run_metadata
28 rows where experiment.library_source = "TRANSCRIPTOMIC", experiment.library_strategy = "ncRNA-Seq" and tissue_curation_coarse = "Reproductive System"
This data as json, CSV (advanced)
| Link | rowid ▼ | run.accession | experiment.accession | sample.accession | study.accession | bioproject | study.title | study.alias | study.type | study.abstract | study.attributes | study.PMIDs | sample.description | sample.title | sample.alias | sample.centername | sample.attributes | GEOsample.title | GEOsample.dataprocessing | GEOsample.source | GEOsample.treatmentprotocol | GEOsample.extractprotocol | GEOsample.growthprotocol | GEOsample.characteristics | GEOsample.accession | experiment.title | experiment.alias | experiment.library_name | experiment.design_description | experiment.library_construction_protocol | experiment.attributes | experiment.library_strategy | experiment.library_source | experiment.library_selection | experiment.library_layout | experiment.platform | experiment.instrument_model | experiment.spot_descriptor | experiment.study_ref | run.title | run.attributes | run.filename | run.semantic_name | run.total_bases | run.total_spots | run.alias | run.read_lengths | run.base_counts | run.r1_length | run.r2_length | run.r3_length | run.r4_length | run.Acount | run.Ccount | run.Gcount | run.Tcount | run.Ncount | run.experiment | run.pool_member | submission.accession | submission.srasource | submission.bioprojectsource | seqdetective.n_mates | seqdetective.mapping_rate.mate1 | seqdetective.mapping_rate.mate2 | seqdetective.nofeature_rate.mate1 | seqdetective.nofeature_rate.mate2 | seqdetective.sparsity.mate1 | seqdetective.sparsity.mate2 | seqdetective.pos_strand_rate.mate1 | seqdetective.pos_strand_rate.mate2 | seqdetective.readlen.mate1 | seqdetective.readlen.mate2 | seqdetective.judgement.mate1 | seqdetective.judgement.mate2 | seqdetective.judgement.reason | platform_family | instrument_generation | read_bias | selection_class | prep_kit | sc_or_bulk | tech_class | technology | tech_variant | submission.bioprojectsource.country | earliest_date | devstage_curation | devstage_curation_coarse | tissue_curation | tissue_curation_coarse |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 25293 | 25293 | SRR25764131 | SRX21486791 | SRS18719090 | SRP457111 | PRJNA1009808 | Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] | GSE241754 | Transcriptome Analysis | Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. | parent bioproject:PRJNA1009800 | pubmed:39402326 | WT egg 0 hpf tRNA seq rep2 | GSM7734772 | source name:Unfertilized egg|strain:TLAB strain|tissue:Unfertilized egg|developmental stage:unfertilized egg 0 hpf|genotype:WT|geo loc name:missing|collection date:missing | WT egg 0 hpf tRNA seq rep2 | Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts | Unfertilized egg | unperturbed growth conditions in E3 medium for zebrafish embryos. | 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq | Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle. | strain:TLAB strain|tissue:Unfertilized egg|developmental stage:unfertilized egg 0 hpf|genotype:WT | GSM7734772 | GSM7734772: WT egg 0 hpf tRNA seq rep2; Danio rerio; ncRNA Seq | GSM7734772 r1 | GSM7734772 | 1 | 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 500 | SRP457111 | WT_tRNA_egg_2.fastq.gz | fastq | 206374994.0 | 3181706.0 | GSM7734772 r1 | 0:64.86 | A:41195250;C:56578032;G:56479855;T:52121365;N:492 | 64 | 41195250 | 56578032 | 56479855 | 52121365 | 492 | SRX21486791 | SRS18719090 | SRA1700461 | Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry | Max Planck Institute of Biochemistry | 1 | 0.28659 | 0.02017 | 0.9207 | 0.48536 | 78 | B | usable mapping rate | illumina | nextseq | 5prime | size_fractionation | unknown | bulk | unknown | unknown | Germany | 2023-08-28 | Zygote | Embryo | Oocyte | Reproductive System | ||||||||||||||||
| 25294 | 25294 | SRR25764132 | SRX21486790 | SRS18719089 | SRP457111 | PRJNA1009808 | Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] | GSE241754 | Transcriptome Analysis | Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. | parent bioproject:PRJNA1009800 | pubmed:39402326 | WT egg 0 hpf tRNA seq rep1 | GSM7734771 | source name:Unfertilized egg|strain:TLAB strain|tissue:Unfertilized egg|developmental stage:unfertilized egg 0 hpf|genotype:WT|geo loc name:missing|collection date:missing | WT egg 0 hpf tRNA seq rep1 | Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts | Unfertilized egg | unperturbed growth conditions in E3 medium for zebrafish embryos. | 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq | Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle. | strain:TLAB strain|tissue:Unfertilized egg|developmental stage:unfertilized egg 0 hpf|genotype:WT | GSM7734771 | GSM7734771: WT egg 0 hpf tRNA seq rep1; Danio rerio; ncRNA Seq | GSM7734771 r1 | GSM7734771 | 1 | 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 500 | SRP457111 | WT_tRNA_egg_1.fastq.gz | fastq | 86021968.0 | 1304769.0 | GSM7734771 r1 | 0:65.93 | A:17511521;C:23474625;G:23300759;T:21734864;N:199 | 65 | 17511521 | 23474625 | 23300759 | 21734864 | 199 | SRX21486790 | SRS18719089 | SRA1700461 | Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry | Max Planck Institute of Biochemistry | 1 | 0.29829 | 0.02027 | 0.92245 | 0.48877 | 74 | B | usable mapping rate | illumina | nextseq | 5prime | size_fractionation | unknown | bulk | unknown | unknown | Germany | 2023-08-28 | Zygote | Embryo | Oocyte | Reproductive System | ||||||||||||||||
| 41150 | 41150 | SRR3744678 | SRX1898686 | SRS1541536 | SRP077941 | PRJNA327880 | Analysis of piRNA production in meioc moto mutant zebrafish testis | GSE84060 | Transcriptome Analysis | We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals. | pubmed:39605693 | moto homozygous 5 | GSM2226636 | tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / | moto homozygous 5 | Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type. | testis | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / | GSM2226636 | GSM2226636: moto homozygous 5; Danio rerio; ncRNA Seq | GSM2226636 | 1 | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | GEO Accession:GSM2226636 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP077941 | 2118467988.0 | 41538588.0 | GSM2226636 r1 | 0:51 | A:616161510;C:469529175;G:576120961;T:456560109;N:96233 | 51 | 616161510 | 469529175 | 576120961 | 456560109 | 96233 | SRX1898686 | SRS1541536 | SRA438045 | GEO | Bioinformatics Core Facility, Institute of Molecular Biology | 1 | 0.52011 | 0.38818 | 0.90193 | 0.51677 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Germany | 2016-07-05 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||||
