RNAquarium Metadata Server
Institute Website Terms of Use Privacy Policy

run_metadata

49 rows where experiment.library_source = "TRANSCRIPTOMIC", experiment.library_strategy = "ncRNA-Seq" and tissue_curation = "Whole Organism"

✎ View and edit SQL

This data as json, CSV (advanced)

devstage_curation 6

technology 2

devstage_curation_coarse 2

tissue_curation_coarse 1

tissue_curation 1

  • Whole Organism · 49 ✖

experiment.platform 1

experiment.library_strategy 1

  • ncRNA-Seq · 49 ✖

experiment.library_source 1

  • TRANSCRIPTOMIC · 49 ✖

experiment.library_selection 1

experiment.library_layout 1

Link rowid ▼ run.accession experiment.accession sample.accession study.accession bioproject study.title study.alias study.type study.abstract study.attributes study.PMIDs sample.description sample.title sample.alias sample.centername sample.attributes GEOsample.title GEOsample.dataprocessing GEOsample.source GEOsample.treatmentprotocol GEOsample.extractprotocol GEOsample.growthprotocol GEOsample.characteristics GEOsample.accession experiment.title experiment.alias experiment.library_name experiment.design_description experiment.library_construction_protocol experiment.attributes experiment.library_strategy experiment.library_source experiment.library_selection experiment.library_layout experiment.platform experiment.instrument_model experiment.spot_descriptor experiment.study_ref run.title run.attributes run.filename run.semantic_name run.total_bases run.total_spots run.alias run.read_lengths run.base_counts run.r1_length run.r2_length run.r3_length run.r4_length run.Acount run.Ccount run.Gcount run.Tcount run.Ncount run.experiment run.pool_member submission.accession submission.srasource submission.bioprojectsource seqdetective.n_mates seqdetective.mapping_rate.mate1 seqdetective.mapping_rate.mate2 seqdetective.nofeature_rate.mate1 seqdetective.nofeature_rate.mate2 seqdetective.sparsity.mate1 seqdetective.sparsity.mate2 seqdetective.pos_strand_rate.mate1 seqdetective.pos_strand_rate.mate2 seqdetective.readlen.mate1 seqdetective.readlen.mate2 seqdetective.judgement.mate1 seqdetective.judgement.mate2 seqdetective.judgement.reason platform_family instrument_generation read_bias selection_class prep_kit sc_or_bulk tech_class technology tech_variant submission.bioprojectsource.country earliest_date devstage_curation devstage_curation_coarse tissue_curation tissue_curation_coarse
25283 25283 SRR25764121 SRX21486801 SRS18719093 SRP457111 PRJNA1009808 Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] GSE241754 Transcriptome Analysis Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. parent bioproject:PRJNA1009800 pubmed:39402326   WT bud 10 hpf tRNA seq rep2 GSM7734782   source name:Gastrula|strain:TLAB strain|tissue:Gastrula|developmental stage:Bud 10 hpf|genotype:WT|geo loc name:missing|collection date:missing WT bud 10 hpf tRNA seq rep2 Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts Gastrula unperturbed growth conditions in E3 medium for zebrafish embryos. 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle. strain:TLAB strain|tissue:Gastrula|developmental stage:Bud 10 hpf|genotype:WT GSM7734782 GSM7734782: WT bud 10 hpf tRNA seq rep2; Danio rerio; ncRNA Seq GSM7734782 r1 GSM7734782 1 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 500   SRP457111     WT_tRNA_bud_2.fastq.gz fastq 278145656.0 4215107.0 GSM7734782 r1 0:65.99 A:52499947;C:77161357;G:79314034;T:69169753;N:565 65       52499947 77161357 79314034 69169753 565 SRX21486801 SRS18719093 SRA1700461 Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry Max Planck Institute of Biochemistry 1 0.31888   0.01661   0.92348   0.40156   75   B   usable mapping rate illumina nextseq 5prime size_fractionation unknown bulk unknown unknown   Germany 2023-08-28 Gastrula Embryo Whole Organism All anatomical structures
25284 25284 SRR25764122 SRX21486800 SRS18719092 SRP457111 PRJNA1009808 Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] GSE241754 Transcriptome Analysis Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. parent bioproject:PRJNA1009800 pubmed:39402326   WT bud 10 hpf tRNA seq rep1 GSM7734781   source name:Gastrula|strain:TLAB strain|tissue:Gastrula|developmental stage:Bud 10 hpf|genotype:WT|geo loc name:missing|collection date:missing WT bud 10 hpf tRNA seq rep1 Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts Gastrula unperturbed growth conditions in E3 medium for zebrafish embryos. 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle. strain:TLAB strain|tissue:Gastrula|developmental stage:Bud 10 hpf|genotype:WT GSM7734781 GSM7734781: WT bud 10 hpf tRNA seq rep1; Danio rerio; ncRNA Seq GSM7734781 r1 GSM7734781 1 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 500   SRP457111     WT_tRNA_bud_1.fastq.gz fastq 385514625.0 5770392.0 GSM7734781 r1 0:66.81 A:73305393;C:107155246;G:109793285;T:95259823;N:878 66       73305393 107155246 109793285 95259823 878 SRX21486800 SRS18719092 SRA1700461 Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry Max Planck Institute of Biochemistry 1 0.33213   0.01782   0.92354   0.42724   39   B   usable mapping rate illumina nextseq 5prime size_fractionation unknown bulk unknown unknown   Germany 2023-08-28 Gastrula Embryo Whole Organism All anatomical structures
25285 25285 SRR25764123 SRX21486799 SRS18719098 SRP457111 PRJNA1009808 Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] GSE241754 Transcriptome Analysis Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. parent bioproject:PRJNA1009800 pubmed:39402326   WT shield 6 hpf tRNA seq rep2 GSM7734780   source name:Gastrula|strain:TLAB strain|tissue:Gastrula|developmental stage:Shield 6 hpf|genotype:WT|geo loc name:missing|collection date:missing WT shield 6 hpf tRNA seq rep2 Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts Gastrula unperturbed growth conditions in E3 medium for zebrafish embryos. 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle. strain:TLAB strain|tissue:Gastrula|developmental stage:Shield 6 hpf|genotype:WT GSM7734780 GSM7734780: WT shield 6 hpf tRNA seq rep2; Danio rerio; ncRNA Seq GSM7734780 r1 GSM7734780 1 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 500   SRP457111     WT_tRNA_shield_2.fastq.gz fastq 469031736.0 7421688.0 GSM7734780 r1 0:63.20 A:90257219;C:130440728;G:130549302;T:117783411;N:1076 63       90257219 130440728 130549302 117783411 1076 SRX21486799 SRS18719098 SRA1700461 Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry Max Planck Institute of Biochemistry 1 0.29535   0.02113   0.91528   0.43824   37   B   usable mapping rate illumina nextseq 5prime size_fractionation unknown bulk unknown unknown   Germany 2023-08-28 Gastrula Embryo Whole Organism All anatomical structures
25286 25286 SRR25764124 SRX21486798 SRS18719100 SRP457111 PRJNA1009808 Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] GSE241754 Transcriptome Analysis Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. parent bioproject:PRJNA1009800 pubmed:39402326   WT shield 6 hpf tRNA seq rep1 GSM7734779   source name:Gastrula|strain:TLAB strain|tissue:Gastrula|developmental stage:Shield 6 hpf|genotype:WT|geo loc name:missing|collection date:missing WT shield 6 hpf tRNA seq rep1 Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts Gastrula unperturbed growth conditions in E3 medium for zebrafish embryos. 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle. strain:TLAB strain|tissue:Gastrula|developmental stage:Shield 6 hpf|genotype:WT GSM7734779 GSM7734779: WT shield 6 hpf tRNA seq rep1; Danio rerio; ncRNA Seq GSM7734779 r1 GSM7734779 1 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 500   SRP457111     WT_tRNA_shield_1.fastq.gz fastq 487207771.0 7521930.0 GSM7734779 r1 0:64.77 A:94654510;C:134893975;G:135716906;T:121941280;N:1100 64       94654510 134893975 135716906 121941280 1100 SRX21486798 SRS18719100 SRA1700461 Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry Max Planck Institute of Biochemistry 1 0.30664   0.02274   0.91297   0.46012   79   B   usable mapping rate illumina nextseq 5prime size_fractionation unknown bulk unknown unknown   Germany 2023-08-28 Gastrula Embryo Whole Organism All anatomical structures
25287 25287 SRR25764125 SRX21486797 SRS18719094 SRP457111 PRJNA1009808 Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] GSE241754 Transcriptome Analysis Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. parent bioproject:PRJNA1009800 pubmed:39402326   WT sphere 4 hpf tRNA seq rep2 GSM7734778   source name:Blastula|strain:TLAB strain|tissue:Blastula|developmental stage:Sphere 4 hpf|genotype:WT|geo loc name:missing|collection date:missing WT sphere 4 hpf tRNA seq rep2 Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts Blastula unperturbed growth conditions in E3 medium for zebrafish embryos. 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle. strain:TLAB strain|tissue:Blastula|developmental stage:Sphere 4 hpf|genotype:WT GSM7734778 GSM7734778: WT sphere 4 hpf tRNA seq rep2; Danio rerio; ncRNA Seq GSM7734778 r1 GSM7734778 1 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 500   SRP457111     WT_tRNA_sphere_2.fastq.gz fastq 196089572.0 2998867.0 GSM7734778 r1 0:65.39 A:39134451;C:53803100;G:53602781;T:49548779;N:461 65       39134451 53803100 53602781 49548779 461 SRX21486797 SRS18719094 SRA1700461 Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry Max Planck Institute of Biochemistry 1 0.28808   0.01959   0.91553   0.47742   78   B   usable mapping rate illumina nextseq 5prime size_fractionation unknown bulk unknown unknown   Germany 2023-08-28 Blastula Embryo Whole Organism All anatomical structures
