metadata: run_metadata: 7 rows where experiment.library_source = "TRANSCRIPTOMIC", experiment.library_strategy = "ncRNA-Seq" and tissue

7 rows where experiment.library_source = "TRANSCRIPTOMIC", experiment.library_strategy = "ncRNA-Seq" and tissue_curation = "Oocyte"

descending

Link	rowid ▼	run.accession	experiment.accession	sample.accession	study.accession	bioproject	study.title	study.alias	study.type	study.abstract	study.attributes	study.PMIDs	sample.title	sample.alias	sample.attributes	GEOsample.title	GEOsample.dataprocessing	GEOsample.source	GEOsample.treatmentprotocol	GEOsample.extractprotocol	GEOsample.growthprotocol	GEOsample.characteristics	GEOsample.accession	experiment.title	experiment.alias	experiment.library_name	experiment.design_description	experiment.library_construction_protocol	experiment.attributes	experiment.library_strategy	experiment.library_source	experiment.library_selection	experiment.library_layout	experiment.platform	experiment.instrument_model	experiment.study_ref	run.filename	run.semantic_name	run.total_bases	run.total_spots	run.alias	run.read_lengths	run.base_counts	run.r1_length	run.r2_length	run.Acount	run.Ccount	run.Gcount	run.Tcount	run.Ncount	run.experiment	run.pool_member	submission.accession	submission.srasource	submission.bioprojectsource	seqdetective.n_mates	seqdetective.mapping_rate.mate1	seqdetective.nofeature_rate.mate1	seqdetective.sparsity.mate1	seqdetective.pos_strand_rate.mate1	seqdetective.readlen.mate1	seqdetective.judgement.mate1	seqdetective.judgement.reason	platform_family	instrument_generation	read_bias	selection_class	prep_kit	sc_or_bulk	tech_class	technology	submission.bioprojectsource.country	earliest_date	devstage_curation	devstage_curation_coarse	tissue_curation	tissue_curation_coarse
25293	25293	SRR25764131	SRX21486791	SRS18719090	SRP457111	PRJNA1009808	Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq]	GSE241754	Transcriptome Analysis	Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.	parent bioproject:PRJNA1009800	pubmed:39402326	WT egg 0 hpf tRNA seq rep2	GSM7734772	source name:Unfertilized egg\|strain:TLAB strain\|tissue:Unfertilized egg\|developmental stage:unfertilized egg 0 hpf\|genotype:WT\|geo loc name:missing\|collection date:missing	WT egg 0 hpf tRNA seq rep2	Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts	Unfertilized egg	unperturbed growth conditions in E3 medium for zebrafish embryos.	50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq	Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle.	strain:TLAB strain\|tissue:Unfertilized egg\|developmental stage:unfertilized egg 0 hpf\|genotype:WT	GSM7734772	GSM7734772: WT egg 0 hpf tRNA seq rep2; Danio rerio; ncRNA Seq	GSM7734772 r1	GSM7734772	1	50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq		ncRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	NextSeq 500	SRP457111	WT_tRNA_egg_2.fastq.gz	fastq	206374994.0	3181706.0	GSM7734772 r1	0:64.86	A:41195250;C:56578032;G:56479855;T:52121365;N:492	64		41195250	56578032	56479855	52121365	492	SRX21486791	SRS18719090	SRA1700461	Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry	Max Planck Institute of Biochemistry	1	0.28659	0.02017	0.9207	0.48536	78	B	usable mapping rate	illumina	nextseq	5prime	size_fractionation	unknown	bulk	unknown	unknown	Germany	2023-08-28	Zygote	Embryo	Oocyte	Reproductive System
25294	25294	SRR25764132	SRX21486790	SRS18719089	SRP457111	PRJNA1009808	Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq]	GSE241754	Transcriptome Analysis	Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.	parent bioproject:PRJNA1009800	pubmed:39402326	WT egg 0 hpf tRNA seq rep1	GSM7734771	source name:Unfertilized egg\|strain:TLAB strain\|tissue:Unfertilized egg\|developmental stage:unfertilized egg 0 hpf\|genotype:WT\|geo loc name:missing\|collection date:missing	WT egg 0 hpf tRNA seq rep1	Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts	Unfertilized egg	unperturbed growth conditions in E3 medium for zebrafish embryos.	50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq	Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle.	strain:TLAB strain\|tissue:Unfertilized egg\|developmental stage:unfertilized egg 0 hpf\|genotype:WT	GSM7734771	GSM7734771: WT egg 0 hpf tRNA seq rep1; Danio rerio; ncRNA Seq	GSM7734771 r1	GSM7734771	1	50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq		ncRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	NextSeq 500	SRP457111	WT_tRNA_egg_1.fastq.gz	fastq	86021968.0	1304769.0	GSM7734771 r1	0:65.93	A:17511521;C:23474625;G:23300759;T:21734864;N:199	65		17511521	23474625	23300759	21734864	199	SRX21486790	SRS18719089	SRA1700461	Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry	Max Planck Institute of Biochemistry	1	0.29829	0.02027	0.92245	0.48877	74	B	usable mapping rate	illumina	nextseq	5prime	size_fractionation	unknown	bulk	unknown	unknown	Germany	2023-08-28	Zygote	Embryo	Oocyte	Reproductive System