| 41151 | 41151 | SRR3744677 | SRX1898685 | SRS1541535 | SRP077941 | PRJNA327880 | Analysis of piRNA production in meioc moto mutant zebrafish testis | GSE84060 | Transcriptome Analysis | We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals. | pubmed:39605693 | moto homozygous 4 | GSM2226635 | tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / | moto homozygous 4 | Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type. | testis | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / | GSM2226635 | GSM2226635: moto homozygous 4; Danio rerio; ncRNA Seq | GSM2226635 | 1 | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | GEO Accession:GSM2226635 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP077941 | 1771929771.0 | 34743721.0 | GSM2226635 r1 | 0:51 | A:524609276;C:393148247;G:436902442;T:417188575;N:81231 | 51 | 524609276 | 393148247 | 436902442 | 417188575 | 81231 | SRX1898685 | SRS1541535 | SRA438045 | GEO | Bioinformatics Core Facility, Institute of Molecular Biology | 1 | 0.62874 | 0.45148 | 0.89008 | 0.52837 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Germany | 2016-07-05 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||||
| 41152 | 41152 | SRR3744676 | SRX1898684 | SRS1541534 | SRP077941 | PRJNA327880 | Analysis of piRNA production in meioc moto mutant zebrafish testis | GSE84060 | Transcriptome Analysis | We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals. | pubmed:39605693 | moto homozygous 3 | GSM2226634 | tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / | moto homozygous 3 | Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type. | testis | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / | GSM2226634 | GSM2226634: moto homozygous 3; Danio rerio; ncRNA Seq | GSM2226634 | 1 | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | GEO Accession:GSM2226634 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP077941 | 1849849917.0 | 36271567.0 | GSM2226634 r1 | 0:51 | A:554317433;C:408404232;G:459010543;T:428033928;N:83781 | 51 | 554317433 | 408404232 | 459010543 | 428033928 | 83781 | SRX1898684 | SRS1541534 | SRA438045 | GEO | Bioinformatics Core Facility, Institute of Molecular Biology | 1 | 0.69752 | 0.51829 | 0.89027 | 0.53775 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Germany | 2016-07-05 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||||
| 41153 | 41153 | SRR3744675 | SRX1898683 | SRS1541533 | SRP077941 | PRJNA327880 | Analysis of piRNA production in meioc moto mutant zebrafish testis | GSE84060 | Transcriptome Analysis | We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals. | pubmed:39605693 | moto homozygous 2 | GSM2226633 | tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / | moto homozygous 2 | Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type. | testis | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / | GSM2226633 | GSM2226633: moto homozygous 2; Danio rerio; ncRNA Seq | GSM2226633 | 1 | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | GEO Accession:GSM2226633 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP077941 | 1863615327.0 | 36541477.0 | GSM2226633 r1 | 0:51 | A:554370010;C:414418365;G:465346091;T:429394630;N:86231 | 51 | 554370010 | 414418365 | 465346091 | 429394630 | 86231 | SRX1898683 | SRS1541533 | SRA438045 | GEO | Bioinformatics Core Facility, Institute of Molecular Biology | 1 | 0.74326 | 0.52319 | 0.87361 | 0.53081 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Germany | 2016-07-05 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||||
| 41154 | 41154 | SRR3744674 | SRX1898682 | SRS1541532 | SRP077941 | PRJNA327880 | Analysis of piRNA production in meioc moto mutant zebrafish testis | GSE84060 | Transcriptome Analysis | We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals. | pubmed:39605693 | moto homozygous 1 | GSM2226632 | tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / | moto homozygous 1 | Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type. | testis | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / | GSM2226632 | GSM2226632: moto homozygous 1; Danio rerio; ncRNA Seq | GSM2226632 | 1 | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | GEO Accession:GSM2226632 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP077941 | 1453145193.0 | 28493043.0 | GSM2226632 r1 | 0:51 | A:435644830;C:320413861;G:361678589;T:335340817;N:67096 | 51 | 435644830 | 320413861 | 361678589 | 335340817 | 67096 | SRX1898682 | SRS1541532 | SRA438045 | GEO | Bioinformatics Core Facility, Institute of Molecular Biology | 1 | 0.66367 | 0.47841 | 0.88262 | 0.50114 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Germany | 2016-07-05 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||||
| 41155 | 41155 | SRR3744673 | SRX1898681 | SRS1541531 | SRP077941 | PRJNA327880 | Analysis of piRNA production in meioc moto mutant zebrafish testis | GSE84060 | Transcriptome Analysis | We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals. | pubmed:39605693 | moto heterozygous 6 | GSM2226631 | tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ | moto heterozygous 6 | Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type. | testis | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ | GSM2226631 | GSM2226631: moto heterozygous 6; Danio rerio; ncRNA Seq | GSM2226631 | 1 | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | GEO Accession:GSM2226631 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP077941 | 2009800248.0 | 39407848.0 | GSM2226631 r1 | 0:51 | A:586066305;C:443066820;G:503291347;T:477284226;N:91550 | 51 | 586066305 | 443066820 | 503291347 | 477284226 | 91550 | SRX1898681 | SRS1541531 | SRA438045 | GEO | Bioinformatics Core Facility, Institute of Molecular Biology | 1 | 0.69598 | 0.49191 | 0.8828 | 0.51759 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Germany | 2016-07-05 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||||
| 41156 | 41156 | SRR3744672 | SRX1898680 | SRS1541530 | SRP077941 | PRJNA327880 | Analysis of piRNA production in meioc moto mutant zebrafish testis | GSE84060 | Transcriptome Analysis | We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals. | pubmed:39605693 | moto heterozygous 5 | GSM2226630 | tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ | moto heterozygous 5 | Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type. | testis | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ | GSM2226630 | GSM2226630: moto heterozygous 5; Danio rerio; ncRNA Seq | GSM2226630 | 1 | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | GEO Accession:GSM2226630 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP077941 | 1833618504.0 | 35953304.0 | GSM2226630 r1 | 0:51 | A:510624241;C:446979639;G:473431335;T:402499572;N:83717 | 51 | 510624241 | 446979639 | 473431335 | 402499572 | 83717 | SRX1898680 | SRS1541530 | SRA438045 | GEO | Bioinformatics Core Facility, Institute of Molecular Biology | 1 | 0.73675 | 0.50008 | 0.87957 | 0.53243 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Germany | 2016-07-05 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||||
| 41157 | 41157 | SRR3744671 | SRX1898679 | SRS1541529 | SRP077941 | PRJNA327880 | Analysis of piRNA production in meioc moto mutant zebrafish testis | GSE84060 | Transcriptome Analysis | We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals. | pubmed:39605693 | moto heterozygous 4 | GSM2226629 | tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ | moto heterozygous 4 | Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type. | testis | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ | GSM2226629 | GSM2226629: moto heterozygous 4; Danio rerio; ncRNA Seq | GSM2226629 | 1 | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | GEO Accession:GSM2226629 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP077941 | 2011846776.0 | 39447976.0 | GSM2226629 r1 | 0:51 | A:566935163;C:480777294;G:518987229;T:445055757;N:91333 | 51 | 566935163 | 480777294 | 518987229 | 445055757 | 91333 | SRX1898679 | SRS1541529 | SRA438045 | GEO | Bioinformatics Core Facility, Institute of Molecular Biology | 1 | 0.7246 | 0.49021 | 0.88051 | 0.5202 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Germany | 2016-07-05 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||||