25288 25288 SRR25764126 SRX21486796 SRS18719096 SRP457111 PRJNA1009808 Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] GSE241754 Transcriptome Analysis Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. parent bioproject:PRJNA1009800 pubmed:39402326   WT sphere 4 hpf tRNA seq rep1 GSM7734777   source name:Blastula|strain:TLAB strain|tissue:Blastula|developmental stage:Sphere 4 hpf|genotype:WT|geo loc name:missing|collection date:missing WT sphere 4 hpf tRNA seq rep1 Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts Blastula unperturbed growth conditions in E3 medium for zebrafish embryos. 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle. strain:TLAB strain|tissue:Blastula|developmental stage:Sphere 4 hpf|genotype:WT GSM7734777 GSM7734777: WT sphere 4 hpf tRNA seq rep1; Danio rerio; ncRNA Seq GSM7734777 r1 GSM7734777 1 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 500   SRP457111     WT_tRNA_sphere_1.fastq.gz fastq 273027894.0 4080366.0 GSM7734777 r1 0:66.91 A:54678043;C:74713512;G:74872888;T:68762883;N:568 66       54678043 74713512 74872888 68762883 568 SRX21486796 SRS18719096 SRA1700461 Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry Max Planck Institute of Biochemistry 1 0.30124   0.01877   0.9163   0.49987   79   B   usable mapping rate illumina nextseq 5prime size_fractionation unknown bulk unknown unknown   Germany 2023-08-28 Blastula Embryo Whole Organism All anatomical structures
25289 25289 SRR25764127 SRX21486795 SRS18719097 SRP457111 PRJNA1009808 Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] GSE241754 Transcriptome Analysis Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. parent bioproject:PRJNA1009800 pubmed:39402326   WT 1000 cell 3 hpf tRNA seq rep2 GSM7734776   source name:Blastula|strain:TLAB strain|tissue:Blastula|developmental stage:1000 cell 3 hpf|genotype:WT|geo loc name:missing|collection date:missing WT 1000 cell 3 hpf tRNA seq rep2 Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts Blastula unperturbed growth conditions in E3 medium for zebrafish embryos. 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle. strain:TLAB strain|tissue:Blastula|developmental stage:1000 cell 3 hpf|genotype:WT GSM7734776 GSM7734776: WT 1000 cell 3 hpf tRNA seq rep2; Danio rerio; ncRNA Seq GSM7734776 r1 GSM7734776 1 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 500   SRP457111     WT_tRNA_1Kcell_2.fastq.gz fastq 240973473.0 3918764.0 GSM7734776 r1 0:61.49 A:48091658;C:66684510;G:65183534;T:61013184;N:587 61       48091658 66684510 65183534 61013184 587 SRX21486795 SRS18719097 SRA1700461 Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry Max Planck Institute of Biochemistry 1 0.26629   0.02297   0.92305   0.48525   79   B   usable mapping rate illumina nextseq 5prime size_fractionation unknown bulk unknown unknown   Germany 2023-08-28 Blastula Embryo Whole Organism All anatomical structures
25290 25290 SRR25764128 SRX21486794 SRS18719095 SRP457111 PRJNA1009808 Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] GSE241754 Transcriptome Analysis Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. parent bioproject:PRJNA1009800 pubmed:39402326   WT 1000 cell 3 hpf tRNA seq rep1 GSM7734775   source name:Blastula|strain:TLAB strain|tissue:Blastula|developmental stage:1000 cell 3 hpf|genotype:WT|geo loc name:missing|collection date:missing WT 1000 cell 3 hpf tRNA seq rep1 Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts Blastula unperturbed growth conditions in E3 medium for zebrafish embryos. 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle. strain:TLAB strain|tissue:Blastula|developmental stage:1000 cell 3 hpf|genotype:WT GSM7734775 GSM7734775: WT 1000 cell 3 hpf tRNA seq rep1; Danio rerio; ncRNA Seq GSM7734775 r1 GSM7734775 1 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 500   SRP457111     WT_tRNA_1Kcell_1.fastq.gz fastq 153597915.0 2445091.0 GSM7734775 r1 0:62.82 A:30905842;C:42377268;G:41639937;T:38674503;N:365 62       30905842 42377268 41639937 38674503 365 SRX21486794 SRS18719095 SRA1700461 Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry Max Planck Institute of Biochemistry 1 0.27317   0.02516   0.92454   0.49385   77   B   usable mapping rate illumina nextseq 5prime size_fractionation unknown bulk unknown unknown   Germany 2023-08-28 Blastula Embryo Whole Organism All anatomical structures
25291 25291 SRR25764129 SRX21486793 SRS18719091 SRP457111 PRJNA1009808 Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] GSE241754 Transcriptome Analysis Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. parent bioproject:PRJNA1009800 pubmed:39402326   WT 256 cell 2.5 hpf tRNA seq rep2 GSM7734774   source name:Blastula|strain:TLAB strain|tissue:Blastula|developmental stage:256 cell 2.5 hpf|genotype:WT|geo loc name:missing|collection date:missing WT 256 cell 2.5 hpf tRNA seq rep2 Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts Blastula unperturbed growth conditions in E3 medium for zebrafish embryos. 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle. strain:TLAB strain|tissue:Blastula|developmental stage:256 cell 2.5 hpf|genotype:WT GSM7734774 GSM7734774: WT 256 cell 2.5 hpf tRNA seq rep2; Danio rerio; ncRNA Seq GSM7734774 r1 GSM7734774 1 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 500   SRP457111     WT_tRNA_256cell_2.fastq.gz fastq 844659062.0 13660310.0 GSM7734774 r1 0:61.83 A:165996817;C:234451560;G:230230791;T:213977958;N:1936 61       165996817 234451560 230230791 213977958 1936 SRX21486793 SRS18719091 SRA1700461 Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry Max Planck Institute of Biochemistry 1 0.26001   0.01993   0.92594   0.45714   61   B   usable mapping rate illumina nextseq 5prime size_fractionation unknown bulk unknown unknown   Germany 2023-08-28 Blastula Embryo Whole Organism All anatomical structures
25292 25292 SRR25764130 SRX21486792 SRS18719088 SRP457111 PRJNA1009808 Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] GSE241754 Transcriptome Analysis Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. parent bioproject:PRJNA1009800 pubmed:39402326   WT 256 cell 2.5 hpf tRNA seq rep1 GSM7734773   source name:Blastula|strain:TLAB strain|tissue:Blastula|developmental stage:256 cell 2.5 hpf|genotype:WT|geo loc name:missing|collection date:missing WT 256 cell 2.5 hpf tRNA seq rep1 Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts Blastula unperturbed growth conditions in E3 medium for zebrafish embryos. 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle. strain:TLAB strain|tissue:Blastula|developmental stage:256 cell 2.5 hpf|genotype:WT GSM7734773 GSM7734773: WT 256 cell 2.5 hpf tRNA seq rep1; Danio rerio; ncRNA Seq GSM7734773 r1 GSM7734773 1 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 500   SRP457111     WT_tRNA_256cell_1.fastq.gz fastq 215968508.0 3436266.0 GSM7734773 r1 0:62.85 A:43791388;C:59547637;G:58130851;T:54498124;N:508 62       43791388 59547637 58130851 54498124 508 SRX21486792 SRS18719088 SRA1700461 Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry Max Planck Institute of Biochemistry 1 0.27383   0.02205   0.92748   0.46217   71   B   usable mapping rate illumina nextseq 5prime size_fractionation unknown bulk unknown unknown   Germany 2023-08-28 Blastula Embryo Whole Organism All anatomical structures
36266 36266 SRR953577 SRX336218 SRS471213 SRP028895 PRJNA138095 Transcriptome wide analysis of small RNA expression in early zebrafish development GSE27722 Transcriptome Analysis During early vertebrate development a large number of noncoding RNAs are maternally inherited or expressed upon activation of zygotic transcription. The exact identity expression levels and function during early vertebrate development for most of these noncoding RNAs remains largely unknown. miRNAs microRNAs and piRNAs piwi interacting RNAs are two classes of small non coding RNAs that play important roles in gene regulation during early embryonic development. Here we utilized Illumina next generation sequencing technology to determine temporal expression patterns for both miRNAs and piRNAs during four distinct stages of early vertebrate development using zebrafish as a model system. For miRNAs the expression patterns for 192 known miRNAs and 12 novel miRNAs within 123 different miRNA families were determined. Significant sequence variation was observed at the five prime' and three prime' ends of miRNAs with a large number of extra nucleotides added in a non template directed manner. We also identified a large and diverse set of piRNAs expressed during early development far beyond that expected if piRNA expression is restricted to germ cells. Our analyses represent the deepest investigation to date of small RNA expression during early vertebrate development and suggest important novel functions for small RNAs during embryogenesis. Overall design: Identify the expression of small RNAs in zebrafish embryos of four different developmental stages using high through put sequencing   pubmed:22408181   embryo 1dpf rep1 GSM686385   source name:the whole embryo|strain:AB*WT|developmental stage:1dpf|tissue:the whole embryos embryo 1dpf rep1 fasta: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. All the sequence with N inside was removed as well. The unique sequences were retained with the counts indicating thier abundance. The header of each sequence is composed of a unique sequence ID followed by a " x" and the reads counts. e.g. unique ID x counts. alignment: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. Small RNAs with perfect matches to the zebrafish genome Zv8 from Ensembl http://www.ensembl.org were retrieved using megaBLAST http://www.ncbi.nlm.nih.gov/blast/megablast.shtml and Bowtie http://bowtie bio.sourceforge.net/tutorial.shtml. To identify piRNAs consensus sequences from zebrafish repetitive elements were retrieved from Repbase http://www.girinst.org/repbase/index.html and Repeat Maskers using the UCSC genome browser http://genome.ucsc.edu. Small RNAs perfectly mapping to these consensus sequences and their genomic flanking regions were sorted into piRNA libraries with up to 3 genomic mapping positions for each unique RNA sequence. fasta files description: small RNA 15 30 nt alignment file description: piRNA map to repetitive elements the whole embryo   Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform. Embryos were raised at 28°C in egg water 0.03% Instant Ocean marine salt mix for the initial several hours of development strain:AB*WT|developmental stage:1dpf|tissue:the whole embryos GSM686385 GSM686385: embryo 1dpf rep1; Danio rerio; ncRNA Seq GSM686385   1 Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform. GEO Accession:GSM686385 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina Genome Analyzer II   SRP028895     GSM686385_1dpf_Raw.txt fastq 293700240.0 8158340.0 GSM686385 r1 0:36 A:74642033;C:62153879;G:83836688;T:69542606;N:3525034 36       74642033 62153879 83836688 69542606 3525034 SRX336218 SRS471213 SRA098146 GEO Lee Lab, Molecular Biology, Mass General Hospital 1 0.00386   0.00274   0.99758   0.53623   36   T   under 1.2% mapping rate illumina early_illumina 5prime size_fractionation unknown bulk unknown unknown   United States 2011-03-07 Pharyngula Embryo Whole Organism All anatomical structures
