metadata: run_metadata: 21 rows where experiment.library_source = "TRANSCRIPTOMIC", experiment.library_strategy = "ncRNA-Seq" and tissue

21 rows where experiment.library_source = "TRANSCRIPTOMIC", experiment.library_strategy = "ncRNA-Seq" and tissue_curation = "Gonad"

descending

Link	rowid ▼	run.accession	experiment.accession	sample.accession	study.accession	bioproject	study.title	study.alias	study.type	study.abstract	study.attributes	study.PMIDs	sample.title	sample.alias	sample.attributes	GEOsample.title	GEOsample.dataprocessing	GEOsample.source	GEOsample.treatmentprotocol	GEOsample.extractprotocol	GEOsample.growthprotocol	GEOsample.characteristics	GEOsample.accession	experiment.title	experiment.alias	experiment.library_name	experiment.design_description	experiment.library_construction_protocol	experiment.attributes	experiment.library_strategy	experiment.library_source	experiment.library_selection	experiment.library_layout	experiment.platform	experiment.instrument_model	experiment.study_ref	run.filename	run.semantic_name	run.total_bases	run.total_spots	run.alias	run.read_lengths	run.base_counts	run.r1_length	run.r2_length	run.Acount	run.Ccount	run.Gcount	run.Tcount	run.Ncount	run.experiment	run.pool_member	submission.accession	submission.srasource	submission.bioprojectsource	seqdetective.n_mates	seqdetective.mapping_rate.mate1	seqdetective.mapping_rate.mate2	seqdetective.nofeature_rate.mate1	seqdetective.nofeature_rate.mate2	seqdetective.sparsity.mate1	seqdetective.sparsity.mate2	seqdetective.pos_strand_rate.mate1	seqdetective.pos_strand_rate.mate2	seqdetective.readlen.mate1	seqdetective.readlen.mate2	seqdetective.judgement.mate1	seqdetective.judgement.mate2	seqdetective.judgement.reason	platform_family	instrument_generation	read_bias	selection_class	prep_kit	sc_or_bulk	tech_class	technology	submission.bioprojectsource.country	earliest_date	devstage_curation	devstage_curation_coarse	tissue_curation	tissue_curation_coarse
41150	41150	SRR3744678	SRX1898686	SRS1541536	SRP077941	PRJNA327880	Analysis of piRNA production in meioc moto mutant zebrafish testis	GSE84060	Transcriptome Analysis	We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.		pubmed:39605693	moto homozygous 5	GSM2226636	tissue:testis\|strain:Tuebingen/WIK\|age:10 month\|genotype:homozygous mutant moto /	moto homozygous 5	Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type.	testis		Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.		strain:Tuebingen/WIK\|age:10 month\|genotype:homozygous mutant moto /	GSM2226636	GSM2226636: moto homozygous 5; Danio rerio; ncRNA Seq	GSM2226636		1	Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.	GEO Accession:GSM2226636	ncRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP077941			2118467988.0	41538588.0	GSM2226636 r1	0:51	A:616161510;C:469529175;G:576120961;T:456560109;N:96233	51		616161510	469529175	576120961	456560109	96233	SRX1898686	SRS1541536	SRA438045	GEO	Bioinformatics Core Facility, Institute of Molecular Biology	1	0.52011		0.38818		0.90193		0.51677		51		B		usable mapping rate	illumina	hiseq_era	unknown	size_fractionation	nebnext	bulk	unknown	unknown	Germany	2016-07-05	Adult	Adult	Gonad	Reproductive System
41151	41151	SRR3744677	SRX1898685	SRS1541535	SRP077941	PRJNA327880	Analysis of piRNA production in meioc moto mutant zebrafish testis	GSE84060	Transcriptome Analysis	We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.		pubmed:39605693	moto homozygous 4	GSM2226635	tissue:testis\|strain:Tuebingen/WIK\|age:10 month\|genotype:homozygous mutant moto /	moto homozygous 4	Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type.	testis		Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.		strain:Tuebingen/WIK\|age:10 month\|genotype:homozygous mutant moto /	GSM2226635	GSM2226635: moto homozygous 4; Danio rerio; ncRNA Seq	GSM2226635		1	Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.	GEO Accession:GSM2226635	ncRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP077941			1771929771.0	34743721.0	GSM2226635 r1	0:51	A:524609276;C:393148247;G:436902442;T:417188575;N:81231	51		524609276	393148247	436902442	417188575	81231	SRX1898685	SRS1541535	SRA438045	GEO	Bioinformatics Core Facility, Institute of Molecular Biology	1	0.62874		0.45148		0.89008		0.52837		51		B		usable mapping rate	illumina	hiseq_era	unknown	size_fractionation	nebnext	bulk	unknown	unknown	Germany	2016-07-05	Adult	Adult	Gonad	Reproductive System