| 41158 | 41158 | SRR3744670 | SRX1898678 | SRS1541528 | SRP077941 | PRJNA327880 | Analysis of piRNA production in meioc moto mutant zebrafish testis | GSE84060 | Transcriptome Analysis | We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals. | pubmed:39605693 | moto heterozygous 3 | GSM2226628 | tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ | moto heterozygous 3 | Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type. | testis | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ | GSM2226628 | GSM2226628: moto heterozygous 3; Danio rerio; ncRNA Seq | GSM2226628 | 1 | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | GEO Accession:GSM2226628 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP077941 | 1618368312.0 | 31732712.0 | GSM2226628 r1 | 0:51 | A:476792369;C:353703619;G:406141931;T:381656601;N:73792 | 51 | 476792369 | 353703619 | 406141931 | 381656601 | 73792 | SRX1898678 | SRS1541528 | SRA438045 | GEO | Bioinformatics Core Facility, Institute of Molecular Biology | 1 | 0.67806 | 0.48273 | 0.88363 | 0.53518 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Germany | 2016-07-05 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||||
| 41159 | 41159 | SRR3744669 | SRX1898677 | SRS1541527 | SRP077941 | PRJNA327880 | Analysis of piRNA production in meioc moto mutant zebrafish testis | GSE84060 | Transcriptome Analysis | We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals. | pubmed:39605693 | moto heterozygous 2 | GSM2226627 | tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ | moto heterozygous 2 | Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type. | testis | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ | GSM2226627 | GSM2226627: moto heterozygous 2; Danio rerio; ncRNA Seq | GSM2226627 | 1 | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | GEO Accession:GSM2226627 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP077941 | 1825076565.0 | 35785815.0 | GSM2226627 r1 | 0:51 | A:543891854;C:404479103;G:451780092;T:424842227;N:83289 | 51 | 543891854 | 404479103 | 451780092 | 424842227 | 83289 | SRX1898677 | SRS1541527 | SRA438045 | GEO | Bioinformatics Core Facility, Institute of Molecular Biology | 1 | 0.53478 | 0.39486 | 0.89899 | 0.52282 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Germany | 2016-07-05 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||||
| 41160 | 41160 | SRR3744668 | SRX1898676 | SRS1541526 | SRP077941 | PRJNA327880 | Analysis of piRNA production in meioc moto mutant zebrafish testis | GSE84060 | Transcriptome Analysis | We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals. | pubmed:39605693 | moto heterozygous 1 | GSM2226626 | tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ | moto heterozygous 1 | Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type. | testis | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ | GSM2226626 | GSM2226626: moto heterozygous 1; Danio rerio; ncRNA Seq | GSM2226626 | 1 | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | GEO Accession:GSM2226626 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP077941 | 1358381226.0 | 26634926.0 | GSM2226626 r1 | 0:51 | A:402110510;C:300618987;G:340178435;T:315410530;N:62764 | 51 | 402110510 | 300618987 | 340178435 | 315410530 | 62764 | SRX1898676 | SRS1541526 | SRA438045 | GEO | Bioinformatics Core Facility, Institute of Molecular Biology | 1 | 0.68106 | 0.46812 | 0.87596 | 0.53427 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Germany | 2016-07-05 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||||
| 41693 | 41693 | SRR5122167 | SRX2437316 | SRS1872014 | SRP095411 | PRJNA358209 | Identification of a specific 13 miRNA expression signature during follicle activation in Zebrafish | GSE92639 | Transcriptome Analysis | Purpose: We aimed to investigate important miRNA events and to define specific miRNA expression signature underlying the follicle activation of zebrafish. Methods: By using small and regular RNA sequencing we performed transcriptomic analyses of PG primary growth stage I; inactive and PV pre vitellogenic stage II; activated follicles to decipher important miRNA and gene events underlying follicle activation of zebrafish. We identified differentially expressed miRNAs for subsequent qPCR validation and miRNA::target gene prediction. Interaction of candidate miRNA:: target gene pairs were further validated by luciferase reporter assay. Global gene networks involved during PG to PV transition were also assessed by Gene Ontology as well as KEGG pathway analyses. Results and Conclusion: Our expression results indicated that PG follicles can be well differentiated from PV follicles by simply using a specific 13 miRNA expression signature let 7a 7b 7c 5p 7d 5p 7h 7i; miR 21 23a 27c 3p 107a 3p 125b 5p 145 3p 202 5p. Besides we validated interactions of let 7i::atg4a miR 202 5p::c23h20orf24 and miR 144::ybx1 by luciferase reporter assay. Purpose: we aimed to investigate important miRNA events and to define specific miRNA expression signature underlying the follicle activation of zebrafish Overall design: To identify differentially expressed miRNAs and its potential downstream targets during follicle activation of zebrafish we carried out transcriptomic profiling by both small and regular RNA sequencing. By intersecting gene lists of the online predicted targets and RNA seq derived differentially expressed transcripts with a reciprocal expression pattern of miRNAs we shortlisted 6 pairs of miRNA::target gene for validation using luciferase reporter assay. | pubmed:29228146 | PG small RNA seq 2 | GSM2433869 | tissue:Ovarian follicle|strain:AB|cell type:Pre vitellogenic follicle|age:from ovary of 3 month zebrafish | PG small RNA seq 2 | For the RNA seq data all the pair end reads were mapped to the zebrafish genome using TopHat version 2.0.11. Genome annotation files with GTF format for known genes were downloaded from Ensembl. FPKM and RPKM values were calculated for each miRNA and gene respectively using Cufflinks software version 2.2.1 with default parameters. Genome build: Zv9 Ensembl release 79 Supplementary files format and content: tab delimited text files include FFKM for each mRNA transcript; tab delimited text files include RFKM for each miRNA. | Ovarian follicle | Ovaries from 3 mpf adult zebrafish were dissected in 60% medium of Leibovitz L 15 and follicles PG PV were sorted out according to the size and morphology. | RNA was extracted with miRNeasy and RNAeasy extraction kits Qiagen RNA Seq libraries were constructed according to Illumima TrueSeq and small RNA seq protocol and sequenced with the Illumina Hiseq 2000 Single end sequencing and pair end sequencing were used for small RNA seq library and RNA