36267 36267 SRR953576 SRX336217 SRS471211 SRP028895 PRJNA138095 Transcriptome wide analysis of small RNA expression in early zebrafish development GSE27722 Transcriptome Analysis During early vertebrate development a large number of noncoding RNAs are maternally inherited or expressed upon activation of zygotic transcription. The exact identity expression levels and function during early vertebrate development for most of these noncoding RNAs remains largely unknown. miRNAs microRNAs and piRNAs piwi interacting RNAs are two classes of small non coding RNAs that play important roles in gene regulation during early embryonic development. Here we utilized Illumina next generation sequencing technology to determine temporal expression patterns for both miRNAs and piRNAs during four distinct stages of early vertebrate development using zebrafish as a model system. For miRNAs the expression patterns for 192 known miRNAs and 12 novel miRNAs within 123 different miRNA families were determined. Significant sequence variation was observed at the five prime' and three prime' ends of miRNAs with a large number of extra nucleotides added in a non template directed manner. We also identified a large and diverse set of piRNAs expressed during early development far beyond that expected if piRNA expression is restricted to germ cells. Our analyses represent the deepest investigation to date of small RNA expression during early vertebrate development and suggest important novel functions for small RNAs during embryogenesis. Overall design: Identify the expression of small RNAs in zebrafish embryos of four different developmental stages using high through put sequencing   pubmed:22408181   embryo Shield rep1 GSM686384   source name:the whole embryo|strain:AB*WT|developmental stage:Shield|tissue:the whole embryos embryo Shield rep1 fasta: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. All the sequence with N inside was removed as well. The unique sequences were retained with the counts indicating thier abundance. The header of each sequence is composed of a unique sequence ID followed by a " x" and the reads counts. e.g. unique ID x counts. alignment: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. Small RNAs with perfect matches to the zebrafish genome Zv8 from Ensembl http://www.ensembl.org were retrieved using megaBLAST http://www.ncbi.nlm.nih.gov/blast/megablast.shtml and Bowtie http://bowtie bio.sourceforge.net/tutorial.shtml. To identify piRNAs consensus sequences from zebrafish repetitive elements were retrieved from Repbase http://www.girinst.org/repbase/index.html and Repeat Maskers using the UCSC genome browser http://genome.ucsc.edu. Small RNAs perfectly mapping to these consensus sequences and their genomic flanking regions were sorted into piRNA libraries with up to 3 genomic mapping positions for each unique RNA sequence. fasta files description: small RNA 15 30 nt alignment file description: piRNA map to repetitive elements the whole embryo   Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform. Embryos were raised at 28°C in egg water 0.03% Instant Ocean marine salt mix for the initial several hours of development strain:AB*WT|developmental stage:Shield|tissue:the whole embryos GSM686384 GSM686384: embryo Shield rep1; Danio rerio; ncRNA Seq GSM686384   1 Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform. GEO Accession:GSM686384 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina Genome Analyzer II   SRP028895     GSM686384_Shield_Raw.txt fastq 115067916.0 3196331.0 GSM686384 r1 0:36 A:28435718;C:21893278;G:31779352;T:26635839;N:6323729 36       28435718 21893278 31779352 26635839 6323729 SRX336217 SRS471211 SRA098146 GEO Lee Lab, Molecular Biology, Mass General Hospital 1 0.00278   0.00217   0.99933   0.60606   36   T   under 1.2% mapping rate illumina early_illumina 5prime size_fractionation unknown bulk unknown unknown   United States 2011-03-07 Gastrula Embryo Whole Organism All anatomical structures
36268 36268 SRR953575 SRX336216 SRS471212 SRP028895 PRJNA138095 Transcriptome wide analysis of small RNA expression in early zebrafish development GSE27722 Transcriptome Analysis During early vertebrate development a large number of noncoding RNAs are maternally inherited or expressed upon activation of zygotic transcription. The exact identity expression levels and function during early vertebrate development for most of these noncoding RNAs remains largely unknown. miRNAs microRNAs and piRNAs piwi interacting RNAs are two classes of small non coding RNAs that play important roles in gene regulation during early embryonic development. Here we utilized Illumina next generation sequencing technology to determine temporal expression patterns for both miRNAs and piRNAs during four distinct stages of early vertebrate development using zebrafish as a model system. For miRNAs the expression patterns for 192 known miRNAs and 12 novel miRNAs within 123 different miRNA families were determined. Significant sequence variation was observed at the five prime' and three prime' ends of miRNAs with a large number of extra nucleotides added in a non template directed manner. We also identified a large and diverse set of piRNAs expressed during early development far beyond that expected if piRNA expression is restricted to germ cells. Our analyses represent the deepest investigation to date of small RNA expression during early vertebrate development and suggest important novel functions for small RNAs during embryogenesis. Overall design: Identify the expression of small RNAs in zebrafish embryos of four different developmental stages using high through put sequencing   pubmed:22408181   embryo sphere rep2 GSM686383   source name:the whole embryo|strain:AB*WT|developmental stage:sphere|tissue:the whole embryos embryo sphere rep2 fasta: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. All the sequence with N inside was removed as well. The unique sequences were retained with the counts indicating thier abundance. The header of each sequence is composed of a unique sequence ID followed by a " x" and the reads counts. e.g. unique ID x counts. alignment: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. Small RNAs with perfect matches to the zebrafish genome Zv8 from Ensembl http://www.ensembl.org were retrieved using megaBLAST http://www.ncbi.nlm.nih.gov/blast/megablast.shtml and Bowtie http://bowtie bio.sourceforge.net/tutorial.shtml. To identify piRNAs consensus sequences from zebrafish repetitive elements were retrieved from Repbase http://www.girinst.org/repbase/index.html and Repeat Maskers using the UCSC genome browser http://genome.ucsc.edu. Small RNAs perfectly mapping to these consensus sequences and their genomic flanking regions were sorted into piRNA libraries with up to 3 genomic mapping positions for each unique RNA sequence. fasta files description: small RNA 15 30 nt alignment file description: piRNA map to repetitive elements the whole embryo   Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform. Embryos were raised at 28°C in egg water 0.03% Instant Ocean marine salt mix for the initial several hours of development strain:AB*WT|developmental stage:sphere|tissue:the whole embryos GSM686383 GSM686383: embryo sphere rep2; Danio rerio; ncRNA Seq GSM686383   1 Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform. GEO Accession:GSM686383 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina Genome Analyzer II   SRP028895     GSM686383_Sphere_2_Raw.txt fastq 369741456.0 10270596.0 GSM686383 r1 0:36 A:89854472;C:70044086;G:109552597;T:100266590;N:23711 36       89854472 70044086 109552597 100266590 23711 SRX336216 SRS471212 SRA098146 GEO Lee Lab, Molecular Biology, Mass General Hospital 1 0.00421   0.00367   0.99924   0.51111   36   T   under 1.2% mapping rate illumina early_illumina 5prime size_fractionation unknown bulk unknown unknown   United States 2011-03-07 Blastula Embryo Whole Organism All anatomical structures
36269 36269 SRR953574 SRX336215 SRS471209 SRP028895 PRJNA138095 Transcriptome wide analysis of small RNA expression in early zebrafish development GSE27722 Transcriptome Analysis During early vertebrate development a large number of noncoding RNAs are maternally inherited or expressed upon activation of zygotic transcription. The exact identity expression levels and function during early vertebrate development for most of these noncoding RNAs remains largely unknown. miRNAs microRNAs and piRNAs piwi interacting RNAs are two classes of small non coding RNAs that play important roles in gene regulation during early embryonic development. Here we utilized Illumina next generation sequencing technology to determine temporal expression patterns for both miRNAs and piRNAs during four distinct stages of early vertebrate development using zebrafish as a model system. For miRNAs the expression patterns for 192 known miRNAs and 12 novel miRNAs within 123 different miRNA families were determined. Significant sequence variation was observed at the five prime' and three prime' ends of miRNAs with a large number of extra nucleotides added in a non template directed manner. We also identified a large and diverse set of piRNAs expressed during early development far beyond that expected if piRNA expression is restricted to germ cells. Our analyses represent the deepest investigation to date of small RNA expression during early vertebrate development and suggest important novel functions for small RNAs during embryogenesis. Overall design: Identify the expression of small RNAs in zebrafish embryos of four different developmental stages using high through put sequencing   pubmed:22408181   embryo sphere rep1 GSM686382   source name:the whole embryo|strain:AB*WT|developmental stage:sphere|tissue:the whole embryos embryo sphere rep1 fasta: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. All the sequence with N inside was removed as well. The