41152	41152	SRR3744676	SRX1898684	SRS1541534	SRP077941	PRJNA327880	Analysis of piRNA production in meioc moto mutant zebrafish testis	GSE84060	Transcriptome Analysis	We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.		pubmed:39605693	moto homozygous 3	GSM2226634	tissue:testis\|strain:Tuebingen/WIK\|age:10 month\|genotype:homozygous mutant moto /	moto homozygous 3	Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type.	testis		Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.		strain:Tuebingen/WIK\|age:10 month\|genotype:homozygous mutant moto /	GSM2226634	GSM2226634: moto homozygous 3; Danio rerio; ncRNA Seq	GSM2226634		1	Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.	GEO Accession:GSM2226634	ncRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP077941			1849849917.0	36271567.0	GSM2226634 r1	0:51	A:554317433;C:408404232;G:459010543;T:428033928;N:83781	51		554317433	408404232	459010543	428033928	83781	SRX1898684	SRS1541534	SRA438045	GEO	Bioinformatics Core Facility, Institute of Molecular Biology	1	0.69752		0.51829		0.89027		0.53775		51		B		usable mapping rate	illumina	hiseq_era	unknown	size_fractionation	nebnext	bulk	unknown	unknown	Germany	2016-07-05	Adult	Adult	Gonad	Reproductive System
41153	41153	SRR3744675	SRX1898683	SRS1541533	SRP077941	PRJNA327880	Analysis of piRNA production in meioc moto mutant zebrafish testis	GSE84060	Transcriptome Analysis	We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.		pubmed:39605693	moto homozygous 2	GSM2226633	tissue:testis\|strain:Tuebingen/WIK\|age:10 month\|genotype:homozygous mutant moto /	moto homozygous 2	Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type.	testis		Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.		strain:Tuebingen/WIK\|age:10 month\|genotype:homozygous mutant moto /	GSM2226633	GSM2226633: moto homozygous 2; Danio rerio; ncRNA Seq	GSM2226633		1	Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.	GEO Accession:GSM2226633	ncRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP077941			1863615327.0	36541477.0	GSM2226633 r1	0:51	A:554370010;C:414418365;G:465346091;T:429394630;N:86231	51		554370010	414418365	465346091	429394630	86231	SRX1898683	SRS1541533	SRA438045	GEO	Bioinformatics Core Facility, Institute of Molecular Biology	1	0.74326		0.52319		0.87361		0.53081		51		B		usable mapping rate	illumina	hiseq_era	unknown	size_fractionation	nebnext	bulk	unknown	unknown	Germany	2016-07-05	Adult	Adult	Gonad	Reproductive System
41154	41154	SRR3744674	SRX1898682	SRS1541532	SRP077941	PRJNA327880	Analysis of piRNA production in meioc moto mutant zebrafish testis	GSE84060	Transcriptome Analysis	We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.		pubmed:39605693	moto homozygous 1	GSM2226632	tissue:testis\|strain:Tuebingen/WIK\|age:10 month\|genotype:homozygous mutant moto /	moto homozygous 1	Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type.	testis		Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.		strain:Tuebingen/WIK\|age:10 month\|genotype:homozygous mutant moto /	GSM2226632	GSM2226632: moto homozygous 1; Danio rerio; ncRNA Seq	GSM2226632		1	Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.	GEO Accession:GSM2226632	ncRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP077941			1453145193.0	28493043.0	GSM2226632 r1	0:51	A:435644830;C:320413861;G:361678589;T:335340817;N:67096	51		435644830	320413861	361678589	335340817	67096	SRX1898682	SRS1541532	SRA438045	GEO	Bioinformatics Core Facility, Institute of Molecular Biology	1	0.66367		0.47841		0.88262		0.50114		51		B		usable mapping rate	illumina	hiseq_era	unknown	size_fractionation	nebnext	bulk	unknown	unknown	Germany	2016-07-05	Adult	Adult	Gonad	Reproductive System