seq library respectively | AB fish was housed under a stable flow through condition at 28°C on a 14L:10D photoperiod with the light on at 0800 and off at 2200. Fish were fed regularly twice a day with live brine shrimp with supplement of commercial tropical fish food at a fixed time basis. | strain:AB|cell type:Pre vitellogenic follicle|age:from ovary of 3 month zebrafish | GSM2433869 | GSM2433869: PG small RNA seq 2; Danio rerio; ncRNA Seq | GSM2433869 | 1 | RNA was extracted with miRNeasy and RNAeasy extraction kits Qiagen RNA Seq libraries were constructed according to Illumima TrueSeq and small RNA seq protocol and sequenced with the Illumina Hiseq 2000 Single end sequencing and pair end sequencing were used for small RNA seq library and RNA seq library respectively | GEO Accession:GSM2433869 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP095411 | Ctrl_PV_1.fq.gz | fastq | 532189753.0 | 19043107.0 | GSM2433869 r1 | 0:27.95 1:0 | A:138460901;C:107807428;G:115489810;T:170431567;N:47 | 27 | 0 | 138460901 | 107807428 | 115489810 | 170431567 | 47 | SRX2437316 | SRS1872014 | SRA505873 | GEO | Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institute of Health | 1 | 0.86612 | 0.65562 | 0.84486 | 0.53167 | 26 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | unknown | unknown | United States | 2016-12-20 | Adult | Adult | Gonad | Reproductive System | ||||||||||||||||
| 41694 | 41694 | SRR5122166 | SRX2437315 | SRS1872013 | SRP095411 | PRJNA358209 | Identification of a specific 13 miRNA expression signature during follicle activation in Zebrafish | GSE92639 | Transcriptome Analysis | Purpose: We aimed to investigate important miRNA events and to define specific miRNA expression signature underlying the follicle activation of zebrafish. Methods: By using small and regular RNA sequencing we performed transcriptomic analyses of PG primary growth stage I; inactive and PV pre vitellogenic stage II; activated follicles to decipher important miRNA and gene events underlying follicle activation of zebrafish. We identified differentially expressed miRNAs for subsequent qPCR validation and miRNA::target gene prediction. Interaction of candidate miRNA:: target gene pairs were further validated by luciferase reporter assay. Global gene networks involved during PG to PV transition were also assessed by Gene Ontology as well as KEGG pathway analyses. Results and Conclusion: Our expression results indicated that PG follicles can be well differentiated from PV follicles by simply using a specific 13 miRNA expression signature let 7a 7b 7c 5p 7d 5p 7h 7i; miR 21 23a 27c 3p 107a 3p 125b 5p 145 3p 202 5p. Besides we validated interactions of let 7i::atg4a miR 202 5p::c23h20orf24 and miR 144::ybx1 by luciferase reporter assay. Purpose: we aimed to investigate important miRNA events and to define specific miRNA expression signature underlying the follicle activation of zebrafish Overall design: To identify differentially expressed miRNAs and its potential downstream targets during follicle activation of zebrafish we carried out transcriptomic profiling by both small and regular RNA sequencing. By intersecting gene lists of the online predicted targets and RNA seq derived differentially expressed transcripts with a reciprocal expression pattern of miRNAs we shortlisted 6 pairs of miRNA::target gene for validation using luciferase reporter assay. | pubmed:29228146 | PG small RNA seq 1 | GSM2433868 | tissue:Ovarian follicle|strain:AB|cell type:Primary growth follicle|age:from ovary of 3 month zebrafish | PG small RNA seq 1 | For the RNA seq data all the pair end reads were mapped to the zebrafish genome using TopHat version 2.0.11. Genome annotation files with GTF format for known genes were downloaded from Ensembl. FPKM and RPKM values were calculated for each miRNA and gene respectively using Cufflinks software version 2.2.1 with default parameters. Genome build: Zv9 Ensembl release 79 Supplementary files format and content: tab delimited text files include FFKM for each mRNA transcript; tab delimited text files include RFKM for each miRNA. | Ovarian follicle | Ovaries from 3 mpf adult zebrafish were dissected in 60% medium of Leibovitz L 15 and follicles PG PV were sorted out according to the size and morphology. | RNA was extracted with miRNeasy and RNAeasy extraction kits Qiagen RNA Seq libraries were constructed according to Illumima TrueSeq and small RNA seq protocol and sequenced with the Illumina Hiseq 2000 Single end sequencing and pair end sequencing were used for small RNA seq library and RNA seq library respectively | AB fish was housed under a stable flow through condition at 28°C on a 14L:10D photoperiod with the light on at 0800 and off at 2200. Fish were fed regularly twice a day with live brine shrimp with supplement of commercial tropical fish food at a fixed time basis. | strain:AB|cell type:Primary growth follicle|age:from ovary of 3 month zebrafish | GSM2433868 | GSM2433868: PG small RNA seq 1; Danio rerio; ncRNA Seq | GSM2433868 | 1 | RNA was extracted with miRNeasy and RNAeasy extraction kits Qiagen RNA Seq libraries were constructed according to Illumima TrueSeq and small RNA seq protocol and sequenced with the Illumina Hiseq 2000 Single end sequencing and pair end sequencing were used for small RNA seq library and RNA seq library respectively | GEO Accession:GSM2433868 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP095411 | Ctrl_PG_1.fq.gz | fastq | 368945203.0 | 13147324.0 | GSM2433868 r1 | 0:28.06 1:0 | A:96466912;C:75527992;G:78177838;T:118772423;N:38 | 28 | 0 | 96466912 | 75527992 | 78177838 | 118772423 | 38 | SRX2437315 | SRS1872013 | SRA505873 | GEO | Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institute of Health | 1 | 0.8524 | 0.67638 | 0.86074 | 0.48958 | 27 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | unknown | unknown | United States | 2016-12-20 | Adult | Adult | Gonad | Reproductive System | ||||||||||||||||
| 44967 | 44967 | SRR6345660 | SRX3442976 | SRS2733636 | SRP126106 | PRJNA421016 | Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA] | GSE107682 | Transcriptome Analysis | Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish. | parent bioproject:PRJNA315403 | pubmed:30086300 | smRNA seq library of ovary from tdrd6a mut fish | GSM2875719 | source name:Ovary from tdrd6a mut fish|tissue:whole ovary|genotype:tdrd6a mutant | smRNA seq library of ovary from tdrd6a mut fish | 1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15 6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities. 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to. Supplementary files format and content: Files ending in .bw are bigwig tracks. | Ovary from tdrd6a mut fish | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | tissue:whole ovary|genotype:tdrd6a mutant | GSM2875719 | GSM2875719: smRNA seq library of ovary from tdrd6a mut fish; Danio rerio; ncRNA Seq | GSM2875719 | 1 | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | GEO Accession:GSM2875719 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP126106 | Tdrd6a-mut-ovary-input-Adult.fastq.gz | fastq | 817885062.0 | 16036962.0 | GSM2875719 r1 | 0:51 | A:212456064;C:163491733;G:233627239;T:208262707;N:47319 | 51 | 212456064 | 163491733 | 233627239 | 208262707 | 47319 | SRX3442976 | SRS2733636 | SRA636010 | GEO | Rene Ketting, RNA silencing, IMB | 1 | 0.46308 | 0.13668 | 0.83587 | 0.79104 | 51 | B | usable mapping rate | illumina | hiseq_era | 5prime | size_fractionation | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2017-12-04 | Undetermined | Undetermined | Gonad | Reproductive System | ||||||||||||||||||