unique sequences were retained with the counts indicating thier abundance. The header of each sequence is composed of a unique sequence ID followed by a " x" and the reads counts. e.g. unique ID x counts. alignment: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. Small RNAs with perfect matches to the zebrafish genome Zv8 from Ensembl http://www.ensembl.org were retrieved using megaBLAST http://www.ncbi.nlm.nih.gov/blast/megablast.shtml and Bowtie http://bowtie bio.sourceforge.net/tutorial.shtml. To identify piRNAs consensus sequences from zebrafish repetitive elements were retrieved from Repbase http://www.girinst.org/repbase/index.html and Repeat Maskers using the UCSC genome browser http://genome.ucsc.edu. Small RNAs perfectly mapping to these consensus sequences and their genomic flanking regions were sorted into piRNA libraries with up to 3 genomic mapping positions for each unique RNA sequence. fasta files description: small RNA 15 30 nt alignment file description: piRNA map to repetitive elements the whole embryo   Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform. Embryos were raised at 28°C in egg water 0.03% Instant Ocean marine salt mix for the initial several hours of development strain:AB*WT|developmental stage:sphere|tissue:the whole embryos GSM686382 GSM686382: embryo sphere rep1; Danio rerio; ncRNA Seq GSM686382   1 Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform. GEO Accession:GSM686382 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina Genome Analyzer II   SRP028895     GSM686382_Sphere_1_Raw.txt fastq 492502284.0 13680619.0 GSM686382 r1 0:36 A:114418890;C:99502519;G:142841794;T:135061742;N:677339 36       114418890 99502519 142841794 135061742 677339 SRX336215 SRS471209 SRA098146 GEO Lee Lab, Molecular Biology, Mass General Hospital 1 0.00828   0.00636   0.9964   0.54822   36   T   under 1.2% mapping rate illumina early_illumina 5prime size_fractionation unknown bulk unknown unknown   United States 2011-03-07 Blastula Embryo Whole Organism All anatomical structures
36270 36270 SRR953573 SRX336214 SRS471210 SRP028895 PRJNA138095 Transcriptome wide analysis of small RNA expression in early zebrafish development GSE27722 Transcriptome Analysis During early vertebrate development a large number of noncoding RNAs are maternally inherited or expressed upon activation of zygotic transcription. The exact identity expression levels and function during early vertebrate development for most of these noncoding RNAs remains largely unknown. miRNAs microRNAs and piRNAs piwi interacting RNAs are two classes of small non coding RNAs that play important roles in gene regulation during early embryonic development. Here we utilized Illumina next generation sequencing technology to determine temporal expression patterns for both miRNAs and piRNAs during four distinct stages of early vertebrate development using zebrafish as a model system. For miRNAs the expression patterns for 192 known miRNAs and 12 novel miRNAs within 123 different miRNA families were determined. Significant sequence variation was observed at the five prime' and three prime' ends of miRNAs with a large number of extra nucleotides added in a non template directed manner. We also identified a large and diverse set of piRNAs expressed during early development far beyond that expected if piRNA expression is restricted to germ cells. Our analyses represent the deepest investigation to date of small RNA expression during early vertebrate development and suggest important novel functions for small RNAs during embryogenesis. Overall design: Identify the expression of small RNAs in zebrafish embryos of four different developmental stages using high through put sequencing   pubmed:22408181   embryo 256 cell rep1 GSM686381   source name:the whole embryo|strain:AB* WT|developmental stage:256 cell|tissue:the whole embryos embryo 256 cell rep1 fasta: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. All the sequence with N inside was removed as well. The unique sequences were retained with the counts indicating thier abundance. The header of each sequence is composed of a unique sequence ID followed by a " x" and the reads counts. e.g. unique ID x counts. alignment: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. Small RNAs with perfect matches to the zebrafish genome Zv8 from Ensembl http://www.ensembl.org were retrieved using megaBLAST http://www.ncbi.nlm.nih.gov/blast/megablast.shtml and Bowtie http://bowtie bio.sourceforge.net/tutorial.shtml. To identify piRNAs consensus sequences from zebrafish repetitive elements were retrieved from Repbase http://www.girinst.org/repbase/index.html and Repeat Maskers using the UCSC genome browser http://genome.ucsc.edu. Small RNAs perfectly mapping to these consensus sequences and their genomic flanking regions were sorted into piRNA libraries with up to 3 genomic mapping positions for each unique RNA sequence. fasta files description: small RNA 15 30 nt alignment file description: piRNA map to repetitive elements the whole embryo   Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform. Embryos were raised at 28°C in egg water 0.03% Instant Ocean marine salt mix for the initial several hours of development strain:AB* WT|developmental stage:256 cell|tissue:the whole embryos GSM686381 GSM686381: embryo 256 cell rep1; Danio rerio; ncRNA Seq GSM686381   1 Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform. GEO Accession:GSM686381 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina Genome Analyzer II   SRP028895     GSM686381_256-cell_Raw.txt fastq 177430716.0 4928631.0 GSM686381 r1 0:36 A:46047586;C:39494059;G:46591098;T:42305117;N:2992856 36       46047586 39494059 46591098 42305117 2992856 SRX336214 SRS471210 SRA098146 GEO Lee Lab, Molecular Biology, Mass General Hospital 1 0.01914   0.01515   0.99164   0.52579   36   B   usable mapping rate illumina early_illumina 5prime size_fractionation unknown bulk unknown unknown   United States 2011-03-07 Blastula Embryo Whole Organism All anatomical structures
55851 55851 SRR10863004 SRX7533076 SRS5972269 SRP241074 PRJNA597223 Danio rerio primordial germ cell expression pofiling PRJNA597223 Whole Genome Sequencing Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.     The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done.   wt PGCs 2dpf rep1   strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:2dpf|dev stage:Long pec stage|sex:not applicable|tissue:germline|biological replicate:replicate 1|BioSampleModel:Model organism or animal                 small RNA of Zebrafish: PGCs 2dpf imb ketting 2018 03 redl smRNA 04 07 2dpf PGCs rep1 S4.R1 imb ketting 2018 03 redl smRNA 04 07 2dpf PGCs rep1 S4.R1 Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.     ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP241074     imb_ketting_2018_03_redl_smRNA_04_07_2dpf_PGCs_rep1_S4.R1.fastq.gz fastq 3376468872.0 40196058.0 imb ketting 2018 03 redl smRNA 04 07 2dpf PGCs rep1 S4.R1.fastq.gz 0:84 1:0 A:844908938;C:858861843;G:817445857;T:855220450;N:31784 84 0     844908938 858861843 817445857 855220450 31784 SRX7533076 SRS5972269 SRA1023320 Rene Ketting group|Ketting Lab Rene Ketting group 1 0.0005   3e-05   0.99922   0.65853   84   T   under 1.2% mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   Germany 2020-01-10 Hatching Embryo Whole Organism All anatomical structures
55862 55862 SRR10863003 SRX7533065 SRS5972268 SRP241074 PRJNA597223 Danio rerio primordial germ cell expression pofiling PRJNA597223 Whole Genome Sequencing Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.     The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done.   wt PGCs 1dpf rep3   strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:1dpf|dev stage:Pharyngula period|sex:not applicable|tissue:germline|biological replicate:replicate 3|BioSampleModel:Model organism or animal                 small RNA of Zebrafish: PGCs 1dpf imb ketting 2018 03 redl smRNA 03 20 1dpf PGCs rep3 S3.R1 imb ketting 2018 03 redl smRNA 03 20 1dpf PGCs rep3 S3.R1 Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.     ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP241074     imb_ketting_2018_03_redl_smRNA_03_20_1dpf_PGCs_rep3_S3.R1.fastq.gz fastq 3136475328.0 37338992.0 imb ketting 2018 03 redl smRNA 03 20 1dpf PGCs rep3 S3.R1.fastq.gz 0:84 1:0 A:743596563;C:770089055;G:796526363;T:826235723;N:27624 84 0     743596563 770089055 796526363 826235723 27624 SRX7533065 SRS5972268 SRA1023320 Rene Ketting group|Ketting Lab Rene Ketting group 1 0.00094   2e-05   0.999   0.69871   84   T   under 1.2% mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   Germany 2020-01-10 Pharyngula Embryo Whole Organism All anatomical structures
55872 55872 SRR10863015 SRX7533055 SRS5972267 SRP241074 PRJNA597223 Danio rerio primordial germ cell expression pofiling PRJNA597223 Whole Genome Sequencing Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.     The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done.   wt PGCs 1dpf rep2   strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:1dpf|dev stage:Pharyngula period|sex:not applicable|tissue:germline|biological replicate:replicate 2|BioSampleModel:Model organism or animal                 small RNA of Zebrafish: PGCs 1dpf imb ketting 2018 03 redl smRNA 02 30 1dpf PGCs rep2 S2.R1 imb ketting 2018 03 redl smRNA 02 30 1dpf PGCs rep2 S2.R1 Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.     ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP241074     imb_ketting_2018_03_redl_smRNA_02_30_1dpf_PGCs_rep2_S2.R1.fastq.gz fastq 3186833832.0 37938498.0 imb ketting 2018 03 redl smRNA 02 30 1dpf PGCs rep2 S2.R1.fastq.gz 0:84 1:0 A:772047868;C:764764928;G:803857310;T:846133704;N:30022 84 0     772047868 764764928 803857310 846133704 30022 SRX7533055 SRS5972267 SRA1023320 Rene Ketting group|Ketting Lab Rene Ketting group 1 0.00072   1e-05   0.99922   0.65573   84   T   under 1.2% mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   Germany 2020-01-10 Pharyngula Embryo Whole Organism All anatomical structures