41155	41155	SRR3744673	SRX1898681	SRS1541531	SRP077941	PRJNA327880	Analysis of piRNA production in meioc moto mutant zebrafish testis	GSE84060	Transcriptome Analysis	We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.		pubmed:39605693	moto heterozygous 6	GSM2226631	tissue:testis\|strain:Tuebingen/WIK\|age:10 month\|genotype:heterozygous mutant moto+/	moto heterozygous 6	Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type.	testis		Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.		strain:Tuebingen/WIK\|age:10 month\|genotype:heterozygous mutant moto+/	GSM2226631	GSM2226631: moto heterozygous 6; Danio rerio; ncRNA Seq	GSM2226631		1	Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.	GEO Accession:GSM2226631	ncRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP077941			2009800248.0	39407848.0	GSM2226631 r1	0:51	A:586066305;C:443066820;G:503291347;T:477284226;N:91550	51		586066305	443066820	503291347	477284226	91550	SRX1898681	SRS1541531	SRA438045	GEO	Bioinformatics Core Facility, Institute of Molecular Biology	1	0.69598		0.49191		0.8828		0.51759		51		B		usable mapping rate	illumina	hiseq_era	unknown	size_fractionation	nebnext	bulk	unknown	unknown	Germany	2016-07-05	Adult	Adult	Gonad	Reproductive System
41156	41156	SRR3744672	SRX1898680	SRS1541530	SRP077941	PRJNA327880	Analysis of piRNA production in meioc moto mutant zebrafish testis	GSE84060	Transcriptome Analysis	We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.		pubmed:39605693	moto heterozygous 5	GSM2226630	tissue:testis\|strain:Tuebingen/WIK\|age:10 month\|genotype:heterozygous mutant moto+/	moto heterozygous 5	Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type.	testis		Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.		strain:Tuebingen/WIK\|age:10 month\|genotype:heterozygous mutant moto+/	GSM2226630	GSM2226630: moto heterozygous 5; Danio rerio; ncRNA Seq	GSM2226630		1	Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.	GEO Accession:GSM2226630	ncRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP077941			1833618504.0	35953304.0	GSM2226630 r1	0:51	A:510624241;C:446979639;G:473431335;T:402499572;N:83717	51		510624241	446979639	473431335	402499572	83717	SRX1898680	SRS1541530	SRA438045	GEO	Bioinformatics Core Facility, Institute of Molecular Biology	1	0.73675		0.50008		0.87957		0.53243		51		B		usable mapping rate	illumina	hiseq_era	unknown	size_fractionation	nebnext	bulk	unknown	unknown	Germany	2016-07-05	Adult	Adult	Gonad	Reproductive System
41157	41157	SRR3744671	SRX1898679	SRS1541529	SRP077941	PRJNA327880	Analysis of piRNA production in meioc moto mutant zebrafish testis	GSE84060	Transcriptome Analysis	We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.		pubmed:39605693	moto heterozygous 4	GSM2226629	tissue:testis\|strain:Tuebingen/WIK\|age:10 month\|genotype:heterozygous mutant moto+/	moto heterozygous 4	Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type.	testis		Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.		strain:Tuebingen/WIK\|age:10 month\|genotype:heterozygous mutant moto+/	GSM2226629	GSM2226629: moto heterozygous 4; Danio rerio; ncRNA Seq	GSM2226629		1	Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.	GEO Accession:GSM2226629	ncRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP077941			2011846776.0	39447976.0	GSM2226629 r1	0:51	A:566935163;C:480777294;G:518987229;T:445055757;N:91333	51		566935163	480777294	518987229	445055757	91333	SRX1898679	SRS1541529	SRA438045	GEO	Bioinformatics Core Facility, Institute of Molecular Biology	1	0.7246		0.49021		0.88051		0.5202		51		B		usable mapping rate	illumina	hiseq_era	unknown	size_fractionation	nebnext	bulk	unknown	unknown	Germany	2016-07-05	Adult	Adult	Gonad	Reproductive System
41158	41158	SRR3744670	SRX1898678	SRS1541528	SRP077941	PRJNA327880	Analysis of piRNA production in meioc moto mutant zebrafish testis	GSE84060	Transcriptome Analysis	We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.		pubmed:39605693	moto heterozygous 3	GSM2226628	tissue:testis\|strain:Tuebingen/WIK\|age:10 month\|genotype:heterozygous mutant moto+/	moto heterozygous 3	Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type.	testis		Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.		strain:Tuebingen/WIK\|age:10 month\|genotype:heterozygous mutant moto+/	GSM2226628	GSM2226628: moto heterozygous 3; Danio rerio; ncRNA Seq	GSM2226628		1	Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.	GEO Accession:GSM2226628	ncRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP077941			1618368312.0	31732712.0	GSM2226628 r1	0:51	A:476792369;C:353703619;G:406141931;T:381656601;N:73792	51		476792369	353703619	406141931	381656601	73792	SRX1898678	SRS1541528	SRA438045	GEO	Bioinformatics Core Facility, Institute of Molecular Biology	1	0.67806		0.48273		0.88363		0.53518		51		B		usable mapping rate	illumina	hiseq_era	unknown	size_fractionation	nebnext	bulk	unknown	unknown	Germany	2016-07-05	Adult	Adult	Gonad	Reproductive System