| 44968 | 44968 | SRR6345659 | SRX3442975 | SRS2733637 | SRP126106 | PRJNA421016 | Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA] | GSE107682 | Transcriptome Analysis | Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish. | parent bioproject:PRJNA315403 | pubmed:30086300 | smRNA seq library of ovary from tdrd6a het fish | GSM2875718 | source name:Ovary from tdrd6a het fish|tissue:whole ovary|genotype:tdrd6a heterozygous | smRNA seq library of ovary from tdrd6a het fish | 1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15 6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities. 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to. Supplementary files format and content: Files ending in .bw are bigwig tracks. | Ovary from tdrd6a het fish | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | tissue:whole ovary|genotype:tdrd6a heterozygous | GSM2875718 | GSM2875718: smRNA seq library of ovary from tdrd6a het fish; Danio rerio; ncRNA Seq | GSM2875718 | 1 | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | GEO Accession:GSM2875718 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP126106 | Tdrd6a-het-ovary-input-Adult.fastq.gz | fastq | 1452353571.0 | 28477521.0 | GSM2875718 r1 | 0:51 | A:397993735;C:284194126;G:396142390;T:373939235;N:84085 | 51 | 397993735 | 284194126 | 396142390 | 373939235 | 84085 | SRX3442975 | SRS2733637 | SRA636010 | GEO | Rene Ketting, RNA silencing, IMB | 1 | 0.3869 | 0.1369 | 0.86397 | 0.77165 | 51 | B | usable mapping rate | illumina | hiseq_era | 5prime | size_fractionation | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2017-12-04 | Undetermined | Undetermined | Gonad | Reproductive System | ||||||||||||||||||
| 44969 | 44969 | SRR6345658 | SRX3442974 | SRS2733632 | SRP126106 | PRJNA421016 | Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA] | GSE107682 | Transcriptome Analysis | Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish. | parent bioproject:PRJNA315403 | pubmed:30086300 | smRNA seq library of late oocytes from tdrd6a hett fish | GSM2875717 | source name:late oocytes from tdrd6a hett fish|tissue:late oocytes|genotype:tdrd6a heterozygous | smRNA seq library of late oocytes from tdrd6a hett fish | 1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15 6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities. 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to. Supplementary files format and content: Files ending in .bw are bigwig tracks. | late oocytes from tdrd6a hett fish | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | tissue:late oocytes|genotype:tdrd6a heterozygous | GSM2875717 | GSM2875717: smRNA seq library of late oocytes from tdrd6a hett fish; Danio rerio; ncRNA Seq | GSM2875717 | 1 | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | GEO Accession:GSM2875717 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP126106 | tdrd6a-het_oocytes-late-input.fastq.gz | fastq | 1884769630.0 | 28130890.0 | GSM2875717 r1 | 0:67 | A:519051884;C:437635381;G:510738306;T:417295309;N:48750 | 67 | 519051884 | 437635381 | 510738306 | 417295309 | 48750 | SRX3442974 | SRS2733632 | SRA636010 | GEO | Rene Ketting, RNA silencing, IMB | 1 | 0.17778 | 0.06655 | 0.95931 | 0.91529 | 67 | B | usable mapping rate | illumina | hiseq_era | 5prime | size_fractionation | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2017-12-04 | Zygote | Embryo | Oocyte | Reproductive System | ||||||||||||||||||
| 44970 | 44970 | SRR6345657 | SRX3442973 | SRS2733634 | SRP126106 | PRJNA421016 | Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA] | GSE107682 | Transcriptome Analysis | Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish. | parent bioproject:PRJNA315403 | pubmed:30086300 | smRNA seq library of early oocytes from tdrd6a mut fish | GSM2875716 | source name:early oocytes from tdrd6a mut fish|tissue:early oocytes|genotype:tdrd6a mutant | smRNA seq library of early oocytes from tdrd6a mut fish | 1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15 6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities. 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to. Supplementary files format and content: Files ending in .bw are bigwig tracks. | early oocytes from tdrd6a mut fish | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | tissue:early oocytes|genotype:tdrd6a mutant | GSM2875716 | GSM2875716: smRNA seq library of early oocytes from tdrd6a mut fish; Danio rerio; ncRNA Seq | GSM2875716 | 1 | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | GEO Accession:GSM2875716 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP126106 | tdrd6a-mut_oocytes-early-input.fastq.gz | fastq | 2102216723.0 | 31376369.0 | GSM2875716 r1 | 0:67 | A:592618102;C:472348913;G:550028898;T:487165955;N:54855 | 67 | 592618102 | 472348913 | 550028898 | 487165955 | 54855 | SRX3442973 | SRS2733634 | SRA636010 | GEO | Rene Ketting, RNA silencing, IMB | 1 | 0.08293 | 0.04595 | 0.96193 | 0.77321 | 67 | B | usable mapping rate | illumina | hiseq_era | 5prime | size_fractionation | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2017-12-04 | Zygote | Embryo | Oocyte | Reproductive System | ||||||||||||||||||
| 44971 | 44971 | SRR6345656 | SRX3442972 | SRS2733635 | SRP126106 | PRJNA421016 | Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA] | GSE107682 | Transcriptome Analysis | Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish. | parent bioproject:PRJNA315403 | pubmed:30086300 | smRNA seq library of late oocytes from tdrd6a mut fish | GSM2875715 | source name:late oocytes from tdrd6a mut fish|tissue:late oocytes|genotype:tdrd6a mutant | smRNA seq library of late oocytes from tdrd6a mut fish | 1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15 6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities. 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to. Supplementary files format and content: Files ending in .bw are bigwig tracks. | late oocytes from tdrd6a mut fish | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | tissue:late oocytes|genotype:tdrd6a mutant | GSM2875715 | GSM2875715: smRNA seq library of late oocytes from tdrd6a mut fish; Danio rerio; ncRNA Seq | GSM2875715 | 1 | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | GEO Accession:GSM2875715 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP126106 | tdrd6a-mut_oocytes-late-input.fastq.gz | fastq | 2110760295.0 | 31503885.0 | GSM2875715 r1 | 0:67 | A:582021495;C:486821539;G:582933348;T:458929133;N:54780 | 67 | 582021495 | 486821539 | 582933348 | 458929133 | 54780 | SRX3442972 | SRS2733635 | SRA636010 | GEO | Rene Ketting, RNA silencing, IMB | 1 | 0.17064 | 0.06728 | 0.96173 | 0.9114 | 67 | B | usable mapping rate | illumina | hiseq_era | 5prime | size_fractionation | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2017-12-04 | Zygote | Embryo | Oocyte | Reproductive System | ||||||||||||||||||