55882 55882 SRR10863050 SRX7533045 SRS5972243 SRP241074 PRJNA597223 Danio rerio primordial germ cell expression pofiling PRJNA597223 Whole Genome Sequencing Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.     The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done.   wt PGCs 3dpf rep2   strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:3dpf|dev stage:protruding mouth|sex:not applicable|tissue:germline|biological replicate:replicate 2|BioSampleModel:Model organism or animal                 small RNA of Zebrafish: PGCs 3dpf imb ketting 2018 03 redl smRNA 08 46 3dpf PGCs rep2 S8.R1 imb ketting 2018 03 redl smRNA 08 46 3dpf PGCs rep2 S8.R1 Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.     ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP241074     imb_ketting_2018_03_redl_smRNA_08_46_3dpf_PGCs_rep2_S8.R1.fastq.gz fastq 3852707292.0 45865563.0 imb ketting 2018 03 redl smRNA 08 46 3dpf PGCs rep2 S8.R1.fastq.gz 0:84 1:0 A:980860932;C:926253063;G:920737181;T:1024819575;N:36541 84 0     980860932 926253063 920737181 1024819575 36541 SRX7533045 SRS5972243 SRA1023320 Rene Ketting group|Ketting Lab Rene Ketting group 1 0.00017   2e-05   0.99963   0.75   84   T   under 1.2% mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   Germany 2020-01-10 Larval Larval Whole Organism All anatomical structures
55883 55883 SRR10863025 SRX7533044 SRS5972254 SRP241074 PRJNA597223 Danio rerio primordial germ cell expression pofiling PRJNA597223 Whole Genome Sequencing Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.     The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done.   wt zygote 0hpf rep2   strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:0hpf|dev stage:zygote|sex:not applicable|tissue:whole embryo|biological replicate:replicate 2|BioSampleModel:Model organism or animal                 small RNA of Zebrafish: zygotes 0hpf imb ketting 2018 19 redl smRNA 07 0hpf zygotes rep2 S30.R1 imb ketting 2018 19 redl smRNA 07 0hpf zygotes rep2 S30.R1 Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.     ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP241074     imb_ketting_2018_19_redl_smRNA-07_0hpf_zygotes_rep2_S30.R1.fastq.gz fastq 1083028275.0 14440377.0 imb ketting 2018 19 redl smRNA 07 0hpf zygotes rep2 S30.R1.fastq.gz 0:75 1:0 A:261596209;C:277009311;G:258733780;T:285678456;N:10519 75 0     261596209 277009311 258733780 285678456 10519 SRX7533044 SRS5972254 SRA1023320 Rene Ketting group|Ketting Lab Rene Ketting group 1 0.00065   8e-05   0.99906   0.73076   75   T   under 1.2% mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   Germany 2020-01-10 Zygote Embryo Whole Organism All anatomical structures
55884 55884 SRR10863026 SRX7533043 SRS5972253 SRP241074 PRJNA597223 Danio rerio primordial germ cell expression pofiling PRJNA597223 Whole Genome Sequencing Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.     The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done.   wt zygote 0hpf rep1   strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:0hpf|dev stage:zygote|sex:not applicable|tissue:whole embryo|biological replicate:replicate 1|BioSampleModel:Model organism or animal                 small RNA of Zebrafish: zygotes 0hpf imb ketting 2018 19 redl smRNA 06 0hpf zygotes rep1 S29.R1 imb ketting 2018 19 redl smRNA 06 0hpf zygotes rep1 S29.R1 Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.     ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP241074     imb_ketting_2018_19_redl_smRNA-06_0hpf_zygotes_rep1_S29.R1.fastq.gz fastq 1094583075.0 14594441.0 imb ketting 2018 19 redl smRNA 06 0hpf zygotes rep1 S29.R1.fastq.gz 0:75 1:0 A:272231426;C:272258006;G:282795391;T:267287656;N:10596 75 0     272231426 272258006 282795391 267287656 10596 SRX7533043 SRS5972253 SRA1023320 Rene Ketting group|Ketting Lab Rene Ketting group 1 0.00035   7e-05   0.99935   0.63043   75   T   under 1.2% mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   Germany 2020-01-10 Zygote Embryo Whole Organism All anatomical structures
55887 55887 SRR10863028 SRX7533040 SRS5972265 SRP241074 PRJNA597223 Danio rerio primordial germ cell expression pofiling PRJNA597223 Whole Genome Sequencing Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.     The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done.   wt PGCs 1dpf rep1   strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:1dpf|dev stage:Pharyngula period|sex:not applicable|tissue:germline|biological replicate:replicate 1|BioSampleModel:Model organism or animal                 small RNA of Zebrafish: PGCs 1dpf imb ketting 2018 03 redl smRNA 01 24 1dpf PGCs rep1 S1.R1 imb ketting 2018 03 redl smRNA 01 24 1dpf PGCs rep1 S1.R1 Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.     ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP241074     imb_ketting_2018_03_redl_smRNA_01_24_1dpf_PGCs_rep1_S1.R1.fastq.gz fastq 2999534160.0 35708740.0 imb ketting 2018 03 redl smRNA 01 24 1dpf PGCs rep1 S1.R1.fastq.gz 0:84 1:0 A:763136061;C:754741465;G:717861943;T:763766703;N:27988 84 0     763136061 754741465 717861943 763766703 27988 SRX7533040 SRS5972265 SRA1023320 Rene Ketting group|Ketting Lab Rene Ketting group 1 0.00031   0.0   0.99945   0.59259   84   T   under 1.2% mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   Germany 2020-01-10 Pharyngula Embryo Whole Organism All anatomical structures
55898 55898 SRR10863039 SRX7533029 SRS5972255 SRP241074 PRJNA597223 Danio rerio primordial germ cell expression pofiling PRJNA597223 Whole Genome Sequencing Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.     The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done.   wt zygote 0hpf rep3   strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:0hpf|dev stage:zygote|sex:not applicable|tissue:whole embryo|biological replicate:replicate 3|BioSampleModel:Model organism or animal                 small RNA of Zebrafish: zygotes 0hpf imb ketting 2018 19 redl smRNA 08 0hpf zygotes rep3 S31.R1 imb ketting 2018 19 redl smRNA 08 0hpf zygotes rep3 S31.R1 Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.     ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP241074     imb_ketting_2018_19_redl_smRNA-08_0hpf_zygotes_rep3_S31.R1.fastq.gz fastq 1174146225.0 15655283.0 imb ketting 2018 19 redl smRNA 08 0hpf zygotes rep3 S31.R1.fastq.gz 0:75 1:0 A:275690402;C:320014688;G:295706949;T:282722725;N:11461 75 0     275690402 320014688 295706949 282722725 11461 SRX7533029 SRS5972255 SRA1023320 Rene Ketting group|Ketting Lab Rene Ketting group 1 0.00017   2e-05   0.99977   0.26315   75   T   under 1.2% mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   Germany 2020-01-10 Zygote Embryo Whole Organism All anatomical structures
55901 55901 SRR10863042 SRX7533026 SRS5972251 SRP241074 PRJNA597223 Danio rerio primordial germ cell expression pofiling PRJNA597223 Whole Genome Sequencing Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.     The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done.   wt PGCs 10dpf rep3   strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:10dpf|dev stage:larval|sex:not applicable|tissue:germline|biological replicate:replicate 3|BioSampleModel:Model organism or animal                 small RNA of Zebrafish: PGCs 10dpf imb ketting 2018 19 redl smRNA 05 10dpf PGCs rep3 S28.R1 imb ketting 2018 19 redl smRNA 05 10dpf PGCs rep3 S28.R1 Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.     ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP241074     imb_ketting_2018_19_redl_smRNA-05_10dpf_PGCs_rep3_S28.R1.fastq.gz fastq 1042531125.0 13900415.0 imb ketting 2018 19 redl smRNA 05 10dpf PGCs rep3 S28.R1.fastq.gz 0:75 1:0 A:256767457;C:264830616;G:280326422;T:240596693;N:9937 75 0     256767457 264830616 280326422 240596693 9937 SRX7533026 SRS5972251 SRA1023320 Rene Ketting group|Ketting Lab Rene Ketting group 1 9e-05   3e-05   0.99981   0.55555   75   T   under 1.2% mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   Germany 2020-01-10 Larval Larval Whole Organism All anatomical structures
55902 55902 SRR10863043 SRX7533025 SRS5972250 SRP241074 PRJNA597223 Danio rerio primordial germ cell expression pofiling PRJNA597223 Whole Genome Sequencing Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.     The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done.   wt PGCs 10dpf rep2   strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:10dpf|dev stage:larval|sex:not applicable|tissue:germline|biological replicate:replicate 2|BioSampleModel:Model organism or animal                 small RNA of Zebrafish: PGCs 10dpf imb ketting 2018 19 redl smRNA 04 10dpf PGCs rep2 S27.R1 imb ketting 2018 19 redl smRNA 04 10dpf PGCs rep2 S27.R1 Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.     ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP241074     imb_ketting_2018_19_redl_smRNA-04_10dpf_PGCs_rep2_S27.R1.fastq.gz fastq 1011225675.0 13483009.0 imb ketting 2018 19 redl smRNA 04 10dpf PGCs rep2 S27.R1.fastq.gz 0:75 1:0 A:249509861;C:240472285;G:259641490;T:261592569;N:9470 75 0     249509861 240472285 259641490 261592569 9470 SRX7533025 SRS5972250 SRA1023320 Rene Ketting group|Ketting Lab Rene Ketting group 1 0.0001   3e-05   0.99981   0.6   75   T   under 1.2% mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   Germany 2020-01-10 Larval Larval Whole Organism All anatomical structures
55903 55903 SRR10863047 SRX7533024 SRS5972249 SRP241074 PRJNA597223 Danio rerio primordial germ cell expression pofiling PRJNA597223 Whole Genome Sequencing Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.     The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done.   wt PGCs 10dpf rep1   strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:10dpf|dev stage:larval|sex:not applicable|tissue:germline|biological replicate:replicate 1|BioSampleModel:Model organism or animal                 small RNA of Zebrafish: PGCs 10dpf imb ketting 2018 19 redl smRNA 03 10dpf PGCs rep1 S26.R1 imb ketting 2018 19 redl smRNA 03 10dpf PGCs rep1 S26.R1 Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.     ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP241074     imb_ketting_2018_19_redl_smRNA-03_10dpf_PGCs_rep1_S26.R1.fastq.gz fastq 1084119750.0 14454930.0 imb ketting 2018 19 redl smRNA 03 10dpf PGCs rep1 S26.R1.fastq.gz 0:75 1:0 A:284983733;C:273119022;G:259385750;T:266620639;N:10606 75 0     284983733 273119022 259385750 266620639 10606 SRX7533024 SRS5972249 SRA1023320 Rene Ketting group|Ketting Lab Rene Ketting group 1 7e-05   4e-05   0.99991   1.0   75   T   under 1.2% mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   Germany 2020-01-10 Larval Larval Whole Organism All anatomical structures