41159	41159	SRR3744669	SRX1898677	SRS1541527	SRP077941	PRJNA327880	Analysis of piRNA production in meioc moto mutant zebrafish testis	GSE84060	Transcriptome Analysis	We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.		pubmed:39605693	moto heterozygous 2	GSM2226627	tissue:testis\|strain:Tuebingen/WIK\|age:10 month\|genotype:heterozygous mutant moto+/	moto heterozygous 2	Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type.	testis		Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.		strain:Tuebingen/WIK\|age:10 month\|genotype:heterozygous mutant moto+/	GSM2226627	GSM2226627: moto heterozygous 2; Danio rerio; ncRNA Seq	GSM2226627		1	Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.	GEO Accession:GSM2226627	ncRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP077941			1825076565.0	35785815.0	GSM2226627 r1	0:51	A:543891854;C:404479103;G:451780092;T:424842227;N:83289	51		543891854	404479103	451780092	424842227	83289	SRX1898677	SRS1541527	SRA438045	GEO	Bioinformatics Core Facility, Institute of Molecular Biology	1	0.53478		0.39486		0.89899		0.52282		51		B		usable mapping rate	illumina	hiseq_era	unknown	size_fractionation	nebnext	bulk	unknown	unknown	Germany	2016-07-05	Adult	Adult	Gonad	Reproductive System
41160	41160	SRR3744668	SRX1898676	SRS1541526	SRP077941	PRJNA327880	Analysis of piRNA production in meioc moto mutant zebrafish testis	GSE84060	Transcriptome Analysis	We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.		pubmed:39605693	moto heterozygous 1	GSM2226626	tissue:testis\|strain:Tuebingen/WIK\|age:10 month\|genotype:heterozygous mutant moto+/	moto heterozygous 1	Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type.	testis		Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.		strain:Tuebingen/WIK\|age:10 month\|genotype:heterozygous mutant moto+/	GSM2226626	GSM2226626: moto heterozygous 1; Danio rerio; ncRNA Seq	GSM2226626		1	Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.	GEO Accession:GSM2226626	ncRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP077941			1358381226.0	26634926.0	GSM2226626 r1	0:51	A:402110510;C:300618987;G:340178435;T:315410530;N:62764	51		402110510	300618987	340178435	315410530	62764	SRX1898676	SRS1541526	SRA438045	GEO	Bioinformatics Core Facility, Institute of Molecular Biology	1	0.68106		0.46812		0.87596		0.53427		51		B		usable mapping rate	illumina	hiseq_era	unknown	size_fractionation	nebnext	bulk	unknown	unknown	Germany	2016-07-05	Adult	Adult	Gonad	Reproductive System
41693	41693	SRR5122167	SRX2437316	SRS1872014	SRP095411	PRJNA358209	Identification of a specific 13 miRNA expression signature during follicle activation in Zebrafish	GSE92639	Transcriptome Analysis	Purpose: We aimed to investigate important miRNA events and to define specific miRNA expression signature underlying the follicle activation of zebrafish. Methods: By using small and regular RNA sequencing we performed transcriptomic analyses of PG primary growth stage I; inactive and PV pre vitellogenic stage II; activated follicles to decipher important miRNA and gene events underlying follicle activation of zebrafish. We identified differentially expressed miRNAs for subsequent qPCR validation and miRNA::target gene prediction. Interaction of candidate miRNA:: target gene pairs were further validated by luciferase reporter assay. Global gene networks involved during PG to PV transition were also assessed by Gene Ontology as well as KEGG pathway analyses. Results and Conclusion: Our expression results indicated that PG follicles can be well differentiated from PV follicles by simply using a specific 13 miRNA expression signature let 7a 7b 7c 5p 7d 5p 7h 7i; miR 21 23a 27c 3p 107a 3p 125b 5p 145 3p 202 5p. Besides we validated interactions of let 7i::atg4a miR 202 5p::c23h20orf24 and miR 144::ybx1 by luciferase reporter assay. Purpose: we aimed to investigate important miRNA events and to define specific miRNA expression signature underlying the follicle activation of zebrafish Overall design: To identify differentially expressed miRNAs and its potential downstream targets during follicle activation of zebrafish we carried out transcriptomic profiling by both small and regular RNA sequencing. By intersecting gene lists of the online predicted targets and RNA seq derived differentially expressed transcripts with a reciprocal expression pattern of miRNAs we shortlisted 6 pairs of miRNA::target gene for validation using luciferase reporter assay.		