44969	44969	SRR6345658	SRX3442974	SRS2733632	SRP126106	PRJNA421016	Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA]	GSE107682	Transcriptome Analysis	Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish.	parent bioproject:PRJNA315403	pubmed:30086300	smRNA seq library of late oocytes from tdrd6a hett fish	GSM2875717	source name:late oocytes from tdrd6a hett fish\|tissue:late oocytes\|genotype:tdrd6a heterozygous	smRNA seq library of late oocytes from tdrd6a hett fish	1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15 6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities. 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to. Supplementary files format and content: Files ending in .bw are bigwig tracks.	late oocytes from tdrd6a hett fish		RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation		tissue:late oocytes\|genotype:tdrd6a heterozygous	GSM2875717	GSM2875717: smRNA seq library of late oocytes from tdrd6a hett fish; Danio rerio; ncRNA Seq	GSM2875717		1	RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation	GEO Accession:GSM2875717	ncRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP126106	tdrd6a-het_oocytes-late-input.fastq.gz	fastq	1884769630.0	28130890.0	GSM2875717 r1	0:67	A:519051884;C:437635381;G:510738306;T:417295309;N:48750	67		519051884	437635381	510738306	417295309	48750	SRX3442974	SRS2733632	SRA636010	GEO	Rene Ketting, RNA silencing, IMB	1	0.17778	0.06655	0.95931	0.91529	67	B	usable mapping rate	illumina	hiseq_era	5prime	size_fractionation	unknown	sc_generic	single_cell_generic	generic-scrnaseq-only	Germany	2017-12-04	Zygote	Embryo	Oocyte	Reproductive System
44970	44970	SRR6345657	SRX3442973	SRS2733634	SRP126106	PRJNA421016	Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA]	GSE107682	Transcriptome Analysis	Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish.	parent bioproject:PRJNA315403	pubmed:30086300	smRNA seq library of early oocytes from tdrd6a mut fish	GSM2875716	source name:early oocytes from tdrd6a mut fish\|tissue:early oocytes\|genotype:tdrd6a mutant	smRNA seq library of early oocytes from tdrd6a mut fish	1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15 6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities. 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to. Supplementary files format and content: Files ending in .bw are bigwig tracks.	early oocytes from tdrd6a mut fish		RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation		tissue:early oocytes\|genotype:tdrd6a mutant	GSM2875716	GSM2875716: smRNA seq library of early oocytes from tdrd6a mut fish; Danio rerio; ncRNA Seq	GSM2875716		1	RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation	GEO Accession:GSM2875716	ncRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP126106	tdrd6a-mut_oocytes-early-input.fastq.gz	fastq	2102216723.0	31376369.0	GSM2875716 r1	0:67	A:592618102;C:472348913;G:550028898;T:487165955;N:54855	67		592618102	472348913	550028898	487165955	54855	SRX3442973	SRS2733634	SRA636010	GEO	Rene Ketting, RNA silencing, IMB	1	0.08293	0.04595	0.96193	0.77321	67	B	usable mapping rate	illumina	hiseq_era	5prime	size_fractionation	unknown	sc_generic	single_cell_generic	generic-scrnaseq-only	Germany	2017-12-04	Zygote	Embryo	Oocyte	Reproductive System
44971	44971	SRR6345656	SRX3442972	SRS2733635	SRP126106	PRJNA421016	Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA]	GSE107682	Transcriptome Analysis	Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish.	parent bioproject:PRJNA315403	pubmed:30086300	smRNA seq library of late oocytes from tdrd6a mut fish	GSM2875715	source name:late oocytes from tdrd6a mut fish\|tissue:late oocytes\|genotype:tdrd6a mutant	smRNA seq library of late oocytes from tdrd6a mut fish	1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15 6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities. 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to. Supplementary files format and content: Files ending in .bw are bigwig tracks.	late oocytes from tdrd6a mut fish		RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation		tissue:late oocytes\|genotype:tdrd6a mutant	GSM2875715	GSM2875715: smRNA seq library of late oocytes from tdrd6a mut fish; Danio rerio; ncRNA Seq	GSM2875715		1	RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation	GEO Accession:GSM2875715	ncRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP126106	tdrd6a-mut_oocytes-late-input.fastq.gz	fastq	2110760295.0	31503885.0	GSM2875715 r1	0:67	A:582021495;C:486821539;G:582933348;T:458929133;N:54780	67		582021495	486821539	582933348	458929133	54780	SRX3442972	SRS2733635	SRA636010	GEO	Rene Ketting, RNA silencing, IMB	1	0.17064	0.06728	0.96173	0.9114	67	B	usable mapping rate	illumina	hiseq_era	5prime	size_fractionation	unknown	sc_generic	single_cell_generic	generic-scrnaseq-only	Germany	2017-12-04	Zygote	Embryo	Oocyte	Reproductive System
