metadata: run_metadata: 1,900 rows where experiment.library_source = "TRANSCRIPTOMIC", technology = "smartseq" and tissue_curation

1,900 rows where experiment.library_source = "TRANSCRIPTOMIC", technology = "smartseq" and tissue_curation_coarse = "Nervous System"

descending

Link	rowid ▼	run.accession	experiment.accession	sample.accession	study.accession	bioproject	study.title	study.alias	study.type	study.abstract	study.attributes	study.PMIDs	sample.description	sample.title	sample.alias	sample.centername	sample.attributes	GEOsample.title	GEOsample.dataprocessing	GEOsample.source	GEOsample.treatmentprotocol	GEOsample.extractprotocol	GEOsample.growthprotocol	GEOsample.characteristics	GEOsample.accession	experiment.title	experiment.alias	experiment.library_name	experiment.design_description	experiment.library_construction_protocol	experiment.attributes	experiment.library_strategy	experiment.library_source	experiment.library_selection	experiment.library_layout	experiment.platform	experiment.instrument_model	experiment.study_ref	run.title	run.attributes	run.filename	run.semantic_name	run.total_bases	run.total_spots	run.alias	run.read_lengths	run.base_counts	run.r1_length	run.r2_length	run.Acount	run.Ccount	run.Gcount	run.Tcount	run.Ncount	run.experiment	run.pool_member	submission.accession	submission.srasource	submission.bioprojectsource	seqdetective.n_mates	seqdetective.mapping_rate.mate1	seqdetective.nofeature_rate.mate1	seqdetective.sparsity.mate1	seqdetective.pos_strand_rate.mate1	seqdetective.readlen.mate1	seqdetective.judgement.mate1	seqdetective.judgement.reason	platform_family	instrument_generation	read_bias	selection_class	prep_kit	sc_or_bulk	tech_class	technology	submission.bioprojectsource.country	earliest_date	devstage_curation	devstage_curation_coarse	tissue_curation	tissue_curation_coarse
10237	10237	ERR7131169	ERX6698608	ERS8070397	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F8 Nega	SAMEA10418613	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418613\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F8 Nega\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry /GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 8\|organism part:olfactory bulb\|sample name:E MTAB 11083:F8 Nega\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F8 Nega s	F8 Nega s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry /GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F22-1_210715_D00404_0538_BCD91CANXX_TCGACGTC-CTAAGCCT_L006_R1_001.fastq.gz	fastq	658093749.0	12903799.0	E MTAB 11083:2874F22 1 210715 D00404 0538 BCD91CANXX TCGACGTC CTAAGCCT L006	0:51 1:0	A:173355262;C:152464129;G:147489024;T:184739885;N:45449	51	0	173355262	152464129	147489024	184739885	45449	ERX6698608	ERS8070397	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.78328	0.15147	0.71289	0.53671	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10238	10238	ERR7131170	ERX6698608	ERS8070397	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F8 Nega	SAMEA10418613	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418613\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F8 Nega\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry /GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 8\|organism part:olfactory bulb\|sample name:E MTAB 11083:F8 Nega\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F8 Nega s	F8 Nega s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry /GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F22-2_210715_D00404_0538_BCD91CANXX_TCGACGTC-CTAAGCCT_L007_R1_001.fastq.gz	fastq	661103769.0	12962819.0	E MTAB 11083:2874F22 2 210715 D00404 0538 BCD91CANXX TCGACGTC CTAAGCCT L007	0:51 1:0	A:174223249;C:153223284;G:148276805;T:185335092;N:45339	51	0	174223249	153223284	148276805	185335092	45339	ERX6698608	ERS8070397	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.78539	0.15054	0.70897	0.5322	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10239	10239	ERR7131167	ERX6698607	ERS8070396	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F8 mCherry GFP	SAMEA10418612	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418612\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F8 mCherry GFP\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP+\|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 8\|organism part:olfactory bulb\|sample name:E MTAB 11083:F8 mCherry GFP\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F8 mCherry GFP s	F8 mCherry GFP s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP+	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F24-1_210715_D00404_0538_BCD91CANXX_TCGACGTC-TCTCTCCG_L006_R1_001.fastq.gz	fastq	693183636.0	13591836.0	E MTAB 11083:2874F24 1 210715 D00404 0538 BCD91CANXX TCGACGTC TCTCTCCG L006	0:51 1:0	A:183977687;C:159275153;G:153149826;T:196732022;N:48948	51	0	183977687	159275153	153149826	196732022	48948	ERX6698607	ERS8070396	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.68942	0.15593	0.75828	0.51858	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10240	10240	ERR7131168	ERX6698607	ERS8070396	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F8 mCherry GFP	SAMEA10418612	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418612\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F8 mCherry GFP\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP+\|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 8\|organism part:olfactory bulb\|sample name:E MTAB 11083:F8 mCherry GFP\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F8 mCherry GFP s	F8 mCherry GFP s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP+	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F24-2_210715_D00404_0538_BCD91CANXX_TCGACGTC-TCTCTCCG_L007_R1_001.fastq.gz	fastq	696648678.0	13659778.0	E MTAB 11083:2874F24 2 210715 D00404 0538 BCD91CANXX TCGACGTC TCTCTCCG L007	0:51 1:0	A:184971832;C:160126524;G:154012023;T:197490098;N:48201	51	0	184971832	160126524	154012023	197490098	48201	ERX6698607	ERS8070396	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.6906	0.15634	0.75909	0.51346	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10241	10241	ERR7131165	ERX6698606	ERS8070395	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F8 mCherry	SAMEA10418611	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418611\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F8 mCherry\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 8\|organism part:olfactory bulb\|sample name:E MTAB 11083:F8 mCherry\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F8 mCherry s	F8 mCherry s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F23-1_210715_D00404_0538_BCD91CANXX_TCGACGTC-CGTCTAAT_L006_R1_001.fastq.gz	fastq	667760646.0	13093346.0	E MTAB 11083:2874F23 1 210715 D00404 0538 BCD91CANXX TCGACGTC CGTCTAAT L006	0:51 1:0	A:179948739;C:150541918;G:145038845;T:192184092;N:47052	51	0	179948739	150541918	145038845	192184092	47052	ERX6698606	ERS8070395	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.71661	0.19774	0.74576	0.52117	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10242	10242	ERR7131166	ERX6698606	ERS8070395	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F8 mCherry	SAMEA10418611	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418611\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F8 mCherry\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 8\|organism part:olfactory bulb\|sample name:E MTAB 11083:F8 mCherry\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F8 mCherry s	F8 mCherry s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F23-2_210715_D00404_0538_BCD91CANXX_TCGACGTC-CGTCTAAT_L007_R1_001.fastq.gz	fastq	670970484.0	13156284.0	E MTAB 11083:2874F23 2 210715 D00404 0538 BCD91CANXX TCGACGTC CGTCTAAT L007	0:51 1:0	A:180906557;C:151329492;G:145816347;T:192872804;N:45284	51	0	180906557	151329492	145816347	192872804	45284	ERX6698606	ERS8070395	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.71682	0.19902	0.74517	0.52618	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10243	10243	ERR7131163	ERX6698605	ERS8070394	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F7 Nega	SAMEA10418610	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418610\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F7 Nega\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry /GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 7\|organism part:olfactory bulb\|sample name:E MTAB 11083:F7 Nega\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F7 Nega s	F7 Nega s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry /GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F19-1_210715_D00404_0538_BCD91CANXX_TCGACGTC-GTAAGGAG_L006_R1_001.fastq.gz	fastq	652205238.0	12788338.0	E MTAB 11083:2874F19 1 210715 D00404 0538 BCD91CANXX TCGACGTC GTAAGGAG L006	0:51 1:0	A:173730405;C:149044598;G:145436777;T:183946928;N:46530	51	0	173730405	149044598	145436777	183946928	46530	ERX6698605	ERS8070394	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.80595	0.17309	0.71003	0.53696	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10244	10244	ERR7131164	ERX6698605	ERS8070394	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F7 Nega	SAMEA10418610	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418610\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F7 Nega\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry /GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 7\|organism part:olfactory bulb\|sample name:E MTAB 11083:F7 Nega\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F7 Nega s	F7 Nega s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry /GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F19-2_210715_D00404_0538_BCD91CANXX_TCGACGTC-GTAAGGAG_L007_R1_001.fastq.gz	fastq	655593423.0	12854773.0	E MTAB 11083:2874F19 2 210715 D00404 0538 BCD91CANXX TCGACGTC GTAAGGAG L007	0:51 1:0	A:174715119;C:149844974;G:146250446;T:184737535;N:45349	51	0	174715119	149844974	146250446	184737535	45349	ERX6698605	ERS8070394	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.80585	0.17497	0.71078	0.53767	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10245	10245	ERR7131161	ERX6698604	ERS8070393	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F7 mCherry GFP	SAMEA10418609	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418609\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F7 mCherry GFP\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP+\|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 7\|organism part:olfactory bulb\|sample name:E MTAB 11083:F7 mCherry GFP\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F7 mCherry GFP s	F7 mCherry GFP s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP+	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F21-1_210715_D00404_0538_BCD91CANXX_TCGACGTC-AAGGAGTA_L006_R1_001.fastq.gz	fastq	661067151.0	12962101.0	E MTAB 11083:2874F21 1 210715 D00404 0538 BCD91CANXX TCGACGTC AAGGAGTA L006	0:51 1:0	A:168281419;C:157701209;G:153487197;T:181550252;N:47074	51	0	168281419	157701209	153487197	181550252	47074	ERX6698604	ERS8070393	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.39074	0.11592	0.82615	0.5252	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10246	10246	ERR7131162	ERX6698604	ERS8070393	