pubmed:29228146	PG small RNA seq 2	GSM2433869	tissue:Ovarian follicle\|strain:AB\|cell type:Pre vitellogenic follicle\|age:from ovary of 3 month zebrafish	PG small RNA seq 2	For the RNA seq data all the pair end reads were mapped to the zebrafish genome using TopHat version 2.0.11. Genome annotation files with GTF format for known genes were downloaded from Ensembl. FPKM and RPKM values were calculated for each miRNA and gene respectively using Cufflinks software version 2.2.1 with default parameters. Genome build: Zv9 Ensembl release 79 Supplementary files format and content: tab delimited text files include FFKM for each mRNA transcript; tab delimited text files include RFKM for each miRNA.	Ovarian follicle	Ovaries from 3 mpf adult zebrafish were dissected in 60% medium of Leibovitz L 15 and follicles PG PV were sorted out according to the size and morphology.	RNA was extracted with miRNeasy and RNAeasy extraction kits Qiagen RNA Seq libraries were constructed according to Illumima TrueSeq and small RNA seq protocol and sequenced with the Illumina Hiseq 2000 Single end sequencing and pair end sequencing were used for small RNA seq library and RNA seq library respectively	AB fish was housed under a stable flow through condition at 28°C on a 14L:10D photoperiod with the light on at 0800 and off at 2200. Fish were fed regularly twice a day with live brine shrimp with supplement of commercial tropical fish food at a fixed time basis.	strain:AB\|cell type:Pre vitellogenic follicle\|age:from ovary of 3 month zebrafish	GSM2433869	GSM2433869: PG small RNA seq 2; Danio rerio; ncRNA Seq	GSM2433869		1	RNA was extracted with miRNeasy and RNAeasy extraction kits Qiagen RNA Seq libraries were constructed according to Illumima TrueSeq and small RNA seq protocol and sequenced with the Illumina Hiseq 2000 Single end sequencing and pair end sequencing were used for small RNA seq library and RNA seq library respectively	GEO Accession:GSM2433869	ncRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP095411	Ctrl_PV_1.fq.gz	fastq	532189753.0	19043107.0	GSM2433869 r1	0:27.95 1:0	A:138460901;C:107807428;G:115489810;T:170431567;N:47	27	0	138460901	107807428	115489810	170431567	47	SRX2437316	SRS1872014	SRA505873	GEO	Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institute of Health	1	0.86612		0.65562		0.84486		0.53167		26		B		usable mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	unknown	unknown	United States	2016-12-20	Adult	Adult	Gonad	Reproductive System
41694	41694	SRR5122166	SRX2437315	SRS1872013	SRP095411	PRJNA358209	Identification of a specific 13 miRNA expression signature during follicle activation in Zebrafish	GSE92639	Transcriptome Analysis	Purpose: We aimed to investigate important miRNA events and to define specific miRNA expression signature underlying the follicle activation of zebrafish. Methods: By using small and regular RNA sequencing we performed transcriptomic analyses of PG primary growth stage I; inactive and PV pre vitellogenic stage II; activated follicles to decipher important miRNA and gene events underlying follicle activation of zebrafish. We identified differentially expressed miRNAs for subsequent qPCR validation and miRNA::target gene prediction. Interaction of candidate miRNA:: target gene pairs were further validated by luciferase reporter assay. Global gene networks involved during PG to PV transition were also assessed by Gene Ontology as well as KEGG pathway analyses. Results and Conclusion: Our expression results indicated that PG follicles can be well differentiated from PV follicles by simply using a specific 13 miRNA expression signature let 7a 7b 7c 5p 7d 5p 7h 7i; miR 21 23a 27c 3p 107a 3p 125b 5p 145 3p 202 5p. Besides we validated interactions of let 7i::atg4a miR 202 5p::c23h20orf24 and miR 144::ybx1 by luciferase reporter assay. Purpose: we aimed to investigate important miRNA events and to define specific miRNA expression signature underlying the follicle activation of zebrafish Overall design: To identify differentially expressed miRNAs and its potential downstream targets during follicle activation of zebrafish we carried out transcriptomic profiling by both small and regular RNA sequencing. By intersecting gene lists of the online predicted targets and RNA seq derived differentially expressed transcripts with a reciprocal expression pattern of miRNAs we shortlisted 6 pairs of miRNA::target gene for validation using luciferase reporter assay.		