER seq has two components: a signaling sensor and a barcode recorder. The sensor activates Cas9 in a Notch dependent manner with inducible control while the recorder obtains mutations in ancestral cells where Notch is active. We combine SABER seq with an expanded juvenile brain atlas to identify cell types derived from Notch active founders. Our data reveals rare examples where differential Notch activity in ancestral progenitors is detected in terminally differentiated neuronal subtypes. SABER seq is a novel platform for rapid scalable and high resolution mapping of signaling activity during development. Overall design: 10x Genomics libraries of single cell transcriptomes and SABER seq data and genomic DNA SABER data		pubmed:39575683		SABERb1 brainC2 Medgenome Run2 brain1 transcriptome	GSM8290044		source name:zebrafish whole brain\|tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB\|geo loc name:missing\|collection date:missing	SABERb1 brainC2 Medgenome Run2 brain1 transcriptome	Raw FASTQ reads were aligned against zebrafish genome built from GRCz.109.gtf and the GRCz11.fa files using the Cell Ranger count pipeline to generate gene by cell count matrices filtered barcode matrix. The count matrices were processed using the standard workflow of the Seurat v5.0.2 R package with modifications. Briefly all count matrices were separately loaded into R. Seurat objects were then created with modified parameters requiring features to be detected in at least 3 cells and cells to contain at least 300 genes. Subsequently the Seurat objects were merged to create a single Seurat object. Cells with RNA counts between 300 and 4000 and a mitochondrial gene percentage of less than 9% were selected for downstream analysis. Gene expression values were log normalized with the default parameters and scaled for the top 3000 variable genes. The scaled data was then used to compute the 50 principal components. Cells were iteratively clustered using the Louvain algorithm post identifying neighboring cells. Differentially expressed genes for each cluster were identified using genes that are detected in at least 10% of cells in either of the two clusters and genes showing a minimum difference of 10% between the two clusters. Cell types were annotated using known marker genes. The SABER seq FASTQ reads were processed using the Cell Ranger count pipeline similar to the transcriptomic reads. A bash script was then used to generate a text file containing all FASTQ headers and error corrected cell barcodes for SABER seq data. post loading filtered barcode matrices into R error corrected cell barcodes from transcriptomic reads were isolated and matched against those in the text file to identify common cell barcode that are shared between the transcriptomic and SABER seq datasets. The resulting text file contained redundant error corrected cell barcodes associated with different UMIs for the same cell. Thus unique error corrected cell barcodes were isolated to create a text file containing unique FASTQ headers an…	zebrafish whole brain		Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer’s instructions Single Cell 3’ v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads used initi…	This work was performed under protocol numbers 807110 and 807259 which were approved by the University of Pennsylvania’s Office of Animal Welfare of Institutional Animal Care and Use Committee IACUC. All zebrafish work in this study follows the University of Pennsylvania Institutional Animal Care and Use Committee regulations.	tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB	GSM8290044	GSM8290044: SABERb1 brainC2 Medgenome Run2 brain1 transcriptome; Danio rerio; RNA Seq	GSM8290044 r1	GSM8290044	1	Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer's instructions Single Cell three prime v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads u…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP509892		loader:fastq load.py	SABERb1_brainC2_S2_L002_I1_001.fastq.gz SABERb1_brainC2_S2_L002_I2_001.fastq.gz SABERb1_brainC2_S2_L002_R1_001.fastq.gz SABERb1_brainC2_S2_L002_R2_001.fastq.gz	fastq fastq fastq fastq	3635949490.0	26157910.0	GSM8290044 r1	0:10 1:10 2:28 3:91	A:726922983;C:475009000;G:515409063;T:663020855;N:7909	10	10	28	91	726922983	475009000	515409063	663020855	7909	SRX24701853	SRS21429382	SRA1989588	University of Pennsylvania	University of Pennsylvania	1	0.91216		0.23091		0.76495		0.55384		91		B		usable mapping rate	illumina	novaseq_era	full_length	random_priming	unknown	sc	single_cell_droplet	10x	United States	2024-05-25	Larval	Larval	Brain	Nervous System
32396	32396	SRR29181705	SRX24701853	SRS21429382	SRP509892	PRJNA1116548	Barcoding Notch signaling in the developing brain	GSE268356	Other	Developmental signaling inputs are fundamental for shaping cell fates and behavior. However traditional fluorescent based signaling reporters have limitations in scalability and molecular resolution of cell types. We present SABER seq a CRISPR Cas molecular recorder that stores transient developmental signaling cues as permanent mutations in cellular genomes for deconstruction at later stages via single cell transcriptomics. We applied SABER seq to record Notch signaling in developing zebrafish brains. SABER seq has two components: a signaling sensor and a barcode recorder. The sensor activates Cas9 in a Notch dependent manner with inducible control while the recorder obtains mutations in ancestral cells where Notch is active. We combine SABER seq with an expanded juvenile brain atlas