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F7 mCherry GFP	SAMEA10418609	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418609\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F7 mCherry GFP\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP+\|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 7\|organism part:olfactory bulb\|sample name:E MTAB 11083:F7 mCherry GFP\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F7 mCherry GFP s	F7 mCherry GFP s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP+	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F21-2_210715_D00404_0538_BCD91CANXX_TCGACGTC-AAGGAGTA_L007_R1_001.fastq.gz	fastq	665709018.0	13053118.0	E MTAB 11083:2874F21 2 210715 D00404 0538 BCD91CANXX TCGACGTC AAGGAGTA L007	0:51 1:0	A:169539998;C:158884603;G:154624803;T:182614264;N:45350	51	0	169539998	158884603	154624803	182614264	45350	ERX6698604	ERS8070393	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.38966	0.1152	0.8258	0.53305	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10247	10247	ERR7131159	ERX6698603	ERS8070392	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F7 mCherry	SAMEA10418608	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418608\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F7 mCherry\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 7\|organism part:olfactory bulb\|sample name:E MTAB 11083:F7 mCherry\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F7 mCherry s	F7 mCherry s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F20-1_210715_D00404_0538_BCD91CANXX_TCGACGTC-ACTGCATA_L006_R1_001.fastq.gz	fastq	657813402.0	12898302.0	E MTAB 11083:2874F20 1 210715 D00404 0538 BCD91CANXX TCGACGTC ACTGCATA L006	0:51 1:0	A:175873489;C:149476129;G:143987770;T:188429588;N:46426	51	0	175873489	149476129	143987770	188429588	46426	ERX6698603	ERS8070392	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.70507	0.2048	0.75923	0.52828	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10248	10248	ERR7131160	ERX6698603	ERS8070392	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F7 mCherry	SAMEA10418608	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418608\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F7 mCherry\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 7\|organism part:olfactory bulb\|sample name:E MTAB 11083:F7 mCherry\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F7 mCherry s	F7 mCherry s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F20-2_210715_D00404_0538_BCD91CANXX_TCGACGTC-ACTGCATA_L007_R1_001.fastq.gz	fastq	660303426.0	12947126.0	E MTAB 11083:2874F20 2 210715 D00404 0538 BCD91CANXX TCGACGTC ACTGCATA L007	0:51 1:0	A:176607119;C:150065781;G:144613110;T:188972809;N:44607	51	0	176607119	150065781	144613110	188972809	44607	ERX6698603	ERS8070392	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.70705	0.20314	0.75852	0.52949	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10249	10249	ERR7131157	ERX6698602	ERS8070391	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F6 Nega	SAMEA10418607	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418607\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F6 Nega\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry /GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 6\|organism part:olfactory bulb\|sample name:E MTAB 11083:F6 Nega\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F6 Nega s	F6 Nega s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry /GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F16-1_210715_D00404_0538_BCD91CANXX_TGCAGCTA-TCTCTCCG_L006_R1_001.fastq.gz	fastq	669627450.0	13129950.0	E MTAB 11083:2874F16 1 210715 D00404 0538 BCD91CANXX TGCAGCTA TCTCTCCG L006	0:51 1:0	A:177483937;C:154097051;G:148063012;T:189935690;N:47760	51	0	177483937	154097051	148063012	189935690	47760	ERX6698602	ERS8070391	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.77183	0.16001	0.71467	0.53352	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10250	10250	ERR7131158	ERX6698602	ERS8070391	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F6 Nega	SAMEA10418607	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418607\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F6 Nega\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry /GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 6\|organism part:olfactory bulb\|sample name:E MTAB 11083:F6 Nega\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F6 Nega s	F6 Nega s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry /GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F16-2_210715_D00404_0538_BCD91CANXX_TGCAGCTA-TCTCTCCG_L007_R1_001.fastq.gz	fastq	671615073.0	13168923.0	E MTAB 11083:2874F16 2 210715 D00404 0538 BCD91CANXX TGCAGCTA TCTCTCCG L007	0:51 1:0	A:178109157;C:154619024;G:148595207;T:190246469;N:45216	51	0	178109157	154619024	148595207	190246469	45216	ERX6698602	ERS8070391	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.77284	0.15963	0.71569	0.53038	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10251	10251	ERR7131155	ERX6698601	ERS8070390	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F6 mCherry GFP	SAMEA10418606	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418606\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F6 mCherry GFP\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP+\|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 6\|organism part:olfactory bulb\|sample name:E MTAB 11083:F6 mCherry GFP\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F6 mCherry GFP s	F6 mCherry GFP s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP+	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F18-1_210715_D00404_0538_BCD91CANXX_TCGACGTC-TATCCTCT_L006_R1_001.fastq.gz	fastq	667663542.0	13091442.0	E MTAB 11083:2874F18 1 210715 D00404 0538 BCD91CANXX TCGACGTC TATCCTCT L006	0:51 1:0	A:177646483;C:152747528;G:146388226;T:190833951;N:47354	51	0	177646483	152747528	146388226	190833951	47354	ERX6698601	ERS8070390	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.67964	0.18123	0.77193	0.53313	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10252	10252	ERR7131156	ERX6698601	ERS8070390	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F6 mCherry GFP	SAMEA10418606	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418606\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F6 mCherry GFP\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP+\|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 6\|organism part:olfactory bulb\|sample name:E MTAB 11083:F6 mCherry GFP\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F6 mCherry GFP s	F6 mCherry GFP s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP+	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F18-2_210715_D00404_0538_BCD91CANXX_TCGACGTC-TATCCTCT_L007_R1_001.fastq.gz	fastq	670170141.0	13140591.0	E MTAB 11083:2874F18 2 210715 D00404 0538 BCD91CANXX TCGACGTC TATCCTCT L007	0:51 1:0	A:178425395;C:153363855;G:147033779;T:191300976;N:46136	51	0	178425395	153363855	147033779	191300976	46136	ERX6698601	ERS8070390	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.67922	0.18101	0.77141	0.53601	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10253	10253	ERR7131153	ERX6698600	ERS8070389	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F6 mCherry	SAMEA10418605	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418605\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F6 mCherry\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 6\|organism part:olfactory bulb\|sample name:E MTAB 11083:F6 mCherry\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F6 mCherry s	F6 mCherry s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F17-1_210715_D00404_0538_BCD91CANXX_TCGACGTC-CTCTCTAT_L006_R1_001.fastq.gz	fastq	677617008.0	13286608.0	E MTAB 11083:2874F17 1 210715 D00404 0538 BCD91CANXX TCGACGTC CTCTCTAT L006	0:51 1:0	A:181785899;C:152797687;G:147070676;T:195914808;N:47938	51	0	181785899	152797687	147070676	195914808	47938	ERX6698600	ERS8070389	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.68298	0.1953	0.76292	0.5395	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10254	10254	ERR7131154	ERX6698600	ERS8070389	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F6 mCherry	SAMEA10418605	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418605\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F6 mCherry\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 6\|organism part:olfactory bulb\|sample name:E MTAB 11083:F6 mCherry\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F6 mCherry s	F6 mCherry s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F17-2_210715_D00404_0538_BCD91CANXX_TCGACGTC-CTCTCTAT_L007_R1_001.fastq.gz	fastq	679922973.0	13331823.0	E MTAB 11083:2874F17 2 210715 D00404 0538 BCD91CANXX TCGACGTC CTCTCTAT L007	0:51 1:0	A:182567819;C:153380607;G:147589890;T:196337722;N:46935	51	0	182567819	153380607	147589890	196337722	46935	ERX6698600	ERS8070389	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.68391	0.19726	0.76299	0.54099	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10255	10255	ERR7131151	ERX6698599	ERS8070388	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F5 Nega	SAMEA10418604	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418604\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F5 Nega\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry /GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 5\|organism part:olfactory bulb\|sample name:E MTAB 11083:F5 Nega\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F5 Nega s	F5 Nega s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry /GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F13-1_210715_D00404_0538_BCD91CANXX_TGCAGCTA-AAGGAGTA_L006_R1_001.fastq.gz	fastq	620316315.0	12163065.0	E MTAB 11083:2874F13 1 210715 D00404 0538 BCD91CANXX TGCAGCTA AAGGAGTA L006	0:51 1:0	A:165967355;C:141072216;G:136931219;T:176301963;N:43562	51	0	165967355	141072216	136931219	176301963	43562	ERX6698599	ERS8070388	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.78924	0.17457	0.71934	0.53563	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10256	10256	ERR7131152	ERX6698599	ERS8070388	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F5 Nega	SAMEA10418604	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418604\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F5 Nega\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry /GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 5\|organism part:olfactory bulb\|sample name:E MTAB 11083:F5 Nega\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F5 Nega s	F5 Nega s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry /GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F13-2_210715_D00404_0538_BCD91CANXX_TGCAGCTA-AAGGAGTA_L007_R1_001.fastq.gz	fastq	623905338.0	12233438.0	E MTAB 11083:2874F13 2 210715 D00404 0538 BCD91CANXX TGCAGCTA AAGGAGTA L007	0:51 1:0	A:166996253;C:141937637;G:137825206;T:177103504;N:42738	51	0	166996253	141937637	137825206	177103504	42738	ERX6698599	ERS8070388	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.78975	0.17387	0.72153	0.54149	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10257	10257	ERR7131149	ERX6698598	