metadata: run_metadata: 350 rows where experiment.library_source = "TRANSCRIPTOMIC" and technology = "iclip"

350 rows where experiment.library_source = "TRANSCRIPTOMIC" and technology = "iclip"

descending

Link	rowid ▼	run.accession	experiment.accession	sample.accession	study.accession	bioproject	study.title	study.alias	study.type	study.abstract	study.attributes	study.PMIDs	sample.title	sample.alias	sample.attributes	GEOsample.title	GEOsample.dataprocessing	GEOsample.source	GEOsample.treatmentprotocol	GEOsample.extractprotocol	GEOsample.growthprotocol	GEOsample.characteristics	GEOsample.accession	experiment.title	experiment.alias	experiment.library_name	experiment.design_description	experiment.library_construction_protocol	experiment.attributes	experiment.library_strategy	experiment.library_source	experiment.library_selection	experiment.library_layout	experiment.platform	experiment.instrument_model	experiment.study_ref	run.attributes	run.filename	run.semantic_name	run.total_bases	run.total_spots	run.alias	run.read_lengths	run.base_counts	run.r1_length	run.r2_length	run.Acount	run.Ccount	run.Gcount	run.Tcount	run.Ncount	run.experiment	run.pool_member	submission.accession	submission.srasource	submission.bioprojectsource	seqdetective.n_mates	seqdetective.mapping_rate.mate1	seqdetective.mapping_rate.mate2	seqdetective.nofeature_rate.mate1	seqdetective.nofeature_rate.mate2	seqdetective.sparsity.mate1	seqdetective.sparsity.mate2	seqdetective.pos_strand_rate.mate1	seqdetective.pos_strand_rate.mate2	seqdetective.readlen.mate1	seqdetective.readlen.mate2	seqdetective.judgement.mate1	seqdetective.judgement.mate2	seqdetective.judgement.reason	platform_family	instrument_generation	read_bias	selection_class	prep_kit	sc_or_bulk	tech_class	technology	submission.bioprojectsource.country	earliest_date	devstage_curation	devstage_curation_coarse	tissue_curation	tissue_curation_coarse
40249	40249	SRR3038049	SRX1494244	SRS1217111	SRP067641	PRJNA306648	Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition	GSE76212	Other	We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined		pubmed:28381614	IgG iCLIP zf ZGA rep3	GSM1976593	tissue:zebrafish embryo\|developmental stage:ZGA 1K cell stage\|antibody:anti IgG\|barcode sequence:NNNTGGCNN	IgG iCLIP zf ZGA rep3	Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls.	zebrafish embryo	Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions.	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	Zebrafish embryos were raised from WT AB strain and maintained using standard conditions.	developmental stage:ZGA 1K cell stage\|antibody:anti IgG\|barcode sequence:NNNTGGCNN	GSM1976593	GSM1976593: IgG iCLIP zf ZGA rep3; Danio rerio; OTHER	GSM1976593		1	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	GEO Accession:GSM1976593	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP067641		iCLIP_IgG_zebrafishembryo_wt_1K_IgGcontrol_Dr_NNNTGGCNN_20140613_L4333_4.fq.gz	fastq	82722124.0	1088449.0	GSM1976593 r1	0:76	A:21959870;C:19048567;G:22289272;T:19403630;N:20785	76		21959870	19048567	22289272	19403630	20785	SRX1494244	SRS1217111	SRA320959	GEO	Molecular Biophysics and Biochemistry, Yale University	1	0.08124		0.02181		0.98591		0.59183		76		B		usable mapping rate	illumina	hiseq_era	3prime	other	unknown	bulk	clip	iclip	United States	2015-12-21	Blastula	Embryo	Embryo Imprecise	All anatomical structures
40250	40250	SRR3038048	SRX1494243	SRS1217112	SRP067641	PRJNA306648	Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition	GSE76212	Other	We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined		pubmed:28381614	IgG iCLIP zf ZGA rep2	GSM1976592	tissue:zebrafish embryo\|developmental stage:ZGA 1K cell stage\|antibody:anti IgG\|barcode sequence:NNNCCACNN	IgG iCLIP zf ZGA rep2	Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls.	zebrafish embryo	Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions.	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	Zebrafish embryos were raised from WT AB strain and maintained using standard conditions.	developmental stage:ZGA 1K cell stage\|antibody:anti IgG\|barcode sequence:NNNCCACNN	GSM1976592	GSM1976592: IgG iCLIP zf ZGA rep2; Danio rerio; OTHER	GSM1976592		1	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	GEO Accession:GSM1976592	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP067641		iCLIP_IgG_zebrafishembryo_wt_1K_IgGcontrol_Dr_NNNCCACNN_20140613_L4333_2.fq.gz	fastq	50195036.0	660461.0	GSM1976592 r1	0:76	A:14249581;C:12927029;G:12969451;T:10036400;N:12575	76		14249581	12927029	12969451	10036400	12575	SRX1494243	SRS1217112	SRA320959	GEO	Molecular Biophysics and Biochemistry, Yale University	1	0.25447		0.03871		0.94556		0.7523		76		B		usable mapping rate	illumina	hiseq_era	3prime	other	unknown	bulk	clip	iclip	United States	2015-12-21	Blastula	Embryo	Embryo Imprecise	All anatomical structures
40251	40251	SRR3038047	SRX1494242	SRS1217113	SRP067641	PRJNA306648	Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition	GSE76212	Other	We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined		pubmed:28381614	IgG iCLIP zf ZGA rep1	GSM1976591	tissue:zebrafish embryo\|developmental stage:ZGA 1K cell stage\|antibody:anti IgG\|barcode sequence:NNNGGCGNN	IgG iCLIP zf ZGA rep1	Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls.	zebrafish embryo	Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions.	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	Zebrafish embryos were raised from WT AB strain and maintained using standard conditions.	developmental stage:ZGA 1K cell stage\|antibody:anti IgG\|barcode sequence:NNNGGCGNN	GSM1976591	GSM1976591: IgG iCLIP zf ZGA rep1; Danio rerio; OTHER	GSM1976591		1	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	GEO Accession:GSM1976591	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP067641		iCLIP_IgG_zebrafishembryo_wt_1K_IgGcontrol_Dr_NNNGGCGNN_20140613_L4333_5.fq.gz	fastq	453449136.0	5966436.0	GSM1976591 r1	0:76	A:124726528;C:101139098;G:135573575;T:91900507;N:109428	76		124726528	101139098	135573575	91900507	109428	SRX1494242	SRS1217113	SRA320959	GEO	Molecular Biophysics and Biochemistry, Yale University	1	0.51353		0.10729		0.88069		0.7159		76		B		usable mapping rate	illumina	hiseq_era	3prime	other	unknown	bulk	clip	iclip	United States	2015-12-21	Blastula	Embryo	Embryo Imprecise	All anatomical structures
40252	40252	SRR3038046	SRX1494241	SRS1217114	SRP067641	PRJNA306648	Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition	GSE76212	Other	We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined		pubmed:28381614	IgG iCLIP zf preZGA rep3	GSM1976590	tissue:zebrafish embryo\|developmental stage:preZGA 32 cell stage\|antibody:anti IgG\|barcode sequence:NNNTGGCNN	IgG iCLIP zf preZGA rep3	Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls.	zebrafish embryo	Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions.	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	Zebrafish embryos were raised from WT AB strain and maintained using standard conditions.	developmental stage:preZGA 32 cell stage\|antibody:anti IgG\|barcode sequence:NNNTGGCNN	GSM1976590	GSM1976590: IgG iCLIP zf preZGA rep3; Danio rerio; OTHER	GSM1976590		1	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	GEO Accession:GSM1976590	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP067641		iCLIP_IgG_Drembryo_wt_IgGcontrol_Dr_NNNTGGCNN_20130812_hnRNPA1_4.fq.gz	fastq	600183932.0	7897157.0	GSM1976590 r1	0:76	A:173843237;C:131372689;G:170729621;T:124187689;N:50696	76		173843237	131372689	170729621	124187689	50696	SRX1494241	SRS1217114	SRA320959	GEO	Molecular Biophysics and Biochemistry, Yale University	1	0.14511		0.03659		0.9332		0.651		76		B		usable mapping rate	illumina	hiseq_era	3prime	other	unknown	bulk	clip	iclip	United States	2015-12-21	Cleavage	Embryo	Embryo Imprecise	All anatomical structures
40253	40253	SRR3038045	SRX1494240	SRS1217115	SRP067641	PRJNA306648	Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition	GSE76212	Other	We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined		pubmed:28381614	IgG iCLIP zf preZGA rep2	GSM1976589	tissue:zebrafish embryo\|developmental stage:preZGA 32 cell stage\|antibody:anti IgG\|barcode sequence:NNNCCGGNN	IgG iCLIP zf preZGA rep2	Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls.	zebrafish embryo	Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions.	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	Zebrafish embryos were raised from WT AB strain and maintained using standard conditions.	developmental stage:preZGA 32 cell stage\|antibody:anti IgG\|barcode sequence:NNNCCGGNN	GSM1976589	GSM1976589: IgG iCLIP zf preZGA rep2; Danio rerio; OTHER	GSM1976589		1	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	GEO Accession:GSM1976589	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP067641		iCLIP_IgG_Drembryo_wt_IgGcontrol_Dr_NNNCCGGNN_20130812_hnRNPA1_5.fq.gz	fastq	612280168.0	8056318.0	GSM1976589 r1	0:76	A:175101988;C:144456623;G:172272609;T:120400014;N:48934	76		175101988	144456623	172272609	120400014	48934	SRX1494240	SRS1217115	SRA320959	GEO	Molecular Biophysics and Biochemistry, Yale University	1	0.05322		0.01649		0.97656		0.67242		76		B		usable mapping rate	illumina	hiseq_era	3prime	other	unknown	bulk	clip	iclip	United States	2015-12-21	Cleavage	Embryo	Embryo Imprecise	All anatomical structures
40254	40254	SRR3038044	SRX1494239	SRS1217116	SRP067641	PRJNA306648	Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition	GSE76212	Other	We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined		pubmed:28381614	IgG iCLIP zf preZGA rep1	GSM1976588	tissue:zebrafish embryo\|developmental stage:preZGA 32 cell stage\|antibody:anti IgG\|barcode sequence:NNNGGCGNN	IgG iCLIP zf preZGA rep1	Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls.	zebrafish embryo	Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions.	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	Zebrafish embryos were raised from WT AB strain and maintained using standard conditions.	developmental stage:preZGA 32 cell stage\|antibody:anti IgG\|barcode sequence:NNNGGCGNN	GSM1976588	GSM1976588: IgG iCLIP zf preZGA rep1; Danio rerio; OTHER	GSM1976588		1	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	GEO Accession:GSM1976588	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP067641		iCLIP_IgG_Drembryo_wt_IgGcontrol_Dr_NNNGGCGNN_20130812_hnRNPA1_1.fq-3.gz	fastq	12806760.0	168510.0	GSM1976588 r1	0:76	A:3652525;C:2758781;G:3842061;T:2552042;N:1351	76		3652525	2758781	3842061	2552042	1351	SRX1494239	SRS1217116	SRA320959	GEO	Molecular Biophysics and Biochemistry, Yale University	1	0.02784		0.01181		0.99813		0.68217		76		B		usable mapping rate	illumina	hiseq_era	3prime	other	unknown	bulk	clip	iclip	United States	2015-12-21	Cleavage	Embryo	Embryo Imprecise	All anatomical structures
40255	40255	SRR3038043	SRX1494238	SRS1217117	SRP067641	PRJNA306648	Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition	GSE76212	Other	We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined		pubmed:28381614	hnRNP A1 iCLIP zf ZGA rep4	GSM1976587	tissue:zebrafish embryo\|developmental stage:ZGA 1K cell stage\|antibody:anti hnRNP A1\|barcode sequence:NNNGGTCNN	hnRNP A1 iCLIP zf ZGA rep4	Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls.	zebrafish embryo	Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions.	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	Zebrafish embryos were raised from WT AB strain and maintained using standard conditions.	developmental stage:ZGA 1K cell stage\|antibody:anti hnRNP A1\|barcode sequence:NNNGGTCNN	GSM1976587	GSM1976587: hnRNP A1 iCLIP zf ZGA rep4; Danio rerio; OTHER	GSM1976587		1	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	GEO Accession:GSM1976587	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP067641		iCLIP_hnRNPA1_zebrafishembryo_wt_1K_hnRNPA1_Dr_NNNGGTCNN_20140613_L4333_6.fq.gz	fastq	2884007568.0	37947468.0	GSM1976587 r1	0:76	A:936463452;C:557587142;G:746595510;T:642623181;N:738283	76		936463452	557587142	746595510	642623181	738283	SRX1494238	SRS1217117	SRA320959	GEO	Molecular Biophysics and Biochemistry, Yale University	1	0.38306		0.08291		0.80568		0.62132		76		B		usable mapping rate	illumina	hiseq_era	3prime	other	unknown	bulk	clip	iclip	United States	2015-12-21	Blastula	Embryo	Embryo Imprecise	All anatomical structures
40256	40256	SRR3038042	SRX1494237	SRS1217118	SRP067641	PRJNA306648	Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition	GSE76212	Other	We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined		pubmed:28381614	hnRNP A1 iCLIP zf ZGA rep3	GSM1976586	tissue:zebrafish embryo\|developmental stage:ZGA 1K cell stage\|antibody:anti hnRNP A1\|barcode sequence:NNNCAATNN	hnRNP A1 iCLIP zf ZGA rep3	Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls.	zebrafish embryo	Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions.	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	Zebrafish embryos were raised from WT AB strain and maintained using standard conditions.	developmental stage:ZGA 1K cell stage\|antibody:anti hnRNP A1\|barcode sequence:NNNCAATNN	GSM1976586	GSM1976586: hnRNP A1 iCLIP zf ZGA rep3; Danio rerio; OTHER	GSM1976586		1	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	GEO Accession:GSM1976586	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP067641		iCLIP_hnRNPA1_zebrafishembryo_wt_1K_hnRNPA1_Dr_NNNCAATNN_20140613_L4333_3.fq.gz	fastq	3875071508.0	50987783.0	GSM1976586 r1	0:76	A:1328984506;C:775814536;G:956147632;T:813109146;N:1015688	76		1328984506	775814536	956147632	813109146	1015688	SRX1494237	SRS1217118	SRA320959	GEO	Molecular Biophysics and Biochemistry, Yale University	1	0.35787		0.0904		0.81874		0.64706		76		B		usable mapping rate	illumina	hiseq_era	3prime	other	unknown	bulk	clip	iclip	United States	2015-12-21	Blastula	Embryo	Embryo Imprecise	All anatomical structures
40257	40257	SRR3038041	SRX1494236	SRS1217119	SRP067641	PRJNA306648	Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition	GSE76212	Other	We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined		pubmed:28381614	hnRNP A1 iCLIP zf ZGA rep2	GSM1976585	tissue:zebrafish embryo\|developmental stage:ZGA 1K cell stage\|antibody:anti hnRNP A1\|barcode sequence:NNNTTGTNN	hnRNP A1 iCLIP zf ZGA rep2	Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls.	zebrafish embryo	Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions.	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	Zebrafish embryos were raised from WT AB strain and maintained using standard conditions.	developmental stage:ZGA 1K cell stage\|antibody:anti hnRNP A1\|barcode sequence:NNNTTGTNN	GSM1976585	GSM1976585: hnRNP A1 iCLIP zf ZGA rep2; Danio rerio; OTHER	GSM1976585		1	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	GEO Accession:GSM1976585	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP067641		iCLIP_hnRNPA1_zebrafishembryo_wt_1K_hnRNPA1_Dr_NNNTTGTNN_20140613_L4333_1.fq.gz	fastq	3482039180.0	45816305.0	GSM1976585 r1	0:76	A:1093877493;C:647486562;G:914636686;T:825135975;N:902464	76		1093877493	647486562	914636686	825135975	902464	SRX1494236	SRS1217119	SRA320959	GEO	Molecular Biophysics and Biochemistry, Yale University	1	0.29908		0.07356		0.83459		0.62976		76		B		usable mapping rate	illumina	hiseq_era	3prime	other	unknown	bulk	clip	iclip	United States	2015-12-21	Blastula	Embryo	Embryo Imprecise	All anatomical structures
40258	40258	SRR3038040	SRX1494235	SRS1217120	SRP067641	PRJNA306648	Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition	GSE76212	Other	We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined		pubmed:28381614	hnRNP A1 iCLIP zf ZGA rep1	GSM1976584	tissue:zebrafish embryo\|developmental stage:ZGA 1K cell stage\|antibody:anti hnRNP A1\|barcode sequence:NNNGGTTNN	hnRNP A1 iCLIP zf ZGA rep1	Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls.	zebrafish embryo	Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions.	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	Zebrafish embryos were raised from WT AB strain and maintained using standard conditions.	developmental stage:ZGA 1K cell stage\|antibody:anti hnRNP A1\|barcode sequence:NNNGGTTNN	GSM1976584	GSM1976584: hnRNP A1 iCLIP zf ZGA rep1; Danio rerio; OTHER	GSM1976584		1	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	GEO Accession:GSM1976584	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP067641		iCLIP_hnRNPA1_zebrafishembryo_wt_1K_hnRNPA1_Dr_NNNGGTTNN_20140613_L4333_7.fq.gz	fastq	3547711920.0	46680420.0	GSM1976584 r1	0:76	A:1105542969;C:658172853;G:958654426;T:824422930;N:918742	76		1105542969	658172853	958654426	824422930	918742	SRX1494235	SRS1217120	SRA320959	GEO	Molecular Biophysics and Biochemistry, Yale University	1	0.34257		0.08694		0.83055		0.64965		76		B		usable mapping rate	illumina	hiseq_era	3prime	other	unknown	bulk	clip	iclip	United States	2015-12-21	Blastula	Embryo	Embryo Imprecise	All anatomical structures
40259	40259	SRR3038039	SRX1494234	SRS1217121	SRP067641	PRJNA306648	Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition	GSE76212	Other	We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined		pubmed:28381614	hnRNP A1 iCLIP zf preZGA rep3	GSM1976583	tissue:zebrafish embryo\|developmental stage:preZGA 32 cell stage\|antibody:anti hnRNP A1\|barcode sequence:NNNCAATNN	hnRNP A1 iCLIP zf preZGA rep3	Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls.	zebrafish embryo	Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions.	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	Zebrafish embryos were raised from WT AB strain and maintained using standard conditions.	developmental stage:preZGA 32 cell stage\|antibody:anti hnRNP A1\|barcode sequence:NNNCAATNN	GSM1976583	GSM1976583: hnRNP A1 iCLIP zf preZGA rep3; Danio rerio; OTHER	GSM1976583		1	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	GEO Accession:GSM1976583	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP067641		iCLIP_hnRNPA1_Drembryo_wt_hnRNPA1_Dr_NNNCAATNN_20130812_hnRNPA1_3.fq.gz	fastq	1944912200.0	25590950.0	GSM1976583 r1	0:76	A:611172831;C:390755201;G:517844203;T:424973726;N:166239	76		611172831	390755201	517844203	424973726	166239	SRX1494234	SRS1217121	SRA320959	GEO	Molecular Biophysics and Biochemistry, Yale University	1	0.23819		0.06019		0.85318		0.72811		76		B		usable mapping rate	illumina	hiseq_era	3prime	other	unknown	bulk	clip	iclip	United States	2015-12-21	Cleavage	Embryo	Embryo Imprecise	All anatomical structures
40260	40260	SRR3038038	SRX1494233	SRS1217122	SRP067641	PRJNA306648	Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition	GSE76212	Other	We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined		pubmed:28381614	hnRNP A1 iCLIP zf preZGA rep2	GSM1976582	tissue:zebrafish embryo\|developmental stage:preZGA 32 cell stage\|antibody:anti hnRNP A1\|barcode sequence:NNNTTGTNN	hnRNP A1 iCLIP zf preZGA rep2	Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls.	zebrafish embryo	Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions.	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	Zebrafish embryos were raised from WT AB strain and maintained using standard conditions.	developmental stage:preZGA 32 cell stage\|antibody:anti hnRNP A1\|barcode sequence:NNNTTGTNN	GSM1976582	GSM1976582: hnRNP A1 iCLIP zf preZGA rep2; Danio rerio; OTHER	GSM1976582		1	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	GEO Accession:GSM1976582	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP067641		iCLIP_hnRNPA1_Drembryo_wt_hnRNPA1_Dr_NNNTTGTNN_20130812_hnRNPA1_6.fq.gz	fastq	1804236124.0	23739949.0	GSM1976582 r1	0:76	A:520750722;C:337743522;G:499109535;T:446481275;N:151070	76		520750722	337743522	499109535	446481275	151070	SRX1494233	SRS1217122	SRA320959	GEO	Molecular Biophysics and Biochemistry, Yale University	1	0.25184		0.06217		0.85687		0.67912		76		B		usable mapping rate	illumina	hiseq_era	3prime	other	unknown	bulk	clip	iclip	United States	2015-12-21	Cleavage	Embryo	Embryo Imprecise	All anatomical structures
40261	40261	SRR3038037	SRX1494232	SRS1217123	SRP067641	PRJNA306648	Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition	GSE76212	Other	We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined		pubmed:28381614	hnRNP A1 iCLIP zf preZGA rep1	GSM1976581	tissue:zebrafish embryo\|developmental stage:preZGA 32 cell stage\|antibody:anti hnRNP A1\|barcode sequence:NNNGGTTNN	hnRNP A1 iCLIP zf preZGA rep1	Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls.	zebrafish embryo	Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions.	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	Zebrafish embryos were raised from WT AB strain and maintained using standard conditions.	developmental stage:preZGA 32 cell stage\|antibody:anti hnRNP A1\|barcode sequence:NNNGGTTNN	GSM1976581	GSM1976581: hnRNP A1 iCLIP zf preZGA rep1; Danio rerio; OTHER	GSM1976581		1	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	GEO Accession:GSM1976581	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP067641		iCLIP_hnRNPA1_Drembryo_wt_hnRNPA1_Dr_NNNGGTTNN_20130812_hnRNPA1_2.fq.gz	fastq	2155200476.0	28357901.0	GSM1976581 r1	0:76	A:646739355;C:394864638;G:606938658;T:506474548;N:183277	76		646739355	394864638	606938658	506474548	183277	SRX1494232	SRS1217123	SRA320959	GEO	Molecular Biophysics and Biochemistry, Yale University	1	0.24207		0.05859		0.84747		0.70564		76		B		usable mapping rate	illumina	hiseq_era	3prime	other	unknown	bulk	clip	iclip	United States	2015-12-21	Cleavage	Embryo	Embryo Imprecise	All anatomical structures
41262	41262	SRR4026154	SRX2018187	SRS1614128	SRP081553	PRJNA338793	Characterization of genetic loss of function of Fus in zebrafish	GSE85554	Transcriptome Analysis	The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates.		pubmed:27898262	FUS KO 6	GSM2277123	source name:adult female brain\|tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:FUS KO	FUS KO 6	RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an…	adult female brain	The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips.	tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:FUS KO	GSM2277123	GSM2277123: FUS KO 6; Danio rerio; RNA Seq	GSM2277123		1	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	GEO Accession:GSM2277123	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP081553		Sample_imb_ketting_2014_13_FUS_KO_6_R1.fastq.gz Sample_imb_ketting_2014_13_FUS_KO_6_R2.fastq.gz	fastq fastq	7975498532.0	39482666.0	GSM2277123 r1	0:101 1:101	A:2277361634;C:1708878425;G:1702517993;T:2283731854;N:3008626	101	101	2277361634	1708878425	1702517993	2283731854	3008626	SRX2018187	SRS1614128	SRA451974	GEO	Rene Ketting, Institute of Molecular Biology	2	0.92046	0.9235	0.18223	0.18163	0.68866	0.68927	0.48519	0.47059	101	101	B	B	biological fallback assumption	illumina	hiseq_era	3prime	poly_a	trueseq	bulk	clip	iclip	Germany	2016-08-12	Adult	Adult	Brain	Nervous System
41263	41263	SRR4026155	SRX2018187	SRS1614128	SRP081553	PRJNA338793	Characterization of genetic loss of function of Fus in zebrafish	GSE85554	Transcriptome Analysis	The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates.		pubmed:27898262	FUS KO 6	GSM2277123	source name:adult female brain\|tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:FUS KO	FUS KO 6	RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an…	adult female brain	The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips.	tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:FUS KO	GSM2277123	GSM2277123: FUS KO 6; Danio rerio; RNA Seq	GSM2277123		1	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	GEO Accession:GSM2277123	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP081553		FUS_KO_6_R1.fastq.gz FUS_KO_6_R2.fastq.gz	fastq fastq	7173346028.0	35511614.0	GSM2277123 r2	0:101 1:101	A:1991537753;C:1595400788;G:1586024536;T:1997441866;N:2941085	101	101	1991537753	1595400788	1586024536	1997441866	2941085	SRX2018187	SRS1614128	SRA451974	GEO	Rene Ketting, Institute of Molecular Biology	2	0.93379	0.93701	0.16593	0.1657	0.68517	0.68558	0.49349	0.49229	101	101	B	B	biological fallback assumption	illumina	hiseq_era	3prime	poly_a	trueseq	bulk	clip	iclip	Germany	2016-08-12	Adult	Adult	Brain	Nervous System