to identify cell types derived from Notch active founders. Our data reveals rare examples where differential Notch activity in ancestral progenitors is detected in terminally differentiated neuronal subtypes. SABER seq is a novel platform for rapid scalable and high resolution mapping of signaling activity during development. Overall design: 10x Genomics libraries of single cell transcriptomes and SABER seq data and genomic DNA SABER data		pubmed:39575683		SABERb1 brainC2 Medgenome Run2 brain1 transcriptome	GSM8290044		source name:zebrafish whole brain\|tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB\|geo loc name:missing\|collection date:missing	SABERb1 brainC2 Medgenome Run2 brain1 transcriptome	Raw FASTQ reads were aligned against zebrafish genome built from GRCz.109.gtf and the GRCz11.fa files using the Cell Ranger count pipeline to generate gene by cell count matrices filtered barcode matrix. The count matrices were processed using the standard workflow of the Seurat v5.0.2 R package with modifications. Briefly all count matrices were separately loaded into R. Seurat objects were then created with modified parameters requiring features to be detected in at least 3 cells and cells to contain at least 300 genes. Subsequently the Seurat objects were merged to create a single Seurat object. Cells with RNA counts between 300 and 4000 and a mitochondrial gene percentage of less than 9% were selected for downstream analysis. Gene expression values were log normalized with the default parameters and scaled for the top 3000 variable genes. The scaled data was then used to compute the 50 principal components. Cells were iteratively clustered using the Louvain algorithm post identifying neighboring cells. Differentially expressed genes for each cluster were identified using genes that are detected in at least 10% of cells in either of the two clusters and genes showing a minimum difference of 10% between the two clusters. Cell types were annotated using known marker genes. The SABER seq FASTQ reads were processed using the Cell Ranger count pipeline similar to the transcriptomic reads. A bash script was then used to generate a text file containing all FASTQ headers and error corrected cell barcodes for SABER seq data. post loading filtered barcode matrices into R error corrected cell barcodes from transcriptomic reads were isolated and matched against those in the text file to identify common cell barcode that are shared between the transcriptomic and SABER seq datasets. The resulting text file contained redundant error corrected cell barcodes associated with different UMIs for the same cell. Thus unique error corrected cell barcodes were isolated to create a text file containing unique FASTQ headers an…	zebrafish whole brain		Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer’s instructions Single Cell 3’ v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads used initi…	This work was performed under protocol numbers 807110 and 807259 which were approved by the University of Pennsylvania’s Office of Animal Welfare of Institutional Animal Care and Use Committee IACUC. All zebrafish work in this study follows the University of Pennsylvania Institutional Animal Care and Use Committee regulations.	tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB	GSM8290044	GSM8290044: SABERb1 brainC2 Medgenome Run2 brain1 transcriptome; Danio rerio; RNA Seq	GSM8290044 r1	GSM8290044	1	Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer's instructions Single Cell three prime v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads u…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP509892		loader:fastq load.py	SABERb1_brainC2_S7_L002_I1_001.fastq.gz SABERb1_brainC2_S7_L002_I2_001.fastq.gz SABERb1_brainC2_S7_L002_R1_001.fastq.gz SABERb1_brainC2_S7_L002_R2_001.fastq.gz	fastq fastq fastq fastq	11551358978.0	83103302.0	GSM8290044 r2	0:10 1:10 2:28 3:91	A:2291886666;C:1518484627;G:1649680085;T:2102329631;N:19473	10	10	28	91	2291886666	1518484627	1649680085	2102329631	19473	SRX24701853	SRS21429382	SRA1989588	University of Pennsylvania	University of Pennsylvania	1	0.91457		0.23286		0.76674		0.5505		91		B		usable mapping rate	illumina	novaseq_era	full_length	random_priming	unknown	sc	single_cell_droplet	10x	United States	2024-05-25	Larval	Larval	Brain	Nervous System
32397	32397	SRR29181702	SRX24701852	SRS21429381	SRP509892	PRJNA1116548	Barcoding Notch signaling in the developing brain	GSE268356	Other	Developmental signaling inputs are fundamental for shaping cell fates and behavior. However traditional fluorescent based signaling reporters have limitations in scalability and molecular resolution of cell types. We present SABER seq a CRISPR Cas molecular recorder that stores transient developmental signaling cues as permanent mutations in cellular genomes for deconstruction at later stages via single cell transcriptomics. We applied SABER seq to record Notch signaling in developing zebrafish brains. SABER seq has two components: a signaling sensor and a barcode recorder. The sensor activates Cas9 in a Notch dependent manner with inducible control while the recorder obtains mutations in ancestral cells where Notch is active. We combine SABER seq with an expanded juvenile brain atlas to identify cell types derived from Notch active founders. Our data reveals rare examples where differential Notch activity in ancestral progenitors is detected in terminally differentiated neuronal subtypes. SABER seq is a novel platform for rapid scalable and high resolution