44972	44972	SRR6345655	SRX3442971	SRS2733633	SRP126106	PRJNA421016	Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA]	GSE107682	Transcriptome Analysis	Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish.	parent bioproject:PRJNA315403	pubmed:30086300	smRNA seq library of early oocytes from tdrd6a het fish	GSM2875714	source name:early oocytes from tdrd6a het fish\|tissue:Early oocytes\|genotype:tdrd6a heterozygous	smRNA seq library of early oocytes from tdrd6a het fish	1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15 6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities. 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to. Supplementary files format and content: Files ending in .bw are bigwig tracks.	early oocytes from tdrd6a het fish		RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation		tissue:Early oocytes\|genotype:tdrd6a heterozygous	GSM2875714	GSM2875714: smRNA seq library of early oocytes from tdrd6a het fish; Danio rerio; ncRNA Seq	GSM2875714		1	RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation	GEO Accession:GSM2875714	ncRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP126106	tdrd6a-het_oocytes-early-input.fastq.gz	fastq	2243425655.0	33483965.0	GSM2875714 r1	0:67	A:633468129;C:503239215;G:592089295;T:514571679;N:57337	67		633468129	503239215	592089295	514571679	57337	SRX3442971	SRS2733633	SRA636010	GEO	Rene Ketting, RNA silencing, IMB	1	0.06641	0.04254	0.96806	0.58509	67	B	usable mapping rate	illumina	hiseq_era	5prime	size_fractionation	unknown	sc_generic	single_cell_generic	generic-scrnaseq-only	Germany	2017-12-04	Zygote	Embryo	Oocyte	Reproductive System
58547	58547	SRR13652350	SRX10049113	SRS8212340	SRP253438	PRJNA613601	five prime half of specific tRNAs feeds back to promote corresponding tRNA gene transcription in vertebrate embryos [small RNA Seq ssDRIP seq]	GSE147253	Other	five primetRFls are small tRNA fragments derived from five prime half of mature tRNAs. However it is unknown whether five primetRFls could feed back to regulate tRNA biogenesis. Here we show that five primetRFlGly/GCC and five primetRFlGlu/CTC function to promote transcription of corresponding tRNA genes and are essential for vertebrate early embryogenesis. During zebrafish embryogenesis dynamics of five primetRFlGly/GCC and five primetRFlGlu/CTC levels correlates with that of tRNAGly/GCC and tRNAGlu/CTC levels. Morpholino mediated knockdown of five primetRFlGly/GCC or five primetRFlGlu/CTC down regulates tRNAGly/GCC or tRNAGlu/CTC levels respectively and causes embryonic lethality that is efficiently rescued by co injection of properly refolded corresponding tRNA. In zebrafish embryos tRNA:DNA and five primetRFl:DNA hybrids commonly exist on the template strand of tRNA genes. Mechanistically unstable five primetRFl:DNA hybrid may prevent the formation of transcriptionally inhibitory stable tRNA:DNA hybrids on the same tRNA loci so as to facilitate tRNA genes transcription. The uncovered mechanism may be implicated in other physiological and pathological processes. Overall design: For small RNA sequencing total RNA were extracted respectively from wildtype zebrafish embryos Tübingen Strain of 6 chosen stages and then subjected to small RNA library preparation individually. To investigate the distribution and stability of R loop on genome we performed ssDRIP seq with S9.6 antibody which specifically recognize RNA:DNA hybrid. Two replicates from wildtype embryos of 256c sphere and shield stage were collected to perform ssDRIPseq. RNaseH pre treated genome DNA was used as negative control which was also performed the standard ssDRIP seq procedure. Genomic DNA extracted from these samples were fragmentated by restriction enzymes and then immunoprecipitated by S9.6 antibody.The ssDNA strands in RNA:DNA hybrids were purified and subjected to library preparation.	