pubmed:29228146	PG small RNA seq 1	GSM2433868	tissue:Ovarian follicle\|strain:AB\|cell type:Primary growth follicle\|age:from ovary of 3 month zebrafish	PG small RNA seq 1	For the RNA seq data all the pair end reads were mapped to the zebrafish genome using TopHat version 2.0.11. Genome annotation files with GTF format for known genes were downloaded from Ensembl. FPKM and RPKM values were calculated for each miRNA and gene respectively using Cufflinks software version 2.2.1 with default parameters. Genome build: Zv9 Ensembl release 79 Supplementary files format and content: tab delimited text files include FFKM for each mRNA transcript; tab delimited text files include RFKM for each miRNA.	Ovarian follicle	Ovaries from 3 mpf adult zebrafish were dissected in 60% medium of Leibovitz L 15 and follicles PG PV were sorted out according to the size and morphology.	RNA was extracted with miRNeasy and RNAeasy extraction kits Qiagen RNA Seq libraries were constructed according to Illumima TrueSeq and small RNA seq protocol and sequenced with the Illumina Hiseq 2000 Single end sequencing and pair end sequencing were used for small RNA seq library and RNA seq library respectively	AB fish was housed under a stable flow through condition at 28°C on a 14L:10D photoperiod with the light on at 0800 and off at 2200. Fish were fed regularly twice a day with live brine shrimp with supplement of commercial tropical fish food at a fixed time basis.	strain:AB\|cell type:Primary growth follicle\|age:from ovary of 3 month zebrafish	GSM2433868	GSM2433868: PG small RNA seq 1; Danio rerio; ncRNA Seq	GSM2433868		1	RNA was extracted with miRNeasy and RNAeasy extraction kits Qiagen RNA Seq libraries were constructed according to Illumima TrueSeq and small RNA seq protocol and sequenced with the Illumina Hiseq 2000 Single end sequencing and pair end sequencing were used for small RNA seq library and RNA seq library respectively	GEO Accession:GSM2433868	ncRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP095411	Ctrl_PG_1.fq.gz	fastq	368945203.0	13147324.0	GSM2433868 r1	0:28.06 1:0	A:96466912;C:75527992;G:78177838;T:118772423;N:38	28	0	96466912	75527992	78177838	118772423	38	SRX2437315	SRS1872013	SRA505873	GEO	Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institute of Health	1	0.8524		0.67638		0.86074		0.48958		27		B		usable mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	unknown	unknown	United States	2016-12-20	Adult	Adult	Gonad	Reproductive System
44967	44967	SRR6345660	SRX3442976	SRS2733636	SRP126106	PRJNA421016	Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA]	GSE107682	Transcriptome Analysis	Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish.	parent bioproject:PRJNA315403	pubmed:30086300	smRNA seq library of ovary from tdrd6a mut fish	GSM2875719	source name:Ovary from tdrd6a mut fish\|tissue:whole ovary\|genotype:tdrd6a mutant	smRNA seq library of ovary from tdrd6a mut fish	1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15 6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities. 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to. Supplementary files format and content: Files ending in .bw are bigwig tracks.	Ovary from tdrd6a mut fish		RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation		tissue:whole ovary\|genotype:tdrd6a mutant	GSM2875719	GSM2875719: smRNA seq library of ovary from tdrd6a mut fish; Danio rerio; ncRNA Seq	GSM2875719		1	RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation	GEO Accession:GSM2875719	ncRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP126106	Tdrd6a-mut-ovary-input-Adult.fastq.gz	fastq	817885062.0	16036962.0	GSM2875719 r1	0:51	A:212456064;C:163491733;G:233627239;T:208262707;N:47319	51		212456064	163491733	233627239	208262707	47319	SRX3442976	SRS2733636	SRA636010	GEO	Rene Ketting, RNA silencing, IMB	1	0.46308		0.13668		0.83587		0.79104		51		B		usable mapping rate	illumina	hiseq_era	5prime	size_fractionation	unknown	sc_generic	single_cell_generic	generic-scrnaseq-only	Germany	2017-12-04	Undetermined	Undetermined	Gonad	Reproductive System