55904 55904 SRR10863044 SRX7533023 SRS5972248 SRP241074 PRJNA597223 Danio rerio primordial germ cell expression pofiling PRJNA597223 Whole Genome Sequencing Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.     The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done.   wt PGCs 6dpf rep3   strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:6dpf|dev stage:larval|sex:not applicable|tissue:germline|biological replicate:replicate 3|BioSampleModel:Model organism or animal                 small RNA of Zebrafish: PGCs 6dpf imb ketting 2018 03 redl smRNA 12 57 6dpf PGCs rep3 S12.R1 imb ketting 2018 03 redl smRNA 12 57 6dpf PGCs rep3 S12.R1 Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.     ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP241074     imb_ketting_2018_03_redl_smRNA_12_57_6dpf_PGCs_rep3_S12.R1.fastq.gz fastq 3431563044.0 40851941.0 imb ketting 2018 03 redl smRNA 12 57 6dpf PGCs rep3 S12.R1.fastq.gz 0:84 1:0 A:823584243;C:893116880;G:899744072;T:815086020;N:31829 84 0     823584243 893116880 899744072 815086020 31829 SRX7533023 SRS5972248 SRA1023320 Rene Ketting group|Ketting Lab Rene Ketting group 1 0.00011   0.0   0.99969   0.7647   84   T   under 1.2% mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   Germany 2020-01-10 Larval Larval Whole Organism All anatomical structures
55905 55905 SRR10863045 SRX7533022 SRS5972247 SRP241074 PRJNA597223 Danio rerio primordial germ cell expression pofiling PRJNA597223 Whole Genome Sequencing Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.     The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done.   wt PGCs 6dpf rep2   strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:6dpf|dev stage:larval|sex:not applicable|tissue:germline|biological replicate:replicate 2|BioSampleModel:Model organism or animal                 small RNA of Zebrafish: PGCs 6dpf imb ketting 2018 03 redl smRNA 11 16 6dpf PGCs rep2 S11.R1 imb ketting 2018 03 redl smRNA 11 16 6dpf PGCs rep2 S11.R1 Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.     ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP241074     imb_ketting_2018_03_redl_smRNA_11_16_6dpf_PGCs_rep2_S11.R1.fastq.gz fastq 3706743516.0 44127899.0 imb ketting 2018 03 redl smRNA 11 16 6dpf PGCs rep2 S11.R1.fastq.gz 0:84 1:0 A:934342251;C:847639723;G:983363359;T:941363616;N:34567 84 0     934342251 847639723 983363359 941363616 34567 SRX7533022 SRS5972247 SRA1023320 Rene Ketting group|Ketting Lab Rene Ketting group 1 0.00015   1e-05   0.99969   0.79166   84   T   under 1.2% mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   Germany 2020-01-10 Larval Larval Whole Organism All anatomical structures
55906 55906 SRR10863046 SRX7533021 SRS5972246 SRP241074 PRJNA597223 Danio rerio primordial germ cell expression pofiling PRJNA597223 Whole Genome Sequencing Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.     The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done.   wt PGCs 6dpf rep1   strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:6dpf|dev stage:larval|sex:not applicable|tissue:germline|biological replicate:replicate 1|BioSampleModel:Model organism or animal                 small RNA of Zebrafish: PGCs 6dpf imb ketting 2018 03 redl smRNA 10 15 6dpf PGCs rep1 S10.R1 imb ketting 2018 03 redl smRNA 10 15 6dpf PGCs rep1 S10.R1 Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.     ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP241074     imb_ketting_2018_03_redl_smRNA_10_15_6dpf_PGCs_rep1_S10.R1.fastq.gz fastq 4114543692.0 48982663.0 imb ketting 2018 03 redl smRNA 10 15 6dpf PGCs rep1 S10.R1.fastq.gz 0:84 1:0 A:993905308;C:987610832;G:993056368;T:1139933198;N:37986 84 0     993905308 987610832 993056368 1139933198 37986 SRX7533021 SRS5972246 SRA1023320 Rene Ketting group|Ketting Lab Rene Ketting group 1 0.00012   1e-05   0.99973   0.61111   84   T   under 1.2% mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   Germany 2020-01-10 Larval Larval Whole Organism All anatomical structures
55907 55907 SRR10863048 SRX7533020 SRS5972245 SRP241074 PRJNA597223 Danio rerio primordial germ cell expression pofiling PRJNA597223 Whole Genome Sequencing Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.     The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done.   wt PGCs 3dpf rep3   strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:3dpf|dev stage:protruding mouth|sex:not applicable|tissue:germline|biological replicate:replicate 3|BioSampleModel:Model organism or animal                 small RNA of Zebrafish: PGCs 3dpf imb ketting 2018 03 redl smRNA 09 52 3dpf PGCs rep3 S9.R1 imb ketting 2018 03 redl smRNA 09 52 3dpf PGCs rep3 S9.R1 Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.     ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP241074     imb_ketting_2018_03_redl_smRNA_09_52_3dpf_PGCs_rep3_S9.R1.fastq.gz fastq 3765506136.0 44827454.0 imb ketting 2018 03 redl smRNA 09 52 3dpf PGCs rep3 S9.R1.fastq.gz 0:84 1:0 A:958464986;C:904515238;G:945479893;T:957010792;N:35227 84 0     958464986 904515238 945479893 957010792 35227 SRX7533020 SRS5972245 SRA1023320 Rene Ketting group|Ketting Lab Rene Ketting group 1 0.00026   2e-05   0.99953   0.74418   84   T   under 1.2% mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   Germany 2020-01-10 Larval Larval Whole Organism All anatomical structures
55908 55908 SRR10863049 SRX7533019 SRS5972242 SRP241074 PRJNA597223 Danio rerio primordial germ cell expression pofiling PRJNA597223 Whole Genome Sequencing Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.     The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done.   wt PGCs 3dpf rep1   strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:3dpf|dev stage:protruding mouth|sex:not applicable|tissue:germline|biological replicate:replicate 1|BioSampleModel:Model organism or animal                 small RNA of Zebrafish: PGCs 3dpf imb ketting 2018 03 redl smRNA 07 32 3dpf PGCs rep1 S7.R1 imb ketting 2018 03 redl smRNA 07 32 3dpf PGCs rep1 S7.R1 Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.     ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP241074     imb_ketting_2018_03_redl_smRNA_07_32_3dpf_PGCs_rep1_S7.R1.fastq.gz fastq 3698150988.0 44025607.0 imb ketting 2018 03 redl smRNA 07 32 3dpf PGCs rep1 S7.R1.fastq.gz 0:84 1:0 A:953164627;C:924016680;G:885078395;T:935856295;N:34991 84 0     953164627 924016680 885078395 935856295 34991 SRX7533019 SRS5972242 SRA1023320 Rene Ketting group|Ketting Lab Rene Ketting group 1 0.0001   1e-05   0.99973   0.57142   84   T   under 1.2% mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   Germany 2020-01-10 Larval Larval Whole Organism All anatomical structures
55909 55909 SRR10863051 SRX7533018 SRS5972252 SRP241074 PRJNA597223 Danio rerio primordial germ cell expression pofiling PRJNA597223 Whole Genome Sequencing Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.     The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done.   wt PGCs 2dpf rep3   strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:2dpf|dev stage:Long pec stage|sex:not applicable|tissue:germline|biological replicate:replicate 3|BioSampleModel:Model organism or animal                 small RNA of Zebrafish: PGCs 2dpf imb ketting 2018 03 redl smRNA 06 61 2dpf PGCs rep3 S6.R1 imb ketting 2018 03 redl smRNA 06 61 2dpf PGCs rep3 S6.R1 Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.     ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP241074     imb_ketting_2018_03_redl_smRNA_06_61_2dpf_PGCs_rep3_S6.R1.fastq.gz fastq 3454014564.0 41119221.0 imb ketting 2018 03 redl smRNA 06 61 2dpf PGCs rep3 S6.R1.fastq.gz 0:84 1:0 A:806393586;C:867601464;G:910506431;T:869481915;N:31168 84 0     806393586 867601464 910506431 869481915 31168 SRX7533018 SRS5972252 SRA1023320 Rene Ketting group|Ketting Lab Rene Ketting group 1 0.00017   1e-05   0.99961   0.65384   84   T   under 1.2% mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   Germany 2020-01-10 Hatching Embryo Whole Organism All anatomical structures
55917 55917 SRR10863059 SRX7533010 SRS5972244 SRP241074 PRJNA597223 Danio rerio primordial germ cell expression pofiling PRJNA597223 Whole Genome Sequencing Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.     The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done.   wt PGCs 2dpf rep2   strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:2dpf|dev stage:Long pec stage|sex:not applicable|tissue:germline|biological replicate:replicate 2|BioSampleModel:Model organism or animal                 small RNA of Zebrafish: PGCs 2dpf imb ketting 2018 03 redl smRNA 05 22 2dpf PGCs rep2 S5.R1 imb ketting 2018 03 redl smRNA 05 22 2dpf PGCs rep2 S5.R1 Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.     ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP241074     imb_ketting_2018_03_redl_smRNA_05_22_2dpf_PGCs_rep2_S5.R1.fastq.gz fastq 3308645424.0 39388636.0 imb ketting 2018 03 redl smRNA 05 22 2dpf PGCs rep2 S5.R1.fastq.gz 0:84 1:0 A:854995750;C:785730518;G:836451916;T:831436561;N:30679 84 0     854995750 785730518 836451916 831436561 30679 SRX7533010 SRS5972244 SRA1023320 Rene Ketting group|Ketting Lab Rene Ketting group 1 0.0004   2e-05   0.99939   0.73846   84   T   under 1.2% mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   Germany 2020-01-10 Hatching Embryo Whole Organism All anatomical structures
57067 57067 SRR11214402 SRX7826914 SRS6238049 SRP251256 PRJNA609696 Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] GSE146200 Transcriptome Analysis Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. parent bioproject:PRJNA609691 pubmed:28962522   JD18 [miRNA seq] GSM4368082   source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA JD18 [miRNA seq] The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. 30 pooled larvae 5dpf triptolide for 6 h 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. Zebrafish Danio rerio were maintained at 28.5 °C strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA GSM4368082 GSM4368082: JD18 [miRNA seq]; Danio rerio; ncRNA Seq GSM4368082   1 Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. GEO Accession:GSM4368082 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP251256     small_JD18.combined.fastq.gz fastq 702201000.0 14044020.0 GSM4368082 r1 0:50 1:0 A:165610842;C:167169519;G:192886323;T:176528538;N:5778 50 0     165610842 167169519 192886323 176528538 5778 SRX7826914 SRS6238049 SRA1049684 GEO Centre for Immunity, Infection and Evolution 1 0.06331   0.00756   0.99153   0.5451   50   B   usable mapping rate illumina nextseq unknown size_fractionation trueseq bulk bulk bulk   United States 2020-03-02 Larval Larval Whole Organism All anatomical structures