ERS8070387	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F5 mCherry GFP	SAMEA10418603	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418603\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F5 mCherry GFP\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP+\|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 5\|organism part:olfactory bulb\|sample name:E MTAB 11083:F5 mCherry GFP\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F5 mCherry GFP s	F5 mCherry GFP s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP+	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F15-1_210715_D00404_0538_BCD91CANXX_TGCAGCTA-CGTCTAAT_L006_R1_001.fastq.gz	fastq	670154841.0	13140291.0	E MTAB 11083:2874F15 1 210715 D00404 0538 BCD91CANXX TGCAGCTA CGTCTAAT L006	0:51 1:0	A:182457480;C:149175456;G:144548173;T:193927470;N:46262	51	0	182457480	149175456	144548173	193927470	46262	ERX6698598	ERS8070387	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.71875	0.18671	0.76047	0.52398	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10258	10258	ERR7131150	ERX6698598	ERS8070387	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F5 mCherry GFP	SAMEA10418603	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418603\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F5 mCherry GFP\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP+\|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 5\|organism part:olfactory bulb\|sample name:E MTAB 11083:F5 mCherry GFP\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F5 mCherry GFP s	F5 mCherry GFP s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP+	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F15-2_210715_D00404_0538_BCD91CANXX_TGCAGCTA-CGTCTAAT_L007_R1_001.fastq.gz	fastq	674202048.0	13219648.0	E MTAB 11083:2874F15 2 210715 D00404 0538 BCD91CANXX TGCAGCTA CGTCTAAT L007	0:51 1:0	A:183639511;C:150168226;G:145502071;T:194847755;N:44485	51	0	183639511	150168226	145502071	194847755	44485	ERX6698598	ERS8070387	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.72111	0.18813	0.76378	0.5258	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10259	10259	ERR7131147	ERX6698597	ERS8070386	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F5 mCherry	SAMEA10418602	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418602\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F5 mCherry\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 5\|organism part:olfactory bulb\|sample name:E MTAB 11083:F5 mCherry\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F5 mCherry s	F5 mCherry s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F14-1_210715_D00404_0538_BCD91CANXX_TGCAGCTA-CTAAGCCT_L006_R1_001.fastq.gz	fastq	615458259.0	12067809.0	E MTAB 11083:2874F14 1 210715 D00404 0538 BCD91CANXX TGCAGCTA CTAAGCCT L006	0:51 1:0	A:165108582;C:139178883;G:134070672;T:177059757;N:40365	51	0	165108582	139178883	134070672	177059757	40365	ERX6698597	ERS8070386	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.69017	0.1977	0.77193	0.53352	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10260	10260	ERR7131148	ERX6698597	ERS8070386	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F5 mCherry	SAMEA10418602	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418602\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F5 mCherry\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 5\|organism part:olfactory bulb\|sample name:E MTAB 11083:F5 mCherry\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F5 mCherry s	F5 mCherry s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F14-2_210715_D00404_0538_BCD91CANXX_TGCAGCTA-CTAAGCCT_L007_R1_001.fastq.gz	fastq	619061613.0	12138463.0	E MTAB 11083:2874F14 2 210715 D00404 0538 BCD91CANXX TGCAGCTA CTAAGCCT L007	0:51 1:0	A:166167516;C:140058774;G:134972850;T:177822733;N:39740	51	0	166167516	140058774	134972850	177822733	39740	ERX6698597	ERS8070386	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.69118	0.20019	0.7707	0.52174	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10261	10261	ERR7131145	ERX6698596	ERS8070385	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F4 Nega	SAMEA10418601	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418601\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F4 Nega\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry /GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 4\|organism part:olfactory bulb\|sample name:E MTAB 11083:F4 Nega\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F4 Nega s	F4 Nega s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry /GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F10-1_210715_D00404_0538_BCD91CANXX_TGCAGCTA-TATCCTCT_L006_R1_001.fastq.gz	fastq	652536687.0	12794837.0	E MTAB 11083:2874F10 1 210715 D00404 0538 BCD91CANXX TGCAGCTA TATCCTCT L006	0:51 1:0	A:178033231;C:144661707;G:139876661;T:189921085;N:44003	51	0	178033231	144661707	139876661	189921085	44003	ERX6698596	ERS8070385	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.76201	0.2508	0.71299	0.53379	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10262	10262	ERR7131146	ERX6698596	ERS8070385	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F4 Nega	SAMEA10418601	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418601\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F4 Nega\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry /GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 4\|organism part:olfactory bulb\|sample name:E MTAB 11083:F4 Nega\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F4 Nega s	F4 Nega s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry /GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F10-2_210715_D00404_0538_BCD91CANXX_TGCAGCTA-TATCCTCT_L007_R1_001.fastq.gz	fastq	655278957.0	12848607.0	E MTAB 11083:2874F10 2 210715 D00404 0538 BCD91CANXX TGCAGCTA TATCCTCT L007	0:51 1:0	A:178938002;C:145332613;G:140527756;T:190437189;N:43397	51	0	178938002	145332613	140527756	190437189	43397	ERX6698596	ERS8070385	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.76188	0.25356	0.71344	0.53081	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10263	10263	ERR7131143	ERX6698595	ERS8070384	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F4 mCherry GFP	SAMEA10418600	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418600\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F4 mCherry GFP\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP+\|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 4\|organism part:olfactory bulb\|sample name:E MTAB 11083:F4 mCherry GFP\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F4 mCherry GFP s	F4 mCherry GFP s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP+	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F12-1_210715_D00404_0538_BCD91CANXX_TGCAGCTA-ACTGCATA_L006_R1_001.fastq.gz	fastq	297921855.0	5841605.0	E MTAB 11083:2874F12 1 210715 D00404 0538 BCD91CANXX TGCAGCTA ACTGCATA L006	0:51 1:0	A:82400724;C:65517496;G:64603058;T:85384480;N:16097	51	0	82400724	65517496	64603058	85384480	16097	ERX6698595	ERS8070384	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.72496	0.20794	0.81223	0.52529	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10264	10264	ERR7131144	ERX6698595	ERS8070384	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F4 mCherry GFP	SAMEA10418600	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418600\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F4 mCherry GFP\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP+\|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 4\|organism part:olfactory bulb\|sample name:E MTAB 11083:F4 mCherry GFP\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F4 mCherry GFP s	F4 mCherry GFP s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP+	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F12-2_210715_D00404_0538_BCD91CANXX_TGCAGCTA-ACTGCATA_L007_R1_001.fastq.gz	fastq	309412971.0	6066921.0	E MTAB 11083:2874F12 2 210715 D00404 0538 BCD91CANXX TGCAGCTA ACTGCATA L007	0:51 1:0	A:85531271;C:68164437;G:67129209;T:88573210;N:14844	51	0	85531271	68164437	67129209	88573210	14844	ERX6698595	ERS8070384	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.7245	0.20724	0.80468	0.52791	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10265	10265	ERR7131141	ERX6698594	ERS8070383	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F4 mCherry	SAMEA10418599	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418599\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F4 mCherry\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 4\|organism part:olfactory bulb\|sample name:E MTAB 11083:F4 mCherry\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F4 mCherry s	F4 mCherry s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F11-1_210715_D00404_0538_BCD91CANXX_TGCAGCTA-GTAAGGAG_L006_R1_001.fastq.gz	fastq	672319791.0	13182741.0	E MTAB 11083:2874F11 1 210715 D00404 0538 BCD91CANXX TGCAGCTA GTAAGGAG L006	0:51 1:0	A:181508034;C:150928549;G:146124085;T:193711358;N:47765	51	0	181508034	150928549	146124085	193711358	47765	ERX6698594	ERS8070383	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.71726	0.19842	0.74986	0.53363	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10266	10266	ERR7131142	ERX6698594	ERS8070383	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F4 mCherry	SAMEA10418599	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418599\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F4 mCherry\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 4\|organism part:olfactory bulb\|sample name:E MTAB 11083:F4 mCherry\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F4 mCherry s	F4 mCherry s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F11-2_210715_D00404_0538_BCD91CANXX_TGCAGCTA-GTAAGGAG_L007_R1_001.fastq.gz	fastq	675486075.0	13244825.0	E MTAB 11083:2874F11 2 210715 D00404 0538 BCD91CANXX TGCAGCTA GTAAGGAG L007	0:51 1:0	A:182462261;C:151688554;G:146902713;T:194385945;N:46602	51	0	182462261	151688554	146902713	194385945	46602	ERX6698594	ERS8070383	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.71745	0.19727	0.74805	0.53092	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10267	10267	ERR7131139	ERX6698593	ERS8070382	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F3 Nega	SAMEA10418598	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418598\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F3 Nega\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry /GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 3\|organism part:olfactory bulb\|sample name:E MTAB 11083:F3 Nega\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F3 Nega s	F3 Nega s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry /GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F7-1_210715_D00404_0538_BCD91CANXX_CGATCAGT-CGTCTAAT_L006_R1_001.fastq.gz	fastq	630093627.0	12354777.0	E MTAB 11083:2874F7 1 210715 D00404 0538 BCD91CANXX CGATCAGT CGTCTAAT L006	0:51 1:0	A:165132739;C:146179836;G:142796880;T:175940613;N:43559	51	0	165132739	146179836	142796880	175940613	43559	ERX6698593	ERS8070382	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.81672	0.15219	0.71277	0.52461	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10268	