| 44972 | 44972 | SRR6345655 | SRX3442971 | SRS2733633 | SRP126106 | PRJNA421016 | Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA] | GSE107682 | Transcriptome Analysis | Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish. | parent bioproject:PRJNA315403 | pubmed:30086300 | smRNA seq library of early oocytes from tdrd6a het fish | GSM2875714 | source name:early oocytes from tdrd6a het fish|tissue:Early oocytes|genotype:tdrd6a heterozygous | smRNA seq library of early oocytes from tdrd6a het fish | 1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15 6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities. 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to. Supplementary files format and content: Files ending in .bw are bigwig tracks. | early oocytes from tdrd6a het fish | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | tissue:Early oocytes|genotype:tdrd6a heterozygous | GSM2875714 | GSM2875714: smRNA seq library of early oocytes from tdrd6a het fish; Danio rerio; ncRNA Seq | GSM2875714 | 1 | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | GEO Accession:GSM2875714 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP126106 | tdrd6a-het_oocytes-early-input.fastq.gz | fastq | 2243425655.0 | 33483965.0 | GSM2875714 r1 | 0:67 | A:633468129;C:503239215;G:592089295;T:514571679;N:57337 | 67 | 633468129 | 503239215 | 592089295 | 514571679 | 57337 | SRX3442971 | SRS2733633 | SRA636010 | GEO | Rene Ketting, RNA silencing, IMB | 1 | 0.06641 | 0.04254 | 0.96806 | 0.58509 | 67 | B | usable mapping rate | illumina | hiseq_era | 5prime | size_fractionation | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2017-12-04 | Zygote | Embryo | Oocyte | Reproductive System | ||||||||||||||||||
| 58547 | 58547 | SRR13652350 | SRX10049113 | SRS8212340 | SRP253438 | PRJNA613601 | five prime half of specific tRNAs feeds back to promote corresponding tRNA gene transcription in vertebrate embryos [small RNA Seq ssDRIP seq] | GSE147253 | Other | five primetRFls are small tRNA fragments derived from five prime half of mature tRNAs. However it is unknown whether five primetRFls could feed back to regulate tRNA biogenesis. Here we show that five primetRFlGly/GCC and five primetRFlGlu/CTC function to promote transcription of corresponding tRNA genes and are essential for vertebrate early embryogenesis. During zebrafish embryogenesis dynamics of five primetRFlGly/GCC and five primetRFlGlu/CTC levels correlates with that of tRNAGly/GCC and tRNAGlu/CTC levels. Morpholino mediated knockdown of five primetRFlGly/GCC or five primetRFlGlu/CTC down regulates tRNAGly/GCC or tRNAGlu/CTC levels respectively and causes embryonic lethality that is efficiently rescued by co injection of properly refolded corresponding tRNA. In zebrafish embryos tRNA:DNA and five primetRFl:DNA hybrids commonly exist on the template strand of tRNA genes. Mechanistically unstable five primetRFl:DNA hybrid may prevent the formation of transcriptionally inhibitory stable tRNA:DNA hybrids on the same tRNA loci so as to facilitate tRNA genes transcription. The uncovered mechanism may be implicated in other physiological and pathological processes. Overall design: For small RNA sequencing total RNA were extracted respectively from wildtype zebrafish embryos Tübingen Strain of 6 chosen stages and then subjected to small RNA library preparation individually. To investigate the distribution and stability of R loop on genome we performed ssDRIP seq with S9.6 antibody which specifically recognize RNA:DNA hybrid. Two replicates from wildtype embryos of 256c sphere and shield stage were collected to perform ssDRIPseq. RNaseH pre treated genome DNA was used as negative control which was also performed the standard ssDRIP seq procedure. Genomic DNA extracted from these samples were fragmentated by restriction enzymes and then immunoprecipitated by S9.6 antibody.The ssDNA strands in RNA:DNA hybrids were purified and subjected to library preparation. | parent bioproject:PRJNA753013 | pubmed:34797706 | Egg ncRNA seq | GSM5069280 | tissue:mature oocyte|strain:Tubingen|developmental stage:Mature Oocyte|treatement:no | Egg ncRNA seq | For data processing reads were quality checked by FastQCVersion 0.11.8 and adaptors were cut off by Cutadapt Version 1.16 and only reads that lay between 18 40 nt were kept. The reads of each sample were first aligned to different database by using Bowtie2 Version 2.3.4.1 count table was generated by featureCounts. Genome build: GRCz11 genome and cDNA tRNA database GtRNAdb GRCz11 | mature oocyte | For small RNA sequencing: About 50 100 zebrafish eggs or embryos at a desired stage were dechorionated by Pronase digestion and collected to extract total RNA. Embryos were then transferred to 1.5 ml eppendorf tube and lysed in 1 ml Trizol Reagent Thermo Fisher Scientific 15596018. The lysate was centrifuged at 12 000 rpm for 10 min and the supernatant was collected and mixed with 200 μl chloroform in a fresh tube. post centrifugation at 12 000 rpm for 10 min at 4℃ the supernatant was transferred to a fresh tube with addition of equal volume of isopropanol and incubated at room temperature for 15 min followed by thorough mix and centrifugation at 12 000 rpm for 10 20 min. The RNA pellet was washed by 75% ethanol once and was stored as pellet in 75% ethanol at 80℃ until all samples were collected. Two pretreatment steps were included: First purified total RNAs were treated with T4 Polynucleotide Kinase NEB M0201S with ATP for 30 min at 37℃ then purified by phenol: chloroform extraction. The aim of this step is removing the 2 3’ cyclic phosphate group from the 3’end of 5’tRFls and add phosphate group to the 5’end of 3’tRFs. In the second step total RNAs were treated with ALKB protein mix as mentioned above. Purified total RNAs were then subjected to small RNA library preparation. For small RNA sequencing: Small RNA libraries using 1 μg RNA each were prepared using the NEBNext Multiplex Small RNA Library Prep Set for Illumina NEB according to the manual. The amplified DNA from each sample was first concentrated by DNA concentrator spin column Zymo Research then bands of 135 160 bp about the length of 15 40 nt RNA ligated with both adaptors were manually selected on native PAGE gel. DNAs were eluted from the gel piece with 0.3 M NaOAc pH 4.5 followed by precipitation by adding 2.5 volumes of ethanol. | strain:Tubingen|developmental stage:Mature Oocyte|treatement:no | GSM5069280 | GSM5069280: Egg ncRNA seq; Danio rerio; ncRNA Seq | GSM5069280 | 1 | For small RNA sequencing: About 50 100 zebrafish eggs or embryos at a desired stage were dechorionated by Pronase digestion and collected to extract total RNA. Embryos were then transferred to 1.5 ml eppendorf tube and lysed in 1 ml Trizol Reagent Thermo Fisher Scientific 15596018. The lysate was centrifuged at 12 000 rpm for 10 min and the supernatant was collected and mixed with 200 μl chloroform in a fresh tube. post centrifugation at 12 000 rpm for 10 min at 4℃ the supernatant was transferred to a fresh tube with addition of equal volume of isopropanol and incubated at room temperature for 15 min followed by thorough mix and centrifugation at 12 000 rpm for 10 20 