mapping of signaling activity during development. Overall design: 10x Genomics libraries of single cell transcriptomes and SABER seq data and genomic DNA SABER data		pubmed:39575683		SABERb1 brainC1 Medgenome Run2 brain1 transcriptome	GSM8290043		source name:zebrafish whole brain\|tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB\|geo loc name:missing\|collection date:missing	SABERb1 brainC1 Medgenome Run2 brain1 transcriptome	Raw FASTQ reads were aligned against zebrafish genome built from GRCz.109.gtf and the GRCz11.fa files using the Cell Ranger count pipeline to generate gene by cell count matrices filtered barcode matrix. The count matrices were processed using the standard workflow of the Seurat v5.0.2 R package with modifications. Briefly all count matrices were separately loaded into R. Seurat objects were then created with modified parameters requiring features to be detected in at least 3 cells and cells to contain at least 300 genes. Subsequently the Seurat objects were merged to create a single Seurat object. Cells with RNA counts between 300 and 4000 and a mitochondrial gene percentage of less than 9% were selected for downstream analysis. Gene expression values were log normalized with the default parameters and scaled for the top 3000 variable genes. The scaled data was then used to compute the 50 principal components. Cells were iteratively clustered using the Louvain algorithm post identifying neighboring cells. Differentially expressed genes for each cluster were identified using genes that are detected in at least 10% of cells in either of the two clusters and genes showing a minimum difference of 10% between the two clusters. Cell types were annotated using known marker genes. The SABER seq FASTQ reads were processed using the Cell Ranger count pipeline similar to the transcriptomic reads. A bash script was then used to generate a text file containing all FASTQ headers and error corrected cell barcodes for SABER seq data. post loading filtered barcode matrices into R error corrected cell barcodes from transcriptomic reads were isolated and matched against those in the text file to identify common cell barcode that are shared between the transcriptomic and SABER seq datasets. The resulting text file contained redundant error corrected cell barcodes associated with different UMIs for the same cell. Thus unique error corrected cell barcodes were isolated to create a text file containing unique FASTQ headers an…	zebrafish whole brain		Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer’s instructions Single Cell 3’ v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads used initi…	This work was performed under protocol numbers 807110 and 807259 which were approved by the University of Pennsylvania’s Office of Animal Welfare of Institutional Animal Care and Use Committee IACUC. All zebrafish work in this study follows the University of Pennsylvania Institutional Animal Care and Use Committee regulations.	tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB	GSM8290043	GSM8290043: SABERb1 brainC1 Medgenome Run2 brain1 transcriptome; Danio rerio; RNA Seq	GSM8290043 r1	GSM8290043	1	Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer's instructions Single Cell three prime v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads u…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP509892		loader:fastq load.py	SABERb1_brainC1_S1_L002_I1_001.fastq.gz SABERb1_brainC1_S1_L002_I2_001.fastq.gz SABERb1_brainC1_S1_L002_R1_001.fastq.gz SABERb1_brainC1_S1_L002_R2_001.fastq.gz	fastq fastq fastq fastq	3575922201.0	25726059.0	GSM8290043 r1	0:10 1:10 2:28 3:91	A:706764997;C:473784835;G:514720645;T:645793304;N:7588	10	10	28	91	706764997	473784835	514720645	645793304	7588	SRX24701852	SRS21429381	SRA1989588	University of Pennsylvania	University of Pennsylvania	1	0.91627		0.22683		0.76469		0.54848		91		B		usable mapping rate	illumina	novaseq_era	full_length	random_priming	unknown	sc	single_cell_droplet	10x	United States	2024-05-25	Larval	Larval	Brain	Nervous System
32398	32398	SRR29181703	SRX24701852	SRS21429381	SRP509892	PRJNA1116548	Barcoding Notch signaling in the developing brain	GSE268356	Other	Developmental signaling inputs are fundamental for shaping cell fates and behavior. However traditional fluorescent based signaling reporters have limitations in scalability and molecular resolution of cell types. We present SABER seq a CRISPR Cas molecular recorder that stores transient developmental signaling cues as permanent mutations in cellular genomes for deconstruction at later stages via single cell transcriptomics. We applied SABER seq to record Notch signaling in developing zebrafish brains. SABER seq has two components: a signaling sensor and a barcode recorder. The sensor activates Cas9 in a Notch dependent manner with inducible control while the recorder obtains mutations in ancestral cells where Notch is active. We combine SABER seq with an expanded juvenile brain atlas to identify cell types derived from Notch active founders. Our data reveals rare examples where differential Notch activity in ancestral progenitors is detected in terminally differentiated neuronal subtypes. SABER seq is a novel platform for rapid scalable and high resolution mapping of signaling activity during development. Overall design: 10x Genomics libraries of single cell transcriptomes and SABER seq data and genomic DNA SABER data		pubmed:39575683		SABERb1 brainC1 Medgenome Run2 brain1 transcriptome	GSM8290043		source name:zebrafish whole