41264	41264	SRR4026152	SRX2018186	SRS1614129	SRP081553	PRJNA338793	Characterization of genetic loss of function of Fus in zebrafish	GSE85554	Transcriptome Analysis	The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates.		pubmed:27898262	FUS KO 5	GSM2277122	source name:adult female brain\|tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:FUS KO	FUS KO 5	RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an…	adult female brain	The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips.	tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:FUS KO	GSM2277122	GSM2277122: FUS KO 5; Danio rerio; RNA Seq	GSM2277122		1	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	GEO Accession:GSM2277122	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP081553		Sample_imb_ketting_2014_13_FUS_KO_5_R1.fastq.gz Sample_imb_ketting_2014_13_FUS_KO_5_R2.fastq.gz	fastq fastq	7478598328.0	37022764.0	GSM2277122 r1	0:101 1:101	A:2133855925;C:1603288158;G:1598612742;T:2140065375;N:2776128	101	101	2133855925	1603288158	1598612742	2140065375	2776128	SRX2018186	SRS1614129	SRA451974	GEO	Rene Ketting, Institute of Molecular Biology	2	0.9197	0.92307	0.17221	0.17171	0.68578	0.68586	0.49581	0.50519	101	101	B	B	biological fallback assumption	illumina	hiseq_era	3prime	poly_a	trueseq	bulk	clip	iclip	Germany	2016-08-12	Adult	Adult	Brain	Nervous System
41265	41265	SRR4026153	SRX2018186	SRS1614129	SRP081553	PRJNA338793	Characterization of genetic loss of function of Fus in zebrafish	GSE85554	Transcriptome Analysis	The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates.		pubmed:27898262	FUS KO 5	GSM2277122	source name:adult female brain\|tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:FUS KO	FUS KO 5	RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an…	adult female brain	The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips.	tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:FUS KO	GSM2277122	GSM2277122: FUS KO 5; Danio rerio; RNA Seq	GSM2277122		1	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	GEO Accession:GSM2277122	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP081553		FUS_KO_5_R1.fastq.gz FUS_KO_5_R2.fastq.gz	fastq fastq	6719087822.0	33262811.0	GSM2277122 r2	0:101 1:101	A:1785013612;C:1574089873;G:1572290158;T:1784978560;N:2715619	101	101	1785013612	1574089873	1572290158	1784978560	2715619	SRX2018186	SRS1614129	SRA451974	GEO	Rene Ketting, Institute of Molecular Biology	2	0.94652	0.94901	0.12756	0.12603	0.67834	0.6789	0.50281	0.50397	101	101	B	B	biological fallback assumption	illumina	hiseq_era	3prime	poly_a	trueseq	bulk	clip	iclip	Germany	2016-08-12	Adult	Adult	Brain	Nervous System
41266	41266	SRR4026151	SRX2018185	SRS1614126	SRP081553	PRJNA338793	Characterization of genetic loss of function of Fus in zebrafish	GSE85554	Transcriptome Analysis	The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates.		pubmed:27898262	FUS KO 3	GSM2277121	source name:adult female brain\|tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:FUS KO	FUS KO 3	RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an…	adult female brain	The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips.	tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:FUS KO	GSM2277121	GSM2277121: FUS KO 3; Danio rerio; RNA Seq	GSM2277121		1	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	GEO Accession:GSM2277121	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP081553		Sample_imb_ketting_2014_13_FUS_KO_3_R1.fastq.gz Sample_imb_ketting_2014_13_FUS_KO_3_R2.fastq.gz	fastq fastq	7443582840.0	36849420.0	GSM2277121 r1	0:101 1:101	A:2135476546;C:1584607182;G:1583492766;T:2137210756;N:2795590	101	101	2135476546	1584607182	1583492766	2137210756	2795590	SRX2018185	SRS1614126	SRA451974	GEO	Rene Ketting, Institute of Molecular Biology	2	0.91865	0.92202	0.16917	0.16765	0.69402	0.69424	0.49158	0.505	101	101	B	B	biological fallback assumption	illumina	hiseq_era	3prime	poly_a	trueseq	bulk	clip	iclip	Germany	2016-08-12	Adult	Adult	Brain	Nervous System
41267	41267	SRR4026149	SRX2018184	SRS1614127	SRP081553	PRJNA338793	Characterization of genetic loss of function of Fus in zebrafish	GSE85554	Transcriptome Analysis	The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates.		pubmed:27898262	FUS KO 2	GSM2277120	source name:adult female brain\|tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:FUS KO	FUS KO 2	RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an…	adult female brain	The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips.	tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:FUS KO	GSM2277120	GSM2277120: FUS KO 2; Danio rerio; RNA Seq	GSM2277120		1	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	GEO Accession:GSM2277120	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP081553		Sample_imb_ketting_2014_13_FUS_KO_2_R1.fastq.gz Sample_imb_ketting_2014_13_FUS_KO_2_R2.fastq.gz	fastq fastq	7538568694.0	37319647.0	GSM2277120 r1	0:101 1:101	A:2147431018;C:1618323797;G:1622221747;T:2147775519;N:2816613	101	101	2147431018	1618323797	1622221747	2147775519	2816613	SRX2018184	SRS1614127	SRA451974	GEO	Rene Ketting, Institute of Molecular Biology	2	0.92241	0.92545	0.17277	0.17289	0.6882	0.68878	0.50153	0.49587	101	101	B	B	biological fallback assumption	illumina	hiseq_era	3prime	poly_a	trueseq	bulk	clip	iclip	Germany	2016-08-12	Adult	Adult	Brain	Nervous System
41268	41268	SRR4026150	SRX2018184	SRS1614127	SRP081553	PRJNA338793	Characterization of genetic loss of function of Fus in zebrafish	GSE85554	Transcriptome Analysis	The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates.		pubmed:27898262	FUS KO 2	GSM2277120	source name:adult female brain\|tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:FUS KO	FUS KO 2	RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an…	adult female brain	The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips.	tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:FUS KO	GSM2277120	GSM2277120: FUS KO 2; Danio rerio; RNA Seq	GSM2277120		1	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	GEO Accession:GSM2277120	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP081553		FUS_KO_2_R1.fastq.gz FUS_KO_2_R2.fastq.gz	fastq fastq	6447010386.0	31915893.0	GSM2277120 r2	0:101 1:101	A:1836751010;C:1386222757;G:1379853653;T:1841581040;N:2601926	101	101	1836751010	1386222757	1379853653	1841581040	2601926	SRX2018184	SRS1614127	SRA451974	GEO	Rene Ketting, Institute of Molecular Biology	2	0.92533	0.92991	0.17619	0.17625	0.69031	0.69081	0.49983	0.50191	101	101	B	B	biological fallback assumption	illumina	hiseq_era	3prime	poly_a	trueseq	bulk	clip	iclip	Germany	2016-08-12	Adult	Adult	Brain	Nervous System
41269	41269	SRR4026148	SRX2018183	SRS1614125	SRP081553	PRJNA338793	Characterization of genetic loss of function of Fus in zebrafish	GSE85554	Transcriptome Analysis	The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates.		pubmed:27898262	FUS KO 1	GSM2277119	source name:adult female brain\|tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:FUS KO	FUS KO 1	RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an…	adult female brain	The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips.	tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:FUS KO	GSM2277119	GSM2277119: FUS KO 1; Danio rerio; RNA Seq	GSM2277119		1	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	GEO Accession:GSM2277119	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP081553		FUS_KO_1_R1.fastq.gz FUS_KO_1_R2.fastq.gz	fastq fastq	7395102840.0	36609420.0	GSM2277119 r1	0:101 1:101	A:2103771703;C:1595017984;G:1583980946;T:2109307704;N:3024503	101	101	2103771703	1595017984	1583980946	2109307704	3024503	SRX2018183	SRS1614125	SRA451974	GEO	Rene Ketting, Institute of Molecular Biology	2	0.9246	0.92781	0.17577	0.17518	0.69116	0.69232	0.50228	0.49896	101	101	B	B	biological fallback assumption	illumina	hiseq_era	3prime	poly_a	trueseq	bulk	clip	iclip	Germany	2016-08-12	Adult	Adult	Brain	Nervous System
41270	41270	SRR4026146	SRX2018182	SRS1614123	SRP081553	PRJNA338793	Characterization of genetic loss of function of Fus in zebrafish	GSE85554	Transcriptome Analysis	The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates.		pubmed:27898262	WT 6	GSM2277118	source name:adult female brain\|tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:wild type	WT 6	RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an…	adult female brain	The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips.	tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:wild type	GSM2277118	GSM2277118: WT 6; Danio rerio; RNA Seq	GSM2277118		1	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	GEO Accession:GSM2277118	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP081553		Sample_imb_ketting_2014_13_WT_6_R1.fastq.gz Sample_imb_ketting_2014_13_WT_6_R2.fastq.gz	fastq fastq	8334635544.0	41260572.0	GSM2277118 r1	0:101 1:101	A:2382306534;C:1783081151;G:1778919442;T:2387251408;N:3077009	101	101	2382306534	1783081151	1778919442	2387251408	3077009	SRX2018182	SRS1614123	SRA451974	GEO	Rene Ketting, Institute of Molecular Biology	2	0.91647	0.9192	0.1793	0.17873	0.69215	0.69262	0.50463	0.50038	101	101	B	B	biological fallback assumption	illumina	hiseq_era	3prime	poly_a	trueseq	bulk	clip	iclip	Germany	2016-08-12	Adult	Adult	Brain	Nervous System
41271	41271	SRR4026147	SRX2018182	SRS1614123	SRP081553	PRJNA338793	Characterization of genetic loss of function of Fus in zebrafish	GSE85554	Transcriptome Analysis	The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates.		pubmed:27898262	WT 6	GSM2277118	source name:adult female brain\|tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:wild type	WT 6	RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an…	adult female brain	The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips.	tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:wild type	GSM2277118	GSM2277118: WT 6; Danio rerio; RNA Seq	GSM2277118		1	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	GEO Accession:GSM2277118	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP081553		WT_6_R1.fastq.gz WT_6_R2.fastq.gz	fastq fastq	7239861396.0	35840898.0	GSM2277118 r2	0:101 1:101	A:1993396411;C:1626521001;G:1620190105;T:1996794482;N:2959397	101	101	1993396411	1626521001	1620190105	1996794482	2959397	SRX2018182	SRS1614123	SRA451974	GEO	Rene Ketting, Institute of Molecular Biology	2	0.93444	0.93758	0.15305	0.15223	0.68781	0.6885	0.5083	0.50745	101	101	B	B	biological fallback assumption	illumina	hiseq_era	3prime	poly_a	trueseq	bulk	clip	iclip	Germany	2016-08-12	Adult	Adult	Brain	Nervous System
41272	41272	SRR4026144	SRX2018181	SRS1614122	SRP081553	PRJNA338793	Characterization of genetic loss of function of Fus in zebrafish	GSE85554	Transcriptome Analysis	The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates.		pubmed:27898262	WT 4	GSM2277117	source name:adult female brain\|tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:wild type	WT 4	RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an…	adult female brain	The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips.	tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:wild type	GSM2277117	GSM2277117: WT 4; Danio rerio; RNA Seq	GSM2277117		1	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	GEO Accession:GSM2277117	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP081553		Sample_imb_ketting_2014_13_WT_4_R1.fastq.gz Sample_imb_ketting_2014_13_WT_4_R2.fastq.gz	fastq fastq	7425010556.0	36757478.0	GSM2277117 r1	0:101 1:101	A:2145596358;C:1565455511;G:1562345442;T:2148814299;N:2798946	101	101	2145596358	1565455511	1562345442	2148814299	2798946	SRX2018181	SRS1614122	SRA451974	GEO	Rene Ketting, Institute of Molecular Biology	2	0.91897	0.92157	0.17645	0.17633	0.6981	0.69948	0.51038	0.50544	101	101	B	B	biological fallback assumption	illumina	hiseq_era	3prime	poly_a	trueseq	bulk	clip	iclip	Germany	2016-08-12	Adult	Adult	Brain	Nervous System
41273	41273	SRR4026145	SRX2018181	SRS1614122	SRP081553	PRJNA338793	Characterization of genetic loss of function of Fus in zebrafish	GSE85554	Transcriptome Analysis	The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates.		pubmed:27898262	WT 4	GSM2277117	source name:adult female brain\|tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:wild type	WT 4	RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an…	adult female brain	The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips.	tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:wild type	GSM2277117	GSM2277117: WT 4; Danio rerio; RNA Seq	GSM2277117		1	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	GEO Accession:GSM2277117	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP081553		WT_4_R1.fastq.gz WT_4_R2.fastq.gz	fastq fastq	6322186910.0	31297955.0	GSM2277117 r2	0:101 1:101	A:1808695425;C:1352265448;G:1346884156;T:1811742728;N:2599153	101	101	1808695425	1352265448	1346884156	1811742728	2599153	SRX2018181	SRS1614122	SRA451974	GEO	Rene Ketting, Institute of Molecular Biology	2	0.927	0.92959	0.17323	0.17284	0.69562	0.69601	0.50522	0.50634	101	101	B	B	biological fallback assumption	illumina	hiseq_era	3prime	poly_a	trueseq	bulk	clip	iclip	Germany	2016-08-12	Adult	Adult	Brain	Nervous System
41274	41274	SRR4026142	SRX2018180	SRS1614124	SRP081553	PRJNA338793	Characterization of genetic loss of function of Fus in zebrafish	GSE85554	Transcriptome Analysis	The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates.		pubmed:27898262	WT 3	GSM2277116	source name:adult female brain\|tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:wild type	WT 3	RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an…	adult female brain	The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips.	tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:wild type	GSM2277116	GSM2277116: WT 3; Danio rerio; RNA Seq	GSM2277116		1	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	GEO Accession:GSM2277116	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP081553		Sample_imb_ketting_2014_13_WT_3_R1.fastq.gz Sample_imb_ketting_2014_13_WT_3_R2.fastq.gz	fastq fastq	7556697588.0	37409394.0	GSM2277116 r1	0:101 1:101	A:2168554402;C:1607788560;G:1605790339;T:2171752391;N:2811896	101	101	2168554402	1607788560	1605790339	2171752391	2811896	SRX2018180	SRS1614124	SRA451974	GEO	Rene Ketting, Institute of Molecular Biology	2	0.91892	0.92233	0.17858	0.17763	0.69589	0.69674	0.50649	0.50869	101	101	B	B	biological fallback assumption	illumina	hiseq_era	3prime	poly_a	trueseq	bulk	clip	iclip	Germany	2016-08-12	Adult	Adult	Brain	Nervous System
41275	41275	SRR4026143	SRX2018180	SRS1614124	SRP081553	PRJNA338793	Characterization of genetic loss of function of Fus in zebrafish	GSE85554	Transcriptome Analysis	The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates.		pubmed:27898262	WT 3	GSM2277116	source name:adult female brain\|tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:wild type	WT 3	RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an…	adult female brain	The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips.	tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:wild type	GSM2277116	GSM2277116: WT 3; Danio rerio; RNA Seq	GSM2277116		1	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	GEO Accession:GSM2277116	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP081553		WT_3_R1.fastq.gz WT_3_R2.fastq.gz	fastq fastq	7898912858.0	39103529.0	GSM2277116 r2	0:101 1:101	A:2243356257;C:1706636846;G:1702064968;T:2243634692;N:3220095	101	101	2243356257	1706636846	1702064968	2243634692	3220095	SRX2018180	SRS1614124	SRA451974	GEO	Rene Ketting, Institute of Molecular Biology	2	0.92701	0.93109	0.17113	0.17214	0.69591	0.69716	0.50649	0.51272	101	101	B	B	biological fallback assumption	illumina	hiseq_era	3prime	poly_a	trueseq	bulk	clip	iclip	Germany	2016-08-12	Adult	Adult	Brain	Nervous System
41276	41276	SRR4026140	SRX2018179	SRS1614121	SRP081553	PRJNA338793	Characterization of genetic loss of function of Fus in zebrafish	GSE85554	Transcriptome Analysis	The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates.		pubmed:27898262	WT 1	GSM2277115	source name:adult female brain\|tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:wild type	WT 1	RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an…	adult female brain	The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips.	tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:wild type	GSM2277115	GSM2277115: WT 1; Danio rerio; RNA Seq	GSM2277115		1	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	GEO Accession:GSM2277115	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP081553		Sample_imb_ketting_2014_13_WT_1_R1.fastq.gz Sample_imb_ketting_2014_13_WT_1_R2.fastq.gz	fastq fastq	7999392910.0	39600955.0	GSM2277115 r1	0:101 1:101	A:2287512350;C:1711532349;G:1705616114;T:2291731604;N:3000493	101	101	2287512350	1711532349	1705616114	2291731604	3000493	SRX2018179	SRS1614121	SRA451974	GEO	Rene Ketting, Institute of Molecular Biology	2	0.92291	0.92474	0.16701	0.16646	0.698	0.69814	0.51025	0.51024	101	101	B	B	biological fallback assumption	illumina	hiseq_era	3prime	poly_a	trueseq	bulk	clip	iclip	Germany	2016-08-12	Adult	Adult	Brain	Nervous System
41277	41277	SRR4026141	SRX2018179	SRS1614121	SRP081553	PRJNA338793	Characterization of genetic loss of function of Fus in zebrafish	GSE85554	Transcriptome Analysis	The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates.		pubmed:27898262	WT 1	GSM2277115	source name:adult female brain\|tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:wild type	WT 1	RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an…	adult female brain	The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips.	tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:wild type	GSM2277115	GSM2277115: WT 1; Danio rerio; RNA Seq	GSM2277115		1	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	GEO Accession:GSM2277115	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP081553		WT_1_R1.fastq.gz WT_1_R2.fastq.gz	fastq fastq	6187101026.0	30629213.0	GSM2277115 r2	0:101 1:101	A:1757769151;C:1333826875;G:1336928364;T:1756068161;N:2508475	101	101	1757769151	1333826875	1336928364	1756068161	2508475	SRX2018179	SRS1614121	SRA451974	GEO	Rene Ketting, Institute of Molecular Biology	2	0.9294	0.9334	0.16402	0.16355	0.69682	0.69741	0.49912	0.50428	101	101	B	B	biological fallback assumption	illumina	hiseq_era	3prime	poly_a	trueseq	bulk	clip	iclip	Germany	2016-08-12	Adult	Adult	Brain	Nervous System
41527	41527	SRR5441898	SRX2731753	SRS2119651	SRP092907	PRJNA352850	Transcriptomics analysis of gene expressions m6A enrichment levels and ythdf2 binding targets in control and mettl3 or ythdf2 morphants zebrafish embryos	GSE89655	Other	RNA was isolated from control and mettl3 or ythdf2 morphants zebrafish cells using the TRIzol Invitrogen reagent by following the company manual. For all samples the RNA integrity was checked using an Agilent Bioanalyzer 2100. All samples showed a RIN RNA integrity number of higher than 9. Approximately 2.5 µg of total RNA was then used for library preparation using a TruSeq™ RNA Sample Prep Kit v2 Illumina San Diego CA USA according to the manufacturer’s protocol.The libraries were sequenced using HiSeq2500 or HiSeq 3000 Illumina in paired read mode creating reads with a length of 101 or 151 bp. Sequencing chemistry v2 Illumina was used. Overall design: Examination of gene expressive levels m6A enrichment levels m6A single uncleotide sites and ythdf2 binding targets in normal and mettl3 or ythdf2 morphants zebrafish cells		pubmed:28869969	control zebrafish embryos m6A miCLIP rep2	GSM2572320	source name:zebrafish embryos\|cell type:normal zebrafish embryos cells\|age:28hpf\|tissue:trunk\|enrichment antibody vendor:Abcam	control zebrafish embryos m6A miCLIP rep2	library strategy: miCLIP seq Reads were trimmed for adaptor sequence using fastx clipper from FASTX Toolkit fastx clipper a AGATCGGAAGAGCACACG n Q 33. Low quality bases were filtered by fastq filter.pl a custom perl script from CLIP Tool Kit CTK and reads shorter than 24 nt would be discard. The forward reads were demultiplexed based on 5’ barcodes for individual replicates by fastq2collapse.pl to remove PCR amplified reads. The reverse reads were reversed complemented and processed like their forward mates. And then paired end reads were mixed for downstream analysis. Random barcodes of remained reads were stripped by stripBarcode.pl. Then the barcode sequence was moved to header line for each read. Remained reads were mapped to the zebrafish genomes version zv9 with BWA v0.7.10. The CIMS pipeline https://zhanglab.c2b2.columbia.edu/index.php/CTK Documentation was used to collapse PCR duplicates based on their mapped coordinates and to determine the unique tag coverage k and the number of mutation m for each nucleotide. The filter for the dataset was k >= 15 and m/k <= 50% and only mutation positions within RRACH motif were identified as m6A for downstream analysis to exclude the potential m6Am modification. Genome build: zv9 Supplementary files format and content: Single nucleotide resolution m6A sites identified by CIMS software.	zebrafish embryos		For miCLIP seq mRNA was isolate from the trunck region of zebrafish embryos at 28hpf and the RNA integrity was checked using an Agilent Bioanalyzer 2100. 10 ug of mRNA was first fragmented and immunoprecipitated with m6A antibody and thus obtained m6A containing RNA was subjected to cDNA library construction according to previously reported method [Linder et al. 2015; PMID: 26121403]. The libraries were sequenced using HiSeq3000 Illumina in paired read mode creating reads with a length of 101 bp.		cell type:normal zebrafish embryos cells\|age:28hpf\|tissue:trunk\|enrichment antibody vendor:Abcam	GSM2572320	GSM2572320: control zebrafish embryos m6A miCLIP rep2; Danio rerio; OTHER	GSM2572320		1	For miCLIP seq mRNA was isolate from the trunck region of zebrafish embryos at 28hpf and the RNA integrity was checked using an Agilent Bioanalyzer 2100. 10 ug of mRNA was first fragmented and immunoprecipitated with m6A antibody and thus obtained m6A containing RNA was subjected to cDNA library construction according to previously reported method [Linder et al. 2015; PMID: 26121403]. The libraries were sequenced using HiSeq2000 or HiSeq3000 Illumina in single read or paired read mode creating reads with a length of 101 bp	GEO Accession:GSM2572320	OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina HiSeq 3000	SRP092907		miCLIP_Abcam_rep2_1.fastq.gz miCLIP_Abcam_rep2_2.fastq.gz	fastq fastq	5381144865.0	26771865.0	GSM2572320 r1	0:101 1:100	A:1590037266;C:1121098903;G:1187084038;T:1482144584;N:780074	101	100	1590037266	1121098903	1187084038	1482144584	780074	SRX2731753	SRS2119651	SRA491654	GEO	Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS)	2	0.55442	0.60543	0.10037	0.11559	0.75432	0.747	0.55512	0.44818	101	100	B	B	biological fallback assumption	illumina	hiseq_era	unknown	other	trueseq	bulk	clip	iclip	China	2017-04-10	Pharyngula	Embryo	Trunk	Surface Structure