min. The RNA pellet was washed by 75% ethanol once and was stored as pellet in 75% ethanol at 80℃ until all samples were collected. Two pretreatment steps were included: First purified total RNAs were treated with T4 Polynucleotide Kinase NEB M0201S with ATP for 30 min at 37℃ then purified by phenol: chloroform extraction. The aim of this step is removing the 2 three prime cyclic phosphate group from the three primeend of five primetRFls and add phosphate group to the five primeend of three primetRFs. In the second step total RNAs were treated with ALKB protein mix as mentioned above. Purified total RNAs were then subjected to small RNA library preparation. For small RNA sequencing: Small RNA libraries using 1 μg RNA each were prepared using the NEBNext Multiplex Small RNA Library Prep Set for Illumina NEB according to the manual. The amplified DNA from each sample was first concentrated by DNA concentrator spin column Zymo Research then bands of 135 160 bp about the length of 15 40 nt RNA ligated with both adaptors were manually selected on native PAGE gel. DNAs were eluted from the gel piece with 0.3 M NaOAc pH 4.5 followed by precipitation by adding 2.5 volumes of ethanol. | GEO Accession:GSM5069280 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina NovaSeq 6000 | SRP253438 | Egg-RNA_seq.fq.gz | fastq | 4328292000.0 | 28855280.0 | GSM5069280 r1 | 0:150 1:0 | A:757944111;C:789419055;G:2112325298;T:668359520;N:244016 | 150 | 0 | 757944111 | 789419055 | 2112325298 | 668359520 | 244016 | SRX10049113 | SRS8212340 | SRA1056877 | GEO | Anming Meng Lab, School of Life Science, Tsinghua University | 1 | 0.74704 | 0.18839 | 0.83197 | 0.55802 | 150 | B | usable mapping rate | illumina | novaseq_era | 5prime | size_fractionation | nebnext | bulk | unknown | unknown | China | 2021-02-08 | Zygote | Embryo | Oocyte | Reproductive System | |||||||||||||||||
| 68556 | 68556 | SRR18028171 | SRX14182301 | SRS12005942 | SRP359829 | PRJNA807002 | samll RNA seq of zebrafish gonads of wildtype and pld6 / at 22 dpf | PRJNA807002 | Other | In this study we generated zebrafish pld6 knockouts and found that the pld6 null mutants developed as infertile males with testes containing no germ cells. Pld6 is considered to be a candidate ribonuclease participating in primary piRNA biogenesis which is essential for the survival of germ cells. We deep sequenced 20 33 nt total small RNAs obtained from 22 dpf wildtype and pld6 / gonad with three repetition. In pld6 / gonad small RNAs mapped to the known piRNA clusters were almost absent. Moreover piRNA clusters in pld6 / gonad lost the enrichment for uridine at the first position or for adenine at the 10th position. our results unequivocally demonstrate a conserved role for MitoPLD in the piRNA biogenesis pathway. | 6WT 3 | strain:AB|isolate:replicate3|ecotype:wt|age:post fertilization day 22|dev stage:juvenile|sex:missing|tissue:Gonad|BioSampleModel:Model organism or animal | wt 3 S11 L001 R1 | 011 | 011 | Zebrafish larvae were anesthetized in 0.2 mg/mL MS 222 and disected to isolate gonads under a microscope. Three wildtype or mutant gonads were mixed into one repeat and three repeats were performed for samll RNA sequencing. | ncRNA-Seq | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | HiSeq X Ten | SRP359829 | wt-3_S11_L001_R1_001.fastq.gz wt-3_S11_L001_R2_001.fastq.gz | fastq fastq | 3576981600.0 | 11923272.0 | wt 3 S11 L001 R1 001.fastq.gz | 0:150 1:150 | A:689001630;C:496844981;G:1779990511;T:610974133;N:170345 | 150 | 150 | 689001630 | 496844981 | 1779990511 | 610974133 | 170345 | SRX14182301 | SRS12005942 | SRA1372890 | Huazhong agricultural university|School of Life Science and Technology | Huazhong agricultural university | 2 | 0.8179 | 0.81697 | 0.60905 | 0.60864 | 0.82692 | 0.82915 | 0.52425 | 0.52623 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | China | 2022-02-14 | Multi-stage | Multi-stage | Gonad | Reproductive System | |||||||||||||||||||||
| 68557 | 68557 | SRR18028172 | SRX14182300 | SRS12005941 | SRP359829 | PRJNA807002 | samll RNA seq of zebrafish gonads of wildtype and pld6 / at 22 dpf | PRJNA807002 | Other | In this study we generated zebrafish pld6 knockouts and found that the pld6 null mutants developed as infertile males with testes containing no germ cells. Pld6 is considered to be a candidate ribonuclease participating in primary piRNA biogenesis which is essential for the survival of germ cells. We deep sequenced 20 33 nt total small RNAs obtained from 22 dpf wildtype and pld6 / gonad with three repetition. In pld6 / gonad small RNAs mapped to the known piRNA clusters were almost absent. Moreover piRNA clusters in pld6 / gonad lost the enrichment for uridine at the first position or for adenine at the 10th position. our results unequivocally demonstrate a conserved role for MitoPLD in the piRNA biogenesis pathway. | 5WT 2 | strain:AB|isolate:replicate2|ecotype:wt|age:post fertilization day 22|dev stage:juvenile|sex:missing|tissue:Gonad|BioSampleModel:Model organism or animal | wt 2 S10 L001 R1 | 009 | 009 | Zebrafish larvae were anesthetized in 0.2 mg/mL MS 222 and disected to isolate gonads under a microscope. Three wildtype or mutant gonads were mixed into one repeat and three repeats were performed for samll RNA sequencing. | ncRNA-Seq | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | HiSeq X Ten | SRP359829 | wt-2_S10_L001_R1_001.fastq.gz wt-2_S10_L001_R2_001.fastq.gz | fastq fastq | 4200013800.0 | 14000046.0 | wt 2 S10 L001 R1 001.fastq.gz | 0:150 1:150 | A:781057232;C:617020885;G:2110010128;T:691723797;N:201758 | 150 | 150 | 781057232 | 617020885 | 2110010128 | 691723797 | 201758 | SRX14182300 | SRS12005941 | SRA1372890 | Huazhong agricultural university|School of Life Science and Technology | Huazhong agricultural university | 2 | 0.8213 | 0.82216 | 0.59414 | 0.59507 | 0.81089 | 0.81306 | 0.53839 | 0.52755 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | China | 2022-02-14 | Multi-stage | Multi-stage | Gonad | Reproductive System | |||||||||||||||||||||
| 68558 | 68558 | SRR18028173 | SRX14182299 | SRS12005940 | SRP359829 | PRJNA807002 | samll RNA seq of zebrafish gonads of wildtype and pld6 / at 22 dpf | PRJNA807002 | Other | In this study we generated zebrafish pld6 knockouts and found that the pld6 null mutants developed as infertile males with testes containing no germ cells. Pld6 is considered to be a candidate ribonuclease participating in primary piRNA biogenesis which is essential for the survival of germ cells. We deep sequenced 20 33 nt total small RNAs obtained from 22 dpf wildtype and pld6 / gonad with three repetition. In pld6 / gonad small RNAs mapped to the known piRNA clusters were almost absent. Moreover piRNA clusters in pld6 / gonad lost the enrichment for uridine at the first position or for adenine at the 10th position. our results unequivocally demonstrate a conserved role for MitoPLD in the piRNA biogenesis pathway. | 4WT 1 | strain:AB|isolate:replicate1|ecotype:wt|age:post fertilization day 22|dev stage:juvenile|sex:missing|tissue:Gonad|BioSampleModel:Model organism or animal | wt 1 S9 L001 R1 | 007 | 007 | Zebrafish larvae were anesthetized in 0.2 mg/mL MS 222 and disected to isolate gonads under a microscope. Three wildtype or mutant gonads were mixed into one repeat and three repeats were performed for samll RNA sequencing. | ncRNA-Seq | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | HiSeq X Ten | SRP359829 | wt-1_S9_L001_R1_001.fastq.gz wt-1_S9_L001_R2_001.fastq.gz | fastq fastq | 4820063700.0 | 16066879.0 | wt 1 S9 L001 R1 001.fastq.gz | 0:150 1:150 | A:996304548;C:657334691;G:2379519106;T:786675131;N:230224 | 150 | 150 | 996304548 | 657334691 | 2379519106 | 786675131 | 230224 | SRX14182299 | SRS12005940 | SRA1372890 | Huazhong agricultural university|School of Life Science and Technology | Huazhong agricultural university | 2 | 0.80219 | 0.80319 | 0.60906 | 0.60878 | 0.83238 | 0.83303 | 0.52559 | 0.51852 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | China | 2022-02-14 | Multi-stage | Multi-stage | Gonad | Reproductive System | |||||||||||||||||||||