brain\|tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB\|geo loc name:missing\|collection date:missing	SABERb1 brainC1 Medgenome Run2 brain1 transcriptome	Raw FASTQ reads were aligned against zebrafish genome built from GRCz.109.gtf and the GRCz11.fa files using the Cell Ranger count pipeline to generate gene by cell count matrices filtered barcode matrix. The count matrices were processed using the standard workflow of the Seurat v5.0.2 R package with modifications. Briefly all count matrices were separately loaded into R. Seurat objects were then created with modified parameters requiring features to be detected in at least 3 cells and cells to contain at least 300 genes. Subsequently the Seurat objects were merged to create a single Seurat object. Cells with RNA counts between 300 and 4000 and a mitochondrial gene percentage of less than 9% were selected for downstream analysis. Gene expression values were log normalized with the default parameters and scaled for the top 3000 variable genes. The scaled data was then used to compute the 50 principal components. Cells were iteratively clustered using the Louvain algorithm post identifying neighboring cells. Differentially expressed genes for each cluster were identified using genes that are detected in at least 10% of cells in either of the two clusters and genes showing a minimum difference of 10% between the two clusters. Cell types were annotated using known marker genes. The SABER seq FASTQ reads were processed using the Cell Ranger count pipeline similar to the transcriptomic reads. A bash script was then used to generate a text file containing all FASTQ headers and error corrected cell barcodes for SABER seq data. post loading filtered barcode matrices into R error corrected cell barcodes from transcriptomic reads were isolated and matched against those in the text file to identify common cell barcode that are shared between the transcriptomic and SABER seq datasets. The resulting text file contained redundant error corrected cell barcodes associated with different UMIs for the same cell. Thus unique error corrected cell barcodes were isolated to create a text file containing unique FASTQ headers an…	zebrafish whole brain		Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer’s instructions Single Cell 3’ v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads used initi…	This work was performed under protocol numbers 807110 and 807259 which were approved by the University of Pennsylvania’s Office of Animal Welfare of Institutional Animal Care and Use Committee IACUC. All zebrafish work in this study follows the University of Pennsylvania Institutional Animal Care and Use Committee regulations.	tissue:zebrafish whole brain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB	GSM8290043	GSM8290043: SABERb1 brainC1 Medgenome Run2 brain1 transcriptome; Danio rerio; RNA Seq	GSM8290043 r1	GSM8290043	1	Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer's instructions Single Cell three prime v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads u…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP509892		loader:fastq load.py	SABERb1_brainC1_S6_L002_R2_001.fastq.gz SABERb1_brainC1_S6_L002_R1_001.fastq.gz SABERb1_brainC1_S6_L002_I2_001.fastq.gz SABERb1_brainC1_S6_L002_I1_001.fastq.gz	fastq fastq fastq fastq	9218042845.0	66316855.0	GSM8290043 r2	0:10 1:10 2:28 3:91	A:1809678331;C:1230188279;G:1336832583;T:1658118873;N:15739	10	10	28	91	1809678331	1230188279	1336832583	1658118873	15739	SRX24701852	SRS21429381	SRA1989588	University of Pennsylvania	University of Pennsylvania	1	0.91802		0.22377		0.76254		0.54853		91		B		usable mapping rate	illumina	novaseq_era	full_length	random_priming	unknown	sc	single_cell_droplet	10x	United States	2024-05-25	Larval	Larval	Brain	Nervous System
32399	32399	SRR29181701	SRX24701851	SRS21429380	SRP509892	PRJNA1116548	Barcoding Notch signaling in the developing brain	GSE268356	Other	Developmental signaling inputs are fundamental for shaping cell fates and behavior. However traditional fluorescent based signaling reporters have limitations in scalability and molecular resolution of cell types. We present SABER seq a CRISPR Cas molecular recorder that stores transient developmental signaling cues as permanent mutations in cellular genomes for deconstruction at later stages via single cell transcriptomics. We applied SABER seq to record Notch signaling in developing zebrafish brains. SABER seq has two components: a signaling sensor and a barcode recorder. The sensor activates Cas9 in a Notch dependent manner with inducible control while the recorder obtains mutations in ancestral cells where Notch is active. We combine SABER seq with an expanded juvenile brain atlas to identify cell types derived from Notch active founders. Our data reveals rare examples where differential Notch activity in ancestral progenitors is detected in terminally differentiated neuronal subtypes. SABER seq is a novel platform for rapid scalable and high resolution mapping of signaling activity during development. Overall design: 10x Genomics libraries of single cell transcriptomes and SABER seq data and genomic DNA SABER data		pubmed:39575683		zBrHb C1hind021023wk3 hindbrain transcriptome	GSM8290042		source name:zebrafish hindbrain\|tissue:zebrafish hindbrain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB\|geo loc name:missing\|collection date:missing	zBrHb C1hind021023wk3 hindbrain transcriptome	Raw FASTQ reads were aligned against zebrafish genome built from GRCz.109.gtf and