44968	44968	SRR6345659	SRX3442975	SRS2733637	SRP126106	PRJNA421016	Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA]	GSE107682	Transcriptome Analysis	Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish.	parent bioproject:PRJNA315403	pubmed:30086300	smRNA seq library of ovary from tdrd6a het fish	GSM2875718	source name:Ovary from tdrd6a het fish\|tissue:whole ovary\|genotype:tdrd6a heterozygous	smRNA seq library of ovary from tdrd6a het fish	1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15 6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities. 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to. Supplementary files format and content: Files ending in .bw are bigwig tracks.	Ovary from tdrd6a het fish		RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation		tissue:whole ovary\|genotype:tdrd6a heterozygous	GSM2875718	GSM2875718: smRNA seq library of ovary from tdrd6a het fish; Danio rerio; ncRNA Seq	GSM2875718		1	RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation	GEO Accession:GSM2875718	ncRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP126106	Tdrd6a-het-ovary-input-Adult.fastq.gz	fastq	1452353571.0	28477521.0	GSM2875718 r1	0:51	A:397993735;C:284194126;G:396142390;T:373939235;N:84085	51		397993735	284194126	396142390	373939235	84085	SRX3442975	SRS2733637	SRA636010	GEO	Rene Ketting, RNA silencing, IMB	1	0.3869		0.1369		0.86397		0.77165		51		B		usable mapping rate	illumina	hiseq_era	5prime	size_fractionation	unknown	sc_generic	single_cell_generic	generic-scrnaseq-only	Germany	2017-12-04	Undetermined	Undetermined	Gonad	Reproductive System
68556	68556	SRR18028171	SRX14182301	SRS12005942	SRP359829	PRJNA807002	samll RNA seq of zebrafish gonads of wildtype and pld6 / at 22 dpf	PRJNA807002	Other	In this study we generated zebrafish pld6 knockouts and found that the pld6 null mutants developed as infertile males with testes containing no germ cells. Pld6 is considered to be a candidate ribonuclease participating in primary piRNA biogenesis which is essential for the survival of germ cells. We deep sequenced 20 33 nt total small RNAs obtained from 22 dpf wildtype and pld6 / gonad with three repetition. In pld6 / gonad small RNAs mapped to the known piRNA clusters were almost absent. Moreover piRNA clusters in pld6 / gonad lost the enrichment for uridine at the first position or for adenine at the 10th position. our results unequivocally demonstrate a conserved role for MitoPLD in the piRNA biogenesis pathway.				6WT 3	strain:AB\|isolate:replicate3\|ecotype:wt\|age:post fertilization day 22\|dev stage:juvenile\|sex:missing\|tissue:Gonad\|BioSampleModel:Model organism or animal									wt 3 S11 L001 R1	011	011	Zebrafish larvae were anesthetized in 0.2 mg/mL MS 222 and disected to isolate gonads under a microscope. Three wildtype or mutant gonads were mixed into one repeat and three repeats were performed for samll RNA sequencing.			ncRNA-Seq	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	HiSeq X Ten	SRP359829	wt-3_S11_L001_R1_001.fastq.gz wt-3_S11_L001_R2_001.fastq.gz	fastq fastq	3576981600.0	11923272.0	wt 3 S11 L001 R1 001.fastq.gz	0:150 1:150	A:689001630;C:496844981;G:1779990511;T:610974133;N:170345	150	150	689001630	496844981	1779990511	610974133	170345	SRX14182301	SRS12005942	SRA1372890	Huazhong agricultural university\|School of Life Science and Technology	Huazhong agricultural university	2	0.8179	0.81697	0.60905	0.60864	0.82692	0.82915	0.52425	0.52623	150	150	B	B	biological fallback assumption	illumina	hiseq_era	unknown	small_rna	unknown	bulk	unknown	unknown	China	2022-02-14	Multi-stage	Multi-stage	Gonad	Reproductive System