41528	41528	SRR5441897	SRX2731752	SRS2119650	SRP092907	PRJNA352850	Transcriptomics analysis of gene expressions m6A enrichment levels and ythdf2 binding targets in control and mettl3 or ythdf2 morphants zebrafish embryos	GSE89655	Other	RNA was isolated from control and mettl3 or ythdf2 morphants zebrafish cells using the TRIzol Invitrogen reagent by following the company manual. For all samples the RNA integrity was checked using an Agilent Bioanalyzer 2100. All samples showed a RIN RNA integrity number of higher than 9. Approximately 2.5 µg of total RNA was then used for library preparation using a TruSeq™ RNA Sample Prep Kit v2 Illumina San Diego CA USA according to the manufacturer’s protocol.The libraries were sequenced using HiSeq2500 or HiSeq 3000 Illumina in paired read mode creating reads with a length of 101 or 151 bp. Sequencing chemistry v2 Illumina was used. Overall design: Examination of gene expressive levels m6A enrichment levels m6A single uncleotide sites and ythdf2 binding targets in normal and mettl3 or ythdf2 morphants zebrafish cells		pubmed:28869969	control zebrafish embryos m6A miCLIP rep1	GSM2572319	source name:zebrafish embryos\|cell type:normal zebrafish embryos cells\|age:28hpf\|tissue:trunk\|enrichment antibody vendor:Abcam	control zebrafish embryos m6A miCLIP rep1	library strategy: miCLIP seq Reads were trimmed for adaptor sequence using fastx clipper from FASTX Toolkit fastx clipper a AGATCGGAAGAGCACACG n Q 33. Low quality bases were filtered by fastq filter.pl a custom perl script from CLIP Tool Kit CTK and reads shorter than 24 nt would be discard. The forward reads were demultiplexed based on 5’ barcodes for individual replicates by fastq2collapse.pl to remove PCR amplified reads. The reverse reads were reversed complemented and processed like their forward mates. And then paired end reads were mixed for downstream analysis. Random barcodes of remained reads were stripped by stripBarcode.pl. Then the barcode sequence was moved to header line for each read. Remained reads were mapped to the zebrafish genomes version zv9 with BWA v0.7.10. The CIMS pipeline https://zhanglab.c2b2.columbia.edu/index.php/CTK Documentation was used to collapse PCR duplicates based on their mapped coordinates and to determine the unique tag coverage k and the number of mutation m for each nucleotide. The filter for the dataset was k >= 15 and m/k <= 50% and only mutation positions within RRACH motif were identified as m6A for downstream analysis to exclude the potential m6Am modification. Genome build: zv9 Supplementary files format and content: Single nucleotide resolution m6A sites identified by CIMS software.	zebrafish embryos		For miCLIP seq mRNA was isolate from the trunck region of zebrafish embryos at 28hpf and the RNA integrity was checked using an Agilent Bioanalyzer 2100. 10 ug of mRNA was first fragmented and immunoprecipitated with m6A antibody and thus obtained m6A containing RNA was subjected to cDNA library construction according to previously reported method [Linder et al. 2015; PMID: 26121403]. The libraries were sequenced using HiSeq3000 Illumina in paired read mode creating reads with a length of 101 bp.		cell type:normal zebrafish embryos cells\|age:28hpf\|tissue:trunk\|enrichment antibody vendor:Abcam	GSM2572319	GSM2572319: control zebrafish embryos m6A miCLIP rep1; Danio rerio; OTHER	GSM2572319		1	For miCLIP seq mRNA was isolate from the trunck region of zebrafish embryos at 28hpf and the RNA integrity was checked using an Agilent Bioanalyzer 2100. 10 ug of mRNA was first fragmented and immunoprecipitated with m6A antibody and thus obtained m6A containing RNA was subjected to cDNA library construction according to previously reported method [Linder et al. 2015; PMID: 26121403]. The libraries were sequenced using HiSeq2000 or HiSeq3000 Illumina in single read or paired read mode creating reads with a length of 101 bp	GEO Accession:GSM2572319	OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina HiSeq 3000	SRP092907		miCLIP_Abcam_rep1_1.fastq.gz miCLIP_Abcam_rep1_2.fastq.gz	fastq fastq	6036174318.0	30030718.0	GSM2572319 r1	0:101 1:100	A:1726466495;C:1297674104;G:1364186585;T:1647084426;N:762708	101	100	1726466495	1297674104	1364186585	1647084426	762708	SRX2731752	SRS2119650	SRA491654	GEO	Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS)	2	0.5985	0.66835	0.09404	0.1086	0.74491	0.73596	0.54343	0.45047	101	100	B	B	biological fallback assumption	illumina	hiseq_era	unknown	other	trueseq	bulk	clip	iclip	China	2017-04-10	Pharyngula	Embryo	Trunk	Surface Structure
48384	48384	SRR7236655	SRX4142917	SRS3356704	SRP149368	PRJNA473836	mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis: KHSRP iCLIP	PRJNA473836	Other	RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. This is the endogenous KHSRP iCLIP part of the study.			Raw multiplex: KHSRP iCLIP iCLIP Khsrp Ab B2;KHSRP iCLIP iCLIP Khsrp noAb B2	Raw multiplex: KHSRP iCLIP iC Khsrp Ab B2 AG01175;KHSRP iCLIP iC Khsrp noAb B2 AG01176	strain:TU/AB\|age:4.0\|dev stage:sphere\|sex:pooled male and female\|tissue:embryo\|treatment:iCLIP\|molecule:RNA\|selection:KHSRP antibody;\|replicate group:1;2\|replicate:2\|barcode:TCTC;GTGT\|BioSampleModel:Model organism or animal									Raw multiplex: KHSRP iCLIP iCLIP Khsrp Ab B2;KHSRP iCLIP iCLIP Khsrp noAb B2	AG01175.2;AG01176.2	AG01175.2;AG01176.2	RNA			OTHER	TRANSCRIPTOMIC	unspecified	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP149368		HHLV3ADXX_kh2_NOBCX_R1.fastq.gz	fastq	7675050912.0	100987512.0	HHLV3ADXX kh2 NOBCX R1.fastq.gz	0:76	A:2241934669;C:1774343310;G:1727825603;T:1912212373;N:18734957	76		2241934669	1774343310	1727825603	1912212373	18734957	SRX4142917	SRS3356704	SRA712863	Yale_Giraldez\|Genetics	Yale_Giraldez_Group	1	0.00123		0.00083		0.99939		0.47297		76		T		under 1.2% mapping rate	illumina	hiseq_era	unknown	small_rna	unknown	bulk	clip	iclip	United States	2018-06-07	Blastula	Embryo	Embryo Imprecise	All anatomical structures
48385	48385	SRR7236656	SRX4142916	SRS3356704	SRP149368	PRJNA473836	mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis: KHSRP iCLIP	PRJNA473836	Other	RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. This is the endogenous KHSRP iCLIP part of the study.			Raw multiplex: KHSRP iCLIP iCLIP Khsrp Ab B2;KHSRP iCLIP iCLIP Khsrp noAb B2	Raw multiplex: KHSRP iCLIP iC Khsrp Ab B2 AG01175;KHSRP iCLIP iC Khsrp noAb B2 AG01176	strain:TU/AB\|age:4.0\|dev stage:sphere\|sex:pooled male and female\|tissue:embryo\|treatment:iCLIP\|molecule:RNA\|selection:KHSRP antibody;\|replicate group:1;2\|replicate:2\|barcode:TCTC;GTGT\|BioSampleModel:Model organism or animal									Raw multiplex: KHSRP iCLIP iCLIP Khsrp Ab B2;KHSRP iCLIP iCLIP Khsrp noAb B2	AG01175.1;AG01176.1	AG01175.1;AG01176.1	RNA			OTHER	TRANSCRIPTOMIC	unspecified	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP149368		HHLY2ADXX_kh2_NOBCX_R1.fastq.gz	fastq	10199922760.0	134209510.0	HHLY2ADXX kh2 NOBCX R1.fastq.gz	0:76	A:2990232290;C:2350693064;G:2293777949;T:2554099449;N:11120008	76		2990232290	2350693064	2293777949	2554099449	11120008	SRX4142916	SRS3356704	SRA712863	Yale_Giraldez\|Genetics	Yale_Giraldez_Group	1	0.00128		0.00076		0.99945		0.43877		76		T		under 1.2% mapping rate	illumina	hiseq_era	unknown	small_rna	unknown	bulk	clip	iclip	United States	2018-06-07	Blastula	Embryo	Embryo Imprecise	All anatomical structures
48386	48386	SRR7236657	SRX4142915	SRS3356703	SRP149368	PRJNA473836	mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis: KHSRP iCLIP	PRJNA473836	Other	RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. This is the endogenous KHSRP iCLIP part of the study.			Raw multiplex: KHSRP iCLIP iCLIP Khsrp noAb B3;KHSRP iCLIP iCLIP Khsrp Ab B3	Raw multiplex: KHSRP iCLIP iC Khsrp noAb B3 AG01177;KHSRP iCLIP iC Khsrp Ab B3 AG01178	strain:TU/AB\|age:4.0\|dev stage:sphere\|sex:pooled male and female\|tissue:embryo\|treatment:iCLIP\|molecule:RNA\|selection:;KHSRP antibody\|replicate group:2;1\|replicate:3\|barcode:CACA;AGAG\|BioSampleModel:Model organism or animal									Raw multiplex: KHSRP iCLIP iCLIP Khsrp noAb B3;KHSRP iCLIP iCLIP Khsrp Ab B3	AG01177.2;AG01178.2	AG01177.2;AG01178.2	RNA			OTHER	TRANSCRIPTOMIC	unspecified	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP149368		HHLTFADXX_kh3_022_R1.fastq.gz	fastq	5612942988.0	73854513.0	HHLTFADXX kh3 022 R1.fastq.gz	0:76	A:1761182916;C:1273000548;G:1339715056;T:1238748082;N:296386	76		1761182916	1273000548	1339715056	1238748082	296386	SRX4142915	SRS3356703	SRA712863	Yale_Giraldez\|Genetics	Yale_Giraldez_Group	1	0.00125		0.00069		0.99831		0.5566		76		T		under 1.2% mapping rate	illumina	hiseq_era	unknown	small_rna	unknown	bulk	clip	iclip	United States	2018-06-07	Blastula	Embryo	Embryo Imprecise	All anatomical structures
48387	48387	SRR7236658	SRX4142914	SRS3356703	SRP149368	PRJNA473836	mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis: KHSRP iCLIP	PRJNA473836	Other	RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. This is the endogenous KHSRP iCLIP part of the study.			Raw multiplex: KHSRP iCLIP iCLIP Khsrp noAb B3;KHSRP iCLIP iCLIP Khsrp Ab B3	Raw multiplex: KHSRP iCLIP iC Khsrp noAb B3 AG01177;KHSRP iCLIP iC Khsrp Ab B3 AG01178	strain:TU/AB\|age:4.0\|dev stage:sphere\|sex:pooled male and female\|tissue:embryo\|treatment:iCLIP\|molecule:RNA\|selection:;KHSRP antibody\|replicate group:2;1\|replicate:3\|barcode:CACA;AGAG\|BioSampleModel:Model organism or animal									Raw multiplex: KHSRP iCLIP iCLIP Khsrp noAb B3;KHSRP iCLIP iCLIP Khsrp Ab B3	AG01177.1;AG01178.1	AG01177.1;AG01178.1	RNA			OTHER	TRANSCRIPTOMIC	unspecified	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP149368		HHLV3ADXX_kh3_NOBCX_R1.fastq.gz	fastq	7810653532.0	102771757.0	HHLV3ADXX kh3 NOBCX R1.fastq.gz	0:76	A:2439317937;C:1775190292;G:1863760875;T:1714265680;N:18118748	76		2439317937	1775190292	1863760875	1714265680	18118748	SRX4142914	SRS3356703	SRA712863	Yale_Giraldez\|Genetics	Yale_Giraldez_Group	1	0.00121		0.00071		0.99864		0.54444		76		T		under 1.2% mapping rate	illumina	hiseq_era	unknown	small_rna	unknown	bulk	clip	iclip	United States	2018-06-07	Blastula	Embryo	Embryo Imprecise	All anatomical structures
48388	48388	SRR7236659	SRX4142913	SRS3356702	SRP149368	PRJNA473836	mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis: KHSRP iCLIP	PRJNA473836	Other	RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. This is the endogenous KHSRP iCLIP part of the study.			KHSRP iCLIP iCLIP Khsrp Ab B3	KHSRP iCLIP iC Khsrp Ab B3 AG01178	strain:TU/AB\|age:4.0\|dev stage:sphere\|sex:pooled male and female\|tissue:embryo\|treatment:iCLIP\|molecule:RNA\|selection:KHSRP antibody\|replicate group:1\|replicate:3\|barcode:AGAG\|BioSampleModel:Model organism or animal									KHSRP iCLIP iCLIP Khsrp Ab B3	AG01178.2	AG01178.2	RNA			OTHER	TRANSCRIPTOMIC	unspecified	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP149368		AG01178.2_R1.fastq.gz	fastq	1046051929.0	35061189.0	AG01178.2 R1.fastq.gz	0:29.84 1:0	A:304629557;C:170568838;G:208541597;T:362307791;N:4146	29	0	304629557	170568838	208541597	362307791	4146	SRX4142913	SRS3356702	SRA712863	Yale_Giraldez\|Genetics	Yale_Giraldez_Group	1	0.68324		0.4824		0.78139		0.51734		20		B		usable mapping rate	illumina	hiseq_era	unknown	small_rna	unknown	bulk	clip	iclip	United States	2018-06-07	Blastula	Embryo	Embryo Imprecise	All anatomical structures
48389	48389	SRR7236660	SRX4142912	SRS3356702	SRP149368	PRJNA473836	mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis: KHSRP iCLIP	PRJNA473836	Other	RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. This is the endogenous KHSRP iCLIP part of the study.			KHSRP iCLIP iCLIP Khsrp Ab B3	KHSRP iCLIP iC Khsrp Ab B3 AG01178	strain:TU/AB\|age:4.0\|dev stage:sphere\|sex:pooled male and female\|tissue:embryo\|treatment:iCLIP\|molecule:RNA\|selection:KHSRP antibody\|replicate group:1\|replicate:3\|barcode:AGAG\|BioSampleModel:Model organism or animal									KHSRP iCLIP iCLIP Khsrp Ab B3	AG01178.1	AG01178.1	RNA			OTHER	TRANSCRIPTOMIC	unspecified	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP149368		AG01178.1_R1.fastq.gz	fastq	1429865561.0	47958542.0	AG01178.1 R1.fastq.gz	0:29.81 1:0	A:416462367;C:233529708;G:285810572;T:494062288;N:626	29	0	416462367	233529708	285810572	494062288	626	SRX4142912	SRS3356702	SRA712863	Yale_Giraldez\|Genetics	Yale_Giraldez_Group	1	0.67776		0.47933		0.782		0.52337		31		B		usable mapping rate	illumina	hiseq_era	unknown	small_rna	unknown	bulk	clip	iclip	United States	2018-05-30	Blastula	Embryo	Embryo Imprecise	All anatomical structures
48390	48390	SRR7236661	SRX4142911	SRS3356701	SRP149368	PRJNA473836	mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis: KHSRP iCLIP	PRJNA473836	Other	RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. This is the endogenous KHSRP iCLIP part of the study.			Raw multiplex: KHSRP iCLIP iCLIP Khsrp Ab B1;KHSRP iCLIP iCLIP Khsrp noAb B1	Raw multiplex: KHSRP iCLIP iC Khsrp Ab B1 AG01173;KHSRP iCLIP iC Khsrp noAb B1 AG01174	strain:TU/AB\|age:4.0\|dev stage:sphere\|sex:pooled male and female\|tissue:embryo\|treatment:iCLIP\|molecule:RNA\|selection:KHSRP antibody;\|replicate group:1;2\|replicate:1\|barcode:CACA;AGAG\|BioSampleModel:Model organism or animal									Raw multiplex: KHSRP iCLIP iCLIP Khsrp Ab B1;KHSRP iCLIP iCLIP Khsrp noAb B1	AG01173.2;AG01174.2	AG01173.2;AG01174.2	RNA			OTHER	TRANSCRIPTOMIC	unspecified	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP149368		HHMMTADXX_kh1_020_R1.fastq.gz	fastq	5281915868.0	69498893.0	HHMMTADXX kh1 020 R1.fastq.gz	0:76	A:1639173476;C:1196546385;G:1285461861;T:1160482436;N:251710	76		1639173476	1196546385	1285461861	1160482436	251710	SRX4142911	SRS3356701	SRA712863	Yale_Giraldez\|Genetics	Yale_Giraldez_Group	1	0.00021		0.00011		0.99973		0.64705		76		T		under 1.2% mapping rate	illumina	hiseq_era	unknown	small_rna	unknown	bulk	clip	iclip	United States	2018-06-07	Blastula	Embryo	Embryo Imprecise	All anatomical structures
48391	48391	SRR7236662	SRX4142910	SRS3356701	SRP149368	PRJNA473836	mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis: KHSRP iCLIP	PRJNA473836	Other	RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. This is the endogenous KHSRP iCLIP part of the study.			Raw multiplex: KHSRP iCLIP iCLIP Khsrp Ab B1;KHSRP iCLIP iCLIP Khsrp noAb B1	Raw multiplex: KHSRP iCLIP iC Khsrp Ab B1 AG01173;KHSRP iCLIP iC Khsrp noAb B1 AG01174	strain:TU/AB\|age:4.0\|dev stage:sphere\|sex:pooled male and female\|tissue:embryo\|treatment:iCLIP\|molecule:RNA\|selection:KHSRP antibody;\|replicate group:1;2\|replicate:1\|barcode:CACA;AGAG\|BioSampleModel:Model organism or animal									Raw multiplex: KHSRP iCLIP iCLIP Khsrp Ab B1;KHSRP iCLIP iCLIP Khsrp noAb B1	AG01173.1;AG01174.1	AG01173.1;AG01174.1	RNA			OTHER	TRANSCRIPTOMIC	unspecified	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP149368		HHLY2ADXX_kh1_NOBCX_R1.fastq.gz	fastq	9991920032.0	131472632.0	HHLY2ADXX kh1 NOBCX R1.fastq.gz	0:76	A:3100849614;C:2254998457;G:2420727161;T:2205131206;N:10213594	76		3100849614	2254998457	2420727161	2205131206	10213594	SRX4142910	SRS3356701	SRA712863	Yale_Giraldez\|Genetics	Yale_Giraldez_Group	1	0.00019		0.0001		0.99975		0.46666		76		T		under 1.2% mapping rate	illumina	hiseq_era	unknown	small_rna	unknown	bulk	clip	iclip	United States	2018-05-31	Blastula	Embryo	Embryo Imprecise	All anatomical structures
48392	48392	SRR7236663	SRX4142909	SRS3356700	SRP149368	PRJNA473836	mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis: KHSRP iCLIP	PRJNA473836	Other	RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. This is the endogenous KHSRP iCLIP part of the study.			KHSRP iCLIP iCLIP Khsrp noAb B3	KHSRP iCLIP iC Khsrp noAb B3 AG01177	strain:TU/AB\|age:4.0\|dev stage:sphere\|sex:pooled male and female\|tissue:embryo\|treatment:iCLIP\|molecule:RNA\|replicate group:2\|replicate:3\|barcode:CACA\|BioSampleModel:Model organism or animal									KHSRP iCLIP iCLIP Khsrp noAb B3	AG01177.2	AG01177.2	RNA			OTHER	TRANSCRIPTOMIC	unspecified	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP149368		AG01177.2_R1.fastq.gz	fastq	885888031.0	33497952.0	AG01177.2 R1.fastq.gz	0:26.45 1:0	A:206425913;C:174763971;G:243957147;T:260737810;N:3190	26	0	206425913	174763971	243957147	260737810	3190	SRX4142909	SRS3356700	SRA712863	Yale_Giraldez\|Genetics	Yale_Giraldez_Group	1	0.06832		0.02459		0.98098		0.60923		28		B		usable mapping rate	illumina	hiseq_era	unknown	small_rna	unknown	bulk	clip	iclip	United States	2018-05-30	Blastula	Embryo	Embryo Imprecise	All anatomical structures
48393	48393	SRR7236664	SRX4142908	SRS3356700	SRP149368	PRJNA473836	mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis: KHSRP iCLIP	PRJNA473836	Other	RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. This is the endogenous KHSRP iCLIP part of the study.			KHSRP iCLIP iCLIP Khsrp noAb B3	KHSRP iCLIP iC Khsrp noAb B3 AG01177	strain:TU/AB\|age:4.0\|dev stage:sphere\|sex:pooled male and female\|tissue:embryo\|treatment:iCLIP\|molecule:RNA\|replicate group:2\|replicate:3\|barcode:CACA\|BioSampleModel:Model organism or animal									KHSRP iCLIP iCLIP Khsrp noAb B3	AG01177.1	AG01177.1	RNA			OTHER	TRANSCRIPTOMIC	unspecified	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP149368		AG01177.1_R1.fastq.gz	fastq	1222226291.0	46319107.0	AG01177.1 R1.fastq.gz	0:26.39 1:0	A:284330952;C:241163311;G:337366164;T:359365256;N:608	26	0	284330952	241163311	337366164	359365256	608	SRX4142908	SRS3356700	SRA712863	Yale_Giraldez\|Genetics	Yale_Giraldez_Group	1	0.06321		0.02496		0.99541		0.59566		24		B		usable mapping rate	illumina	hiseq_era	unknown	small_rna	unknown	bulk	clip	iclip	United States	2018-06-07	Blastula	Embryo	Embryo Imprecise	All anatomical structures
48394	48394	SRR7236665	SRX4142907	SRS3356699	SRP149368	PRJNA473836	mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis: KHSRP iCLIP	PRJNA473836	Other	RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. This is the endogenous KHSRP iCLIP part of the study.			KHSRP iCLIP iCLIP Khsrp noAb B2	KHSRP iCLIP iC Khsrp noAb B2 AG01176	strain:TU/AB\|age:4.0\|dev stage:sphere\|sex:pooled male and female\|tissue:embryo\|treatment:iCLIP\|molecule:RNA\|replicate group:2\|replicate:2\|barcode:GTGT\|BioSampleModel:Model organism or animal									KHSRP iCLIP iCLIP Khsrp noAb B2	AG01176.2	AG01176.2	RNA			OTHER	TRANSCRIPTOMIC	unspecified	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP149368		AG01176.2_R1.fastq.gz	fastq	233885454.0	7281208.0	AG01176.2 R1.fastq.gz	0:32.12 1:0	A:54788902;C:54168846;G:66577250;T:58350443;N:13	32	0	54788902	54168846	66577250	58350443	13	SRX4142907	SRS3356699	SRA712863	Yale_Giraldez\|Genetics	Yale_Giraldez_Group	1	0.10795		0.04438		0.97516		0.69327		38		B		usable mapping rate	illumina	hiseq_era	unknown	small_rna	unknown	bulk	clip	iclip	United States	2018-06-07	Blastula	Embryo	Embryo Imprecise	All anatomical structures
48395	48395	SRR7236666	SRX4142906	SRS3356699	SRP149368	PRJNA473836	mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis: KHSRP iCLIP	PRJNA473836	Other	RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. This is the endogenous KHSRP iCLIP part of the study.			KHSRP iCLIP iCLIP Khsrp noAb B2	KHSRP iCLIP iC Khsrp noAb B2 AG01176	strain:TU/AB\|age:4.0\|dev stage:sphere\|sex:pooled male and female\|tissue:embryo\|treatment:iCLIP\|molecule:RNA\|replicate group:2\|replicate:2\|barcode:GTGT\|BioSampleModel:Model organism or animal									KHSRP iCLIP iCLIP Khsrp noAb B2	AG01176.1	AG01176.1	RNA			OTHER	TRANSCRIPTOMIC	unspecified	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP149368		AG01176.1_R1.fastq.gz	fastq	311212095.0	9672607.0	AG01176.1 R1.fastq.gz	0:32.17 1:0	A:73018762;C:72027124;G:88456228;T:77709256;N:725	32	0	73018762	72027124	88456228	77709256	725	SRX4142906	SRS3356699	SRA712863	Yale_Giraldez\|Genetics	Yale_Giraldez_Group	1	0.10719		0.04462		0.97498		0.70725		37		B		usable mapping rate	illumina	hiseq_era	unknown	small_rna	unknown	bulk	clip	iclip	United States	2018-05-30	Blastula	Embryo	Embryo Imprecise	All anatomical structures
48396	48396	SRR7236667	SRX4142905	SRS3356698	SRP149368	PRJNA473836	mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis: KHSRP iCLIP	PRJNA473836	Other	RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. This is the endogenous KHSRP iCLIP part of the study.			KHSRP iCLIP iCLIP Khsrp Ab B2	KHSRP iCLIP iC Khsrp Ab B2 AG01175	strain:TU/AB\|age:4.0\|dev stage:sphere\|sex:pooled male and female\|tissue:embryo\|treatment:iCLIP\|molecule:RNA\|selection:KHSRP antibody\|replicate group:1\|replicate:2\|barcode:TCTC\|BioSampleModel:Model organism or animal									KHSRP iCLIP iCLIP Khsrp Ab B2	AG01175.2	AG01175.2	RNA			OTHER	TRANSCRIPTOMIC	unspecified	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP149368		AG01175.2_R1.fastq.gz	fastq	2466162835.0	77779195.0	AG01175.2 R1.fastq.gz	0:31.71 1:0	A:716944933;C:413092452;G:514707831;T:821417411;N:208	31	0	716944933	413092452	514707831	821417411	208	SRX4142905	SRS3356698	SRA712863	Yale_Giraldez\|Genetics	Yale_Giraldez_Group	1	0.64577		0.4225		0.77516		0.52286		23		B		usable mapping rate	illumina	hiseq_era	unknown	small_rna	unknown	bulk	clip	iclip	United States	2018-06-07	Blastula	Embryo	Embryo Imprecise	All anatomical structures
48397	48397	SRR7236668	SRX4142904	SRS3356698	SRP149368	PRJNA473836	mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis: KHSRP iCLIP	PRJNA473836	Other	RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. This is the endogenous KHSRP iCLIP part of the study.			KHSRP iCLIP iCLIP Khsrp Ab B2	KHSRP iCLIP iC Khsrp Ab B2 AG01175	strain:TU/AB\|age:4.0\|dev stage:sphere\|sex:pooled male and female\|tissue:embryo\|treatment:iCLIP\|molecule:RNA\|selection:KHSRP antibody\|replicate group:1\|replicate:2\|barcode:TCTC\|BioSampleModel:Model organism or animal									KHSRP iCLIP iCLIP Khsrp Ab B2	AG01175.1	AG01175.1	RNA			OTHER	TRANSCRIPTOMIC	unspecified	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP149368		AG01175.1_R1.fastq.gz	fastq	3316001149.0	104496257.0	AG01175.1 R1.fastq.gz	0:31.73 1:0	A:964563720;C:554605513;G:690144862;T:1106678088;N:8966	31	0	964563720	554605513	690144862	1106678088	8966	SRX4142904	SRS3356698	SRA712863	Yale_Giraldez\|Genetics	Yale_Giraldez_Group	1	0.64794		0.42598		0.77719		0.53602		31		B		usable mapping rate	illumina	hiseq_era	unknown	small_rna	unknown	bulk	clip	iclip	United States	2018-05-31	Blastula	Embryo	Embryo Imprecise	All anatomical structures
48398	48398	SRR7236669	SRX4142903	SRS3356697	SRP149368	PRJNA473836	mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis: KHSRP iCLIP	PRJNA473836	Other	RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. This is the endogenous KHSRP iCLIP part of the study.			KHSRP iCLIP iCLIP Khsrp noAb B1	KHSRP iCLIP iC Khsrp noAb B1 AG01174	strain:TU/AB\|age:4.0\|dev stage:sphere\|sex:pooled male and female\|tissue:embryo\|treatment:iCLIP\|molecule:RNA\|replicate group:2\|replicate:1\|barcode:AGAG\|BioSampleModel:Model organism or animal									KHSRP iCLIP iCLIP Khsrp noAb B1	AG01174.2	AG01174.2	RNA			OTHER	TRANSCRIPTOMIC	unspecified	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP149368		AG01174.2_R1.fastq.gz	fastq	997707611.0	35501164.0	AG01174.2 R1.fastq.gz	0:28.10 1:0	A:234873124;C:200942687;G:273279747;T:288611385;N:668	28	0	234873124	200942687	273279747	288611385	668	SRX4142903	SRS3356697	SRA712863	Yale_Giraldez\|Genetics	Yale_Giraldez_Group	1	0.05803		0.02195		0.99632		0.62645		26		B		usable mapping rate	illumina	hiseq_era	unknown	small_rna	unknown	bulk	clip	iclip	United States	2018-06-07	Blastula	Embryo	Embryo Imprecise	All anatomical structures
48399	48399	SRR7236670	SRX4142902	SRS3356697	SRP149368	PRJNA473836	mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis: KHSRP iCLIP	PRJNA473836	Other	RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. This is the endogenous KHSRP iCLIP part of the study.			KHSRP iCLIP iCLIP Khsrp noAb B1	KHSRP iCLIP iC Khsrp noAb B1 AG01174	strain:TU/AB\|age:4.0\|dev stage:sphere\|sex:pooled male and female\|tissue:embryo\|treatment:iCLIP\|molecule:RNA\|replicate group:2\|replicate:1\|barcode:AGAG\|BioSampleModel:Model organism or animal									KHSRP iCLIP iCLIP Khsrp noAb B1	AG01174.1	AG01174.1	RNA			OTHER	TRANSCRIPTOMIC	unspecified	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP149368		AG01174.1_R1.fastq.gz	fastq	1864739454.0	66313666.0	AG01174.1 R1.fastq.gz	0:28.12 1:0	A:439206469;C:375517297;G:509810941;T:540192256;N:12491	28	0	439206469	375517297	509810941	540192256	12491	SRX4142902	SRS3356697	SRA712863	Yale_Giraldez\|Genetics	Yale_Giraldez_Group	1	0.0573		0.02132		0.99618		0.52433		34		B		usable mapping rate	illumina	hiseq_era	unknown	small_rna	unknown	bulk	clip	iclip	United States	2018-06-07	Blastula	Embryo	Embryo Imprecise	All anatomical structures
48400	48400	SRR7236671	SRX4142901	SRS3356696	SRP149368	PRJNA473836	mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis: KHSRP iCLIP	PRJNA473836	Other	RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. This is the endogenous KHSRP iCLIP part of the study.			KHSRP iCLIP iCLIP Khsrp Ab B1	KHSRP iCLIP iC Khsrp Ab B1 AG01173	strain:TU/AB\|age:4.0\|dev stage:sphere\|sex:pooled male and female\|tissue:embryo\|treatment:iCLIP\|molecule:RNA\|selection:KHSRP antibody\|replicate group:1\|replicate:1\|barcode:CACA\|BioSampleModel:Model organism or animal									KHSRP iCLIP iCLIP Khsrp Ab B1	AG01173.2	AG01173.2	RNA			OTHER	TRANSCRIPTOMIC	unspecified	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP149368		AG01173.2_R1.fastq.gz	fastq	867830730.0	28259963.0	AG01173.2 R1.fastq.gz	0:30.71 1:0	A:248512374;C:137460842;G:175204067;T:306652878;N:569	30	0	248512374	137460842	175204067	306652878	569	SRX4142901	SRS3356696	SRA712863	Yale_Giraldez\|Genetics	Yale_Giraldez_Group	1	0.67622		0.4515		0.76765		0.52978		31		B		usable mapping rate	illumina	hiseq_era	unknown	small_rna	unknown	bulk	clip	iclip	United States	2018-06-07	Blastula	Embryo	Embryo Imprecise	All anatomical structures