the GRCz11.fa files using the Cell Ranger count pipeline to generate gene by cell count matrices filtered barcode matrix. The count matrices were processed using the standard workflow of the Seurat v5.0.2 R package with modifications. Briefly all count matrices were separately loaded into R. Seurat objects were then created with modified parameters requiring features to be detected in at least 3 cells and cells to contain at least 300 genes. Subsequently the Seurat objects were merged to create a single Seurat object. Cells with RNA counts between 300 and 4000 and a mitochondrial gene percentage of less than 9% were selected for downstream analysis. Gene expression values were log normalized with the default parameters and scaled for the top 3000 variable genes. The scaled data was then used to compute the 50 principal components. Cells were iteratively clustered using the Louvain algorithm post identifying neighboring cells. Differentially expressed genes for each cluster were identified using genes that are detected in at least 10% of cells in either of the two clusters and genes showing a minimum difference of 10% between the two clusters. Cell types were annotated using known marker genes. The SABER seq FASTQ reads were processed using the Cell Ranger count pipeline similar to the transcriptomic reads. A bash script was then used to generate a text file containing all FASTQ headers and error corrected cell barcodes for SABER seq data. post loading filtered barcode matrices into R error corrected cell barcodes from transcriptomic reads were isolated and matched against those in the text file to identify common cell barcode that are shared between the transcriptomic and SABER seq datasets. The resulting text file contained redundant error corrected cell barcodes associated with different UMIs for the same cell. Thus unique error corrected cell barcodes were isolated to create a text file containing unique FASTQ headers an…	zebrafish hindbrain		Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer’s instructions Single Cell 3’ v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads used initi…	This work was performed under protocol numbers 807110 and 807259 which were approved by the University of Pennsylvania’s Office of Animal Welfare of Institutional Animal Care and Use Committee IACUC. All zebrafish work in this study follows the University of Pennsylvania Institutional Animal Care and Use Committee regulations.	tissue:zebrafish hindbrain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB	GSM8290042	GSM8290042: zBrHb C1hind021023wk3 hindbrain transcriptome; Danio rerio; RNA Seq	GSM8290042 r1	GSM8290042	1	Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer's instructions Single Cell three prime v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads u…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP509892		loader:fastq load.py	zBrHb_C2hind021023wk3_CKDL230006230-1A_HW3J5DSX5_S2_L004_I1_001.fastq.gz zBrHb_C2hind021023wk3_CKDL230006230-1A_HW3J5DSX5_S2_L004_I2_001.fastq.gz zBrHb_C2hind021023wk3_CKDL230006230-1A_HW3J5DSX5_S2_L004_R1_001.fastq.gz zBrHb_C2hind021023wk3_CKDL230006230-1A_HW3J5DSX5_S2_L004_R2_001.fastq.gz	fastq fastq fastq fastq	64546948800.0	201709215.0	GSM8290042 r2	0:10 1:10 2:150 3:150	A:19999216483;C:7881744410;G:8397001445;T:24234036869;N:765293	10	10	150	150	19999216483	7881744410	8397001445	24234036869	765293	SRX24701851	SRS21429380	SRA1989588	University of Pennsylvania	University of Pennsylvania	2	0.16904	0.87311	0.05961	0.20305	0.98169	0.771	0.4964	0.52096	150	150	T	B	mate1 technical by mapping diff	illumina	novaseq_era	full_length	random_priming	unknown	sc	single_cell_droplet	10x	United States	2024-05-25	Larval	Larval	Brain	Nervous System
32400	32400	SRR29181710	SRX24701851	SRS21429380	SRP509892	PRJNA1116548	Barcoding Notch signaling in the developing brain	GSE268356	Other	Developmental signaling inputs are fundamental for shaping cell fates and behavior. However traditional fluorescent based signaling reporters have limitations in scalability and molecular resolution of cell types. We present SABER seq a CRISPR Cas molecular recorder that stores transient developmental signaling cues as permanent mutations in cellular genomes for deconstruction at later stages via single cell transcriptomics. We applied SABER seq to record Notch signaling in developing zebrafish brains. SABER seq has two components: a signaling sensor and a barcode recorder. The sensor activates Cas9 in a Notch dependent manner with inducible control while the recorder obtains mutations in ancestral cells where Notch is active. We combine SABER seq with an expanded juvenile brain atlas to identify cell types derived from Notch active founders. Our data reveals rare examples where differential Notch activity in ancestral progenitors is detected in terminally differentiated neuronal subtypes. SABER seq is a novel platform for rapid scalable and high resolution mapping of signaling activity during development. Overall design: 10x Genomics libraries of single cell transcriptomes and SABER seq data and genomic DNA SABER data		pubmed:39575683		zBrHb C1hind021023wk3 hindbrain transcriptome	GSM8290042		source name:zebrafish hindbrain\|tissue:zebrafish hindbrain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB\|geo loc name:missing\|collection date:missing	zBrHb C1hind021023wk3 hindbrain transcriptome	Raw FASTQ reads were aligned against zebrafish genome built from GRCz.109.gtf and the GRCz11.fa files using the Cell Ranger count pipeline to