10268	ERR7131140	ERX6698593	ERS8070382	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F3 Nega	SAMEA10418598	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418598\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F3 Nega\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry /GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 3\|organism part:olfactory bulb\|sample name:E MTAB 11083:F3 Nega\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F3 Nega s	F3 Nega s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry /GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F7-2_210715_D00404_0538_BCD91CANXX_CGATCAGT-CGTCTAAT_L007_R1_001.fastq.gz	fastq	632305242.0	12398142.0	E MTAB 11083:2874F7 2 210715 D00404 0538 BCD91CANXX CGATCAGT CGTCTAAT L007	0:51 1:0	A:165832174;C:146751895;G:143384539;T:176293313;N:43321	51	0	165832174	146751895	143384539	176293313	43321	ERX6698593	ERS8070382	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.81791	0.15444	0.7151	0.52585	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10269	10269	ERR7131137	ERX6698592	ERS8070381	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F3 mCherry GFP	SAMEA10418597	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418597\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F3 mCherry GFP\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP+\|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 3\|organism part:olfactory bulb\|sample name:E MTAB 11083:F3 mCherry GFP\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F3 mCherry GFP s	F3 mCherry GFP s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP+	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F9-1_210715_D00404_0538_BCD91CANXX_TGCAGCTA-CTCTCTAT_L006_R1_001.fastq.gz	fastq	660379620.0	12948620.0	E MTAB 11083:2874F9 1 210715 D00404 0538 BCD91CANXX TGCAGCTA CTCTCTAT L006	0:51 1:0	A:178482695;C:147417787;G:143797476;T:190635173;N:46489	51	0	178482695	147417787	143797476	190635173	46489	ERX6698592	ERS8070381	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.65635	0.17778	0.76899	0.52957	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10270	10270	ERR7131138	ERX6698592	ERS8070381	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F3 mCherry GFP	SAMEA10418597	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418597\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F3 mCherry GFP\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP+\|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 3\|organism part:olfactory bulb\|sample name:E MTAB 11083:F3 mCherry GFP\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F3 mCherry GFP s	F3 mCherry GFP s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP+	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F9-2_210715_D00404_0538_BCD91CANXX_TGCAGCTA-CTCTCTAT_L007_R1_001.fastq.gz	fastq	662411307.0	12988457.0	E MTAB 11083:2874F9 2 210715 D00404 0538 BCD91CANXX TGCAGCTA CTCTCTAT L007	0:51 1:0	A:179158323;C:147942300;G:144319925;T:190945370;N:45389	51	0	179158323	147942300	144319925	190945370	45389	ERX6698592	ERS8070381	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.65813	0.17896	0.77076	0.52835	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10271	10271	ERR7131135	ERX6698591	ERS8070380	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F3 mCherry	SAMEA10418596	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418596\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F3 mCherry\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 3\|organism part:olfactory bulb\|sample name:E MTAB 11083:F3 mCherry\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F3 mCherry s	F3 mCherry s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F8-1_210715_D00404_0538_BCD91CANXX_CGATCAGT-TCTCTCCG_L006_R1_001.fastq.gz	fastq	698608353.0	13698203.0	E MTAB 11083:2874F8 1 210715 D00404 0538 BCD91CANXX CGATCAGT TCTCTCCG L006	0:51 1:0	A:188718612;C:156814081;G:151125083;T:201901570;N:49007	51	0	188718612	156814081	151125083	201901570	49007	ERX6698591	ERS8070380	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.70185	0.21547	0.75588	0.53853	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10272	10272	ERR7131136	ERX6698591	ERS8070380	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F3 mCherry	SAMEA10418596	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418596\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F3 mCherry\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 3\|organism part:olfactory bulb\|sample name:E MTAB 11083:F3 mCherry\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F3 mCherry s	F3 mCherry s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F8-2_210715_D00404_0538_BCD91CANXX_CGATCAGT-TCTCTCCG_L007_R1_001.fastq.gz	fastq	699869175.0	13722925.0	E MTAB 11083:2874F8 2 210715 D00404 0538 BCD91CANXX CGATCAGT TCTCTCCG L007	0:51 1:0	A:189192315;C:157176897;G:151498983;T:201952867;N:48113	51	0	189192315	157176897	151498983	201952867	48113	ERX6698591	ERS8070380	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.70221	0.21684	0.75621	0.53787	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10273	10273	ERR7131133	ERX6698590	ERS8070379	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F2 Nega	SAMEA10418595	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418595\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F2 Nega\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry /GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 2\|organism part:olfactory bulb\|sample name:E MTAB 11083:F2 Nega\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F2 Nega s	F2 Nega s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry /GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F4-1_210715_D00404_0538_BCD91CANXX_CGATCAGT-ACTGCATA_L006_R1_001.fastq.gz	fastq	573812985.0	11251235.0	E MTAB 11083:2874F4 1 210715 D00404 0538 BCD91CANXX CGATCAGT ACTGCATA L006	0:51 1:0	A:150716404;C:132203167;G:129732968;T:161120057;N:40389	51	0	150716404	132203167	129732968	161120057	40389	ERX6698590	ERS8070379	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.81899	0.17302	0.72281	0.54315	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10274	10274	ERR7131134	ERX6698590	ERS8070379	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F2 Nega	SAMEA10418595	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418595\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F2 Nega\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry /GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 2\|organism part:olfactory bulb\|sample name:E MTAB 11083:F2 Nega\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F2 Nega s	F2 Nega s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry /GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F4-2_210715_D00404_0538_BCD91CANXX_CGATCAGT-ACTGCATA_L007_R1_001.fastq.gz	fastq	576184587.0	11297737.0	E MTAB 11083:2874F4 2 210715 D00404 0538 BCD91CANXX CGATCAGT ACTGCATA L007	0:51 1:0	A:151387408;C:132788210;G:130392043;T:161577529;N:39397	51	0	151387408	132788210	130392043	161577529	39397	ERX6698590	ERS8070379	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.81999	0.17082	0.72196	0.54505	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10275	10275	ERR7131131	ERX6698589	ERS8070378	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F2 mCherry GFP	SAMEA10418594	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418594\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F2 mCherry GFP\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP+\|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 2\|organism part:olfactory bulb\|sample name:E MTAB 11083:F2 mCherry GFP\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F2 mCherry GFP s	F2 mCherry GFP s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP+	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F6-1_210715_D00404_0538_BCD91CANXX_CGATCAGT-CTAAGCCT_L006_R1_001.fastq.gz	fastq	654811032.0	12839432.0	E MTAB 11083:2874F6 1 210715 D00404 0538 BCD91CANXX CGATCAGT CTAAGCCT L006	0:51 1:0	A:177403486;C:146202733;G:142207545;T:188951373;N:45895	51	0	177403486	146202733	142207545	188951373	45895	ERX6698589	ERS8070378	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.67854	0.21407	0.76104	0.52713	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10276	10276	ERR7131132	ERX6698589	ERS8070378	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F2 mCherry GFP	SAMEA10418594	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418594\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F2 mCherry GFP\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP+\|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 2\|organism part:olfactory bulb\|sample name:E MTAB 11083:F2 mCherry GFP\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F2 mCherry GFP s	F2 mCherry GFP s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP+	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F6-2_210715_D00404_0538_BCD91CANXX_CGATCAGT-CTAAGCCT_L007_R1_001.fastq.gz	fastq	656911926.0	12880626.0	E MTAB 11083:2874F6 2 210715 D00404 0538 BCD91CANXX CGATCAGT CTAAGCCT L007	0:51 1:0	A:178119212;C:146730132;G:142725348;T:189293212;N:44022	51	0	178119212	146730132	142725348	189293212	44022	ERX6698589	ERS8070378	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.68162	0.21431	0.761	0.5071	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10277	10277	ERR7131129	ERX6698588	ERS8070377	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F2 mCherry	SAMEA10418593	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418593\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F2 mCherry\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 2\|organism part:olfactory bulb\|sample name:E MTAB 11083:F2 mCherry\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F2 mCherry s	F2 mCherry s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F5-1_210715_D00404_0538_BCD91CANXX_CGATCAGT-AAGGAGTA_L006_R1_001.fastq.gz	fastq	607851558.0	11918658.0	E MTAB 11083:2874F5 1 210715 D00404 0538 BCD91CANXX CGATCAGT AAGGAGTA L006	0:51 1:0	A:164814138;C:136071648;G:132945950;T:173976881;N:42941	51	0	164814138	136071648	132945950	173976881	42941	ERX6698588	ERS8070377	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.78967	0.18905	0.73241	0.52347	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10278	10278	ERR7131130	ERX6698588	ERS8070377	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F2 mCherry	SAMEA10418593	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418593\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F2 mCherry\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 2\|organism part:olfactory bulb\|sample name:E MTAB 11083:F2 mCherry\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F2 mCherry s	F2 mCherry s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F5-2_210715_D00404_0538_BCD91CANXX_CGATCAGT-AAGGAGTA_L007_R1_001.fastq.gz	fastq	610931805.0	11979055.0	E MTAB 11083:2874F5 2 210715 D00404 0538 BCD91CANXX CGATCAGT AAGGAGTA L007	0:51 1:0	A:165714775;C:136822925;G:133684294;T:174667814;N:41997	51	0	165714775	136822925	133684294	174667814	41997	ERX6698588	ERS8070377	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.78869	0.18885	0.73156	0.51691	