48401	48401	SRR7236672	SRX4142900	SRS3356696	SRP149368	PRJNA473836	mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis: KHSRP iCLIP	PRJNA473836	Other	RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. This is the endogenous KHSRP iCLIP part of the study.			KHSRP iCLIP iCLIP Khsrp Ab B1	KHSRP iCLIP iC Khsrp Ab B1 AG01173	strain:TU/AB\|age:4.0\|dev stage:sphere\|sex:pooled male and female\|tissue:embryo\|treatment:iCLIP\|molecule:RNA\|selection:KHSRP antibody\|replicate group:1\|replicate:1\|barcode:CACA\|BioSampleModel:Model organism or animal									KHSRP iCLIP iCLIP Khsrp Ab B1	AG01173.1	AG01173.1	RNA			OTHER	TRANSCRIPTOMIC	unspecified	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP149368		AG01173.1_R1.fastq.gz	fastq	1644979798.0	53548650.0	AG01173.1 R1.fastq.gz	0:30.72 1:0	A:471457103;C:259804358;G:331035207;T:582672297;N:10833	30	0	471457103	259804358	331035207	582672297	10833	SRX4142900	SRS3356696	SRA712863	Yale_Giraldez\|Genetics	Yale_Giraldez_Group	1	0.67964		0.45484		0.77147		0.52736		27		B		usable mapping rate	illumina	hiseq_era	unknown	small_rna	unknown	bulk	clip	iclip	United States	2018-05-30	Blastula	Embryo	Embryo Imprecise	All anatomical structures
49537	49537	SRR8937007	SRX5717520	SRS4655940	SRP162876	PRJNA493828	Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo sample.	GSE120646	Other	The maternal to zygotic transition MZT is a conserved and fundamental process during which the embryo undergoes dramatic reprogramming to convert maternal environment to embryonic driven programing. However how the maternally supplied transcripts are dynamically regulated during MZT remains largely unknown. Herein through genome wide profiling of RNA 5 methylcytosine m5C in zebrafish early embryos we show that m5C methylated maternal mRNAs display higher stability during MZT. We identify that the Y box binding protein 1 Ybx1 prefers to recognizing m5C modified mRNAs through p p interaction with a key residue Trp45 in its cold shock domain CSD which plays essential roles in maternal mRNA stability and early embryogenesis of zebrafish. Cooperated with an mRNA stabilizer Pabpc1a Ybx1 promotes the stability of its target mRNAs in an m5C dependent manner. Our study demonstrates a novel mechanism of RNA m5C methylation regulated maternal mRNA stability during zebrafish MZT highlighting the critical role of m5C mRNA methylation in early development. Overall design: Examination of Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo. RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/Î¼l RNasin by rotating at 4Â°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4Â°C for 1 h. 50 Î¼l pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 Î¼l Protein A Dynabeads for 4 h at 4Â°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/Âµl RNasin for eight times and once with 1ml ice cold 1Ã— PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated i…	parent bioproject:PRJNA534030		RIP BS 3hpf	GSM3732427	source name:Zebrafish embryo\|strain:AB strain\|age:3 hpf\|tissue:whole embryo\|rip antibody:polyclonal anti Ybx1 antibody	RIP BS 3hpf	library strategy: RNA RIP BisSeq Reads were aligned to the zv9 genome assembly using meRanTK v1.2.0 m5C sites were called by meRanCall v1.2.0 and annotated by applying BEDTools’ intersectBed. MACS2 v2.1.1 were used for the peak calling and peaks were annotated by applying BEDTools’ intersectBed. Genome build: zv9 Supplementary files format and content: Ybx1 binding m5C sites in one biological replicates.	Zebrafish embryo		Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol® Reagent Ambion. mRNA was extracted with using Dynabeads® mRNA Purification Kit Ambion and subjected to TURBO™ DNase Invitrogen treatment at 37°C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. Thus purified mRNA was used for RNA BisSeq library construction. Around 200 ng mRNA premixed with the in vitro transcribed Dhfr mRNA at a ratio of 300:1 Dhfr mRNA serves as methylation conversion control was fragmented to 100 nt fragments for 1 min at 90°C in 10× RNA Fragmentation Reagent Ambion then stopped by 10× RNA stop solution Ambion and precipitated with 100% ethanol. The RNA pellet was resuspended in 100 µl bisulfite solution pH 5.1 which is a 100:1 mixture of 40% sodium bisulfite Sigma and 600 µM hydroquinone Sigma and subjected to heat incubation at 75°C for 4.5 h. The reaction mixture was desalted by passing through Nanosep with 3K Omega 500/pk columns PALL Corporation with centrifugation. post washed with nuclease free water and centrifuged for five times the RNA was finally disolved in 75 μl nuclease free water and then desulfonated by incubation with an equal volume of 1 M Tris HCl pH 9.0 at 75 °C for 1 h. post ethanol precipitation the RNA was resuspended in 11 µl of RNase free water and subjected to library construction. Reverse transcription was carried out with superscript II Reverse Transcriptase Invitrogen and ACT random hexamers. The following procedures were performed with the KAPA Stranded mRNA Seq Kit KAPA according to the manufacturer’s instructions.Libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 125 bp.		strain:AB strain\|age:3 hpf\|tissue:whole embryo\|rip antibody:polyclonal anti Ybx1 antibody	GSM3732427	GSM3732427: RIP BS 3hpf; Danio rerio; OTHER	GSM3732427		1	Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol® Reagent Ambion. mRNA was extracted with using Dynabeads® mRNA Purification Kit Ambion and subjected to TURBO™ DNase Invitrogen treatment at 37°C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. Thus purified mRNA was used for RNA BisSeq library construction. Around 200 ng mRNA premixed with the in vitro transcribed Dhfr mRNA at a ratio of 300:1 Dhfr mRNA serves as methylation conversion control was fragmented to 100 nt fragments for 1 min at 90°C in 10× RNA Fragmentation Reagent Ambion then stopped by 10× RNA stop solution Ambion and precipitated with 100% ethanol. The RNA pellet was resuspended in 100 µl bisulfite solution pH 5.1 which is a 100:1 mixture of 40% sodium bisulfite Sigma and 600 µM hydroquinone Sigma and subjected to heat incubation at 75°C for 4.5 h. The reaction mixture was desalted by passing through Nanosep with 3K Omega 500/pk columns PALL Corporation with centrifugation. post washed with nuclease free water and centrifuged for five times the RNA was finally disolved in 75 μl nuclease free water and then desulfonated by incubation with an equal volume of 1 M Tris HCl pH 9.0 at 75 °C for 1 h. post ethanol precipitation the RNA was resuspended in 11 µl of RNase free water and subjected to library construction. Reverse transcription was carried out with superscript II Reverse Transcriptase Invitrogen and ACT random hexamers. The following procedures were performed with the KAPA Stranded mRNA Seq Kit KAPA according to the manufacturer's instructions.Libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 125 bp.	GEO Accession:GSM3732427	OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP162876		RIP-BS_3hpf_R1.fastq.gz RIP-BS_3hpf_R2.fastq.gz	fastq fastq	46222984200.0	154076614.0	GSM3732427 r1	0:150 1:150	A:13069130635;C:10120441406;G:10858372086;T:12169793951;N:5246122	150	150	13069130635	10120441406	10858372086	12169793951	5246122	SRX5717520	SRS4655940	SRA786939	GEO	Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS)	2	0.0063	0.00488	0.00135	0.00112	0.99736	0.99801	0.66703	0.76167	150	150	T	T	mates < 9% mapping rate	illumina	hiseq_era	full_length	random_priming	smarter	bulk	clip	iclip	China	2019-04-22	Blastula	Embryo	Whole Organism	All anatomical structures
49538	49538	SRR8937006	SRX5717519	SRS4655939	SRP162876	PRJNA493828	Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo sample.	GSE120646	Other	The maternal to zygotic transition MZT is a conserved and fundamental process during which the embryo undergoes dramatic reprogramming to convert maternal environment to embryonic driven programing. However how the maternally supplied transcripts are dynamically regulated during MZT remains largely unknown. Herein through genome wide profiling of RNA 5 methylcytosine m5C in zebrafish early embryos we show that m5C methylated maternal mRNAs display higher stability during MZT. We identify that the Y box binding protein 1 Ybx1 prefers to recognizing m5C modified mRNAs through p p interaction with a key residue Trp45 in its cold shock domain CSD which plays essential roles in maternal mRNA stability and early embryogenesis of zebrafish. Cooperated with an mRNA stabilizer Pabpc1a Ybx1 promotes the stability of its target mRNAs in an m5C dependent manner. Our study demonstrates a novel mechanism of RNA m5C methylation regulated maternal mRNA stability during zebrafish MZT highlighting the critical role of m5C mRNA methylation in early development. Overall design: Examination of Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo. RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/Î¼l RNasin by rotating at 4Â°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4Â°C for 1 h. 50 Î¼l pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 Î¼l Protein A Dynabeads for 4 h at 4Â°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/Âµl RNasin for eight times and once with 1ml ice cold 1Ã— PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated i…	parent bioproject:PRJNA534030		RIP BS 0hpf	GSM3732426	source name:Zebrafish embryo\|strain:AB strain\|age:0 hpf\|tissue:whole embryo\|rip antibody:polyclonal anti Ybx1 antibody	RIP BS 0hpf	library strategy: RNA RIP BisSeq Reads were aligned to the zv9 genome assembly using meRanTK v1.2.0 m5C sites were called by meRanCall v1.2.0 and annotated by applying BEDTools’ intersectBed. MACS2 v2.1.1 were used for the peak calling and peaks were annotated by applying BEDTools’ intersectBed. Genome build: zv9 Supplementary files format and content: Ybx1 binding m5C sites in one biological replicates.	Zebrafish embryo		Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol® Reagent Ambion. mRNA was extracted with using Dynabeads® mRNA Purification Kit Ambion and subjected to TURBO™ DNase Invitrogen treatment at 37°C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. Thus purified mRNA was used for RNA BisSeq library construction. Around 200 ng mRNA premixed with the in vitro transcribed Dhfr mRNA at a ratio of 300:1 Dhfr mRNA serves as methylation conversion control was fragmented to 100 nt fragments for 1 min at 90°C in 10× RNA Fragmentation Reagent Ambion then stopped by 10× RNA stop solution Ambion and precipitated with 100% ethanol. The RNA pellet was resuspended in 100 µl bisulfite solution pH 5.1 which is a 100:1 mixture of 40% sodium bisulfite Sigma and 600 µM hydroquinone Sigma and subjected to heat incubation at 75°C for 4.5 h. The reaction mixture was desalted by passing through Nanosep with 3K Omega 500/pk columns PALL Corporation with centrifugation. post washed with nuclease free water and centrifuged for five times the RNA was finally disolved in 75 μl nuclease free water and then desulfonated by incubation with an equal volume of 1 M Tris HCl pH 9.0 at 75 °C for 1 h. post ethanol precipitation the RNA was resuspended in 11 µl of RNase free water and subjected to library construction. Reverse transcription was carried out with superscript II Reverse Transcriptase Invitrogen and ACT random hexamers. The following procedures were performed with the KAPA Stranded mRNA Seq Kit KAPA according to the manufacturer’s instructions.Libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 125 bp.		strain:AB strain\|age:0 hpf\|tissue:whole embryo\|rip antibody:polyclonal anti Ybx1 antibody	GSM3732426	GSM3732426: RIP BS 0hpf; Danio rerio; OTHER	GSM3732426		1	Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol® Reagent Ambion. mRNA was extracted with using Dynabeads® mRNA Purification Kit Ambion and subjected to TURBO™ DNase Invitrogen treatment at 37°C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. Thus purified mRNA was used for RNA BisSeq library construction. Around 200 ng mRNA premixed with the in vitro transcribed Dhfr mRNA at a ratio of 300:1 Dhfr mRNA serves as methylation conversion control was fragmented to 100 nt fragments for 1 min at 90°C in 10× RNA Fragmentation Reagent Ambion then stopped by 10× RNA stop solution Ambion and precipitated with 100% ethanol. The RNA pellet was resuspended in 100 µl bisulfite solution pH 5.1 which is a 100:1 mixture of 40% sodium bisulfite Sigma and 600 µM hydroquinone Sigma and subjected to heat incubation at 75°C for 4.5 h. The reaction mixture was desalted by passing through Nanosep with 3K Omega 500/pk columns PALL Corporation with centrifugation. post washed with nuclease free water and centrifuged for five times the RNA was finally disolved in 75 μl nuclease free water and then desulfonated by incubation with an equal volume of 1 M Tris HCl pH 9.0 at 75 °C for 1 h. post ethanol precipitation the RNA was resuspended in 11 µl of RNase free water and subjected to library construction. Reverse transcription was carried out with superscript II Reverse Transcriptase Invitrogen and ACT random hexamers. The following procedures were performed with the KAPA Stranded mRNA Seq Kit KAPA according to the manufacturer's instructions.Libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 125 bp.	GEO Accession:GSM3732426	OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP162876		RIP-BS_0hpf_R1.fastq.gz RIP-BS_0hpf_R2.fastq.gz	fastq fastq	41224496700.0	137414989.0	GSM3732426 r1	0:150 1:150	A:11515809359;C:9072060634;G:9856717145;T:10775122637;N:4786925	150	150	11515809359	9072060634	9856717145	10775122637	4786925	SRX5717519	SRS4655939	SRA786939	GEO	Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS)	2	0.00575	0.00421	0.00122	0.00083	0.99738	0.99801	0.70652	0.78053	150	150	T	T	mates < 9% mapping rate	illumina	hiseq_era	full_length	random_priming	smarter	bulk	clip	iclip	China	2019-04-22	Zygote	Embryo	Whole Organism	All anatomical structures
49539	49539	SRR8937005	SRX5717518	SRS4655938	SRP162876	PRJNA493828	Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo sample.	GSE120646	Other	The maternal to zygotic transition MZT is a conserved and fundamental process during which the embryo undergoes dramatic reprogramming to convert maternal environment to embryonic driven programing. However how the maternally supplied transcripts are dynamically regulated during MZT remains largely unknown. Herein through genome wide profiling of RNA 5 methylcytosine m5C in zebrafish early embryos we show that m5C methylated maternal mRNAs display higher stability during MZT. We identify that the Y box binding protein 1 Ybx1 prefers to recognizing m5C modified mRNAs through p p interaction with a key residue Trp45 in its cold shock domain CSD which plays essential roles in maternal mRNA stability and early embryogenesis of zebrafish. Cooperated with an mRNA stabilizer Pabpc1a Ybx1 promotes the stability of its target mRNAs in an m5C dependent manner. Our study demonstrates a novel mechanism of RNA m5C methylation regulated maternal mRNA stability during zebrafish MZT highlighting the critical role of m5C mRNA methylation in early development. Overall design: Examination of Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo. RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/Î¼l RNasin by rotating at 4Â°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4Â°C for 1 h. 50 Î¼l pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 Î¼l Protein A Dynabeads for 4 h at 4Â°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/Âµl RNasin for eight times and once with 1ml ice cold 1Ã— PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated i…	parent bioproject:PRJNA534030		RIP INPUT 2hpf rep2	GSM3732425	source name:RIP INPUT 2hpf\|strain:AB strain\|age:2 hpf\|tissue:whole embryo	RIP INPUT 2hpf rep2	Reads were aligned to the zv9 genome assembly using TopHat v2.1.1. MACS2 v2.1.1 were used for the peak calling and peaks were annotated by applying BEDTools’ intersectBed. Genome build: zv9 Supplementary files format and content: Ybx1 binding sites in two biological replicates.	RIP INPUT 2hpf		Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol® Reagent Ambion. mRNA was extracted with using Dynabeads® mRNA Purification Kit Ambion and subjected to TURBO™ DNase Invitrogen treatment at 37°C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp.		strain:AB strain\|age:2 hpf\|tissue:whole embryo	GSM3732425	GSM3732425: RIP INPUT 2hpf rep2; Danio rerio; RIP Seq	GSM3732425		1	Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol® Reagent Ambion. mRNA was extracted with using Dynabeads® mRNA Purification Kit Ambion and subjected to TURBO™ DNase Invitrogen treatment at 37°C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp.	GEO Accession:GSM3732425	RIP-Seq	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP162876		RIP-INPUT_2hpf_rep2_R1.fastq.gz RIP-INPUT_2hpf_rep2_R2.fastq.gz	fastq fastq	16388119500.0	54627065.0	GSM3732425 r1	0:150 1:150	A:3232127065;C:4976385987;G:5052844082;T:3122288663;N:4473703	150	150	3232127065	4976385987	5052844082	3122288663	4473703	SRX5717518	SRS4655938	SRA786939	GEO	Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS)	2	0.98209	0.9812	0.33332	0.33565	0.93811	0.94186	0.95153	0.95984	150	150	B	B	biological fallback assumption	illumina	hiseq_era	full_length	random_priming	smarter	bulk	clip	iclip	China	2019-04-22	Cleavage	Embryo	Whole Organism	All anatomical structures
49540	49540	SRR8937004	SRX5717517	SRS4655937	SRP162876	PRJNA493828	Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo sample.	GSE120646	Other	The maternal to zygotic transition MZT is a conserved and fundamental process during which the embryo undergoes dramatic reprogramming to convert maternal environment to embryonic driven programing. However how the maternally supplied transcripts are dynamically regulated during MZT remains largely unknown. Herein through genome wide profiling of RNA 5 methylcytosine m5C in zebrafish early embryos we show that m5C methylated maternal mRNAs display higher stability during MZT. We identify that the Y box binding protein 1 Ybx1 prefers to recognizing m5C modified mRNAs through p p interaction with a key residue Trp45 in its cold shock domain CSD which plays essential roles in maternal mRNA stability and early embryogenesis of zebrafish. Cooperated with an mRNA stabilizer Pabpc1a Ybx1 promotes the stability of its target mRNAs in an m5C dependent manner. Our study demonstrates a novel mechanism of RNA m5C methylation regulated maternal mRNA stability during zebrafish MZT highlighting the critical role of m5C mRNA methylation in early development. Overall design: Examination of Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo. RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/Î¼l RNasin by rotating at 4Â°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4Â°C for 1 h. 50 Î¼l pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 Î¼l Protein A Dynabeads for 4 h at 4Â°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/Âµl RNasin for eight times and once with 1ml ice cold 1Ã— PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated i…	parent bioproject:PRJNA534030		RIP INPUT 2hpf rep1	GSM3732424	source name:RIP INPUT 2hpf\|strain:AB strain\|age:2 hpf\|tissue:whole embryo	RIP INPUT 2hpf rep1	Reads were aligned to the zv9 genome assembly using TopHat v2.1.1. MACS2 v2.1.1 were used for the peak calling and peaks were annotated by applying BEDTools’ intersectBed. Genome build: zv9 Supplementary files format and content: Ybx1 binding sites in two biological replicates.	RIP INPUT 2hpf		Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol® Reagent Ambion. mRNA was extracted with using Dynabeads® mRNA Purification Kit Ambion and subjected to TURBO™ DNase Invitrogen treatment at 37°C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp.		strain:AB strain\|age:2 hpf\|tissue:whole embryo	GSM3732424	GSM3732424: RIP INPUT 2hpf rep1; Danio rerio; RIP Seq	GSM3732424		1	Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol® Reagent Ambion. mRNA was extracted with using Dynabeads® mRNA Purification Kit Ambion and subjected to TURBO™ DNase Invitrogen treatment at 37°C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp.	GEO Accession:GSM3732424	RIP-Seq	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP162876		RIP-INPUT_2hpf_rep1_R1.fastq.gz RIP-INPUT_2hpf_rep1_R2.fastq.gz	fastq fastq	18857336400.0	62857788.0	GSM3732424 r1	0:150 1:150	A:3116761123;C:6239715125;G:6450542871;T:3049605751;N:711530	150	150	3116761123	6239715125	6450542871	3049605751	711530	SRX5717517	SRS4655937	SRA786939	GEO	Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS)	2	0.97874	0.96891	0.03494	0.03355	0.92693	0.93456	0.9502	0.94986	150	150	B	B	biological fallback assumption	illumina	hiseq_era	full_length	random_priming	smarter	bulk	clip	iclip	China	2019-04-22	Cleavage	Embryo	Whole Organism	All anatomical structures
49541	49541	SRR8937003	SRX5717516	SRS4655936	SRP162876	PRJNA493828	Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo sample.	GSE120646	Other	The maternal to zygotic transition MZT is a conserved and fundamental process during which the embryo undergoes dramatic reprogramming to convert maternal environment to embryonic driven programing. However how the maternally supplied transcripts are dynamically regulated during MZT remains largely unknown. Herein through genome wide profiling of RNA 5 methylcytosine m5C in zebrafish early embryos we show that m5C methylated maternal mRNAs display higher stability during MZT. We identify that the Y box binding protein 1 Ybx1 prefers to recognizing m5C modified mRNAs through p p interaction with a key residue Trp45 in its cold shock domain CSD which plays essential roles in maternal mRNA stability and early embryogenesis of zebrafish. Cooperated with an mRNA stabilizer Pabpc1a Ybx1 promotes the stability of its target mRNAs in an m5C dependent manner. Our study demonstrates a novel mechanism of RNA m5C methylation regulated maternal mRNA stability during zebrafish MZT highlighting the critical role of m5C mRNA methylation in early development. Overall design: Examination of Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo. RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/Î¼l RNasin by rotating at 4Â°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4Â°C for 1 h. 50 Î¼l pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 Î¼l Protein A Dynabeads for 4 h at 4Â°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/Âµl RNasin for eight times and once with 1ml ice cold 1Ã— PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated i…	parent bioproject:PRJNA534030		RIP INPUT 0hpf rep2	GSM3732423	source name:RIP INPUT 0hpf\|strain:AB strain\|age:0 hpf\|tissue:whole embryo	RIP INPUT 0hpf rep2	Reads were aligned to the zv9 genome assembly using TopHat v2.1.1. MACS2 v2.1.1 were used for the peak calling and peaks were annotated by applying BEDTools’ intersectBed. Genome build: zv9 Supplementary files format and content: Ybx1 binding sites in two biological replicates.	RIP INPUT 0hpf		Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol® Reagent Ambion. mRNA was extracted with using Dynabeads® mRNA Purification Kit Ambion and subjected to TURBO™ DNase Invitrogen treatment at 37°C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp.		strain:AB strain\|age:0 hpf\|tissue:whole embryo	GSM3732423	GSM3732423: RIP INPUT 0hpf rep2; Danio rerio; RIP Seq	GSM3732423		1	Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol® Reagent Ambion. mRNA was extracted with using Dynabeads® mRNA Purification Kit Ambion and subjected to TURBO™ DNase Invitrogen treatment at 37°C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp.	GEO Accession:GSM3732423	RIP-Seq	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP162876		RIP-INPUT_0hpf_rep2_R1.fastq.gz RIP-INPUT_0hpf_rep2_R2.fastq.gz	fastq fastq	17402218800.0	58007396.0	GSM3732423 r1	0:150 1:150	A:3416144403;C:5315174821;G:5345201218;T:3320906221;N:4792137	150	150	3416144403	5315174821	5345201218	3320906221	4792137	SRX5717516	SRS4655936	SRA786939	GEO	Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS)	2	0.9819	0.9814	0.33605	0.34016	0.93458	0.93963	0.90172	0.91272	150	150	B	B	biological fallback assumption	illumina	hiseq_era	full_length	random_priming	smarter	bulk	clip	iclip	China	2019-04-22	Zygote	Embryo	Whole Organism	All anatomical structures