generate gene by cell count matrices filtered barcode matrix. The count matrices were processed using the standard workflow of the Seurat v5.0.2 R package with modifications. Briefly all count matrices were separately loaded into R. Seurat objects were then created with modified parameters requiring features to be detected in at least 3 cells and cells to contain at least 300 genes. Subsequently the Seurat objects were merged to create a single Seurat object. Cells with RNA counts between 300 and 4000 and a mitochondrial gene percentage of less than 9% were selected for downstream analysis. Gene expression values were log normalized with the default parameters and scaled for the top 3000 variable genes. The scaled data was then used to compute the 50 principal components. Cells were iteratively clustered using the Louvain algorithm post identifying neighboring cells. Differentially expressed genes for each cluster were identified using genes that are detected in at least 10% of cells in either of the two clusters and genes showing a minimum difference of 10% between the two clusters. Cell types were annotated using known marker genes. The SABER seq FASTQ reads were processed using the Cell Ranger count pipeline similar to the transcriptomic reads. A bash script was then used to generate a text file containing all FASTQ headers and error corrected cell barcodes for SABER seq data. post loading filtered barcode matrices into R error corrected cell barcodes from transcriptomic reads were isolated and matched against those in the text file to identify common cell barcode that are shared between the transcriptomic and SABER seq datasets. The resulting text file contained redundant error corrected cell barcodes associated with different UMIs for the same cell. Thus unique error corrected cell barcodes were isolated to create a text file containing unique FASTQ headers an…	zebrafish hindbrain		Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer’s instructions Single Cell 3’ v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads used initi…	This work was performed under protocol numbers 807110 and 807259 which were approved by the University of Pennsylvania’s Office of Animal Welfare of Institutional Animal Care and Use Committee IACUC. All zebrafish work in this study follows the University of Pennsylvania Institutional Animal Care and Use Committee regulations.	tissue:zebrafish hindbrain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB	GSM8290042	GSM8290042: zBrHb C1hind021023wk3 hindbrain transcriptome; Danio rerio; RNA Seq	GSM8290042 r1	GSM8290042	1	Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer's instructions Single Cell three prime v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads u…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP509892		loader:fastq load.py	zBrHb_C1hind021023wk3_CKDL230006230-1A_HW3J5DSX5_S4_L004_R2_001.fastq.gz zBrHb_C1hind021023wk3_CKDL230006230-1A_HW3J5DSX5_S4_L004_R1_001.fastq.gz zBrHb_C1hind021023wk3_CKDL230006230-1A_HW3J5DSX5_S4_L004_I2_001.fastq.gz zBrHb_C1hind021023wk3_CKDL230006230-1A_HW3J5DSX5_S4_L004_I1_001.fastq.gz	fastq fastq fastq fastq	65651641280.0	205161379.0	GSM8290042 r1	0:10 1:10 2:150 3:150	A:20160289471;C:8227800878;G:8724732321;T:24434818500;N:772530	10	10	150	150	20160289471	8227800878	8724732321	24434818500	772530	SRX24701851	SRS21429380	SRA1989588	University of Pennsylvania	University of Pennsylvania	2	0.20153	0.88953	0.07095	0.20427	0.97944	0.77007	0.47788	0.5233	150	150	T	B	mate1 technical by mapping diff	illumina	novaseq_era	full_length	random_priming	unknown	sc	single_cell_droplet	10x	United States	2024-05-25	Larval	Larval	Brain	Nervous System
32401	32401	SRR29181708	SRX24701850	SRS21429379	SRP509892	PRJNA1116548	Barcoding Notch signaling in the developing brain	GSE268356	Other	Developmental signaling inputs are fundamental for shaping cell fates and behavior. However traditional fluorescent based signaling reporters have limitations in scalability and molecular resolution of cell types. We present SABER seq a CRISPR Cas molecular recorder that stores transient developmental signaling cues as permanent mutations in cellular genomes for deconstruction at later stages via single cell transcriptomics. We applied SABER seq to record Notch signaling in developing zebrafish brains. SABER seq has two components: a signaling sensor and a barcode recorder. The sensor activates Cas9 in a Notch dependent manner with inducible control while the recorder obtains mutations in ancestral cells where Notch is active. We combine SABER seq with an expanded juvenile brain atlas to identify cell types derived from Notch active founders. Our data reveals rare examples where differential Notch activity in ancestral progenitors is detected in terminally differentiated neuronal subtypes. SABER seq is a novel platform for rapid scalable and high resolution mapping of signaling activity during development. Overall design: 10x Genomics libraries of single cell transcriptomes and SABER seq data and genomic DNA SABER data		pubmed:39575683		zBrMb B1mid021023wk3 midbrain transcriptome	GSM8290041		source name:zebrafish midbrain\|tissue:zebrafish midbrain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB\|geo loc name:missing\|collection date:missing	zBrMb B1mid021023wk3 midbrain transcriptome	Raw FASTQ reads were aligned against zebrafish genome built from GRCz.109.gtf and the GRCz11.fa files using the Cell Ranger count pipeline to generate gene by cell count matrices filtered barcode matrix. The