parent bioproject:PRJNA753013	pubmed:34797706	Egg ncRNA seq	GSM5069280	tissue:mature oocyte\|strain:Tubingen\|developmental stage:Mature Oocyte\|treatement:no	Egg ncRNA seq	For data processing reads were quality checked by FastQCVersion 0.11.8 and adaptors were cut off by Cutadapt Version 1.16 and only reads that lay between 18 40 nt were kept. The reads of each sample were first aligned to different database by using Bowtie2 Version 2.3.4.1 count table was generated by featureCounts. Genome build: GRCz11 genome and cDNA tRNA database GtRNAdb GRCz11	mature oocyte		For small RNA sequencing: About 50 100 zebrafish eggs or embryos at a desired stage were dechorionated by Pronase digestion and collected to extract total RNA. Embryos were then transferred to 1.5 ml eppendorf tube and lysed in 1 ml Trizol Reagent Thermo Fisher Scientific 15596018. The lysate was centrifuged at 12 000 rpm for 10 min and the supernatant was collected and mixed with 200 μl chloroform in a fresh tube. post centrifugation at 12 000 rpm for 10 min at 4℃ the supernatant was transferred to a fresh tube with addition of equal volume of isopropanol and incubated at room temperature for 15 min followed by thorough mix and centrifugation at 12 000 rpm for 10 20 min. The RNA pellet was washed by 75% ethanol once and was stored as pellet in 75% ethanol at 80℃ until all samples were collected. Two pretreatment steps were included: First purified total RNAs were treated with T4 Polynucleotide Kinase NEB M0201S with ATP for 30 min at 37℃ then purified by phenol: chloroform extraction. The aim of this step is removing the 2 3’ cyclic phosphate group from the 3’end of 5’tRFls and add phosphate group to the 5’end of 3’tRFs. In the second step total RNAs were treated with ALKB protein mix as mentioned above. Purified total RNAs were then subjected to small RNA library preparation. For small RNA sequencing: Small RNA libraries using 1 μg RNA each were prepared using the NEBNext Multiplex Small RNA Library Prep Set for Illumina NEB according to the manual. The amplified DNA from each sample was first concentrated by DNA concentrator spin column Zymo Research then bands of 135 160 bp about the length of 15 40 nt RNA ligated with both adaptors were manually selected on native PAGE gel. DNAs were eluted from the gel piece with 0.3 M NaOAc pH 4.5 followed by precipitation by adding 2.5 volumes of ethanol.		strain:Tubingen\|developmental stage:Mature Oocyte\|treatement:no	GSM5069280	GSM5069280: Egg ncRNA seq; Danio rerio; ncRNA Seq	GSM5069280		1	For small RNA sequencing: About 50 100 zebrafish eggs or embryos at a desired stage were dechorionated by Pronase digestion and collected to extract total RNA. Embryos were then transferred to 1.5 ml eppendorf tube and lysed in 1 ml Trizol Reagent Thermo Fisher Scientific 15596018. The lysate was centrifuged at 12 000 rpm for 10 min and the supernatant was collected and mixed with 200 μl chloroform in a fresh tube. post centrifugation at 12 000 rpm for 10 min at 4℃ the supernatant was transferred to a fresh tube with addition of equal volume of isopropanol and incubated at room temperature for 15 min followed by thorough mix and centrifugation at 12 000 rpm for 10 20 min. The RNA pellet was washed by 75% ethanol once and was stored as pellet in 75% ethanol at 80℃ until all samples were collected. Two pretreatment steps were included: First purified total RNAs were treated with T4 Polynucleotide Kinase NEB M0201S with ATP for 30 min at 37℃ then purified by phenol: chloroform extraction. The aim of this step is removing the 2 three prime cyclic phosphate group from the three primeend of five primetRFls and add phosphate group to the five primeend of three primetRFs. In the second step total RNAs were treated with ALKB protein mix as mentioned above. Purified total RNAs were then subjected to small RNA library preparation. For small RNA sequencing: Small RNA libraries using 1 μg RNA each were prepared using the NEBNext Multiplex Small RNA Library Prep Set for Illumina NEB according to the manual. The amplified DNA from each sample was first concentrated by DNA concentrator spin column Zymo Research then bands of 135 160 bp about the length of 15 40 nt RNA ligated with both adaptors were manually selected on native PAGE gel. DNAs were eluted from the gel piece with 0.3 M NaOAc pH 4.5 followed by precipitation by adding 2.5 volumes of ethanol.	GEO Accession:GSM5069280	ncRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP253438	Egg-RNA_seq.fq.gz	fastq	4328292000.0	28855280.0	GSM5069280 r1	0:150 1:0	A:757944111;C:789419055;G:2112325298;T:668359520;N:244016	150	0	757944111	789419055	2112325298	668359520	244016	SRX10049113	SRS8212340	SRA1056877	GEO	Anming Meng Lab, School of Life Science, Tsinghua University	1	0.74704	0.18839	0.83197	0.55802	150	B	usable mapping rate	illumina	novaseq_era	5prime	size_fractionation	nebnext	bulk	unknown	unknown	China	2021-02-08	Zygote	Embryo	Oocyte	Reproductive System

Advanced export

JSON shape: default, array, newline-delimited

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;