49542	49542	SRR8937002	SRX5717515	SRS4655935	SRP162876	PRJNA493828	Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo sample.	GSE120646	Other	The maternal to zygotic transition MZT is a conserved and fundamental process during which the embryo undergoes dramatic reprogramming to convert maternal environment to embryonic driven programing. However how the maternally supplied transcripts are dynamically regulated during MZT remains largely unknown. Herein through genome wide profiling of RNA 5 methylcytosine m5C in zebrafish early embryos we show that m5C methylated maternal mRNAs display higher stability during MZT. We identify that the Y box binding protein 1 Ybx1 prefers to recognizing m5C modified mRNAs through p p interaction with a key residue Trp45 in its cold shock domain CSD which plays essential roles in maternal mRNA stability and early embryogenesis of zebrafish. Cooperated with an mRNA stabilizer Pabpc1a Ybx1 promotes the stability of its target mRNAs in an m5C dependent manner. Our study demonstrates a novel mechanism of RNA m5C methylation regulated maternal mRNA stability during zebrafish MZT highlighting the critical role of m5C mRNA methylation in early development. Overall design: Examination of Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo. RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/Î¼l RNasin by rotating at 4Â°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4Â°C for 1 h. 50 Î¼l pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 Î¼l Protein A Dynabeads for 4 h at 4Â°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/Âµl RNasin for eight times and once with 1ml ice cold 1Ã— PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated i…	parent bioproject:PRJNA534030		RIP INPUT 0hpf rep1	GSM3732422	source name:RIP INPUT 0hpf\|strain:AB strain\|age:0 hpf\|tissue:whole embryo	RIP INPUT 0hpf rep1	Reads were aligned to the zv9 genome assembly using TopHat v2.1.1. MACS2 v2.1.1 were used for the peak calling and peaks were annotated by applying BEDTools’ intersectBed. Genome build: zv9 Supplementary files format and content: Ybx1 binding sites in two biological replicates.	RIP INPUT 0hpf		Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol® Reagent Ambion. mRNA was extracted with using Dynabeads® mRNA Purification Kit Ambion and subjected to TURBO™ DNase Invitrogen treatment at 37°C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp.		strain:AB strain\|age:0 hpf\|tissue:whole embryo	GSM3732422	GSM3732422: RIP INPUT 0hpf rep1; Danio rerio; RIP Seq	GSM3732422		1	Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol® Reagent Ambion. mRNA was extracted with using Dynabeads® mRNA Purification Kit Ambion and subjected to TURBO™ DNase Invitrogen treatment at 37°C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp.	GEO Accession:GSM3732422	RIP-Seq	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP162876		RIP-INPUT_0hpf_rep1_R1.fastq.gz RIP-INPUT_0hpf_rep1_R2.fastq.gz	fastq fastq	16615204800.0	55384016.0	GSM3732422 r1	0:150 1:150	A:2869477028;C:5392959051;G:5575878422;T:2776252538;N:637761	150	150	2869477028	5392959051	5575878422	2776252538	637761	SRX5717515	SRS4655935	SRA786939	GEO	Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS)	2	0.97584	0.96561	0.04007	0.03832	0.9262	0.933	0.94642	0.94376	150	150	B	B	biological fallback assumption	illumina	hiseq_era	full_length	random_priming	smarter	bulk	clip	iclip	China	2019-04-22	Zygote	Embryo	Whole Organism	All anatomical structures
49543	49543	SRR8937001	SRX5717514	SRS4655934	SRP162876	PRJNA493828	Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo sample.	GSE120646	Other	The maternal to zygotic transition MZT is a conserved and fundamental process during which the embryo undergoes dramatic reprogramming to convert maternal environment to embryonic driven programing. However how the maternally supplied transcripts are dynamically regulated during MZT remains largely unknown. Herein through genome wide profiling of RNA 5 methylcytosine m5C in zebrafish early embryos we show that m5C methylated maternal mRNAs display higher stability during MZT. We identify that the Y box binding protein 1 Ybx1 prefers to recognizing m5C modified mRNAs through p p interaction with a key residue Trp45 in its cold shock domain CSD which plays essential roles in maternal mRNA stability and early embryogenesis of zebrafish. Cooperated with an mRNA stabilizer Pabpc1a Ybx1 promotes the stability of its target mRNAs in an m5C dependent manner. Our study demonstrates a novel mechanism of RNA m5C methylation regulated maternal mRNA stability during zebrafish MZT highlighting the critical role of m5C mRNA methylation in early development. Overall design: Examination of Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo. RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/Î¼l RNasin by rotating at 4Â°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4Â°C for 1 h. 50 Î¼l pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 Î¼l Protein A Dynabeads for 4 h at 4Â°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/Âµl RNasin for eight times and once with 1ml ice cold 1Ã— PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated i…	parent bioproject:PRJNA534030		RIP 2hpf rep2	GSM3732421	source name:RIP 2hpf\|strain:AB strain\|age:2 hpf\|tissue:whole embryo\|rip antibody:rabbit polyclonal anti Ybx1 antibody	RIP 2hpf rep2	Reads were aligned to the zv9 genome assembly using TopHat v2.1.1. MACS2 v2.1.1 were used for the peak calling and peaks were annotated by applying BEDTools’ intersectBed. Genome build: zv9 Supplementary files format and content: Ybx1 binding sites in two biological replicates.	RIP 2hpf		Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol® Reagent Ambion. mRNA was extracted with using Dynabeads® mRNA Purification Kit Ambion and subjected to TURBO™ DNase Invitrogen treatment at 37°C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp.		strain:AB strain\|age:2 hpf\|tissue:whole embryo\|rip antibody:rabbit polyclonal anti Ybx1 antibody	GSM3732421	GSM3732421: RIP 2hpf rep2; Danio rerio; RIP Seq	GSM3732421		1	Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol® Reagent Ambion. mRNA was extracted with using Dynabeads® mRNA Purification Kit Ambion and subjected to TURBO™ DNase Invitrogen treatment at 37°C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp.	GEO Accession:GSM3732421	RIP-Seq	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP162876		RIP_2hpf_rep2_R1.fastq.gz RIP_2hpf_rep2_R2.fastq.gz	fastq fastq	17557024800.0	58523416.0	GSM3732421 r1	0:150 1:150	A:4454737772;C:4407385601;G:4364085079;T:4328962997;N:1853351	150	150	4454737772	4407385601	4364085079	4328962997	1853351	SRX5717514	SRS4655934	SRA786939	GEO	Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS)	2	0.96216	0.96226	0.08174	0.08009	0.76907	0.77693	0.68824	0.65939	150	150	B	B	biological fallback assumption	illumina	hiseq_era	full_length	random_priming	smarter	bulk	clip	iclip	China	2019-04-22	Cleavage	Embryo	Whole Organism	All anatomical structures
49544	49544	SRR8937000	SRX5717513	SRS4655933	SRP162876	PRJNA493828	Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo sample.	GSE120646	Other	The maternal to zygotic transition MZT is a conserved and fundamental process during which the embryo undergoes dramatic reprogramming to convert maternal environment to embryonic driven programing. However how the maternally supplied transcripts are dynamically regulated during MZT remains largely unknown. Herein through genome wide profiling of RNA 5 methylcytosine m5C in zebrafish early embryos we show that m5C methylated maternal mRNAs display higher stability during MZT. We identify that the Y box binding protein 1 Ybx1 prefers to recognizing m5C modified mRNAs through p p interaction with a key residue Trp45 in its cold shock domain CSD which plays essential roles in maternal mRNA stability and early embryogenesis of zebrafish. Cooperated with an mRNA stabilizer Pabpc1a Ybx1 promotes the stability of its target mRNAs in an m5C dependent manner. Our study demonstrates a novel mechanism of RNA m5C methylation regulated maternal mRNA stability during zebrafish MZT highlighting the critical role of m5C mRNA methylation in early development. Overall design: Examination of Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo. RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/Î¼l RNasin by rotating at 4Â°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4Â°C for 1 h. 50 Î¼l pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 Î¼l Protein A Dynabeads for 4 h at 4Â°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/Âµl RNasin for eight times and once with 1ml ice cold 1Ã— PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated i…	parent bioproject:PRJNA534030		RIP 2hpf rep1	GSM3732420	source name:RIP 2hpf\|strain:AB strain\|age:2 hpf\|tissue:whole embryo\|rip antibody:rabbit polyclonal anti Ybx1 antibody	RIP 2hpf rep1	Reads were aligned to the zv9 genome assembly using TopHat v2.1.1. MACS2 v2.1.1 were used for the peak calling and peaks were annotated by applying BEDTools’ intersectBed. Genome build: zv9 Supplementary files format and content: Ybx1 binding sites in two biological replicates.	RIP 2hpf		Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol® Reagent Ambion. mRNA was extracted with using Dynabeads® mRNA Purification Kit Ambion and subjected to TURBO™ DNase Invitrogen treatment at 37°C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp.		strain:AB strain\|age:2 hpf\|tissue:whole embryo\|rip antibody:rabbit polyclonal anti Ybx1 antibody	GSM3732420	GSM3732420: RIP 2hpf rep1; Danio rerio; RIP Seq	GSM3732420		1	Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol® Reagent Ambion. mRNA was extracted with using Dynabeads® mRNA Purification Kit Ambion and subjected to TURBO™ DNase Invitrogen treatment at 37°C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp.	GEO Accession:GSM3732420	RIP-Seq	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP162876		RIP_2hpf_rep1_R1.fastq.gz RIP_2hpf_rep1_R2.fastq.gz	fastq fastq	5656083600.0	18853612.0	GSM3732420 r1	0:150 1:150	A:1244757394;C:1581273853;G:1666307178;T:1162885398;N:859777	150	150	1244757394	1581273853	1666307178	1162885398	859777	SRX5717513	SRS4655933	SRA786939	GEO	Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS)	2	0.80705	0.80575	0.2454	0.24923	0.85478	0.85644	0.83319	0.80065	150	150	B	B	biological fallback assumption	illumina	hiseq_era	full_length	random_priming	smarter	bulk	clip	iclip	China	2019-04-22	Cleavage	Embryo	Whole Organism	All anatomical structures
49545	49545	SRR8936999	SRX5717512	SRS4655932	SRP162876	PRJNA493828	Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo sample.	GSE120646	Other	The maternal to zygotic transition MZT is a conserved and fundamental process during which the embryo undergoes dramatic reprogramming to convert maternal environment to embryonic driven programing. However how the maternally supplied transcripts are dynamically regulated during MZT remains largely unknown. Herein through genome wide profiling of RNA 5 methylcytosine m5C in zebrafish early embryos we show that m5C methylated maternal mRNAs display higher stability during MZT. We identify that the Y box binding protein 1 Ybx1 prefers to recognizing m5C modified mRNAs through p p interaction with a key residue Trp45 in its cold shock domain CSD which plays essential roles in maternal mRNA stability and early embryogenesis of zebrafish. Cooperated with an mRNA stabilizer Pabpc1a Ybx1 promotes the stability of its target mRNAs in an m5C dependent manner. Our study demonstrates a novel mechanism of RNA m5C methylation regulated maternal mRNA stability during zebrafish MZT highlighting the critical role of m5C mRNA methylation in early development. Overall design: Examination of Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo. RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/Î¼l RNasin by rotating at 4Â°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4Â°C for 1 h. 50 Î¼l pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 Î¼l Protein A Dynabeads for 4 h at 4Â°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/Âµl RNasin for eight times and once with 1ml ice cold 1Ã— PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated i…	parent bioproject:PRJNA534030		RIP 0hpf rep2	GSM3732419	source name:RIP 0hpf\|strain:AB strain\|age:0 hpf\|tissue:whole embryo\|rip antibody:rabbit polyclonal anti Ybx1 antibody	RIP 0hpf rep2	Reads were aligned to the zv9 genome assembly using TopHat v2.1.1. MACS2 v2.1.1 were used for the peak calling and peaks were annotated by applying BEDTools’ intersectBed. Genome build: zv9 Supplementary files format and content: Ybx1 binding sites in two biological replicates.	RIP 0hpf		Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol® Reagent Ambion. mRNA was extracted with using Dynabeads® mRNA Purification Kit Ambion and subjected to TURBO™ DNase Invitrogen treatment at 37°C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp.		strain:AB strain\|age:0 hpf\|tissue:whole embryo\|rip antibody:rabbit polyclonal anti Ybx1 antibody	GSM3732419	GSM3732419: RIP 0hpf rep2; Danio rerio; RIP Seq	GSM3732419		1	Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol® Reagent Ambion. mRNA was extracted with using Dynabeads® mRNA Purification Kit Ambion and subjected to TURBO™ DNase Invitrogen treatment at 37°C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp.	GEO Accession:GSM3732419	RIP-Seq	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP162876		RIP_0hpf_rep2_R1.fastq.gz RIP_0hpf_rep2_R2.fastq.gz	fastq fastq	14319153300.0	47730511.0	GSM3732419 r1	0:150 1:150	A:3633266473;C:3581763715;G:3602109377;T:3500497801;N:1515934	150	150	3633266473	3581763715	3602109377	3500497801	1515934	SRX5717512	SRS4655932	SRA786939	GEO	Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS)	2	0.96309	0.96299	0.09978	0.09922	0.80012	0.80635	0.7641	0.76535	150	150	B	B	biological fallback assumption	illumina	hiseq_era	full_length	random_priming	smarter	bulk	clip	iclip	China	2019-04-22	Zygote	Embryo	Whole Organism	All anatomical structures
49546	49546	SRR8936998	SRX5717511	SRS4655931	SRP162876	PRJNA493828	Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo sample.	GSE120646	Other	The maternal to zygotic transition MZT is a conserved and fundamental process during which the embryo undergoes dramatic reprogramming to convert maternal environment to embryonic driven programing. However how the maternally supplied transcripts are dynamically regulated during MZT remains largely unknown. Herein through genome wide profiling of RNA 5 methylcytosine m5C in zebrafish early embryos we show that m5C methylated maternal mRNAs display higher stability during MZT. We identify that the Y box binding protein 1 Ybx1 prefers to recognizing m5C modified mRNAs through p p interaction with a key residue Trp45 in its cold shock domain CSD which plays essential roles in maternal mRNA stability and early embryogenesis of zebrafish. Cooperated with an mRNA stabilizer Pabpc1a Ybx1 promotes the stability of its target mRNAs in an m5C dependent manner. Our study demonstrates a novel mechanism of RNA m5C methylation regulated maternal mRNA stability during zebrafish MZT highlighting the critical role of m5C mRNA methylation in early development. Overall design: Examination of Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo. RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/Î¼l RNasin by rotating at 4Â°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4Â°C for 1 h. 50 Î¼l pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 Î¼l Protein A Dynabeads for 4 h at 4Â°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/Âµl RNasin for eight times and once with 1ml ice cold 1Ã— PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated i…	parent bioproject:PRJNA534030		RIP 0hpf rep1	GSM3732418	source name:RIP 0hpf\|strain:AB strain\|age:0 hpf\|tissue:whole embryo\|rip antibody:rabbit polyclonal anti Ybx1 antibody	RIP 0hpf rep1	Reads were aligned to the zv9 genome assembly using TopHat v2.1.1. MACS2 v2.1.1 were used for the peak calling and peaks were annotated by applying BEDTools’ intersectBed. Genome build: zv9 Supplementary files format and content: Ybx1 binding sites in two biological replicates.	RIP 0hpf		Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol® Reagent Ambion. mRNA was extracted with using Dynabeads® mRNA Purification Kit Ambion and subjected to TURBO™ DNase Invitrogen treatment at 37°C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp.		strain:AB strain\|age:0 hpf\|tissue:whole embryo\|rip antibody:rabbit polyclonal anti Ybx1 antibody	GSM3732418	GSM3732418: RIP 0hpf rep1; Danio rerio; RIP Seq	GSM3732418		1	Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol® Reagent Ambion. mRNA was extracted with using Dynabeads® mRNA Purification Kit Ambion and subjected to TURBO™ DNase Invitrogen treatment at 37°C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp.	GEO Accession:GSM3732418	RIP-Seq	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP162876		RIP_0hpf_rep1_R1.fastq.gz RIP_0hpf_rep1_R2.fastq.gz	fastq fastq	7807878000.0	26026260.0	GSM3732418 r1	0:150 1:150	A:1698013251;C:2200605244;G:2305251364;T:1602824248;N:1183893	150	150	1698013251	2200605244	2305251364	1602824248	1183893	SRX5717511	SRS4655931	SRA786939	GEO	Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS)	2	0.89154	0.89105	0.26373	0.26886	0.82477	0.827	0.79125	0.77711	150	150	B	B	biological fallback assumption	illumina	hiseq_era	full_length	random_priming	smarter	bulk	clip	iclip	China	2019-04-22	Zygote	Embryo	Whole Organism	All anatomical structures
49547	49547	SRR7942638	SRX4776903	SRS3857464	SRP162876	PRJNA493828	Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo sample.	GSE120646	Other	The maternal to zygotic transition MZT is a conserved and fundamental process during which the embryo undergoes dramatic reprogramming to convert maternal environment to embryonic driven programing. However how the maternally supplied transcripts are dynamically regulated during MZT remains largely unknown. Herein through genome wide profiling of RNA 5 methylcytosine m5C in zebrafish early embryos we show that m5C methylated maternal mRNAs display higher stability during MZT. We identify that the Y box binding protein 1 Ybx1 prefers to recognizing m5C modified mRNAs through p p interaction with a key residue Trp45 in its cold shock domain CSD which plays essential roles in maternal mRNA stability and early embryogenesis of zebrafish. Cooperated with an mRNA stabilizer Pabpc1a Ybx1 promotes the stability of its target mRNAs in an m5C dependent manner. Our study demonstrates a novel mechanism of RNA m5C methylation regulated maternal mRNA stability during zebrafish MZT highlighting the critical role of m5C mRNA methylation in early development. Overall design: Examination of Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo. RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/Î¼l RNasin by rotating at 4Â°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4Â°C for 1 h. 50 Î¼l pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 Î¼l Protein A Dynabeads for 4 h at 4Â°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/Âµl RNasin for eight times and once with 1ml ice cold 1Ã— PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated i…	parent bioproject:PRJNA534030		iCLIP 4hpf rep2	GSM3406904	source name:Zebrafish embryo\|strain:AB strain\|cell type:Zebrafish embryo\|age:4 hpf\|tissue:whole embryo	iCLIP 4hpf rep2	RIP seq and iCLIP seq reads were aligned to the zv9 genome assembly using TopHat v2.1.1 and BWA v0.7.10 respectively. RIP seq: MACS2 v2.1.1 were used for the peak calling and peaks were annotated by applying BEDTools’ intersectBed. iCLIP: To identify the Ybx1 targets’ locus the mode of truncation calling was performed. For each truncation position the coverages of unique tag k and truncations m were determined by CIMS.pl program CLIP Tool Kit CTK. The sites were annotated by applying BEDTools’ intersectBed. Genome build: zv9 Supplementary files format and content: Ybx1 binding sites in two biological replicates.	Zebrafish embryo		RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/μl RNasin by rotating at 4°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4°C for 1 h. 50 μl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 μl Protein A Dynabeads for 4 h at 4°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/µl RNasin for eight times and once with 1ml ice cold 1× PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche 0311582001 for 1 h at 55°C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The Input RNA was extracted by using TRIzol reagent. Both the Input and IP RNA were treated by TURBO™ DNase Invitrogen AM2238. iCLIP seq: 1000 zebrafish embryos at 4 hpf were irradiated twice with 0.8 J/cm2 Stratalinker 2400 Stratagene lysed and subjected to mild fragmentation. Crosslinked RNA protein complexes were immunoprecipated using polyclonal Ybx1 antibody Abmax and protein A dynabeads. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp.		strain:AB strain\|cell type:Zebrafish embryo\|age:4 hpf\|tissue:whole embryo	GSM3406904	GSM3406904: iCLIP 4hpf rep2; Danio rerio; OTHER	GSM3406904		1	RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/μl RNasin by rotating at 4°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4°C for 1 h. 50 μl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 μl Protein A Dynabeads for 4 h at 4°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/µl RNasin for eight times and once with 1ml ice cold 1× PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche 0311582001 for 1 h at 55°C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The Input RNA was extracted by using TRIzol reagent. Both the Input and IP RNA were treated by TURBO™ DNase Invitrogen AM2238. iCLIP seq: 1000 zebrafish embryos at 4 hpf were irradiated twice with 0.8 J/cm2 Stratalinker 2400 Stratagene lysed and subjected to mild fragmentation. Crosslinked RNA protein complexes were immunoprecipated using polyclonal Ybx1 antibody Abmax and protein A dynabeads. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp.	GEO Accession:GSM3406904	OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP162876		iCLIP_4hpf_rep2_R1.fastq.gz iCLIP_4hpf_rep2_R2.fastq.gz	fastq fastq	17432004900.0	58106683.0	GSM3406904 r1	0:150 1:150	A:5027776225;C:3413769313;G:3531157280;T:5459126811;N:175271	150	150	5027776225	3413769313	3531157280	5459126811	175271	SRX4776903	SRS3857464	SRA786939	GEO	Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS)	2	0.62059	0.61563	0.02838	0.02072	0.95298	0.9628	0.94729	0.94715	150	150	B	B	biological fallback assumption	illumina	hiseq_era	full_length	random_priming	smarter	bulk	clip	iclip	China	2018-09-28	Blastula	Embryo	Whole Organism	All anatomical structures