count matrices were processed using the standard workflow of the Seurat v5.0.2 R package with modifications. Briefly all count matrices were separately loaded into R. Seurat objects were then created with modified parameters requiring features to be detected in at least 3 cells and cells to contain at least 300 genes. Subsequently the Seurat objects were merged to create a single Seurat object. Cells with RNA counts between 300 and 4000 and a mitochondrial gene percentage of less than 9% were selected for downstream analysis. Gene expression values were log normalized with the default parameters and scaled for the top 3000 variable genes. The scaled data was then used to compute the 50 principal components. Cells were iteratively clustered using the Louvain algorithm post identifying neighboring cells. Differentially expressed genes for each cluster were identified using genes that are detected in at least 10% of cells in either of the two clusters and genes showing a minimum difference of 10% between the two clusters. Cell types were annotated using known marker genes. The SABER seq FASTQ reads were processed using the Cell Ranger count pipeline similar to the transcriptomic reads. A bash script was then used to generate a text file containing all FASTQ headers and error corrected cell barcodes for SABER seq data. post loading filtered barcode matrices into R error corrected cell barcodes from transcriptomic reads were isolated and matched against those in the text file to identify common cell barcode that are shared between the transcriptomic and SABER seq datasets. The resulting text file contained redundant error corrected cell barcodes associated with different UMIs for the same cell. Thus unique error corrected cell barcodes were isolated to create a text file containing unique FASTQ headers an…	zebrafish midbrain		Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer’s instructions Single Cell 3’ v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads used initi…	This work was performed under protocol numbers 807110 and 807259 which were approved by the University of Pennsylvania’s Office of Animal Welfare of Institutional Animal Care and Use Committee IACUC. All zebrafish work in this study follows the University of Pennsylvania Institutional Animal Care and Use Committee regulations.	tissue:zebrafish midbrain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB	GSM8290041	GSM8290041: zBrMb B1mid021023wk3 midbrain transcriptome; Danio rerio; RNA Seq	GSM8290041 r1	GSM8290041	1	Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer's instructions Single Cell three prime v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads u…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP509892		loader:fastq load.py	zBrMb_B1mid021023wk3_CKDL230006230-1A_HW3J5DSX5_S1_L004_I1_001.fastq.gz zBrMb_B1mid021023wk3_CKDL230006230-1A_HW3J5DSX5_S1_L004_I2_001.fastq.gz zBrMb_B1mid021023wk3_CKDL230006230-1A_HW3J5DSX5_S1_L004_R1_001.fastq.gz zBrMb_B1mid021023wk3_CKDL230006230-1A_HW3J5DSX5_S1_L004_R2_001.fastq.gz	fastq fastq fastq fastq	57396728320.0	179364776.0	GSM8290041 r1	0:10 1:10 2:150 3:150	A:17624133070;C:7302355189;G:7764883537;T:21117377617;N:683387	10	10	150	150	17624133070	7302355189	7764883537	21117377617	683387	SRX24701850	SRS21429379	SRA1989588	University of Pennsylvania	University of Pennsylvania	2	0.17325	0.90421	0.06608	0.18333	0.98508	0.78303	0.51396	0.52463	150	150	T	B	mate1 technical by mapping diff	illumina	novaseq_era	full_length	random_priming	unknown	sc	single_cell_droplet	10x	United States	2024-05-25	Larval	Larval	Brain	Nervous System
32402	32402	SRR29181709	SRX24701850	SRS21429379	SRP509892	PRJNA1116548	Barcoding Notch signaling in the developing brain	GSE268356	Other	Developmental signaling inputs are fundamental for shaping cell fates and behavior. However traditional fluorescent based signaling reporters have limitations in scalability and molecular resolution of cell types. We present SABER seq a CRISPR Cas molecular recorder that stores transient developmental signaling cues as permanent mutations in cellular genomes for deconstruction at later stages via single cell transcriptomics. We applied SABER seq to record Notch signaling in developing zebrafish brains. SABER seq has two components: a signaling sensor and a barcode recorder. The sensor activates Cas9 in a Notch dependent manner with inducible control while the recorder obtains mutations in ancestral cells where Notch is active. We combine SABER seq with an expanded juvenile brain atlas to identify cell types derived from Notch active founders. Our data reveals rare examples where differential Notch activity in ancestral progenitors is detected in terminally differentiated neuronal subtypes. SABER seq is a novel platform for rapid scalable and high resolution mapping of signaling activity during development. Overall design: 10x Genomics libraries of single cell transcriptomes and SABER seq data and genomic DNA SABER data		pubmed:39575683		zBrMb B1mid021023wk3 midbrain transcriptome	GSM8290041		source name:zebrafish midbrain\|tissue:zebrafish midbrain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB\|geo loc name:missing\|collection date:missing	zBrMb B1mid021023wk3 midbrain transcriptome	Raw FASTQ reads were aligned against zebrafish genome built from GRCz.109.gtf and the GRCz11.fa files using the Cell Ranger count pipeline to generate gene by cell count matrices filtered barcode matrix. The count matrices were processed using the standard workflow of the Seurat