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10279	10279	ERR7131127	ERX6698587	ERS8070376	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F1 Nega	SAMEA10418592	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418592\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F1 Nega\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry /GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 1\|organism part:olfactory bulb\|sample name:E MTAB 11083:F1 Nega\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F1 Nega s	F1 Nega s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry /GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F1-1_210715_D00404_0538_BCD91CANXX_CGATCAGT-CTCTCTAT_L006_R1_001.fastq.gz	fastq	619561872.0	12148272.0	E MTAB 11083:2874F1 1 210715 D00404 0538 BCD91CANXX CGATCAGT CTCTCTAT L006	0:51 1:0	A:164385545;C:141746313;G:138163219;T:175223323;N:43472	51	0	164385545	141746313	138163219	175223323	43472	ERX6698587	ERS8070376	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.80258	0.17703	0.72614	0.53483	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10280	10280	ERR7131128	ERX6698587	ERS8070376	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F1 Nega	SAMEA10418592	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418592\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F1 Nega\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry /GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 1\|organism part:olfactory bulb\|sample name:E MTAB 11083:F1 Nega\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F1 Nega s	F1 Nega s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry /GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F1-2_210715_D00404_0538_BCD91CANXX_CGATCAGT-CTCTCTAT_L007_R1_001.fastq.gz	fastq	621481971.0	12185921.0	E MTAB 11083:2874F1 2 210715 D00404 0538 BCD91CANXX CGATCAGT CTCTCTAT L007	0:51 1:0	A:165030774;C:142231469;G:138651078;T:175527080;N:41570	51	0	165030774	142231469	138651078	175527080	41570	ERX6698587	ERS8070376	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.80248	0.17699	0.726	0.53711	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10281	10281	ERR7131125	ERX6698586	ERS8070375	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F1 mCherry GFP	SAMEA10418591	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418591\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F1 mCherry GFP\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP+\|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 1\|organism part:olfactory bulb\|sample name:E MTAB 11083:F1 mCherry GFP\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F1 mCherry GFP s	F1 mCherry GFP s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP+	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F3-1_210715_D00404_0538_BCD91CANXX_CGATCAGT-GTAAGGAG_L006_R1_001.fastq.gz	fastq	651189369.0	12768419.0	E MTAB 11083:2874F3 1 210715 D00404 0538 BCD91CANXX CGATCAGT GTAAGGAG L006	0:51 1:0	A:176398415;C:145659111;G:142137610;T:186948280;N:45953	51	0	176398415	145659111	142137610	186948280	45953	ERX6698586	ERS8070375	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.69561	0.18489	0.75345	0.52316	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10282	10282	ERR7131126	ERX6698586	ERS8070375	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F1 mCherry GFP	SAMEA10418591	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418591\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F1 mCherry GFP\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP+\|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 1\|organism part:olfactory bulb\|sample name:E MTAB 11083:F1 mCherry GFP\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F1 mCherry GFP s	F1 mCherry GFP s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP+	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F3-2_210715_D00404_0538_BCD91CANXX_CGATCAGT-GTAAGGAG_L007_R1_001.fastq.gz	fastq	653398944.0	12811744.0	E MTAB 11083:2874F3 2 210715 D00404 0538 BCD91CANXX CGATCAGT GTAAGGAG L007	0:51 1:0	A:177139734;C:146171766;G:142707146;T:187335475;N:44823	51	0	177139734	146171766	142707146	187335475	44823	ERX6698586	ERS8070375	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.69496	0.18414	0.75375	0.52317	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10283	10283	ERR7131123	ERX6698585	ERS8070374	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F1 mCherry	SAMEA10418590	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418590\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F1 mCherry\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 1\|organism part:olfactory bulb\|sample name:E MTAB 11083:F1 mCherry\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F1 mCherry s	F1 mCherry s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F2-1_210715_D00404_0538_BCD91CANXX_CGATCAGT-TATCCTCT_L006_R1_001.fastq.gz	fastq	613574319.0	12030869.0	E MTAB 11083:2874F2 1 210715 D00404 0538 BCD91CANXX CGATCAGT TATCCTCT L006	0:51 1:0	A:164891629;C:138401759;G:135818073;T:174419828;N:43030	51	0	164891629	138401759	135818073	174419828	43030	ERX6698585	ERS8070374	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.79499	0.21674	0.73359	0.52207	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10284	10284	ERR7131124	ERX6698585	ERS8070374	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07		Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F1 mCherry	SAMEA10418590	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418590\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F1 mCherry\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 1\|organism part:olfactory bulb\|sample name:E MTAB 11083:F1 mCherry\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK									Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F1 mCherry s	F1 mCherry s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F2-2_210715_D00404_0538_BCD91CANXX_CGATCAGT-TATCCTCT_L007_R1_001.fastq.gz	fastq	615666798.0	12071898.0	E MTAB 11083:2874F2 2 210715 D00404 0538 BCD91CANXX CGATCAGT TATCCTCT L007	0:51 1:0	A:165536502;C:138952758;G:136375193;T:174760659;N:41686	51	0	165536502	138952758	136375193	174760659	41686	ERX6698585	ERS8070374	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.7941	0.21645	0.73494	0.50761	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
24927	24927	SRR25557778	SRX21286665	SRS18536778	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant XI	GSM7688794		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688794	GSM7688794: Morphant XI; Danio rerio; RNA Seq	GSM7688794 r1	GSM7688794	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Morphant-XI_S7_L001_R1_001.fastq.gz	fastq	420092501.0	5668059.0	GSM7688794 r1	0:74.12	A:113006440;C:96725832;G:99320773;T:110915967;N:123489	74		113006440	96725832	99320773	110915967	123489	SRX21286665	SRS18536778	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94757	0.06229	0.72364	0.46676	74	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24928	24928	SRR25557779	SRX21286665	SRS18536778	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant XI	GSM7688794		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688794	GSM7688794: Morphant XI; Danio rerio; RNA Seq	GSM7688794 r1	GSM7688794	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Morphant-XI_S7_L002_R1_001.fastq.gz	fastq	421869780.0	5690053.0	GSM7688794 r2	0:74.14	A:113530489;C:97144227;G:99697959;T:111388539;N:108566	74		113530489	97144227	99697959	111388539	108566	SRX21286665	SRS18536778	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94921	0.06226	0.72462	0.4738	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24929	24929	SRR25557780	SRX21286665	SRS18536778	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant XI	GSM7688794		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688794	GSM7688794: Morphant XI; Danio rerio; RNA Seq	GSM7688794 r1	GSM7688794	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Morphant-XI_S7_L003_R1_001.fastq.gz	fastq	425064659.0	5734041.0	GSM7688794 r3	0:74.13	A:114342253;C:97873100;G:100532599;T:112196433;N:120274	74		114342253	97873100	100532599	112196433	120274	SRX21286665	SRS18536778	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94886	0.06112	0.72425	0.47055	74	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24930	24930	SRR25557781	SRX21286665	SRS18536778	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant XI	GSM7688794		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688794	GSM7688794: Morphant XI; Danio rerio; RNA Seq	GSM7688794 r1	GSM7688794	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Morphant-XI_S7_L004_R1_001.fastq.gz	fastq	416990548.0	5624902.0	GSM7688794 r4	0:74.13	A:112153356;C:96009158;G:98613145;T:110097476;N:117413	74		112153356	96009158	98613145	110097476	117413	SRX21286665	SRS18536778	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94869	0.06229	0.72506	0.47222	74	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24931	24931	SRR25557782	SRX21286664	SRS18536777	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant X	GSM7688793		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688793	GSM7688793: Morphant X; Danio rerio; RNA Seq	GSM7688793 r1	GSM7688793	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Morphant-X_S6_L001_R1_001.fastq.gz	fastq	434485284.0	5881416.0	GSM7688793 r1	0:73.87	A:116640351;C:100176557;G:102659919;T:114799536;N:208921	73		116640351	100176557	102659919	114799536	208921	SRX21286664	SRS18536777	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94533	0.07176	0.72464	0.47632	74	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24932	24932	SRR25557783	SRX21286664	SRS18536777	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant X	GSM7688793		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688793	GSM7688793: Morphant X; Danio rerio; RNA Seq	GSM7688793 r1	GSM7688793	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Morphant-X_S6_L002_R1_001.fastq.gz	fastq	435203869.0	5886556.0	GSM7688793 r2	0:73.93	A:116869356;C:100363580;G:102830644;T:114973504;N:166785	73		116869356	100363580	102830644	114973504	166785	SRX21286664	SRS18536777	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94542	0.07203	0.72421	0.47733	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24933	24933	SRR25557784	SRX21286664	SRS18536777	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant X	GSM7688793		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688793	GSM7688793: Morphant X; Danio rerio; RNA Seq	GSM7688793 r1	GSM7688793	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Morphant-X_S6_L003_R1_001.fastq.gz	fastq	439897269.0	5951878.0	GSM7688793 r3	0:73.91	A:118101648;C:101426657;G:103990006;T:116184480;N:194478	73		118101648	101426657	103990006	116184480	194478	SRX21286664	SRS18536777	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94486	0.07224	0.72448	0.47915	74	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24934	24934	SRR25557785	SRX21286664	SRS18536777	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant X	GSM7688793		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688793	GSM7688793: Morphant X; Danio rerio; RNA Seq	GSM7688793 r1	GSM7688793	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Morphant-X_S6_L004_R1_001.fastq.gz	