49548	49548	SRR7942637	SRX4776902	SRS3857447	SRP162876	PRJNA493828	Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo sample.	GSE120646	Other	The maternal to zygotic transition MZT is a conserved and fundamental process during which the embryo undergoes dramatic reprogramming to convert maternal environment to embryonic driven programing. However how the maternally supplied transcripts are dynamically regulated during MZT remains largely unknown. Herein through genome wide profiling of RNA 5 methylcytosine m5C in zebrafish early embryos we show that m5C methylated maternal mRNAs display higher stability during MZT. We identify that the Y box binding protein 1 Ybx1 prefers to recognizing m5C modified mRNAs through p p interaction with a key residue Trp45 in its cold shock domain CSD which plays essential roles in maternal mRNA stability and early embryogenesis of zebrafish. Cooperated with an mRNA stabilizer Pabpc1a Ybx1 promotes the stability of its target mRNAs in an m5C dependent manner. Our study demonstrates a novel mechanism of RNA m5C methylation regulated maternal mRNA stability during zebrafish MZT highlighting the critical role of m5C mRNA methylation in early development. Overall design: Examination of Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo. RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/Î¼l RNasin by rotating at 4Â°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4Â°C for 1 h. 50 Î¼l pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 Î¼l Protein A Dynabeads for 4 h at 4Â°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/Âµl RNasin for eight times and once with 1ml ice cold 1Ã— PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated i…	parent bioproject:PRJNA534030		iCLIP 4hpf rep1	GSM3406903	source name:Zebrafish embryo\|strain:AB strain\|cell type:Zebrafish embryo\|age:4 hpf\|tissue:whole embryo	iCLIP 4hpf rep1	RIP seq and iCLIP seq reads were aligned to the zv9 genome assembly using TopHat v2.1.1 and BWA v0.7.10 respectively. RIP seq: MACS2 v2.1.1 were used for the peak calling and peaks were annotated by applying BEDTools’ intersectBed. iCLIP: To identify the Ybx1 targets’ locus the mode of truncation calling was performed. For each truncation position the coverages of unique tag k and truncations m were determined by CIMS.pl program CLIP Tool Kit CTK. The sites were annotated by applying BEDTools’ intersectBed. Genome build: zv9 Supplementary files format and content: Ybx1 binding sites in two biological replicates.	Zebrafish embryo		RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/μl RNasin by rotating at 4°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4°C for 1 h. 50 μl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 μl Protein A Dynabeads for 4 h at 4°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/µl RNasin for eight times and once with 1ml ice cold 1× PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche 0311582001 for 1 h at 55°C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The Input RNA was extracted by using TRIzol reagent. Both the Input and IP RNA were treated by TURBO™ DNase Invitrogen AM2238. iCLIP seq: 1000 zebrafish embryos at 4 hpf were irradiated twice with 0.8 J/cm2 Stratalinker 2400 Stratagene lysed and subjected to mild fragmentation. Crosslinked RNA protein complexes were immunoprecipated using polyclonal Ybx1 antibody Abmax and protein A dynabeads. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp.		strain:AB strain\|cell type:Zebrafish embryo\|age:4 hpf\|tissue:whole embryo	GSM3406903	GSM3406903: iCLIP 4hpf rep1; Danio rerio; OTHER	GSM3406903		1	RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/μl RNasin by rotating at 4°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4°C for 1 h. 50 μl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 μl Protein A Dynabeads for 4 h at 4°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/µl RNasin for eight times and once with 1ml ice cold 1× PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche 0311582001 for 1 h at 55°C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The Input RNA was extracted by using TRIzol reagent. Both the Input and IP RNA were treated by TURBO™ DNase Invitrogen AM2238. iCLIP seq: 1000 zebrafish embryos at 4 hpf were irradiated twice with 0.8 J/cm2 Stratalinker 2400 Stratagene lysed and subjected to mild fragmentation. Crosslinked RNA protein complexes were immunoprecipated using polyclonal Ybx1 antibody Abmax and protein A dynabeads. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp.	GEO Accession:GSM3406903	OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP162876		iCLIP_4hpf_rep1_R1.fastq.gz iCLIP_4hpf_rep1_R2.fastq.gz	fastq fastq	18547407600.0	61824692.0	GSM3406903 r1	0:150 1:150	A:5264017245;C:3699523947;G:3688768985;T:5894912242;N:185181	150	150	5264017245	3699523947	3688768985	5894912242	185181	SRX4776902	SRS3857447	SRA786939	GEO	Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS)	2	0.68368	0.67882	0.0342	0.02328	0.95375	0.96623	0.962	0.9572	150	150	B	B	biological fallback assumption	illumina	hiseq_era	full_length	random_priming	smarter	bulk	clip	iclip	China	2018-09-28	Blastula	Embryo	Whole Organism	All anatomical structures
49549	49549	SRR7942636	SRX4776901	SRS3857441	SRP162876	PRJNA493828	Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo sample.	GSE120646	Other	The maternal to zygotic transition MZT is a conserved and fundamental process during which the embryo undergoes dramatic reprogramming to convert maternal environment to embryonic driven programing. However how the maternally supplied transcripts are dynamically regulated during MZT remains largely unknown. Herein through genome wide profiling of RNA 5 methylcytosine m5C in zebrafish early embryos we show that m5C methylated maternal mRNAs display higher stability during MZT. We identify that the Y box binding protein 1 Ybx1 prefers to recognizing m5C modified mRNAs through p p interaction with a key residue Trp45 in its cold shock domain CSD which plays essential roles in maternal mRNA stability and early embryogenesis of zebrafish. Cooperated with an mRNA stabilizer Pabpc1a Ybx1 promotes the stability of its target mRNAs in an m5C dependent manner. Our study demonstrates a novel mechanism of RNA m5C methylation regulated maternal mRNA stability during zebrafish MZT highlighting the critical role of m5C mRNA methylation in early development. Overall design: Examination of Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo. RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/Î¼l RNasin by rotating at 4Â°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4Â°C for 1 h. 50 Î¼l pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 Î¼l Protein A Dynabeads for 4 h at 4Â°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/Âµl RNasin for eight times and once with 1ml ice cold 1Ã— PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated i…	parent bioproject:PRJNA534030		RIP 4hpf rep2	GSM3406902	source name:Zebrafish embryo\|strain:AB strain\|cell type:Zebrafish embryo\|age:4 hpf\|tissue:whole embryo	RIP 4hpf rep2	RIP seq and iCLIP seq reads were aligned to the zv9 genome assembly using TopHat v2.1.1 and BWA v0.7.10 respectively. RIP seq: MACS2 v2.1.1 were used for the peak calling and peaks were annotated by applying BEDTools’ intersectBed. iCLIP: To identify the Ybx1 targets’ locus the mode of truncation calling was performed. For each truncation position the coverages of unique tag k and truncations m were determined by CIMS.pl program CLIP Tool Kit CTK. The sites were annotated by applying BEDTools’ intersectBed. Genome build: zv9 Supplementary files format and content: Ybx1 binding sites in two biological replicates.	Zebrafish embryo		RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/μl RNasin by rotating at 4°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4°C for 1 h. 50 μl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 μl Protein A Dynabeads for 4 h at 4°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/µl RNasin for eight times and once with 1ml ice cold 1× PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche 0311582001 for 1 h at 55°C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The Input RNA was extracted by using TRIzol reagent. Both the Input and IP RNA were treated by TURBO™ DNase Invitrogen AM2238. iCLIP seq: 1000 zebrafish embryos at 4 hpf were irradiated twice with 0.8 J/cm2 Stratalinker 2400 Stratagene lysed and subjected to mild fragmentation. Crosslinked RNA protein complexes were immunoprecipated using polyclonal Ybx1 antibody Abmax and protein A dynabeads. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp.		strain:AB strain\|cell type:Zebrafish embryo\|age:4 hpf\|tissue:whole embryo	GSM3406902	GSM3406902: RIP 4hpf rep2; Danio rerio; RIP Seq	GSM3406902		1	RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/μl RNasin by rotating at 4°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4°C for 1 h. 50 μl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 μl Protein A Dynabeads for 4 h at 4°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/µl RNasin for eight times and once with 1ml ice cold 1× PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche 0311582001 for 1 h at 55°C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The Input RNA was extracted by using TRIzol reagent. Both the Input and IP RNA were treated by TURBO™ DNase Invitrogen AM2238. iCLIP seq: 1000 zebrafish embryos at 4 hpf were irradiated twice with 0.8 J/cm2 Stratalinker 2400 Stratagene lysed and subjected to mild fragmentation. Crosslinked RNA protein complexes were immunoprecipated using polyclonal Ybx1 antibody Abmax and protein A dynabeads. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp.	GEO Accession:GSM3406902	RIP-Seq	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP162876		RIP_4hpf_rep2_R1.fastq.gz RIP_4hpf_rep2_R2.fastq.gz	fastq fastq	22888305600.0	76294352.0	GSM3406902 r1	0:150 1:150	A:5927520807;C:4846894836;G:4996844576;T:7111789925;N:5255456	150	150	5927520807	4846894836	4996844576	7111789925	5255456	SRX4776901	SRS3857441	SRA786939	GEO	Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS)	2	0.2704	0.17205	0.06114	0.06961	0.95879	0.9698	0.94515	0.83252	150	150	B	B	mate2-mate1 similar by mapping diff	illumina	hiseq_era	full_length	random_priming	smarter	bulk	clip	iclip	China	2018-09-28	Blastula	Embryo	Whole Organism	All anatomical structures
49550	49550	SRR7942635	SRX4776900	SRS3857440	SRP162876	PRJNA493828	Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo sample.	GSE120646	Other	The maternal to zygotic transition MZT is a conserved and fundamental process during which the embryo undergoes dramatic reprogramming to convert maternal environment to embryonic driven programing. However how the maternally supplied transcripts are dynamically regulated during MZT remains largely unknown. Herein through genome wide profiling of RNA 5 methylcytosine m5C in zebrafish early embryos we show that m5C methylated maternal mRNAs display higher stability during MZT. We identify that the Y box binding protein 1 Ybx1 prefers to recognizing m5C modified mRNAs through p p interaction with a key residue Trp45 in its cold shock domain CSD which plays essential roles in maternal mRNA stability and early embryogenesis of zebrafish. Cooperated with an mRNA stabilizer Pabpc1a Ybx1 promotes the stability of its target mRNAs in an m5C dependent manner. Our study demonstrates a novel mechanism of RNA m5C methylation regulated maternal mRNA stability during zebrafish MZT highlighting the critical role of m5C mRNA methylation in early development. Overall design: Examination of Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo. RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/Î¼l RNasin by rotating at 4Â°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4Â°C for 1 h. 50 Î¼l pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 Î¼l Protein A Dynabeads for 4 h at 4Â°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/Âµl RNasin for eight times and once with 1ml ice cold 1Ã— PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated i…	parent bioproject:PRJNA534030		RIP 4hpf rep1	GSM3406901	source name:Zebrafish embryo\|strain:AB strain\|cell type:Zebrafish embryo\|age:4 hpf\|tissue:whole embryo	RIP 4hpf rep1	RIP seq and iCLIP seq reads were aligned to the zv9 genome assembly using TopHat v2.1.1 and BWA v0.7.10 respectively. RIP seq: MACS2 v2.1.1 were used for the peak calling and peaks were annotated by applying BEDTools’ intersectBed. iCLIP: To identify the Ybx1 targets’ locus the mode of truncation calling was performed. For each truncation position the coverages of unique tag k and truncations m were determined by CIMS.pl program CLIP Tool Kit CTK. The sites were annotated by applying BEDTools’ intersectBed. Genome build: zv9 Supplementary files format and content: Ybx1 binding sites in two biological replicates.	Zebrafish embryo		RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/μl RNasin by rotating at 4°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4°C for 1 h. 50 μl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 μl Protein A Dynabeads for 4 h at 4°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/µl RNasin for eight times and once with 1ml ice cold 1× PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche 0311582001 for 1 h at 55°C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The Input RNA was extracted by using TRIzol reagent. Both the Input and IP RNA were treated by TURBO™ DNase Invitrogen AM2238. iCLIP seq: 1000 zebrafish embryos at 4 hpf were irradiated twice with 0.8 J/cm2 Stratalinker 2400 Stratagene lysed and subjected to mild fragmentation. Crosslinked RNA protein complexes were immunoprecipated using polyclonal Ybx1 antibody Abmax and protein A dynabeads. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp.		strain:AB strain\|cell type:Zebrafish embryo\|age:4 hpf\|tissue:whole embryo	GSM3406901	GSM3406901: RIP 4hpf rep1; Danio rerio; RIP Seq	GSM3406901		1	RIP seq: Briefly 500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl 10 mM HEPES pH 7.6 2 mM EDTA 0.5% NP 40 0.5 mM DTT 1:100 protease inhibitor cocktail 0.4 U/μl RNasin by rotating at 4°C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4°C for 1 h. 50 μl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax China and 30 μl Protein A Dynabeads for 4 h at 4°C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl 50 mM HEPES pH 7.6 2 mM EDTA 0.05% NP 40 0.5 mM DTT 0.4U/µl RNasin for eight times and once with 1ml ice cold 1× PK buffer 100 mM Tris HCl pH 7.4 50 mM NaCl 10 mM EDTA 0.2% SDS the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche 0311582001 for 1 h at 55°C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The Input RNA was extracted by using TRIzol reagent. Both the Input and IP RNA were treated by TURBO™ DNase Invitrogen AM2238. iCLIP seq: 1000 zebrafish embryos at 4 hpf were irradiated twice with 0.8 J/cm2 Stratalinker 2400 Stratagene lysed and subjected to mild fragmentation. Crosslinked RNA protein complexes were immunoprecipated using polyclonal Ybx1 antibody Abmax and protein A dynabeads. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode creating reads with a length of 150 bp.	GEO Accession:GSM3406901	RIP-Seq	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP162876		RIP_4hpf_rep1_R1.fastq.gz RIP_4hpf_rep1_R2.fastq.gz	fastq fastq	19929300600.0	66431002.0	GSM3406901 r1	0:150 1:150	A:5076575451;C:4235012507;G:4442151234;T:6170975339;N:4586069	150	150	5076575451	4235012507	4442151234	6170975339	4586069	SRX4776900	SRS3857440	SRA786939	GEO	Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS)	2	0.27932	0.16557	0.06585	0.06178	0.95692	0.96844	0.94238	0.84334	150	150	B	B	mate2-mate1 similar by mapping diff	illumina	hiseq_era	full_length	random_priming	smarter	bulk	clip	iclip	China	2018-09-28	Blastula	Embryo	Whole Organism	All anatomical structures
49565	49565	SRR11537844	SRX8108899	SRS6473985	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.		pubmed:32423473	Shield Elavl1a MO NAIN3.rep2	GSM4473292	tissue:Shield Elavl1a MO NAIN3\|strain background:AB\|age:6hpf\|cell type:elavl1a morphants zebrafish embryos cells\|treatment:NAI N3	Shield Elavl1a MO NAIN3.rep2	Library strategy: icSHAPE trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calulate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	Shield Elavl1a MO NAIN3	For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages. For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5°C for 5min	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37℃ for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25℃ for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30℃ for 90 min. And then 1µl RecJf NEB was added with another incubation at 37℃ for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain background:AB\|age:6hpf\|cell type:elavl1a morphants zebrafish embryos cells\|treatment:NAI N3	GSM4473292	GSM4473292: Shield Elavl1a MO NAIN3.rep2; Danio rerio; OTHER	GSM4473292		1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37℃ for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25℃ for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30℃ for 90 min. And then 1µl RecJf NEB was added with another incubation at 37℃ for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM4473292	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP163087		Shield_Elavl1a_MO_NAIN3.rep2.fastq.gz	fastq	125703095100.0	838020634.0	GSM4473292 r1	0:150 1:0	A:32023181587;C:24765137819;G:46378114606;T:22535691781;N:969307	150	0	32023181587	24765137819	46378114606	22535691781	969307	SRX8108899	SRS6473985	SRA787572	GEO	Life Science, Tsinghua University	1	0.11412		0.02142		0.92147		0.70154		150		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2020-04-12	Gastrula	Embryo	Embryo Imprecise	All anatomical structures
49566	49566	SRR11537843	SRX8108898	SRS6473984	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.		pubmed:32423473	Shield Elavl1a MO NAIN3.rep1	GSM4473291	tissue:Shield Elavl1a MO NAIN3\|strain background:AB\|age:6hpf\|cell type:elavl1a morphants zebrafish embryos cells\|treatment:NAI N3	Shield Elavl1a MO NAIN3.rep1	Library strategy: icSHAPE trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calulate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	Shield Elavl1a MO NAIN3	For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages. For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5°C for 5min	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37℃ for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25℃ for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30℃ for 90 min. And then 1µl RecJf NEB was added with another incubation at 37℃ for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain background:AB\|age:6hpf\|cell type:elavl1a morphants zebrafish embryos cells\|treatment:NAI N3	GSM4473291	GSM4473291: Shield Elavl1a MO NAIN3.rep1; Danio rerio; OTHER	GSM4473291		1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37℃ for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25℃ for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30℃ for 90 min. And then 1µl RecJf NEB was added with another incubation at 37℃ for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM4473291	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP163087		Shield_Elavl1a_MO_NAIN3.rep1.fastq.gz	fastq	97684476300.0	651229842.0	GSM4473291 r1	0:150 1:0	A:23448978329;C:19171932414;G:36104881456;T:18957926032;N:758069	150	0	23448978329	19171932414	36104881456	18957926032	758069	SRX8108898	SRS6473984	SRA787572	GEO	Life Science, Tsinghua University	1	0.07298		0.01306		0.93789		0.71752		150		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2020-04-12	Gastrula	Embryo	Embryo Imprecise	All anatomical structures
49567	49567	SRR11537842	SRX8108897	SRS6473983	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.		pubmed:32423473	Shield Elavl1a MO DMSO.rep2	GSM4473290	tissue:Shield Elavl1a MO DMSO\|strain background:AB\|age:6hpf\|cell type:elavl1a morphants zebrafish embryos cells\|treatment:DMSO	Shield Elavl1a MO DMSO.rep2	Library strategy: icSHAPE trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calulate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	Shield Elavl1a MO DMSO	For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages. For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5°C for 5min	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37℃ for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25℃ for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30℃ for 90 min. And then 1µl RecJf NEB was added with another incubation at 37℃ for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain background:AB\|age:6hpf\|cell type:elavl1a morphants zebrafish embryos cells\|treatment:DMSO	GSM4473290	GSM4473290: Shield Elavl1a MO DMSO.rep2; Danio rerio; OTHER	GSM4473290		1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37℃ for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25℃ for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30℃ for 90 min. And then 1µl RecJf NEB was added with another incubation at 37℃ for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM4473290	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP163087		Shield_Elavl1a_MO_DMSO.rep2.fastq.gz	fastq	77964750450.0	519765003.0	GSM4473290 r1	0:150 1:0	A:23155551814;C:19934925592;G:15766394313;T:19078082759;N:29795972	150	0	23155551814	19934925592	15766394313	19078082759	29795972	SRX8108897	SRS6473983	SRA787572	GEO	Life Science, Tsinghua University	1	0.07142		0.01724		0.94223		0.779		150		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2020-04-12	Gastrula	Embryo	Embryo Imprecise	All anatomical structures
49568	49568	SRR11537841	SRX8108896	SRS6473982	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.		pubmed:32423473	Shield Elavl1a MO DMSO.rep1	GSM4473289	tissue:Shield Elavl1a MO DMSO\|strain background:AB\|age:6hpf\|cell type:elavl1a morphants zebrafish embryos cells\|treatment:DMSO	Shield Elavl1a MO DMSO.rep1	Library strategy: icSHAPE trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calulate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	Shield Elavl1a MO DMSO	For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages. For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5°C for 5min	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37℃ for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25℃ for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30℃ for 90 min. And then 1µl RecJf NEB was added with another incubation at 37℃ for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain background:AB\|age:6hpf\|cell type:elavl1a morphants zebrafish embryos cells\|treatment:DMSO	GSM4473289	GSM4473289: Shield Elavl1a MO DMSO.rep1; Danio rerio; OTHER	GSM4473289		1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37℃ for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25℃ for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30℃ for 90 min. And then 1µl RecJf NEB was added with another incubation at 37℃ for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM4473289	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP163087		Shield_Elavl1a_MO_DMSO.rep1.fastq.gz	fastq	24430935750.0	162872905.0	GSM4473289 r1	0:150 1:0	A:6922313808;C:5215135549;G:7472148111;T:4821148458;N:189824	150	0	6922313808	5215135549	7472148111	4821148458	189824	SRX8108896	SRS6473982	SRA787572	GEO	Life Science, Tsinghua University	1	0.27515		0.04834		0.86147		0.4542		150		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2020-04-12	Gastrula	Embryo	Embryo Imprecise	All anatomical structures
49569	49569	SRR11537840	SRX8108895	SRS6473981	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.		pubmed:32423473	Sphere Elavl1a MO NAIN3.rep2	GSM4473288	tissue:Sphere Elavl1a MO NAIN3\|strain background:AB\|age:4hpf\|cell type:elavl1a morphants zebrafish embryos cells\|treatment:NAI N3	Sphere Elavl1a MO NAIN3.rep2	Library strategy: icSHAPE trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calulate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	Sphere Elavl1a MO NAIN3	For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages. For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5°C for 5min	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37℃ for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25℃ for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30℃ for 90 min. And then 1µl RecJf NEB was added with another incubation at 37℃ for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain background:AB\|age:4hpf\|cell type:elavl1a morphants zebrafish embryos cells\|treatment:NAI N3	GSM4473288	GSM4473288: Sphere Elavl1a MO NAIN3.rep2; Danio rerio; OTHER	GSM4473288		1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37℃ for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25℃ for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30℃ for 90 min. And then 1µl RecJf NEB was added with another incubation at 37℃ for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM4473288	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP163087		Sphere_Elavl1a_MO_NAIN3.rep2.fastq.gz	fastq	83266825200.0	555112168.0	GSM4473288 r1	0:150 1:0	A:20621422257;C:17635819340;G:29266248375;T:15742691319;N:643909	150	0	20621422257	17635819340	29266248375	15742691319	643909	SRX8108895	SRS6473981	SRA787572	GEO	Life Science, Tsinghua University	1	0.13635		0.01536		0.88586		0.72417		150		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2020-04-12	Blastula	Embryo	Embryo Imprecise	All anatomical structures