v5.0.2 R package with modifications. Briefly all count matrices were separately loaded into R. Seurat objects were then created with modified parameters requiring features to be detected in at least 3 cells and cells to contain at least 300 genes. Subsequently the Seurat objects were merged to create a single Seurat object. Cells with RNA counts between 300 and 4000 and a mitochondrial gene percentage of less than 9% were selected for downstream analysis. Gene expression values were log normalized with the default parameters and scaled for the top 3000 variable genes. The scaled data was then used to compute the 50 principal components. Cells were iteratively clustered using the Louvain algorithm post identifying neighboring cells. Differentially expressed genes for each cluster were identified using genes that are detected in at least 10% of cells in either of the two clusters and genes showing a minimum difference of 10% between the two clusters. Cell types were annotated using known marker genes. The SABER seq FASTQ reads were processed using the Cell Ranger count pipeline similar to the transcriptomic reads. A bash script was then used to generate a text file containing all FASTQ headers and error corrected cell barcodes for SABER seq data. post loading filtered barcode matrices into R error corrected cell barcodes from transcriptomic reads were isolated and matched against those in the text file to identify common cell barcode that are shared between the transcriptomic and SABER seq datasets. The resulting text file contained redundant error corrected cell barcodes associated with different UMIs for the same cell. Thus unique error corrected cell barcodes were isolated to create a text file containing unique FASTQ headers an…	zebrafish midbrain		Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer’s instructions Single Cell 3’ v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads used initi…	This work was performed under protocol numbers 807110 and 807259 which were approved by the University of Pennsylvania’s Office of Animal Welfare of Institutional Animal Care and Use Committee IACUC. All zebrafish work in this study follows the University of Pennsylvania Institutional Animal Care and Use Committee regulations.	tissue:zebrafish midbrain\|developmental stage:21 dpf 23 dpf Juvenile\|genotype:WT/TLAB	GSM8290041	GSM8290041: zBrMb B1mid021023wk3 midbrain transcriptome; Danio rerio; RNA Seq	GSM8290041 r1	GSM8290041	1	Wild type and SABER x her4.3:switchCas9 zebrafish brains were harvested and dissociated at 21 dpf 23 dpf as described previously Raj et. al 2018 Nature Biotechnology with the following modifications. All microcentrifuge tubes were treated with 1% BSA/DPBS overnight to prevent cell loss due to adhesion. Brains were dissociated with 1 mL of 20 units/ml papain in EBSS media and incubated at 37 °C for 20 min. Cells were resuspended with 150 μl ice cold 1%BSA/DPBS solution. Transcriptome libraries were processed according to the manufacturer's instructions Single Cell three prime v3 kit. Transcriptome libraries were sequenced using NovaSeq S4 300 cycle kits Novogene and Novaseq SP 100 and 200 cycle kits MedGenome. To generate SABER seq libraries samples post cDNA amplification and prior to fragmentation were split into two parts. One part was processed for transcriptome libraries as instructed by the manufacturer. The other part was processed for SABER seq libraries as follows. To enrich for SABER barcodes 5 µl of the whole transcriptome cDNA was PCR amplified with 10X p140v1UP GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CGTCGTAGATCTTCATCGTGATG and 10XPCR1F CTACACGACGCTCTTCCGATCT primers and Q5 polymerase. The reaction conditions were: 98 °C 30 s; [98 °C 10 s; 68 °C 25 s; 72 °C 15 s] x 14 cycles; 72 °C 2 min. The reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer. A second PCR was carried out using 3 µl of PCR1 product and 10XPCR1F and 10X p140v2Sa GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GAAACTACATGGGGTcaGCTC primers. Reaction conditions were same as PCR1 except only 13 cycles were completed. At this point 2 different clean up conditions were used: iteration 1 SABER seq v0 and iteration 2 SABER seq v1. For iteration 1 the reaction was cleaned up with 0.8X SPRISelect beads and eluted in 20 µl elution buffer EB buffer similar to PCR1. For iteration 2 an optimization was trialed and the reaction was cleaned up with right side size selection using SPRIselect beads 0.6X beads u…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP509892		loader:fastq load.py	zBrMb_B2mid021023wk3_CKDL230006230-1A_HW3J5DSX5_S6_L004_R2_001.fastq.gz zBrMb_B2mid021023wk3_CKDL230006230-1A_HW3J5DSX5_S6_L004_R1_001.fastq.gz zBrMb_B2mid021023wk3_CKDL230006230-1A_HW3J5DSX5_S6_L004_I2_001.fastq.gz zBrMb_B2mid021023wk3_CKDL230006230-1A_HW3J5DSX5_S6_L004_I1_001.fastq.gz	fastq fastq fastq fastq	61698264000.0	192807075.0	GSM8290041 r2	0:10 1:10 2:150 3:150	A:18951447819;C:7712374364;G:8225043540;T:22952522047;N:734730	10	10	150	150	18951447819	7712374364	8225043540	22952522047	734730	SRX24701850	SRS21429379	SRA1989588	University of Pennsylvania	University of Pennsylvania	2	0.18731	0.88885	0.07427	0.21742	0.98088	0.77662	0.50039	0.51547	150	150	T	B	mate1 technical by mapping diff	illumina	novaseq_era	full_length	random_priming	unknown	sc	single_cell_droplet	10x	United States	2024-05-25	Larval	Larval	Brain	Nervous System

Advanced export

JSON shape: default, array, newline-delimited

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;