fastq	431385256.0	5836029.0	GSM7688793 r4	0:73.92	A:115804970;C:99459059;G:101962932;T:113975935;N:182360	73		115804970	99459059	101962932	113975935	182360	SRX21286664	SRS18536777	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94432	0.07229	0.7261	0.47463	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24935	24935	SRR25557786	SRX21286663	SRS18536776	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant IX	GSM7688792		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688792	GSM7688792: Morphant IX; Danio rerio; RNA Seq	GSM7688792 r1	GSM7688792	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Morphant-IX_S16_L001_R1_001.fastq.gz	fastq	513309395.0	6929648.0	GSM7688792 r1	0:74.07	A:137428462;C:118688804;G:122019962;T:134991729;N:180438	74		137428462	118688804	122019962	134991729	180438	SRX21286663	SRS18536776	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94188	0.07029	0.73772	0.47692	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24936	24936	SRR25557787	SRX21286663	SRS18536776	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant IX	GSM7688792		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688792	GSM7688792: Morphant IX; Danio rerio; RNA Seq	GSM7688792 r1	GSM7688792	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Morphant-IX_S16_L002_R1_001.fastq.gz	fastq	517356735.0	6982196.0	GSM7688792 r2	0:74.10	A:138524037;C:119650852;G:122965491;T:136056171;N:160184	74		138524037	119650852	122965491	136056171	160184	SRX21286663	SRS18536776	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94281	0.06967	0.73963	0.48142	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24937	24937	SRR25557788	SRX21286663	SRS18536776	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant IX	GSM7688792		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688792	GSM7688792: Morphant IX; Danio rerio; RNA Seq	GSM7688792 r1	GSM7688792	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Morphant-IX_S16_L003_R1_001.fastq.gz	fastq	519422328.0	7010631.0	GSM7688792 r3	0:74.09	A:139040684;C:120128748;G:123529198;T:136551898;N:171800	74		139040684	120128748	123529198	136551898	171800	SRX21286663	SRS18536776	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94297	0.06942	0.73726	0.47499	74	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24938	24938	SRR25557789	SRX21286663	SRS18536776	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant IX	GSM7688792		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688792	GSM7688792: Morphant IX; Danio rerio; RNA Seq	GSM7688792 r1	GSM7688792	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Morphant-IX_S16_L004_R1_001.fastq.gz	fastq	511640294.0	6905748.0	GSM7688792 r4	0:74.09	A:136914638;C:118302866;G:121704665;T:134543505;N:174620	74		136914638	118302866	121704665	134543505	174620	SRX21286663	SRS18536776	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94176	0.07029	0.73868	0.47987	74	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24939	24939	SRR25557790	SRX21286662	SRS18536775	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant VIII	GSM7688791		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688791	GSM7688791: Morphant VIII; Danio rerio; RNA Seq	GSM7688791 r1	GSM7688791	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Morphant-VIII_S14_L001_R1_001.fastq.gz	fastq	429446821.0	5803178.0	GSM7688791 r1	0:74.00	A:114793535;C:99506379;G:102226914;T:112748761;N:171232	74		114793535	99506379	102226914	112748761	171232	SRX21286662	SRS18536775	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94175	0.06669	0.73673	0.48179	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24940	24940	SRR25557791	SRX21286662	SRS18536775	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant VIII	GSM7688791		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688791	GSM7688791: Morphant VIII; Danio rerio; RNA Seq	GSM7688791 r1	GSM7688791	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Morphant-VIII_S14_L002_R1_001.fastq.gz	fastq	434629893.0	5870828.0	GSM7688791 r2	0:74.03	A:116216940;C:100703527;G:103463365;T:114092681;N:153380	74		116216940	100703527	103463365	114092681	153380	SRX21286662	SRS18536775	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94143	0.0676	0.73791	0.48091	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24941	24941	SRR25557792	SRX21286662	SRS18536775	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant VIII	GSM7688791		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688791	GSM7688791: Morphant VIII; Danio rerio; RNA Seq	GSM7688791 r1	GSM7688791	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Morphant-VIII_S14_L003_R1_001.fastq.gz	fastq	435879881.0	5888685.0	GSM7688791 r3	0:74.02	A:116548094;C:100971153;G:103794902;T:114400770;N:164962	74		116548094	100971153	103794902	114400770	164962	SRX21286662	SRS18536775	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94195	0.06686	0.73785	0.48044	73	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24942	24942	SRR25557793	SRX21286662	SRS18536775	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant VIII	GSM7688791		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688791	GSM7688791: Morphant VIII; Danio rerio; RNA Seq	GSM7688791 r1	GSM7688791	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Morphant-VIII_S14_L004_R1_001.fastq.gz	fastq	429478475.0	5801978.0	GSM7688791 r4	0:74.02	A:114799280;C:99474677;G:102302775;T:112737475;N:164268	74		114799280	99474677	102302775	112737475	164268	SRX21286662	SRS18536775	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94118	0.06706	0.73892	0.47732	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24943	24943	SRR25557794	SRX21286661	SRS18536774	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant VII	GSM7688790		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688790	GSM7688790: Morphant VII; Danio rerio; RNA Seq	GSM7688790 r1	GSM7688790	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Morphant-VII_S15_L001_R1_001.fastq.gz	fastq	459545188.0	6215897.0	GSM7688790 r1	0:73.93	A:121926568;C:107379723;G:110263606;T:119766429;N:208862	73		121926568	107379723	110263606	119766429	208862	SRX21286661	SRS18536774	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94273	0.06072	0.74582	0.47499	73	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24944	24944	SRR25557795	SRX21286661	SRS18536774	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant VII	GSM7688790		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688790	GSM7688790: Morphant VII; Danio rerio; RNA Seq	GSM7688790 r1	GSM7688790	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Morphant-VII_S15_L002_R1_001.fastq.gz	fastq	463143624.0	6261406.0	GSM7688790 r2	0:73.97	A:122917997;C:108229793;G:111099867;T:120713978;N:181989	73		122917997	108229793	111099867	120713978	181989	SRX21286661	SRS18536774	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94387	0.06093	0.74341	0.47351	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24945	24945	SRR25557796	SRX21286661	SRS18536774	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant VII	GSM7688790		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688790	GSM7688790: Morphant VII; Danio rerio; RNA Seq	GSM7688790 r1	GSM7688790	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Morphant-VII_S15_L003_R1_001.fastq.gz	fastq	465959664.0	6300929.0	GSM7688790 r3	0:73.95	A:123689364;C:108847593;G:111847868;T:121377463;N:197376	73		123689364	108847593	111847868	121377463	197376	SRX21286661	SRS18536774	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94322	0.06219	0.74357	0.47977	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24946	24946	SRR25557797	SRX21286661	SRS18536774	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant VII	GSM7688790		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688790	GSM7688790: Morphant VII; Danio rerio; RNA Seq	GSM7688790 r1	GSM7688790	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Morphant-VII_S15_L004_R1_001.fastq.gz	fastq	459075430.0	6207363.0	GSM7688790 r4	0:73.96	A:121797426;C:107221116;G:110209684;T:119657308;N:189896	73		121797426	107221116	110209684	119657308	189896	SRX21286661	SRS18536774	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94313	0.06211	0.74343	0.47801	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24947	24947	SRR25557798	SRX21286660	SRS18536773	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Control XI	GSM7688787		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688787	GSM7688787: Control XI; Danio rerio; RNA Seq	GSM7688787 r1	GSM7688787	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Control-XI_S2_L001_R1_001.fastq.gz	fastq	439719566.0	5947052.0	GSM7688787 r1	0:73.94	A:117482073;C:102083665;G:104685444;T:115272860;N:195524	73		117482073	102083665	104685444	115272860	195524	SRX21286660	SRS18536773	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94829	0.06278	0.72525	0.46494	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24948	24948	SRR25557799	SRX21286660	SRS18536773	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Control XI	GSM7688787		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688787	GSM7688787: Control XI; Danio rerio; RNA Seq	GSM7688787 r1	GSM7688787	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Control-XI_S2_L002_R1_001.fastq.gz	fastq	438533503.0	5927990.0	GSM7688787 r2	0:73.98	A:117199594;C:101810881;G:104402169;T:114946611;N:174248	73		117199594	101810881	104402169	114946611	174248	SRX21286660	SRS18536773	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94887	0.06387	0.72827	0.46616	74	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24949	24949	SRR25557800	SRX21286660	SRS18536773	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Control XI	GSM7688787		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688787	GSM7688787: Control XI; Danio rerio; RNA Seq	GSM7688787 r1	GSM7688787	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Control-XI_S2_L003_R1_001.fastq.gz	fastq	443995554.0	6003540.0	GSM7688787 r3	0:73.96	A:118663936;C:103031716;G:105723574;T:116387834;N:188494	73		118663936	103031716	105723574	116387834	188494	SRX21286660	SRS18536773	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94788	0.06232	0.72693	0.46653	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24950	24950	SRR25557801	SRX21286660	SRS18536773	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Control XI	GSM7688787		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688787	GSM7688787: Control XI; Danio rerio; RNA Seq	GSM7688787 r1	GSM7688787	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Control-XI_S2_L004_R1_001.fastq.gz	fastq	435088869.0	5882642.0	GSM7688787 r4	0:73.96	A:116261447;C:100986653;G:103615584;T:114042354;N:182831	73		116261447	100986653	103615584	114042354	182831	SRX21286660	SRS18536773	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94914	0.06241	0.72829	0.4546	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24951	24951	SRR25557802	SRX21286659	SRS18536772	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Control X	GSM7688785		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688785	GSM7688785: Control X; Danio rerio; RNA Seq	GSM7688785 r1	GSM7688785	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Control-X_S1_L001_R1_001.fastq.gz	fastq	395130702.0	5338263.0	GSM7688785 r1	