49570	49570	SRR11537839	SRX8108894	SRS6473980	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.		pubmed:32423473	Sphere Elavl1a MO NAIN3.rep1	GSM4473287	tissue:Sphere Elavl1a MO NAIN3\|strain background:AB\|age:4hpf\|cell type:elavl1a morphants zebrafish embryos cells\|treatment:NAI N3	Sphere Elavl1a MO NAIN3.rep1	Library strategy: icSHAPE trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calulate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	Sphere Elavl1a MO NAIN3	For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages. For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5°C for 5min	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37℃ for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25℃ for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30℃ for 90 min. And then 1µl RecJf NEB was added with another incubation at 37℃ for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain background:AB\|age:4hpf\|cell type:elavl1a morphants zebrafish embryos cells\|treatment:NAI N3	GSM4473287	GSM4473287: Sphere Elavl1a MO NAIN3.rep1; Danio rerio; OTHER	GSM4473287		1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37℃ for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25℃ for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30℃ for 90 min. And then 1µl RecJf NEB was added with another incubation at 37℃ for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM4473287	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP163087		Sphere_Elavl1a_MO_NAIN3.rep1.fastq.gz	fastq	75408648300.0	502724322.0	GSM4473287 r1	0:150 1:0	A:19590532626;C:15494788593;G:26125416257;T:14197330642;N:580182	150	0	19590532626	15494788593	26125416257	14197330642	580182	SRX8108894	SRS6473980	SRA787572	GEO	Life Science, Tsinghua University	1	0.0048		0.00055		0.99502		0.81456		150		T		under 1.2% mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2020-04-12	Blastula	Embryo	Embryo Imprecise	All anatomical structures
49571	49571	SRR11537838	SRX8108893	SRS6473979	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.		pubmed:32423473	Sphere Elavl1a MO DMSO.rep2	GSM4473286	tissue:Sphere Elavl1a MO DMSO\|strain background:AB\|age:4hpf\|cell type:elavl1a morphants zebrafish embryos cells\|treatment:DMSO	Sphere Elavl1a MO DMSO.rep2	Library strategy: icSHAPE trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calulate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	Sphere Elavl1a MO DMSO	For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages. For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5°C for 5min	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37℃ for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25℃ for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30℃ for 90 min. And then 1µl RecJf NEB was added with another incubation at 37℃ for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain background:AB\|age:4hpf\|cell type:elavl1a morphants zebrafish embryos cells\|treatment:DMSO	GSM4473286	GSM4473286: Sphere Elavl1a MO DMSO.rep2; Danio rerio; OTHER	GSM4473286		1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37℃ for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25℃ for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30℃ for 90 min. And then 1µl RecJf NEB was added with another incubation at 37℃ for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM4473286	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP163087		Sphere_Elavl1a_MO_DMSO.rep2.fastq.gz	fastq	21843179550.0	145621197.0	GSM4473286 r1	0:150 1:0	A:5896736067;C:4594959790;G:6585009703;T:4766305398;N:168592	150	0	5896736067	4594959790	6585009703	4766305398	168592	SRX8108893	SRS6473979	SRA787572	GEO	Life Science, Tsinghua University	1	0.21638		0.03521		0.84902		0.66034		150		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2020-04-12	Blastula	Embryo	Embryo Imprecise	All anatomical structures
49572	49572	SRR11537837	SRX8108892	SRS6473978	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.		pubmed:32423473	Sphere Elavl1a MO DMSO.rep1	GSM4473285	tissue:Sphere Elavl1a MO DMSO\|strain background:AB\|age:4hpf\|cell type:elavl1a morphants zebrafish embryos cells\|treatment:DMSO	Sphere Elavl1a MO DMSO.rep1	Library strategy: icSHAPE trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calulate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	Sphere Elavl1a MO DMSO	For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages. For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5°C for 5min	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37℃ for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25℃ for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30℃ for 90 min. And then 1µl RecJf NEB was added with another incubation at 37℃ for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain background:AB\|age:4hpf\|cell type:elavl1a morphants zebrafish embryos cells\|treatment:DMSO	GSM4473285	GSM4473285: Sphere Elavl1a MO DMSO.rep1; Danio rerio; OTHER	GSM4473285		1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37℃ for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25℃ for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30℃ for 90 min. And then 1µl RecJf NEB was added with another incubation at 37℃ for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM4473285	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP163087		Sphere_Elavl1a_MO_DMSO.rep1.fastq.gz	fastq	39150278250.0	261001855.0	GSM4473285 r1	0:150 1:0	A:10112519472;C:8251284950;G:12148560750;T:8637610037;N:303041	150	0	10112519472	8251284950	12148560750	8637610037	303041	SRX8108892	SRS6473978	SRA787572	GEO	Life Science, Tsinghua University	1	0.24867		0.03662		0.83402		0.65435		150		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2020-04-12	Blastula	Embryo	Embryo Imprecise	All anatomical structures
49573	49573	SRR10434662	SRX7130632	SRS5639976	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.		pubmed:32423473	shield Flag Elavl1a iCLIP rep2	GSM4157939	tissue:zebrafish embryos\|strain:zebrafish embryos\|cell type:normal zebrafish embryos cells\|age:6hpf	shield Flag Elavl1a iCLIP rep2	The proceesing procedure is similar to CTK toolhttps://zhanglab.c2b2.columbia.edu/index.php/ICLIP data analysis using CTK. First we trimmed three prime adaptor from reads by cutadapt collapsed duplicated reads by fastq2collapse.pl in CTK tool stripped 5’ degenerated barcode mapped clean reads to zebrafish reference genomez10 by bwav0.7.17. data from replicates was merged for peak calling We use CTK tool CITS mode to call the peaks. Reads were clustered using tag2cluster.pl with parameters big s maxgap " 1" peaks are identified using tag2peak.pl with parameters big ss v prefix "CITS" gap 25 p 0.05 Genome build: z10 Supplementary files format and content: iCLIP peaks identified by CTK tool were provided in bed file format. The first three columns represent the 0 based location of the peak in the genome and the last column represents the strand.The fourth column reprents the peak ID and describes the gene locus peak heightPH expected PH/backgroundPH0 and pvalueP. The fifth column represents the peak height.	zebrafish embryos		iCLIP seq was carried out as previously described Despic et al. 2017. Breifly flag elavl1a mRNA injected embryos were collected at xxx h.p.f. and 6 h.p.f.. 400 zebrafish embryos were irradiated twice with 0.8 J/cm2 Stratalinker 2400 Stratagene lysed and subjected to mild RNA fragmentation. Crosslinked RNA proteins complexes were immunopurified using Anti FLAG M2 Magnetic Beads Merck M8823 for 4 h.p.f. and 6 h.p.f. at 4 °C. RNA was extracted Library construction was performed by using Smarter smRNA Seq kit Clontech Laboratories Inc	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain:zebrafish embryos\|cell type:normal zebrafish embryos cells\|age:6hpf	GSM4157939	GSM4157939: shield Flag Elavl1a iCLIP rep2; Danio rerio; OTHER	GSM4157939		1	iCLIP seq was carried out as previously described Despic et al. 2017. Breifly flag elavl1a mRNA injected embryos were collected at xxx h.p.f. and 6 h.p.f.. 400 zebrafish embryos were irradiated twice with 0.8 J/cm2 Stratalinker 2400 Stratagene lysed and subjected to mild RNA fragmentation. Crosslinked RNA proteins complexes were immunopurified using Anti FLAG M2 Magnetic Beads Merck M8823 for 4 h.p.f. and 6 h.p.f. at 4 °C. RNA was extracted Library construction was performed by using Smarter smRNA Seq kit Clontech Laboratories Inc	GEO Accession:GSM4157939	OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	HiSeq X Ten	SRP163087		Shield_Elavl1a_iCLIP_rep2.R2.fq.gz Shield_Elavl1a_iCLIP_rep2.R1.fq.gz	fastq fastq	23879342400.0	79597808.0	GSM4157939 r1	0:150 1:150	A:6335254303;C:5166953187;G:6017120995;T:6358132998;N:1880917	150	150	6335254303	5166953187	6017120995	6358132998	1880917	SRX7130632	SRS5639976	SRA787572	GEO	Life Science, Tsinghua University	2	0.14294	0.15151	0.03583	0.08959	0.99397	0.98269	0.96727	0.75507	150	150	B	B	biological fallback assumption	illumina	hiseq_era	full_length	poly_a	smarter	bulk	clip	iclip	China	2019-11-12	Gastrula	Embryo	Embryo Imprecise	All anatomical structures
49574	49574	SRR10434661	SRX7130631	SRS5639975	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.		pubmed:32423473	shield Flag Elavl1a iCLIP rep1	GSM4157938	tissue:zebrafish embryos\|strain:zebrafish embryos\|cell type:normal zebrafish embryos cells\|age:6hpf	shield Flag Elavl1a iCLIP rep1	The proceesing procedure is similar to CTK toolhttps://zhanglab.c2b2.columbia.edu/index.php/ICLIP data analysis using CTK. First we trimmed three prime adaptor from reads by cutadapt collapsed duplicated reads by fastq2collapse.pl in CTK tool stripped 5’ degenerated barcode mapped clean reads to zebrafish reference genomez10 by bwav0.7.17. data from replicates was merged for peak calling We use CTK tool CITS mode to call the peaks. Reads were clustered using tag2cluster.pl with parameters big s maxgap " 1" peaks are identified using tag2peak.pl with parameters big ss v prefix "CITS" gap 25 p 0.05 Genome build: z10 Supplementary files format and content: iCLIP peaks identified by CTK tool were provided in bed file format. The first three columns represent the 0 based location of the peak in the genome and the last column represents the strand.The fourth column reprents the peak ID and describes the gene locus peak heightPH expected PH/backgroundPH0 and pvalueP. The fifth column represents the peak height.	zebrafish embryos		iCLIP seq was carried out as previously described Despic et al. 2017. Breifly flag elavl1a mRNA injected embryos were collected at xxx h.p.f. and 6 h.p.f.. 400 zebrafish embryos were irradiated twice with 0.8 J/cm2 Stratalinker 2400 Stratagene lysed and subjected to mild RNA fragmentation. Crosslinked RNA proteins complexes were immunopurified using Anti FLAG M2 Magnetic Beads Merck M8823 for 4 h.p.f. and 6 h.p.f. at 4 °C. RNA was extracted Library construction was performed by using Smarter smRNA Seq kit Clontech Laboratories Inc	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain:zebrafish embryos\|cell type:normal zebrafish embryos cells\|age:6hpf	GSM4157938	GSM4157938: shield Flag Elavl1a iCLIP rep1; Danio rerio; OTHER	GSM4157938		1	iCLIP seq was carried out as previously described Despic et al. 2017. Breifly flag elavl1a mRNA injected embryos were collected at xxx h.p.f. and 6 h.p.f.. 400 zebrafish embryos were irradiated twice with 0.8 J/cm2 Stratalinker 2400 Stratagene lysed and subjected to mild RNA fragmentation. Crosslinked RNA proteins complexes were immunopurified using Anti FLAG M2 Magnetic Beads Merck M8823 for 4 h.p.f. and 6 h.p.f. at 4 °C. RNA was extracted Library construction was performed by using Smarter smRNA Seq kit Clontech Laboratories Inc	GEO Accession:GSM4157938	OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	HiSeq X Ten	SRP163087		Shield_Elavl1a_iCLIP_rep1.R1.fq.gz Shield_Elavl1a_iCLIP_rep1.R2.fq.gz	fastq fastq	22375977600.0	74586592.0	GSM4157938 r1	0:150 1:150	A:6243025236;C:5008499337;G:5418170547;T:5704514909;N:1767571	150	150	6243025236	5008499337	5418170547	5704514909	1767571	SRX7130631	SRS5639975	SRA787572	GEO	Life Science, Tsinghua University	2	0.05144	0.12625	0.01219	0.09577	0.99734	0.98113	0.8629	0.52429	150	150	B	B	mate1-mate2 similar by mapping diff	illumina	hiseq_era	full_length	poly_a	smarter	bulk	clip	iclip	China	2019-11-12	Gastrula	Embryo	Embryo Imprecise	All anatomical structures
49575	49575	SRR10434660	SRX7130630	SRS5639974	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.		pubmed:32423473	sphere Flag Elavl1a iCLIP rep2	GSM4157937	tissue:zebrafish embryos\|strain:zebrafish embryos\|cell type:normal zebrafish embryos cells\|age:4hpf	sphere Flag Elavl1a iCLIP rep2	The proceesing procedure is similar to CTK toolhttps://zhanglab.c2b2.columbia.edu/index.php/ICLIP data analysis using CTK. First we trimmed three prime adaptor from reads by cutadapt collapsed duplicated reads by fastq2collapse.pl in CTK tool stripped 5’ degenerated barcode mapped clean reads to zebrafish reference genomez10 by bwav0.7.17. data from replicates was merged for peak calling We use CTK tool CITS mode to call the peaks. Reads were clustered using tag2cluster.pl with parameters big s maxgap " 1" peaks are identified using tag2peak.pl with parameters big ss v prefix "CITS" gap 25 p 0.05 Genome build: z10 Supplementary files format and content: iCLIP peaks identified by CTK tool were provided in bed file format. The first three columns represent the 0 based location of the peak in the genome and the last column represents the strand.The fourth column reprents the peak ID and describes the gene locus peak heightPH expected PH/backgroundPH0 and pvalueP. The fifth column represents the peak height.	zebrafish embryos		iCLIP seq was carried out as previously described Despic et al. 2017. Breifly flag elavl1a mRNA injected embryos were collected at xxx h.p.f. and 6 h.p.f.. 400 zebrafish embryos were irradiated twice with 0.8 J/cm2 Stratalinker 2400 Stratagene lysed and subjected to mild RNA fragmentation. Crosslinked RNA proteins complexes were immunopurified using Anti FLAG M2 Magnetic Beads Merck M8823 for 4 h.p.f. and 6 h.p.f. at 4 °C. RNA was extracted Library construction was performed by using Smarter smRNA Seq kit Clontech Laboratories Inc	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain:zebrafish embryos\|cell type:normal zebrafish embryos cells\|age:4hpf	GSM4157937	GSM4157937: sphere Flag Elavl1a iCLIP rep2; Danio rerio; OTHER	GSM4157937		1	iCLIP seq was carried out as previously described Despic et al. 2017. Breifly flag elavl1a mRNA injected embryos were collected at xxx h.p.f. and 6 h.p.f.. 400 zebrafish embryos were irradiated twice with 0.8 J/cm2 Stratalinker 2400 Stratagene lysed and subjected to mild RNA fragmentation. Crosslinked RNA proteins complexes were immunopurified using Anti FLAG M2 Magnetic Beads Merck M8823 for 4 h.p.f. and 6 h.p.f. at 4 °C. RNA was extracted Library construction was performed by using Smarter smRNA Seq kit Clontech Laboratories Inc	GEO Accession:GSM4157937	OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	HiSeq X Ten	SRP163087		Sphere_Elavl1a_iCLIP_rep2.R1.fq.gz Sphere_Elavl1a_iCLIP_rep2.R2.fq.gz	fastq fastq	22090855200.0	73636184.0	GSM4157937 r1	0:150 1:150	A:5631298996;C:5114935575;G:5742247735;T:5600647498;N:1725396	150	150	5631298996	5114935575	5742247735	5600647498	1725396	SRX7130630	SRS5639974	SRA787572	GEO	Life Science, Tsinghua University	2	0.23476	0.17586	0.06861	0.08859	0.99563	0.98873	0.95465	0.79994	150	150	B	B	mate2-mate1 similar by mapping diff	illumina	hiseq_era	full_length	poly_a	smarter	bulk	clip	iclip	China	2019-11-12	Blastula	Embryo	Embryo Imprecise	All anatomical structures
49576	49576	SRR10434659	SRX7130629	SRS5639973	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.		pubmed:32423473	sphere Flag Elavl1a iCLIP rep1	GSM4157936	tissue:zebrafish embryos\|strain:zebrafish embryos\|cell type:normal zebrafish embryos cells\|age:4hpf	sphere Flag Elavl1a iCLIP rep1	The proceesing procedure is similar to CTK toolhttps://zhanglab.c2b2.columbia.edu/index.php/ICLIP data analysis using CTK. First we trimmed three prime adaptor from reads by cutadapt collapsed duplicated reads by fastq2collapse.pl in CTK tool stripped 5’ degenerated barcode mapped clean reads to zebrafish reference genomez10 by bwav0.7.17. data from replicates was merged for peak calling We use CTK tool CITS mode to call the peaks. Reads were clustered using tag2cluster.pl with parameters big s maxgap " 1" peaks are identified using tag2peak.pl with parameters big ss v prefix "CITS" gap 25 p 0.05 Genome build: z10 Supplementary files format and content: iCLIP peaks identified by CTK tool were provided in bed file format. The first three columns represent the 0 based location of the peak in the genome and the last column represents the strand.The fourth column reprents the peak ID and describes the gene locus peak heightPH expected PH/backgroundPH0 and pvalueP. The fifth column represents the peak height.	zebrafish embryos		iCLIP seq was carried out as previously described Despic et al. 2017. Breifly flag elavl1a mRNA injected embryos were collected at xxx h.p.f. and 6 h.p.f.. 400 zebrafish embryos were irradiated twice with 0.8 J/cm2 Stratalinker 2400 Stratagene lysed and subjected to mild RNA fragmentation. Crosslinked RNA proteins complexes were immunopurified using Anti FLAG M2 Magnetic Beads Merck M8823 for 4 h.p.f. and 6 h.p.f. at 4 °C. RNA was extracted Library construction was performed by using Smarter smRNA Seq kit Clontech Laboratories Inc	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain:zebrafish embryos\|cell type:normal zebrafish embryos cells\|age:4hpf	GSM4157936	GSM4157936: sphere Flag Elavl1a iCLIP rep1; Danio rerio; OTHER	GSM4157936		1	iCLIP seq was carried out as previously described Despic et al. 2017. Breifly flag elavl1a mRNA injected embryos were collected at xxx h.p.f. and 6 h.p.f.. 400 zebrafish embryos were irradiated twice with 0.8 J/cm2 Stratalinker 2400 Stratagene lysed and subjected to mild RNA fragmentation. Crosslinked RNA proteins complexes were immunopurified using Anti FLAG M2 Magnetic Beads Merck M8823 for 4 h.p.f. and 6 h.p.f. at 4 °C. RNA was extracted Library construction was performed by using Smarter smRNA Seq kit Clontech Laboratories Inc	GEO Accession:GSM4157936	OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	HiSeq X Ten	SRP163087		Sphere_Elavl1a_iCLIP_rep1.R2.fq.gz Sphere_Elavl1a_iCLIP_rep1.R1.fq.gz	fastq fastq	15794202300.0	52647341.0	GSM4157936 r1	0:150 1:150	A:4443931911;C:3527112429;G:3707720167;T:4114188890;N:1248903	150	150	4443931911	3527112429	3707720167	4114188890	1248903	SRX7130629	SRS5639973	SRA787572	GEO	Life Science, Tsinghua University	2	0.06877	0.10388	0.02139	0.07135	0.99776	0.98413	0.87145	0.57456	150	150	B	B	mate1-mate2 similar by mapping diff	illumina	hiseq_era	full_length	poly_a	smarter	bulk	clip	iclip	China	2019-11-12	Blastula	Embryo	Embryo Imprecise	All anatomical structures
49577	49577	SRR7947926	SRX4781875	SRS3862067	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.		pubmed:32423473	elavl1a morphant 6h rna seq rep2	GSM3409399	source name:elavl1a morphant 6h rna seq rep2\|strain:AB\|tissue:zebrafish embryos\|genotype/variation:elavl1a morphants zebrafish embryos cells\|age:6hpf	elavl1a morphant 6h rna seq rep2	trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	elavl1a morphant 6h rna seq rep2	For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain:AB\|tissue:zebrafish embryos\|genotype/variation:elavl1a morphants zebrafish embryos cells\|age:6hpf	GSM3409399	GSM3409399: elavl1a morphant 6h rna seq rep2; Danio rerio; RNA Seq	GSM3409399		1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM3409399	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	HiSeq X Ten	SRP163087		elavl1a_morphant_6h_rna-seq_rep2.R1.fastq.gz elavl1a_morphant_6h_rna-seq_rep2.R2.fastq.gz	fastq fastq	19875464400.0	66251548.0	GSM3409399 r1	0:150 1:150	A:5352630990;C:4584661408;G:4726300804;T:5209787586;N:2083612	150	150	5352630990	4584661408	4726300804	5209787586	2083612	SRX4781875	SRS3862067	SRA787572	GEO	Life Science, Tsinghua University	2	0.94901	0.95039	0.09074	0.08943	0.75866	0.76418	0.55609	0.56574	150	150	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2018-10-01	Gastrula	Embryo	Embryo Imprecise	All anatomical structures
49578	49578	SRR7947925	SRX4781874	SRS3862066	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.		pubmed:32423473	elavl1a morphant 6h rna seq rep1	GSM3409398	source name:elavl1a morphant 6h rna seq rep1\|strain:AB\|tissue:zebrafish embryos\|genotype/variation:elavl1a morphants zebrafish embryos cells\|age:6hpf	elavl1a morphant 6h rna seq rep1	trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	elavl1a morphant 6h rna seq rep1	For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain:AB\|tissue:zebrafish embryos\|genotype/variation:elavl1a morphants zebrafish embryos cells\|age:6hpf	GSM3409398	GSM3409398: elavl1a morphant 6h rna seq rep1; Danio rerio; RNA Seq	GSM3409398		1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM3409398	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	HiSeq X Ten	SRP163087		elavl1a_morphant_6h_rna-seq_rep1.R2.fastq.gz elavl1a_morphant_6h_rna-seq_rep1.R1.fastq.gz	fastq fastq	20202214200.0	67340714.0	GSM3409398 r1	0:150 1:150	A:5439747248;C:4667041902;G:4805911969;T:5287977733;N:1535348	150	150	5439747248	4667041902	4805911969	5287977733	1535348	SRX4781874	SRS3862066	SRA787572	GEO	Life Science, Tsinghua University	2	0.94586	0.94757	0.09031	0.09016	0.76019	0.76493	0.55951	0.56185	150	150	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2018-10-01	Gastrula	Embryo	Embryo Imprecise	All anatomical structures
49579	49579	SRR7947924	SRX4781873	SRS3862065	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.		pubmed:32423473	elavl1a morphant 4h rna seq rep2	GSM3409397	source name:elavl1a morphant 4h rna seq rep2\|strain:AB\|tissue:zebrafish embryos\|genotype/variation:elavl1a morphants zebrafish embryos cells\|age:4hpf	elavl1a morphant 4h rna seq rep2	trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	elavl1a morphant 4h rna seq rep2	For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain:AB\|tissue:zebrafish embryos\|genotype/variation:elavl1a morphants zebrafish embryos cells\|age:4hpf	GSM3409397	GSM3409397: elavl1a morphant 4h rna seq rep2; Danio rerio; RNA Seq	GSM3409397		1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM3409397	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	HiSeq X Ten	SRP163087		elavl1a_morphant_4h_rna-seq_rep2.R2.fastq.gz elavl1a_morphant_4h_rna-seq_rep2.R1.fastq.gz	fastq fastq	38764196400.0	129213988.0	GSM3409397 r1	0:150 1:150	A:10980499317;C:8394995318;G:8739322914;T:10645637187;N:3741664	150	150	10980499317	8394995318	8739322914	10645637187	3741664	SRX4781873	SRS3862065	SRA787572	GEO	Life Science, Tsinghua University	2	0.94567	0.94509	0.06713	0.06614	0.76191	0.76508	0.73283	0.74007	150	150	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2018-10-01	Blastula	Embryo	Embryo Imprecise	All anatomical structures
49580	49580	SRR7947923	SRX4781872	SRS3862064	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.		pubmed:32423473	elavl1a morphant 4h rna seq rep1	GSM3409396	source name:elavl1a morphant 4h rna seq rep1\|strain:AB\|tissue:zebrafish embryos\|genotype/variation:elavl1a morphants zebrafish embryos cells\|age:4hpf	elavl1a morphant 4h rna seq rep1	trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	elavl1a morphant 4h rna seq rep1	For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain:AB\|tissue:zebrafish embryos\|genotype/variation:elavl1a morphants zebrafish embryos cells\|age:4hpf	GSM3409396	GSM3409396: elavl1a morphant 4h rna seq rep1; Danio rerio; RNA Seq	GSM3409396		1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM3409396	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	HiSeq X Ten	SRP163087		elavl1a_morphant_4h_rna-seq_rep1.R1.fastq.gz elavl1a_morphant_4h_rna-seq_rep1.R2.fastq.gz	fastq fastq	34417602600.0	114725342.0	GSM3409396 r1	0:150 1:150	A:9798364920;C:7402367067;G:7677976380;T:9534399996;N:4494237	150	150	9798364920	7402367067	7677976380	9534399996	4494237	SRX4781872	SRS3862064	SRA787572	GEO	Life Science, Tsinghua University	2	0.94663	0.94701	0.06442	0.06367	0.76264	0.7655	0.73483	0.74221	150	150	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2018-10-01	Blastula	Embryo	Embryo Imprecise	All anatomical structures
49581	49581	SRR7947922	SRX4781871	SRS3862063	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.		pubmed:32423473	control 6h rna seq rep2	GSM3409395	source name:control 6h rna seq rep2\|strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:6hpf	control 6h rna seq rep2	trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	control 6h rna seq rep2	For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:6hpf	GSM3409395	GSM3409395: control 6h rna seq rep2; Danio rerio; RNA Seq	GSM3409395		1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM3409395	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	HiSeq X Ten	SRP163087		control_6h_rna-seq_rep2.R1.fastq.gz control_6h_rna-seq_rep2.R2.fastq.gz	fastq fastq	39198242400.0	130660808.0	GSM3409395 r1	0:150 1:150	A:11268897172;C:8355243125;G:8663182840;T:10907160510;N:3758753	150	150	11268897172	8355243125	8663182840	10907160510	3758753	SRX4781871	SRS3862063	SRA787572	GEO	Life Science, Tsinghua University	2	0.94553	0.94591	0.09312	0.09248	0.78098	0.78397	0.73432	0.73781	150	150	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2018-10-01	Gastrula	Embryo	Embryo Imprecise	All anatomical structures