| 68559 | 68559 | SRR18028174 | SRX14182298 | SRS12005939 | SRP359829 | PRJNA807002 | samll RNA seq of zebrafish gonads of wildtype and pld6 / at 22 dpf | PRJNA807002 | Other | In this study we generated zebrafish pld6 knockouts and found that the pld6 null mutants developed as infertile males with testes containing no germ cells. Pld6 is considered to be a candidate ribonuclease participating in primary piRNA biogenesis which is essential for the survival of germ cells. We deep sequenced 20 33 nt total small RNAs obtained from 22 dpf wildtype and pld6 / gonad with three repetition. In pld6 / gonad small RNAs mapped to the known piRNA clusters were almost absent. Moreover piRNA clusters in pld6 / gonad lost the enrichment for uridine at the first position or for adenine at the 10th position. our results unequivocally demonstrate a conserved role for MitoPLD in the piRNA biogenesis pathway. | 3PLD6 3 | strain:AB|isolate:replicate3|ecotype:pld6 / |age:post fertilization day 22|dev stage:juvenile|sex:missing|tissue:Gonad|BioSampleModel:Model organism or animal | pld6 3 S3 L003 R1 | 005 | 005 | Zebrafish larvae were anesthetized in 0.2 mg/mL MS 222 and disected to isolate gonads under a microscope. Three wildtype or mutant gonads were mixed into one repeat and three repeats were performed for samll RNA sequencing. | ncRNA-Seq | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | HiSeq X Ten | SRP359829 | pld6-3_S3_L003_R1_001.fastq.gz pld6-3_S3_L003_R2_001.fastq.gz | fastq fastq | 816686700.0 | 2722289.0 | pld6 3 S3 L003 R1 001.fastq.gz | 0:150 1:150 | A:145681738;C:137123477;G:401610833;T:132256312;N:14340 | 150 | 150 | 145681738 | 137123477 | 401610833 | 132256312 | 14340 | SRX14182298 | SRS12005939 | SRA1372890 | Huazhong agricultural university|School of Life Science and Technology | Huazhong agricultural university | 2 | 0.78314 | 0.73942 | 0.07641 | 0.09097 | 0.91603 | 0.91545 | 0.6312 | 0.64467 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | China | 2022-02-14 | Multi-stage | Multi-stage | Gonad | Reproductive System | |||||||||||||||||||||
| 68560 | 68560 | SRR18028175 | SRX14182297 | SRS12005938 | SRP359829 | PRJNA807002 | samll RNA seq of zebrafish gonads of wildtype and pld6 / at 22 dpf | PRJNA807002 | Other | In this study we generated zebrafish pld6 knockouts and found that the pld6 null mutants developed as infertile males with testes containing no germ cells. Pld6 is considered to be a candidate ribonuclease participating in primary piRNA biogenesis which is essential for the survival of germ cells. We deep sequenced 20 33 nt total small RNAs obtained from 22 dpf wildtype and pld6 / gonad with three repetition. In pld6 / gonad small RNAs mapped to the known piRNA clusters were almost absent. Moreover piRNA clusters in pld6 / gonad lost the enrichment for uridine at the first position or for adenine at the 10th position. our results unequivocally demonstrate a conserved role for MitoPLD in the piRNA biogenesis pathway. | 2PLD6 2 | strain:AB|isolate:replicate2|ecotype:pld6 / |age:post fertilization day 22|dev stage:juvenile|sex:missing|tissue:Gonad|BioSampleModel:Model organism or animal | pld6 2 S2 L003 R1 | 003 | 003 | Zebrafish larvae were anesthetized in 0.2 mg/mL MS 222 and disected to isolate gonads under a microscope. Three wildtype or mutant gonads were mixed into one repeat and three repeats were performed for samll RNA sequencing. | ncRNA-Seq | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | HiSeq X Ten | SRP359829 | pld6-2_S2_L003_R1_001.fastq.gz pld6-2_S2_L003_R2_001.fastq.gz | fastq fastq | 6546276900.0 | 21820923.0 | pld6 2 S2 L003 R1 001.fastq.gz | 0:150 1:150 | A:1161502458;C:1095580994;G:3226725392;T:1062358099;N:109957 | 150 | 150 | 1161502458 | 1095580994 | 3226725392 | 1062358099 | 109957 | SRX14182297 | SRS12005938 | SRA1372890 | Huazhong agricultural university|School of Life Science and Technology | Huazhong agricultural university | 2 | 0.6471 | 0.593 | 0.07935 | 0.09168 | 0.92058 | 0.92005 | 0.53626 | 0.65284 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | China | 2022-02-14 | Multi-stage | Multi-stage | Gonad | Reproductive System | |||||||||||||||||||||
| 68561 | 68561 | SRR18028176 | SRX14182296 | SRS12005937 | SRP359829 | PRJNA807002 | samll RNA seq of zebrafish gonads of wildtype and pld6 / at 22 dpf | PRJNA807002 | Other | In this study we generated zebrafish pld6 knockouts and found that the pld6 null mutants developed as infertile males with testes containing no germ cells. Pld6 is considered to be a candidate ribonuclease participating in primary piRNA biogenesis which is essential for the survival of germ cells. We deep sequenced 20 33 nt total small RNAs obtained from 22 dpf wildtype and pld6 / gonad with three repetition. In pld6 / gonad small RNAs mapped to the known piRNA clusters were almost absent. Moreover piRNA clusters in pld6 / gonad lost the enrichment for uridine at the first position or for adenine at the 10th position. our results unequivocally demonstrate a conserved role for MitoPLD in the piRNA biogenesis pathway. | 1PLD6 1 | strain:AB|isolate:replicate1|ecotype:pld6 / |age:post fertilization day 22|dev stage:juvenile|sex:missing|tissue:Gonad|BioSampleModel:Model organism or animal | pld6 1 S1 L003 R1 | 001 | 001 | Zebrafish larvae were anesthetized in 0.2 mg/mL MS 222 and disected to isolate gonads under a microscope. Three wildtype or mutant gonads were mixed into one repeat and three repeats were performed for samll RNA sequencing. | ncRNA-Seq | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | HiSeq X Ten | SRP359829 | pld6-1_S1_L003_R1_001.fastq.gz pld6-1_S1_L003_R2_001.fastq.gz | fastq fastq | 5535130200.0 | 18450434.0 | pld6 1 S1 L003 R1 001.fastq.gz | 0:150 1:150 | A:1014761790;C:833992394;G:2813863824;T:872418512;N:93680 | 150 | 150 | 1014761790 | 833992394 | 2813863824 | 872418512 | 93680 | SRX14182296 | SRS12005937 | SRA1372890 | Huazhong agricultural university|School of Life Science and Technology | Huazhong agricultural university | 2 | 0.70358 | 0.73288 | 0.08649 | 0.09366 | 0.91066 | 0.90914 | 0.6197 | 0.6207 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | China | 2022-02-14 | Multi-stage | Multi-stage | Gonad | Reproductive System |
Advanced export
JSON shape: default, array, newline-delimited
CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;