0:74.02	A:107005793;C:90183031;G:92316770;T:105476481;N:148627	74		107005793	90183031	92316770	105476481	148627	SRX21286659	SRS18536772	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94534	0.07625	0.73888	0.48135	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24952	24952	SRR25557803	SRX21286659	SRS18536772	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Control X	GSM7688785		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688785	GSM7688785: Control X; Danio rerio; RNA Seq	GSM7688785 r1	GSM7688785	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Control-X_S1_L002_R1_001.fastq.gz	fastq	396764458.0	5358448.0	GSM7688785 r2	0:74.04	A:107513717;C:90540282;G:92658504;T:105917444;N:134511	74		107513717	90540282	92658504	105917444	134511	SRX21286659	SRS18536772	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94374	0.07709	0.73878	0.47615	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24953	24953	SRR25557804	SRX21286659	SRS18536772	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Control X	GSM7688785		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688785	GSM7688785: Control X; Danio rerio; RNA Seq	GSM7688785 r1	GSM7688785	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Control-X_S1_L003_R1_001.fastq.gz	fastq	399623551.0	5397520.0	GSM7688785 r3	0:74.04	A:108230540;C:91192011;G:93388052;T:106665106;N:147842	74		108230540	91192011	93388052	106665106	147842	SRX21286659	SRS18536772	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94399	0.07657	0.73797	0.4794	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24954	24954	SRR25557805	SRX21286659	SRS18536772	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Control X	GSM7688785		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688785	GSM7688785: Control X; Danio rerio; RNA Seq	GSM7688785 r1	GSM7688785	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Control-X_S1_L004_R1_001.fastq.gz	fastq	393298978.0	5312101.0	GSM7688785 r4	0:74.04	A:106518845;C:89734564;G:91901232;T:105004490;N:139847	74		106518845	89734564	91901232	105004490	139847	SRX21286659	SRS18536772	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94423	0.07599	0.73884	0.47905	71	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24955	24955	SRR25557806	SRX21286658	SRS18536771	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Control IX	GSM7688783		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688783	GSM7688783: Control IX; Danio rerio; RNA Seq	GSM7688783 r1	GSM7688783	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Control-IX_S22_L001_R1_001.fastq.gz	fastq	366045799.0	4944832.0	GSM7688783 r1	0:74.03	A:98000119;C:84654222;G:86951226;T:96295351;N:144881	74		98000119	84654222	86951226	96295351	144881	SRX21286658	SRS18536771	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94303	0.07499	0.73085	0.47881	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24956	24956	SRR25557807	SRX21286658	SRS18536771	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Control IX	GSM7688783		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688783	GSM7688783: Control IX; Danio rerio; RNA Seq	GSM7688783 r1	GSM7688783	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Control-IX_S22_L002_R1_001.fastq.gz	fastq	369429068.0	4988719.0	GSM7688783 r2	0:74.05	A:98907882;C:85446993;G:87729593;T:97216477;N:128123	74		98907882	85446993	87729593	97216477	128123	SRX21286658	SRS18536771	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94261	0.07335	0.72969	0.47867	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24957	24957	SRR25557808	SRX21286658	SRS18536771	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Control IX	GSM7688783		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688783	GSM7688783: Control IX; Danio rerio; RNA Seq	GSM7688783 r1	GSM7688783	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Control-IX_S22_L003_R1_001.fastq.gz	fastq	369967330.0	4996710.0	GSM7688783 r3	0:74.04	A:99035743;C:85549878;G:87926587;T:97310812;N:144310	74		99035743	85549878	87926587	97310812	144310	SRX21286658	SRS18536771	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94328	0.0743	0.73034	0.47133	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24958	24958	SRR25557809	SRX21286658	SRS18536771	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Control IX	GSM7688783		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688783	GSM7688783: Control IX; Danio rerio; RNA Seq	GSM7688783 r1	GSM7688783	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Control-IX_S22_L004_R1_001.fastq.gz	fastq	365499176.0	4936305.0	GSM7688783 r4	0:74.04	A:97825658;C:84517732;G:86863655;T:96157429;N:134702	74		97825658	84517732	86863655	96157429	134702	SRX21286658	SRS18536771	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94286	0.07288	0.72999	0.4783	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24959	24959	SRR25557810	SRX21286657	SRS18536770	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Control VIII	GSM7688782		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688782	GSM7688782: Control VIII; Danio rerio; RNA Seq	GSM7688782 r1	GSM7688782	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Control-VIII_S20_L001_R1_001.fastq.gz	fastq	488585907.0	6585668.0	GSM7688782 r1	0:74.19	A:131727468;C:112349971;G:115189425;T:129203159;N:115884	74		131727468	112349971	115189425	129203159	115884	SRX21286657	SRS18536770	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.93794	0.07381	0.7315	0.47355	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24960	24960	SRR25557811	SRX21286657	SRS18536770	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Control VIII	GSM7688782		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688782	GSM7688782: Control VIII; Danio rerio; RNA Seq	GSM7688782 r1	GSM7688782	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Control-VIII_S20_L002_R1_001.fastq.gz	fastq	493766544.0	6653820.0	GSM7688782 r2	0:74.21	A:133135166;C:113551418;G:116398455;T:130575771;N:105734	74		133135166	113551418	116398455	130575771	105734	SRX21286657	SRS18536770	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.93729	0.07312	0.7307	0.47966	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24961	24961	SRR25557812	SRX21286657	SRS18536770	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Control VIII	GSM7688782		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688782	GSM7688782: Control VIII; Danio rerio; RNA Seq	GSM7688782 r1	GSM7688782	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Control-VIII_S20_L003_R1_001.fastq.gz	fastq	494935071.0	6670024.0	GSM7688782 r3	0:74.20	A:133406912;C:113769494;G:116771560;T:130871612;N:115493	74		133406912	113769494	116771560	130871612	115493	SRX21286657	SRS18536770	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.93847	0.07383	0.73194	0.47646	74	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24962	24962	SRR25557813	SRX21286657	SRS18536770	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Control VIII	GSM7688782		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688782	GSM7688782: Control VIII; Danio rerio; RNA Seq	GSM7688782 r1	GSM7688782	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Control-VIII_S20_L004_R1_001.fastq.gz	fastq	487644286.0	6572100.0	GSM7688782 r4	0:74.20	A:131423055;C:112092623;G:115067911;T:128945959;N:114738	74		131423055	112092623	115067911	128945959	114738	SRX21286657	SRS18536770	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.93708	0.0732	0.73186	0.4781	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24963	24963	SRR25557814	SRX21286656	SRS18536769	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Control VII	GSM7688781		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688781	GSM7688781: Control VII; Danio rerio; RNA Seq	GSM7688781 r1	GSM7688781	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Control-VII_S21_L001_R1_001.fastq.gz	fastq	419048369.0	5664168.0	GSM7688781 r1	0:73.98	A:111569757;C:97553687;G:100228004;T:109523480;N:173441	73		111569757	97553687	100228004	109523480	173441	SRX21286656	SRS18536769	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94179	0.06596	0.74499	0.46809	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24964	24964	SRR25557815	SRX21286656	SRS18536769	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Control VII	GSM7688781		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688781	GSM7688781: Control VII; Danio rerio; RNA Seq	GSM7688781 r1	GSM7688781	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Control-VII_S21_L002_R1_001.fastq.gz	fastq	422419362.0	5707444.0	GSM7688781 r2	0:74.01	A:112476977;C:98366185;G:101046586;T:110369882;N:159732	74		112476977	98366185	101046586	110369882	159732	SRX21286656	SRS18536769	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94275	0.06539	0.74523	0.47247	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24965	24965	SRR25557816	SRX21286656	SRS18536769	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Control VII	GSM7688781		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688781	GSM7688781: Control VII; Danio rerio; RNA Seq	GSM7688781 r1	GSM7688781	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Control-VII_S21_L003_R1_001.fastq.gz	fastq	424260551.0	5733133.0	GSM7688781 r3	0:74.00	A:112957538;C:98789480;G:101496747;T:110850186;N:166600	74		112957538	98789480	101496747	110850186	166600	SRX21286656	SRS18536769	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94174	0.06482	0.74304	0.46935	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24966	24966	SRR25557817	SRX21286656	SRS18536769	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Control VII	GSM7688781		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688781	GSM7688781: Control VII; Danio rerio; RNA Seq	GSM7688781 r1	GSM7688781	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Control-VII_S21_L004_R1_001.fastq.gz	fastq	417875320.0	5646817.0	GSM7688781 r4	0:74.00	A:111226895;C:97273168;G:100030641;T:109182520;N:162096	74		111226895	97273168	100030641	109182520	162096	SRX21286656	SRS18536769	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94352	0.06524	0.74442	0.47095	74	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
29933	29933	SRR27592958	SRX23261722	SRS20163687	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.				arid1b adult rep15	GSM8020230		source name:single dissected adult brain male\|tissue:single dissected adult brain male\|genotype:arid1b homozygous\|geo loc name:missing\|collection date:missing	arid1b adult rep15	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	single dissected adult brain male		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:single dissected adult brain male\|genotype:arid1b homozygous	GSM8020230	GSM8020230: arid1b adult rep15; Danio rerio; RNA Seq	GSM8020230 r1	GSM8020230	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215		loader:fastq load.py	arid1b-adult-set2-hom_A8_S20_R1_001.fastq.gz	fastq	4265635010.0	42234010.0	GSM8020230 r1	0:101	A:1152569190;C:1002056793;G:969860357;T:1141141715;N:6955	101		1152569190	1002056793	969860357	1141141715	6955	SRX23261722	SRS20163687	SRA1787174	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-01-16	Adult	Adult	Brain	Nervous System