49582	49582	SRR7947921	SRX4781870	SRS3862062	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.		pubmed:32423473	control 6h rna seq rep1	GSM3409394	source name:control 6h rna seq rep1\|strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:6hpf	control 6h rna seq rep1	trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	control 6h rna seq rep1	For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:6hpf	GSM3409394	GSM3409394: control 6h rna seq rep1; Danio rerio; RNA Seq	GSM3409394		1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM3409394	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	HiSeq X Ten	SRP163087		control_6h_rna-seq_rep1.R1.fastq.gz control_6h_rna-seq_rep1.R2.fastq.gz	fastq fastq	49781358600.0	165937862.0	GSM3409394 r1	0:150 1:150	A:14340306167;C:10572507738;G:11006666686;T:13855405563;N:6472446	150	150	14340306167	10572507738	11006666686	13855405563	6472446	SRX4781870	SRS3862062	SRA787572	GEO	Life Science, Tsinghua University	2	0.94466	0.94506	0.09485	0.09402	0.77782	0.78303	0.72367	0.72791	150	150	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2018-10-01	Gastrula	Embryo	Embryo Imprecise	All anatomical structures
49583	49583	SRR7947920	SRX4781869	SRS3862061	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.		pubmed:32423473	control 4h rna seq rep2	GSM3409393	source name:control 4h rna seq rep2\|strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:4hpf	control 4h rna seq rep2	trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	control 4h rna seq rep2	For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:4hpf	GSM3409393	GSM3409393: control 4h rna seq rep2; Danio rerio; RNA Seq	GSM3409393		1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM3409393	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	HiSeq X Ten	SRP163087		control_4h_rna-seq_rep2.R1.fastq.gz control_4h_rna-seq_rep2.R2.fastq.gz	fastq fastq	33462197400.0	111540658.0	GSM3409393 r1	0:150 1:150	A:9246596683;C:7497270682;G:7798285753;T:8916810951;N:3233331	150	150	9246596683	7497270682	7798285753	8916810951	3233331	SRX4781869	SRS3862061	SRA787572	GEO	Life Science, Tsinghua University	2	0.94792	0.94861	0.0862	0.08529	0.76084	0.76309	0.73536	0.73703	150	150	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2018-10-01	Blastula	Embryo	Embryo Imprecise	All anatomical structures
49584	49584	SRR7947919	SRX4781868	SRS3862060	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.		pubmed:32423473	control 4h rna seq rep1	GSM3409392	source name:control 4h rna seq rep1\|strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:4hpf	control 4h rna seq rep1	trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	control 4h rna seq rep1	For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:4hpf	GSM3409392	GSM3409392: control 4h rna seq rep1; Danio rerio; RNA Seq	GSM3409392		1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM3409392	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	HiSeq X Ten	SRP163087		control_4h_rna-seq_rep1.R1.fastq.gz control_4h_rna-seq_rep1.R2.fastq.gz	fastq fastq	38719753500.0	129065845.0	GSM3409392 r1	0:150 1:150	A:10763970685;C:8606443742;G:8961006857;T:10383272808;N:5059408	150	150	10763970685	8606443742	8961006857	10383272808	5059408	SRX4781868	SRS3862060	SRA787572	GEO	Life Science, Tsinghua University	2	0.94748	0.948	0.08608	0.08505	0.76023	0.76357	0.72873	0.73242	150	150	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2018-10-01	Blastula	Embryo	Embryo Imprecise	All anatomical structures
49585	49585	SRR7947918	SRX4781867	SRS3862059	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.		pubmed:32423473	control 2h rna seq rep2	GSM3409391	source name:control 2h rna seq rep2\|strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:2hpf	control 2h rna seq rep2	trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	control 2h rna seq rep2	For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:2hpf	GSM3409391	GSM3409391: control 2h rna seq rep2; Danio rerio; RNA Seq	GSM3409391		1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM3409391	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	HiSeq X Ten	SRP163087		control_2h_rna-seq_rep2.R1.fastq.gz control_2h_rna-seq_rep2.R2.fastq.gz	fastq fastq	39017750100.0	130059167.0	GSM3409391 r1	0:150 1:150	A:10979134932;C:8549683633;G:8854910977;T:10629254366;N:4766192	150	150	10979134932	8549683633	8854910977	10629254366	4766192	SRX4781867	SRS3862059	SRA787572	GEO	Life Science, Tsinghua University	2	0.94685	0.94869	0.03416	0.03311	0.76536	0.76731	0.65079	0.65387	150	150	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2018-10-01	Cleavage	Embryo	Embryo Imprecise	All anatomical structures
49586	49586	SRR7947917	SRX4781866	SRS3862058	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.		pubmed:32423473	control 2h rna seq rep1	GSM3409390	source name:control 2h rna seq rep1\|strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:2hpf	control 2h rna seq rep1	trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	control 2h rna seq rep1	For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:2hpf	GSM3409390	GSM3409390: control 2h rna seq rep1; Danio rerio; RNA Seq	GSM3409390		1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM3409390	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	HiSeq X Ten	SRP163087		control_2h_rna-seq_rep1.R1.fastq.gz control_2h_rna-seq_rep1.R2.fastq.gz	fastq fastq	33999089400.0	113330298.0	GSM3409390 r1	0:150 1:150	A:9602786363;C:7418727808;G:7667052932;T:9305137704;N:5384593	150	150	9602786363	7418727808	7667052932	9305137704	5384593	SRX4781866	SRS3862058	SRA787572	GEO	Life Science, Tsinghua University	2	0.94874	0.95121	0.03388	0.03264	0.76524	0.76662	0.65127	0.65427	150	150	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2018-10-01	Cleavage	Embryo	Embryo Imprecise	All anatomical structures
49587	49587	SRR7947911	SRX4781863	SRS3862055	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.		pubmed:32423473	shield NAIN3 icSHAPE	GSM3409387	source name:shield NAIN3\|strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:6hpf	shield NAIN3 icSHAPE	Library strategy: icSHAPE icSHAPE computational pipeline reference: PubMedID: 26766114 DOI: 10.1038/nprot.2016.011 trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	shield NAIN3	For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5 C for 5min.	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:6hpf	GSM3409387	GSM3409387: shield NAIN3; Danio rerio; OTHER	GSM3409387		1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM3409387	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP163087		shield_NAIN3_rep1.fastq.gz	fastq	152239039350.0	1014926929.0	GSM3409387 r1	0:150 1:0	A:44641737173;C:38963190534;G:30007693087;T:38607452480;N:18966076	150	0	44641737173	38963190534	30007693087	38607452480	18966076	SRX4781863	SRS3862055	SRA787572	GEO	Life Science, Tsinghua University	1	0.02906		0.01259		0.97009		0.74209		150		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2018-10-01	Gastrula	Embryo	Embryo Imprecise	All anatomical structures
49588	49588	SRR7947912	SRX4781863	SRS3862055	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.		pubmed:32423473	shield NAIN3 icSHAPE	GSM3409387	source name:shield NAIN3\|strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:6hpf	shield NAIN3 icSHAPE	Library strategy: icSHAPE icSHAPE computational pipeline reference: PubMedID: 26766114 DOI: 10.1038/nprot.2016.011 trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	shield NAIN3	For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5 C for 5min.	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:6hpf	GSM3409387	GSM3409387: shield NAIN3; Danio rerio; OTHER	GSM3409387		1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM3409387	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP163087	loader:latf load	shield_NAIN3_rep2.fastq.gz	fastq	179520653400.0	1196804356.0	GSM3409387 r2	0:150 1:0	A:48366148973;C:44018616729;G:44760216650;T:42350167763;N:25503285	150	0	48366148973	44018616729	44760216650	42350167763	25503285	SRX4781863	SRS3862055	SRA787572	GEO	Life Science, Tsinghua University	1	0.03361		0.01615		0.96497		0.718		150		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2018-10-01	Gastrula	Embryo	Embryo Imprecise	All anatomical structures
49589	49589	SRR7947909	SRX4781862	SRS3862054	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.		pubmed:32423473	shield DMSO icSHAPE	GSM3409386	source name:shield DMSO\|strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:6hpf	shield DMSO icSHAPE	Library strategy: icSHAPE icSHAPE computational pipeline reference: PubMedID: 26766114 DOI: 10.1038/nprot.2016.011 trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	shield DMSO	For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5 C for 5min.	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:6hpf	GSM3409386	GSM3409386: shield DMSO; Danio rerio; OTHER	GSM3409386		1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM3409386	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP163087		shield_DMSO_rep1.fastq.gz	fastq	39528129600.0	263520864.0	GSM3409386 r1	0:150 1:0	A:11887790635;C:9698771811;G:8565313614;T:9372993255;N:3260285	150	0	11887790635	9698771811	8565313614	9372993255	3260285	SRX4781862	SRS3862054	SRA787572	GEO	Life Science, Tsinghua University	1	0.06286		0.01684		0.93336		0.718		150		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2018-10-01	Gastrula	Embryo	Embryo Imprecise	All anatomical structures
49590	49590	SRR7947910	SRX4781862	SRS3862054	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.		pubmed:32423473	shield DMSO icSHAPE	GSM3409386	source name:shield DMSO\|strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:6hpf	shield DMSO icSHAPE	Library strategy: icSHAPE icSHAPE computational pipeline reference: PubMedID: 26766114 DOI: 10.1038/nprot.2016.011 trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	shield DMSO	For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5 C for 5min.	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:6hpf	GSM3409386	GSM3409386: shield DMSO; Danio rerio; OTHER	GSM3409386		1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM3409386	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP163087		shield_DMSO_rep2.fastq.gz	fastq	43632084450.0	290880563.0	GSM3409386 r2	0:150 1:0	A:12666468004;C:10421063446;G:9540808484;T:10977192542;N:26551974	150	0	12666468004	10421063446	9540808484	10977192542	26551974	SRX4781862	SRS3862054	SRA787572	GEO	Life Science, Tsinghua University	1	0.08049		0.02275		0.91616		0.64879		150		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2018-10-01	Gastrula	Embryo	Embryo Imprecise	All anatomical structures
49591	49591	SRR7947907	SRX4781861	SRS3862053	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.		pubmed:32423473	sphere NAIN3 icSHAPE	GSM3409385	source name:sphere NAIN3\|strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:4hpf	sphere NAIN3 icSHAPE	Library strategy: icSHAPE icSHAPE computational pipeline reference: PubMedID: 26766114 DOI: 10.1038/nprot.2016.011 trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	sphere NAIN3	For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5 C for 5min.	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:4hpf	GSM3409385	GSM3409385: sphere NAIN3; Danio rerio; OTHER	GSM3409385		1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM3409385	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP163087	loader:latf load	sphere_NAIN3_rep1.fastq.gz	fastq	146089426800.0	973929512.0	GSM3409385 r1	0:150 1:0	A:42514514559;C:39238639903;G:29724694125;T:34595978556;N:15599657	150	0	42514514559	39238639903	29724694125	34595978556	15599657	SRX4781861	SRS3862053	SRA787572	GEO	Life Science, Tsinghua University	1	0.02746		0.01225		0.97013		0.77486		150		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2018-10-01	Blastula	Embryo	Embryo Imprecise	All anatomical structures
49592	49592	SRR7947908	SRX4781861	SRS3862053	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.		pubmed:32423473	sphere NAIN3 icSHAPE	GSM3409385	source name:sphere NAIN3\|strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:4hpf	sphere NAIN3 icSHAPE	Library strategy: icSHAPE icSHAPE computational pipeline reference: PubMedID: 26766114 DOI: 10.1038/nprot.2016.011 trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	sphere NAIN3	For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5 C for 5min.	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:4hpf	GSM3409385	GSM3409385: sphere NAIN3; Danio rerio; OTHER	GSM3409385		1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM3409385	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP163087		sphere_NAIN3_rep2.fastq.gz	fastq	129289327500.0	861928850.0	GSM3409385 r2	0:150 1:0	A:36336840338;C:31424534096;G:31054195778;T:30457153761;N:16603527	150	0	36336840338	31424534096	31054195778	30457153761	16603527	SRX4781861	SRS3862053	SRA787572	GEO	Life Science, Tsinghua University	1	0.02812		0.00884		0.95887		0.7364		150		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2018-10-01	Blastula	Embryo	Embryo Imprecise	All anatomical structures
49593	49593	SRR7947905	SRX4781860	SRS3862052	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.		pubmed:32423473	sphere DMSO icSHAPE	GSM3409384	source name:sphere DMSO\|strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:4hpf	sphere DMSO icSHAPE	Library strategy: icSHAPE icSHAPE computational pipeline reference: PubMedID: 26766114 DOI: 10.1038/nprot.2016.011 trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	sphere DMSO	For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5 C for 5min.	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:4hpf	GSM3409384	GSM3409384: sphere DMSO; Danio rerio; OTHER	GSM3409384		1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM3409384	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP163087		sphere_DMSO_rep1.fastq.gz	fastq	57691963050.0	384613087.0	GSM3409384 r1	0:150 1:0	A:16432201667;C:13571913193;G:12837196407;T:14845080025;N:5571758	150	0	16432201667	13571913193	12837196407	14845080025	5571758	SRX4781860	SRS3862052	SRA787572	GEO	Life Science, Tsinghua University	1	0.1036		0.01136		0.87645		0.65935		150		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2018-10-01	Blastula	Embryo	Embryo Imprecise	All anatomical structures
49594	49594	SRR7947906	SRX4781860	SRS3862052	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.		pubmed:32423473	sphere DMSO icSHAPE	GSM3409384	source name:sphere DMSO\|strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:4hpf	sphere DMSO icSHAPE	Library strategy: icSHAPE icSHAPE computational pipeline reference: PubMedID: 26766114 DOI: 10.1038/nprot.2016.011 trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	sphere DMSO	For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5 C for 5min.	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:4hpf	GSM3409384	GSM3409384: sphere DMSO; Danio rerio; OTHER	GSM3409384		1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM3409384	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP163087		sphere_DMSO_rep2.fastq.gz	fastq	67804917750.0	452032785.0	GSM3409384 r2	0:150 1:0	A:18522337687;C:17556962469;G:15356031761;T:16361409956;N:8175877	150	0	18522337687	17556962469	15356031761	16361409956	8175877	SRX4781860	SRS3862052	SRA787572	GEO	Life Science, Tsinghua University	1	0.04269		0.00601		0.92652		0.69825		150		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2018-10-01	Blastula	Embryo	Embryo Imprecise	All anatomical structures
49595	49595	SRR7947903	SRX4781859	SRS3862051	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.		pubmed:32423473	2h NAIN3 icSHAPE	GSM3409383	source name:2h NAIN3\|strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:2hpf	2h NAIN3 icSHAPE	Library strategy: icSHAPE icSHAPE computational pipeline reference: PubMedID: 26766114 DOI: 10.1038/nprot.2016.011 trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	2h NAIN3	For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5 C for 5min.	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:2hpf	GSM3409383	GSM3409383: 2h NAIN3; Danio rerio; OTHER	GSM3409383		1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM3409383	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP163087		2h_NAIN3_rep1.fastq.gz	fastq	124853039850.0	832353599.0	GSM3409383 r1	0:150 1:0	A:37867788703;C:28959738468;G:28543301824;T:29453073564;N:29137291	150	0	37867788703	28959738468	28543301824	29453073564	29137291	SRX4781859	SRS3862051	SRA787572	GEO	Life Science, Tsinghua University	1	0.03381		0.00848		0.94479		0.68089		150		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2018-10-01	Cleavage	Embryo	Embryo Imprecise	All anatomical structures
49596	49596	SRR7947904	SRX4781859	SRS3862051	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.		pubmed:32423473	2h NAIN3 icSHAPE	GSM3409383	source name:2h NAIN3\|strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:2hpf	2h NAIN3 icSHAPE	Library strategy: icSHAPE icSHAPE computational pipeline reference: PubMedID: 26766114 DOI: 10.1038/nprot.2016.011 trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	2h NAIN3	For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5 C for 5min.	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:2hpf	GSM3409383	GSM3409383: 2h NAIN3; Danio rerio; OTHER	GSM3409383		1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM3409383	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP163087	loader:latf load	2h_NAIN3_rep2.fastq.gz	fastq	159060679200.0	1060404528.0	GSM3409383 r2	0:150 1:0	A:45617471657;C:38274494766;G:38676362132;T:36414708832;N:77641813	150	0	45617471657	38274494766	38676362132	36414708832	77641813	SRX4781859	SRS3862051	SRA787572	GEO	Life Science, Tsinghua University	1	0.03227		0.01386		0.96081		0.70955		150		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2018-10-01	Cleavage	Embryo	Embryo Imprecise	All anatomical structures
49597	49597	SRR7947901	SRX4781858	SRS3862049	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.		pubmed:32423473	2h DMSO icSHAPE	GSM3409382	source name:2h DMSO\|strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:2hpf	2h DMSO icSHAPE	Library strategy: icSHAPE icSHAPE computational pipeline reference: PubMedID: 26766114 DOI: 10.1038/nprot.2016.011 trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	2h DMSO	For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5 C for 5min.	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:2hpf	GSM3409382	GSM3409382: 2h DMSO; Danio rerio; OTHER	GSM3409382		1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM3409382	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP163087		2h_DMSO_rep1.fastq.gz	fastq	33202617900.0	221350786.0	GSM3409382 r1	0:150 1:0	A:9125761193;C:9027862202;G:7094595163;T:7949637340;N:4762002	150	0	9125761193	9027862202	7094595163	7949637340	4762002	SRX4781858	SRS3862049	SRA787572	GEO	Life Science, Tsinghua University	1	0.05426		0.01047		0.92322		0.74332		150		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2018-10-01	Cleavage	Embryo	Embryo Imprecise	All anatomical structures
49598	49598	SRR7947902	SRX4781858	SRS3862049	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.		pubmed:32423473	2h DMSO icSHAPE	GSM3409382	source name:2h DMSO\|strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:2hpf	2h DMSO icSHAPE	Library strategy: icSHAPE icSHAPE computational pipeline reference: PubMedID: 26766114 DOI: 10.1038/nprot.2016.011 trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	2h DMSO	For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5 C for 5min.	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:2hpf	GSM3409382	GSM3409382: 2h DMSO; Danio rerio; OTHER	GSM3409382		1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM3409382	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP163087		2h_DMSO_rep2.fastq.gz	fastq	48461244300.0	323074962.0	GSM3409382 r2	0:150 1:0	A:14458403614;C:11285495528;G:10770012549;T:11944151781;N:3180828	150	0	14458403614	11285495528	10770012549	11944151781	3180828	SRX4781858	SRS3862049	SRA787572	GEO	Life Science, Tsinghua University	1	0.05259		0.01006		0.93206		0.75282		150		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2018-10-01	Cleavage	Embryo	Embryo Imprecise	All anatomical structures
49599	49599	SRR7947899	SRX4781857	SRS3862050	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.		pubmed:32423473	4 cell NAIN3 icSHAPE	GSM3409381	source name:4 cell NAIN3\|strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:1hpf	4 cell NAIN3 icSHAPE	Library strategy: icSHAPE icSHAPE computational pipeline reference: PubMedID: 26766114 DOI: 10.1038/nprot.2016.011 trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	4 cell NAIN3	For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5 C for 5min.	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:1hpf	GSM3409381	GSM3409381: 4 cell NAIN3; Danio rerio; OTHER	GSM3409381		1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM3409381	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP163087		4-cell_NAIN3_rep1.fastq.gz	fastq	125465584950.0	836437233.0	GSM3409381 r1	0:150 1:0	A:38241494342;C:30192135809;G:25141580458;T:31866971314;N:23403027	150	0	38241494342	30192135809	25141580458	31866971314	23403027	SRX4781857	SRS3862050	SRA787572	GEO	Life Science, Tsinghua University	1	0.02986		0.00805		0.9498		0.69733		150		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2018-10-01	Cleavage	Embryo	Embryo Imprecise	All anatomical structures
49600	49600	SRR7947900	SRX4781857	SRS3862050	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.		pubmed:32423473	4 cell NAIN3 icSHAPE	GSM3409381	source name:4 cell NAIN3\|strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:1hpf	4 cell NAIN3 icSHAPE	Library strategy: icSHAPE icSHAPE computational pipeline reference: PubMedID: 26766114 DOI: 10.1038/nprot.2016.011 trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	4 cell NAIN3	For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5 C for 5min.	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:1hpf	GSM3409381	GSM3409381: 4 cell NAIN3; Danio rerio; OTHER	GSM3409381		1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM3409381	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP163087		4-cell_NAIN3_rep2.fastq.gz	fastq	124831078200.0	832207188.0	GSM3409381 r2	0:150 1:0	A:37122083059;C:30832904838;G:28247183546;T:28612305554;N:16601203	150	0	37122083059	30832904838	28247183546	28612305554	16601203	SRX4781857	SRS3862050	SRA787572	GEO	Life Science, Tsinghua University	1	0.04217		0.01947		0.95542		0.71549		150		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2018-10-01	Cleavage	Embryo	Embryo Imprecise	All anatomical structures
49601	49601	SRR7947897	SRX4781856	SRS3862048	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.		pubmed:32423473	4 cell DMSO icSHAPE	GSM3409380	source name:4 cell DMSO\|strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:1hpf	4 cell DMSO icSHAPE	Library strategy: icSHAPE icSHAPE computational pipeline reference: PubMedID: 26766114 DOI: 10.1038/nprot.2016.011 trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	4 cell DMSO	For in vivo treatment cells was incubated with NAI N3 or DMSO at 28.5 C for 5min.	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:1hpf	GSM3409380	GSM3409380: 4 cell DMSO; Danio rerio; OTHER	GSM3409380		1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM3409380	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP163087		4-cell_DMSO_rep1.fastq.gz	fastq	36427183500.0	242847890.0	GSM3409380 r1	0:150 1:0	A:10144008700;C:9612700528;G:7003058984;T:9662936070;N:4479218	150	0	10144008700	9612700528	7003058984	9662936070	4479218	SRX4781856	SRS3862048	SRA787572	GEO	Life Science, Tsinghua University	1	0.02972		0.00598		0.94998		0.74592		150		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2018-10-01	Cleavage	Embryo	Embryo Imprecise	All anatomical structures

Advanced export

JSON shape: default, array, newline-delimited

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;