57068 57068 SRR11214401 SRX7826913 SRS6238048 SRP251256 PRJNA609696 Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] GSE146200 Transcriptome Analysis Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. parent bioproject:PRJNA609691 pubmed:28962522   JD17 [miRNA seq] GSM4368081   source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA JD17 [miRNA seq] The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. 30 pooled larvae 5dpf triptolide for 6 h 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. Zebrafish Danio rerio were maintained at 28.5 °C strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA GSM4368081 GSM4368081: JD17 [miRNA seq]; Danio rerio; ncRNA Seq GSM4368081   1 Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. GEO Accession:GSM4368081 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP251256     small_JD17.combined.fastq.gz fastq 429694400.0 8593888.0 GSM4368081 r1 0:50 1:0 A:105670449;C:101354858;G:115926173;T:106739304;N:3616 50 0     105670449 101354858 115926173 106739304 3616 SRX7826913 SRS6238048 SRA1049684 GEO Centre for Immunity, Infection and Evolution 1 0.04686   0.00437   0.99389   0.53154   50   B   usable mapping rate illumina nextseq unknown size_fractionation trueseq bulk bulk bulk   United States 2020-03-02 Larval Larval Whole Organism All anatomical structures
57069 57069 SRR11214400 SRX7826912 SRS6238047 SRP251256 PRJNA609696 Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] GSE146200 Transcriptome Analysis Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. parent bioproject:PRJNA609691 pubmed:28962522   JD16 [miRNA seq] GSM4368080   source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA JD16 [miRNA seq] The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. 30 pooled larvae 5dpf triptolide for 6 h 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. Zebrafish Danio rerio were maintained at 28.5 °C strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA GSM4368080 GSM4368080: JD16 [miRNA seq]; Danio rerio; ncRNA Seq GSM4368080   1 Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. GEO Accession:GSM4368080 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP251256     small_JD16.combined.fastq.gz fastq 381826650.0 7636533.0 GSM4368080 r1 0:50 1:0 A:92578473;C:90665066;G:103254018;T:95325823;N:3270 50 0     92578473 90665066 103254018 95325823 3270 SRX7826912 SRS6238047 SRA1049684 GEO Centre for Immunity, Infection and Evolution 1 0.07185   0.00402   0.99419   0.49823   50   B   usable mapping rate illumina nextseq unknown size_fractionation trueseq bulk bulk bulk   United States 2020-03-02 Larval Larval Whole Organism All anatomical structures
57070 57070 SRR11214399 SRX7826911 SRS6238046 SRP251256 PRJNA609696 Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] GSE146200 Transcriptome Analysis Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. parent bioproject:PRJNA609691 pubmed:28962522   JD15 [miRNA seq] GSM4368079   source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA JD15 [miRNA seq] The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. 30 pooled larvae 5dpf triptolide for 6 h 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. Zebrafish Danio rerio were maintained at 28.5 °C strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA GSM4368079 GSM4368079: JD15 [miRNA seq]; Danio rerio; ncRNA Seq GSM4368079   1 Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. GEO Accession:GSM4368079 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP251256     small_JD15.combined.fastq.gz fastq 285535900.0 5710718.0 GSM4368079 r1 0:50 1:0 A:68624024;C:67839672;G:77291276;T:71778522;N:2406 50 0     68624024 67839672 77291276 71778522 2406 SRX7826911 SRS6238046 SRA1049684 GEO Centre for Immunity, Infection and Evolution 1 0.07651   0.00425   0.99407   0.54635   50   B   usable mapping rate illumina nextseq unknown size_fractionation trueseq bulk bulk bulk   United States 2020-03-02 Larval Larval Whole Organism All anatomical structures
57071 57071 SRR11214398 SRX7826910 SRS6238045 SRP251256 PRJNA609696 Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] GSE146200 Transcriptome Analysis Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. parent bioproject:PRJNA609691 pubmed:28962522   JD14 [miRNA seq] GSM4368078   source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA JD14 [miRNA seq] The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. 30 pooled larvae 5dpf triptolide for 6 h 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. Zebrafish Danio rerio were maintained at 28.5 °C strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA GSM4368078 GSM4368078: JD14 [miRNA seq]; Danio rerio; ncRNA Seq GSM4368078   1 Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. GEO Accession:GSM4368078 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP251256     small_JD14.combined.fastq.gz fastq 363231350.0 7264627.0 GSM4368078 r1 0:50 1:0 A:87298047;C:86511359;G:98123632;T:91295160;N:3152 50 0     87298047 86511359 98123632 91295160 3152 SRX7826910 SRS6238045 SRA1049684 GEO Centre for Immunity, Infection and Evolution 1 0.07156   0.00417   0.99314   0.49982   50   B   usable mapping rate illumina nextseq unknown size_fractionation trueseq bulk bulk bulk   United States 2020-03-02 Larval Larval Whole Organism All anatomical structures
57072 57072 SRR11214397 SRX7826909 SRS6238044 SRP251256 PRJNA609696 Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] GSE146200 Transcriptome Analysis Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. parent bioproject:PRJNA609691 pubmed:28962522   JD13 [miRNA seq] GSM4368077   source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA JD13 [miRNA seq] The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. 30 pooled larvae 5dpf triptolide for 6 h 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. Zebrafish Danio rerio were maintained at 28.5 °C strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA GSM4368077 GSM4368077: JD13 [miRNA seq]; Danio rerio; ncRNA Seq GSM4368077   1 Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. GEO Accession:GSM4368077 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP251256     small_JD13.combined.fastq.gz fastq 280852650.0 5617053.0 GSM4368077 r1 0:50 1:0 A:66976453;C:66985314;G:76111707;T:70776819;N:2357 50 0     66976453 66985314 76111707 70776819 2357 SRX7826909 SRS6238044 SRA1049684 GEO Centre for Immunity, Infection and Evolution 1 0.0785   0.00403   0.99454   0.53818   50   B   usable mapping rate illumina nextseq unknown size_fractionation trueseq bulk bulk bulk   United States 2020-03-02 Larval Larval Whole Organism All anatomical structures
57073 57073 SRR11214396 SRX7826908 SRS6238043 SRP251256 PRJNA609696 Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] GSE146200 Transcriptome Analysis Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. parent bioproject:PRJNA609691 pubmed:28962522   JD12 [miRNA seq] GSM4368076   source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA JD12 [miRNA seq] The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. 30 pooled larvae 5dpf triptolide for 6 h 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. Zebrafish Danio rerio were maintained at 28.5 °C strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA GSM4368076 GSM4368076: JD12 [miRNA seq]; Danio rerio; ncRNA Seq GSM4368076   1 Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. GEO Accession:GSM4368076 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP251256     small_JD12.combined.fastq.gz fastq 267278950.0 5345579.0 GSM4368076 r1 0:50 1:0 A:63524573;C:63700392;G:72574389;T:67477407;N:2189 50 0     63524573 63700392 72574389 67477407 2189 SRX7826908 SRS6238043 SRA1049684 GEO Centre for Immunity, Infection and Evolution 1 0.0867   0.00429   0.99403   0.53048   50   B   usable mapping rate illumina nextseq unknown size_fractionation trueseq bulk bulk bulk   United States 2020-03-02 Larval Larval Whole Organism All anatomical structures
57074 57074 SRR11214395 SRX7826907 SRS6238042 SRP251256 PRJNA609696 Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] GSE146200 Transcriptome Analysis Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. parent bioproject:PRJNA609691 pubmed:28962522   JD11 [miRNA seq] GSM4368075   source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA JD11 [miRNA seq] The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. 30 pooled larvae 5dpf triptolide for 6 h 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. Zebrafish Danio rerio were maintained at 28.5 °C strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA GSM4368075 GSM4368075: JD11 [miRNA seq]; Danio rerio; ncRNA Seq GSM4368075   1 Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. GEO Accession:GSM4368075 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP251256     small_JD11.combined.fastq.gz fastq 323802250.0 6476045.0 GSM4368075 r1 0:50 1:0 A:78153815;C:77052322;G:87557986;T:81035226;N:2901 50 0     78153815 77052322 87557986 81035226 2901 SRX7826907 SRS6238042 SRA1049684 GEO Centre for Immunity, Infection and Evolution 1 0.06809   0.00424   0.99368   0.52229   50   B   usable mapping rate illumina nextseq unknown size_fractionation trueseq bulk bulk bulk   United States 2020-03-02 Larval Larval Whole Organism All anatomical structures