29934	29934	SRR27592959	SRX23261721	SRS20163686	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.				arid1b adult rep14	GSM8020229		source name:single dissected adult brain male\|tissue:single dissected adult brain male\|genotype:arid1b homozygous\|geo loc name:missing\|collection date:missing	arid1b adult rep14	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	single dissected adult brain male		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:single dissected adult brain male\|genotype:arid1b homozygous	GSM8020229	GSM8020229: arid1b adult rep14; Danio rerio; RNA Seq	GSM8020229 r1	GSM8020229	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215		loader:fastq load.py	arid1b-adult-set2-hom_A6_S18_R1_001.fastq.gz	fastq	1422969608.0	14088808.0	GSM8020229 r1	0:101	A:389767872;C:327820009;G:327097969;T:378282090;N:1668	101		389767872	327820009	327097969	378282090	1668	SRX23261721	SRS20163686	SRA1787174	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-01-16	Adult	Adult	Brain	Nervous System
29935	29935	SRR27592960	SRX23261720	SRS20163685	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.				arid1b adult rep13	GSM8020228		source name:single dissected adult brain male\|tissue:single dissected adult brain male\|genotype:arid1b homozygous\|geo loc name:missing\|collection date:missing	arid1b adult rep13	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	single dissected adult brain male		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:single dissected adult brain male\|genotype:arid1b homozygous	GSM8020228	GSM8020228: arid1b adult rep13; Danio rerio; RNA Seq	GSM8020228 r1	GSM8020228	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215		loader:fastq load.py	arid1b-adult-set2-hom_A4_S16_R1_001.fastq.gz	fastq	4331217239.0	42883339.0	GSM8020228 r1	0:101	A:1169654932;C:1016829715;G:986390612;T:1158335000;N:6980	101		1169654932	1016829715	986390612	1158335000	6980	SRX23261720	SRS20163685	SRA1787174	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-01-16	Adult	Adult	Brain	Nervous System
29936	29936	SRR27592961	SRX23261719	SRS20163684	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.				arid1b adult rep12	GSM8020227		source name:single dissected adult brain male\|tissue:single dissected adult brain male\|genotype:arid1b homozygous\|geo loc name:missing\|collection date:missing	arid1b adult rep12	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	single dissected adult brain male		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:single dissected adult brain male\|genotype:arid1b homozygous	GSM8020227	GSM8020227: arid1b adult rep12; Danio rerio; RNA Seq	GSM8020227 r1	GSM8020227	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215		loader:fastq load.py	arid1b-adult-set2-hom_A2_S14_R1_001.fastq.gz	fastq	820969107.0	8128407.0	GSM8020227 r1	0:101	A:229523100;C:185511734;G:179068656;T:226864374;N:1243	101		229523100	185511734	179068656	226864374	1243	SRX23261719	SRS20163684	SRA1787174	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-01-16	Adult	Adult	Brain	Nervous System
29937	29937	SRR27592962	SRX23261718	SRS20163683	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.				arid1b adult rep11	GSM8020226		source name:single dissected adult brain male\|tissue:single dissected adult brain male\|genotype:arid1b heterozygous\|geo loc name:missing\|collection date:missing	arid1b adult rep11	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	single dissected adult brain male		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:single dissected adult brain male\|genotype:arid1b heterozygous	GSM8020226	GSM8020226: arid1b adult rep11; Danio rerio; RNA Seq	GSM8020226 r1	GSM8020226	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215		loader:fastq load.py	arid1b-adult-set2-het_A7_S19_R1_001.fastq.gz	fastq	3609957150.0	35742150.0	GSM8020226 r1	0:101	A:997333826;C:818355353;G:803362992;T:990899286;N:5693	101		997333826	818355353	803362992	990899286	5693	SRX23261718	SRS20163683	SRA1787174	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-01-16	Adult	Adult	Brain	Nervous System
29938	29938	SRR27592963	SRX23261717	SRS20163682	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.				arid1b adult rep10	GSM8020225		source name:single dissected adult brain male\|tissue:single dissected adult brain male\|genotype:arid1b heterozygous\|geo loc name:missing\|collection date:missing	arid1b adult rep10	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	single dissected adult brain male		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:single dissected adult brain male\|genotype:arid1b heterozygous	GSM8020225	GSM8020225: arid1b adult rep10; Danio rerio; RNA Seq	GSM8020225 r1	GSM8020225	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215		loader:fastq load.py	arid1b-adult-set2-het_A5_S17_R1_001.fastq.gz	fastq	3177521913.0	31460613.0	GSM8020225 r1	0:101	A:869322737;C:728803554;G:719191487;T:860199264;N:4871	101		869322737	728803554	719191487	860199264	4871	SRX23261717	SRS20163682	SRA1787174	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-01-16	Adult	Adult	Brain	Nervous System
29939	29939	SRR27592964	SRX23261716	SRS20163681	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.				arid1b adult rep9	GSM8020224		source name:single dissected adult brain male\|tissue:single dissected adult brain male\|genotype:arid1b heterozygous\|geo loc name:missing\|collection date:missing	arid1b adult rep9	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	single dissected adult brain male		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:single dissected adult brain male\|genotype:arid1b heterozygous	GSM8020224	GSM8020224: arid1b adult rep9; Danio rerio; RNA Seq	GSM8020224 r1	GSM8020224	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215		loader:fastq load.py	arid1b-adult-set2-het_A3_S15_R1_001.fastq.gz	fastq	3681640688.0	36451888.0	GSM8020224 r1	0:101	A:972550652;C:881056608;G:858084187;T:969943492;N:5749	101		972550652	881056608	858084187	969943492	5749	SRX23261716	SRS20163681	SRA1787174	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-01-16	Adult	Adult	Brain	Nervous System
29940	29940	SRR27592965	SRX23261715	SRS20163679	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.				arid1b adult rep8	GSM8020223		source name:single dissected adult brain male\|tissue:single dissected adult brain male\|genotype:arid1b heterozygous\|geo loc name:missing\|collection date:missing	arid1b adult rep8	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	single dissected adult brain male		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:single dissected adult brain male\|genotype:arid1b heterozygous	GSM8020223	GSM8020223: arid1b adult rep8; Danio rerio; RNA Seq	GSM8020223 r1	GSM8020223	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215		loader:fastq load.py	arid1b-adult-set2-het_A1_S13_R1_001.fastq.gz	fastq	2692714540.0	26660540.0	GSM8020223 r1	0:101	A:739519019;C:619307370;G:594887957;T:738995900;N:4294	101		739519019	619307370	594887957	738995900	4294	SRX23261715	SRS20163679	SRA1787174	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-01-16	Adult	Adult	Brain	Nervous System
29941	29941	SRR27592966	SRX23261714	SRS20163680	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.				arid1b adult rep7	GSM8020222		source name:single dissected adult brain female\|tissue:single dissected adult brain female\|genotype:arid1b homozygous\|geo loc name:missing\|collection date:missing	arid1b adult rep7	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	single dissected adult brain female		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:single dissected adult brain female\|genotype:arid1b homozygous	GSM8020222	GSM8020222: arid1b adult rep7; Danio rerio; RNA Seq	GSM8020222 r1	GSM8020222	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215		loader:fastq load.py	arid1b-adult-set1-hom_8_S38_R1_001.fastq.gz	fastq	3385303153.0	33517853.0	GSM8020222 r1	0:101	A:922612734;C:831122592;G:725118400;T:906435529;N:13898	101		922612734	831122592	725118400	906435529	13898	SRX23261714	SRS20163680	SRA1787174	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-01-16	Adult	Adult	Brain	Nervous System
29942	29942	SRR27592967	SRX23261713	SRS20163678	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.				arid1b adult rep6	GSM8020221		source name:single dissected adult brain female\|tissue:single dissected adult brain female\|genotype:arid1b homozygous\|geo loc name:missing\|collection date:missing	arid1b adult rep6	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	single dissected adult brain female		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:single dissected adult brain female\|genotype:arid1b homozygous	GSM8020221	GSM8020221: arid1b adult rep6; Danio rerio; RNA Seq	GSM8020221 r1	GSM8020221	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215		loader:fastq load.py	arid1b-adult-set1-hom_6_S36_R1_001.fastq.gz	fastq	4453651055.0	44095555.0	GSM8020221 r1	0:101	A:1190308155;C:1078598974;G:1012348343;T:1172377706;N:17877	101		1190308155	1078598974	1012348343	1172377706	17877	SRX23261713	SRS20163678	SRA1787174	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-01-16	Adult	Adult	Brain	Nervous System
29943	29943	SRR27592968	SRX23261712	SRS20163677	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.				arid1b adult rep5	GSM8020220		source name:single dissected adult brain female\|tissue:single dissected adult brain female\|genotype:arid1b homozygous\|geo loc name:missing\|collection date:missing	arid1b adult rep5	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	single dissected adult brain female		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:single dissected adult brain female\|genotype:arid1b homozygous	GSM8020220	GSM8020220: arid1b adult rep5; Danio rerio; RNA Seq	GSM8020220 r1	GSM8020220	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215		loader:fastq load.py	arid1b-adult-set1-hom_5_S35_R1_001.fastq.gz	fastq	3607941998.0	35722198.0	GSM8020220 r1	0:101	A:986679637;C:834475298;G:801712371;T:985059988;N:14704	101		986679637	834475298	801712371	985059988	14704	SRX23261712	SRS20163677	SRA1787174	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-01-16	Adult	Adult	Brain	Nervous System
29944	29944	SRR27592969	SRX23261711	SRS20163675	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.				arid1b adult rep4	GSM8020219		source name:single dissected adult brain female\|tissue:single dissected adult brain female\|genotype:arid1b heterozygous\|geo loc name:missing\|collection date:missing	arid1b adult rep4	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	single dissected adult brain female		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:single dissected adult brain female\|genotype:arid1b heterozygous	GSM8020219	GSM8020219: arid1b adult rep4; Danio rerio; RNA Seq	GSM8020219 r1	GSM8020219	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215		loader:fastq load.py	arid1b-adult-set1-het_4_S34_R1_001.fastq.gz	fastq	3406563249.0	33728349.0	GSM8020219 r1	0:101	A:929693102;C:825436822;G:742465339;T:908956167;N:11819	101		929693102	825436822	742465339	908956167	11819	SRX23261711	SRS20163675	SRA1787174	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-01-16	Adult	Adult	Brain	Nervous System

Advanced export

JSON shape: default, array, newline-delimited

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;