57075 57075 SRR11214394 SRX7826906 SRS6238041 SRP251256 PRJNA609696 Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] GSE146200 Transcriptome Analysis Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. parent bioproject:PRJNA609691 pubmed:28962522   JD08 [miRNA seq] GSM4368074   source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA JD08 [miRNA seq] The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. 30 pooled larvae 5dpf vehicle 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. Zebrafish Danio rerio were maintained at 28.5 °C strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA GSM4368074 GSM4368074: JD08 [miRNA seq]; Danio rerio; ncRNA Seq GSM4368074   1 Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. GEO Accession:GSM4368074 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP251256     small_JD08.combined.fastq.gz fastq 375132100.0 7502642.0 GSM4368074 r1 0:50 1:0 A:89764502;C:89300619;G:101501695;T:94562105;N:3179 50 0     89764502 89300619 101501695 94562105 3179 SRX7826906 SRS6238041 SRA1049684 GEO Centre for Immunity, Infection and Evolution 1 0.07787   0.0042   0.99338   0.52599   50   B   usable mapping rate illumina nextseq unknown size_fractionation trueseq bulk bulk bulk   United States 2020-03-02 Larval Larval Whole Organism All anatomical structures
57076 57076 SRR11214393 SRX7826905 SRS6238040 SRP251256 PRJNA609696 Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] GSE146200 Transcriptome Analysis Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. parent bioproject:PRJNA609691 pubmed:28962522   JD07 [miRNA seq] GSM4368073   source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA JD07 [miRNA seq] The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. 30 pooled larvae 5dpf vehicle 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. Zebrafish Danio rerio were maintained at 28.5 °C strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA GSM4368073 GSM4368073: JD07 [miRNA seq]; Danio rerio; ncRNA Seq GSM4368073   1 Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. GEO Accession:GSM4368073 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP251256     small_JD07.combined.fastq.gz fastq 317528050.0 6350561.0 GSM4368073 r1 0:50 1:0 A:75643339;C:75642242;G:86133220;T:80106532;N:2717 50 0     75643339 75642242 86133220 80106532 2717 SRX7826905 SRS6238040 SRA1049684 GEO Centre for Immunity, Infection and Evolution 1 0.07711   0.00424   0.9934   0.53196   50   B   usable mapping rate illumina nextseq unknown size_fractionation trueseq bulk bulk bulk   United States 2020-03-02 Larval Larval Whole Organism All anatomical structures
57077 57077 SRR11214392 SRX7826904 SRS6238039 SRP251256 PRJNA609696 Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] GSE146200 Transcriptome Analysis Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. parent bioproject:PRJNA609691 pubmed:28962522   JD06 [miRNA seq] GSM4368072   source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA JD06 [miRNA seq] The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. 30 pooled larvae 5dpf vehicle 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. Zebrafish Danio rerio were maintained at 28.5 °C strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA GSM4368072 GSM4368072: JD06 [miRNA seq]; Danio rerio; ncRNA Seq GSM4368072   1 Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. GEO Accession:GSM4368072 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP251256     small_JD06.combined.fastq.gz fastq 313235150.0 6264703.0 GSM4368072 r1 0:50 1:0 A:74970317;C:74745173;G:84767516;T:78749342;N:2802 50 0     74970317 74745173 84767516 78749342 2802 SRX7826904 SRS6238039 SRA1049684 GEO Centre for Immunity, Infection and Evolution 1 0.07206   0.00403   0.99312   0.52846   50   B   usable mapping rate illumina nextseq unknown size_fractionation trueseq bulk bulk bulk   United States 2020-03-02 Larval Larval Whole Organism All anatomical structures
57078 57078 SRR11214391 SRX7826903 SRS6238038 SRP251256 PRJNA609696 Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] GSE146200 Transcriptome Analysis Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. parent bioproject:PRJNA609691 pubmed:28962522   JD05 [miRNA seq] GSM4368071   source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA JD05 [miRNA seq] The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. 30 pooled larvae 5dpf vehicle 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. Zebrafish Danio rerio were maintained at 28.5 °C strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA GSM4368071 GSM4368071: JD05 [miRNA seq]; Danio rerio; ncRNA Seq GSM4368071   1 Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. GEO Accession:GSM4368071 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP251256     small_JD05.combined.fastq.gz fastq 282608400.0 5652168.0 GSM4368071 r1 0:50 1:0 A:67639670;C:67139768;G:76678815;T:71147790;N:2357 50 0     67639670 67139768 76678815 71147790 2357 SRX7826903 SRS6238038 SRA1049684 GEO Centre for Immunity, Infection and Evolution 1 0.07587   0.00384   0.99299   0.5434   50   B   usable mapping rate illumina nextseq unknown size_fractionation trueseq bulk bulk bulk   United States 2020-03-02 Larval Larval Whole Organism All anatomical structures
57079 57079 SRR11214390 SRX7826902 SRS6238037 SRP251256 PRJNA609696 Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] GSE146200 Transcriptome Analysis Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. parent bioproject:PRJNA609691 pubmed:28962522   JD04 [miRNA seq] GSM4368070   source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA JD04 [miRNA seq] The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. 30 pooled larvae 5dpf vehicle 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. Zebrafish Danio rerio were maintained at 28.5 °C strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA GSM4368070 GSM4368070: JD04 [miRNA seq]; Danio rerio; ncRNA Seq GSM4368070   1 Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. GEO Accession:GSM4368070 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP251256     small_JD04.combined.fastq.gz fastq 289767100.0 5795342.0 GSM4368070 r1 0:50 1:0 A:69580978;C:68900579;G:78340509;T:72942639;N:2395 50 0     69580978 68900579 78340509 72942639 2395 SRX7826902 SRS6238037 SRA1049684 GEO Centre for Immunity, Infection and Evolution 1 0.07492   0.00373   0.99295   0.52294   50   B   usable mapping rate illumina nextseq unknown size_fractionation trueseq bulk bulk bulk   United States 2020-03-02 Larval Larval Whole Organism All anatomical structures
57080 57080 SRR11214389 SRX7826901 SRS6238036 SRP251256 PRJNA609696 Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] GSE146200 Transcriptome Analysis Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. parent bioproject:PRJNA609691 pubmed:28962522   JD03 [miRNA seq] GSM4368069   source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA JD03 [miRNA seq] The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. 30 pooled larvae 5dpf vehicle 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. Zebrafish Danio rerio were maintained at 28.5 °C strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA GSM4368069 GSM4368069: JD03 [miRNA seq]; Danio rerio; ncRNA Seq GSM4368069   1 Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. GEO Accession:GSM4368069 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP251256     small_JD03.combined.fastq.gz fastq 230982600.0 4619652.0 GSM4368069 r1 0:50 1:0 A:55200177;C:55003182;G:62615802;T:58161510;N:1929 50 0     55200177 55003182 62615802 58161510 1929 SRX7826901 SRS6238036 SRA1049684 GEO Centre for Immunity, Infection and Evolution 1 0.07179   0.00361   0.99336   0.47352   50   B   usable mapping rate illumina nextseq unknown size_fractionation trueseq bulk bulk bulk   United States 2020-03-02 Larval Larval Whole Organism All anatomical structures
57081 57081 SRR11214388 SRX7826900 SRS6238035 SRP251256 PRJNA609696 Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] GSE146200 Transcriptome Analysis Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. parent bioproject:PRJNA609691 pubmed:28962522   JD02 [miRNA seq] GSM4368068   source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA JD02 [miRNA seq] The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. 30 pooled larvae 5dpf vehicle 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. Zebrafish Danio rerio were maintained at 28.5 °C strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA GSM4368068 GSM4368068: JD02 [miRNA seq]; Danio rerio; ncRNA Seq GSM4368068   1 Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. GEO Accession:GSM4368068 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP251256     small_JD02.combined.fastq.gz fastq 367984500.0 7359690.0 GSM4368068 r1 0:50 1:0 A:87859797;C:87548819;G:99752643;T:92820007;N:3234 50 0     87859797 87548819 99752643 92820007 3234 SRX7826900 SRS6238035 SRA1049684 GEO Centre for Immunity, Infection and Evolution 1 0.07619   0.00398   0.99403   0.53717   50   B   usable mapping rate illumina nextseq unknown size_fractionation trueseq bulk bulk bulk   United States 2020-03-02 Larval Larval Whole Organism All anatomical structures
57082 57082 SRR11214387 SRX7826899 SRS6238034 SRP251256 PRJNA609696 Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] GSE146200 Transcriptome Analysis Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. parent bioproject:PRJNA609691 pubmed:28962522   JD01 [miRNA seq] GSM4368067   source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA JD01 [miRNA seq] The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. 30 pooled larvae 5dpf vehicle 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. Zebrafish Danio rerio were maintained at 28.5 °C strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA GSM4368067 GSM4368067: JD01 [miRNA seq]; Danio rerio; ncRNA Seq GSM4368067   1 Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. GEO Accession:GSM4368067 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP251256     small_JD01.combined.fastq.gz fastq 374941900.0 7498838.0 GSM4368067 r1 0:50 1:0 A:90013932;C:89307034;G:101275933;T:94341753;N:3248 50 0     90013932 89307034 101275933 94341753 3248 SRX7826899 SRS6238034 SRA1049684 GEO Centre for Immunity, Infection and Evolution 1 0.07456   0.00386   0.99399   0.52664   50   B   usable mapping rate illumina nextseq unknown size_fractionation trueseq bulk bulk bulk   United States 2020-03-02 Larval Larval Whole Organism All anatomical structures

Advanced export

JSON shape: default, array, newline-delimited

CSV options: 

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;