68557	68557	SRR18028172	SRX14182300	SRS12005941	SRP359829	PRJNA807002	samll RNA seq of zebrafish gonads of wildtype and pld6 / at 22 dpf	PRJNA807002	Other	In this study we generated zebrafish pld6 knockouts and found that the pld6 null mutants developed as infertile males with testes containing no germ cells. Pld6 is considered to be a candidate ribonuclease participating in primary piRNA biogenesis which is essential for the survival of germ cells. We deep sequenced 20 33 nt total small RNAs obtained from 22 dpf wildtype and pld6 / gonad with three repetition. In pld6 / gonad small RNAs mapped to the known piRNA clusters were almost absent. Moreover piRNA clusters in pld6 / gonad lost the enrichment for uridine at the first position or for adenine at the 10th position. our results unequivocally demonstrate a conserved role for MitoPLD in the piRNA biogenesis pathway.				5WT 2	strain:AB\|isolate:replicate2\|ecotype:wt\|age:post fertilization day 22\|dev stage:juvenile\|sex:missing\|tissue:Gonad\|BioSampleModel:Model organism or animal									wt 2 S10 L001 R1	009	009	Zebrafish larvae were anesthetized in 0.2 mg/mL MS 222 and disected to isolate gonads under a microscope. Three wildtype or mutant gonads were mixed into one repeat and three repeats were performed for samll RNA sequencing.			ncRNA-Seq	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	HiSeq X Ten	SRP359829	wt-2_S10_L001_R1_001.fastq.gz wt-2_S10_L001_R2_001.fastq.gz	fastq fastq	4200013800.0	14000046.0	wt 2 S10 L001 R1 001.fastq.gz	0:150 1:150	A:781057232;C:617020885;G:2110010128;T:691723797;N:201758	150	150	781057232	617020885	2110010128	691723797	201758	SRX14182300	SRS12005941	SRA1372890	Huazhong agricultural university\|School of Life Science and Technology	Huazhong agricultural university	2	0.8213	0.82216	0.59414	0.59507	0.81089	0.81306	0.53839	0.52755	150	150	B	B	biological fallback assumption	illumina	hiseq_era	unknown	small_rna	unknown	bulk	unknown	unknown	China	2022-02-14	Multi-stage	Multi-stage	Gonad	Reproductive System
68558	68558	SRR18028173	SRX14182299	SRS12005940	SRP359829	PRJNA807002	samll RNA seq of zebrafish gonads of wildtype and pld6 / at 22 dpf	PRJNA807002	Other	In this study we generated zebrafish pld6 knockouts and found that the pld6 null mutants developed as infertile males with testes containing no germ cells. Pld6 is considered to be a candidate ribonuclease participating in primary piRNA biogenesis which is essential for the survival of germ cells. We deep sequenced 20 33 nt total small RNAs obtained from 22 dpf wildtype and pld6 / gonad with three repetition. In pld6 / gonad small RNAs mapped to the known piRNA clusters were almost absent. Moreover piRNA clusters in pld6 / gonad lost the enrichment for uridine at the first position or for adenine at the 10th position. our results unequivocally demonstrate a conserved role for MitoPLD in the piRNA biogenesis pathway.				4WT 1	strain:AB\|isolate:replicate1\|ecotype:wt\|age:post fertilization day 22\|dev stage:juvenile\|sex:missing\|tissue:Gonad\|BioSampleModel:Model organism or animal									wt 1 S9 L001 R1	007	007	Zebrafish larvae were anesthetized in 0.2 mg/mL MS 222 and disected to isolate gonads under a microscope. Three wildtype or mutant gonads were mixed into one repeat and three repeats were performed for samll RNA sequencing.			ncRNA-Seq	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	HiSeq X Ten	SRP359829	wt-1_S9_L001_R1_001.fastq.gz wt-1_S9_L001_R2_001.fastq.gz	fastq fastq	4820063700.0	16066879.0	wt 1 S9 L001 R1 001.fastq.gz	0:150 1:150	A:996304548;C:657334691;G:2379519106;T:786675131;N:230224	150	150	996304548	657334691	2379519106	786675131	230224	SRX14182299	SRS12005940	SRA1372890	Huazhong agricultural university\|School of Life Science and Technology	Huazhong agricultural university	2	0.80219	0.80319	0.60906	0.60878	0.83238	0.83303	0.52559	0.51852	150	150	B	B	biological fallback assumption	illumina	hiseq_era	unknown	small_rna	unknown	bulk	unknown	unknown	China	2022-02-14	Multi-stage	Multi-stage	Gonad	Reproductive System
68559	68559	SRR18028174	SRX14182298	SRS12005939	SRP359829	PRJNA807002	samll RNA seq of zebrafish gonads of wildtype and pld6 / at 22 dpf	PRJNA807002	Other	In this study we generated zebrafish pld6 knockouts and found that the pld6 null mutants developed as infertile males with testes containing no germ cells. Pld6 is considered to be a candidate ribonuclease participating in primary piRNA biogenesis which is essential for the survival of germ cells. We deep sequenced 20 33 nt total small RNAs obtained from 22 dpf wildtype and pld6 / gonad with three repetition. In pld6 / gonad small RNAs mapped to the known piRNA clusters were almost absent. Moreover piRNA clusters in pld6 / gonad lost the enrichment for uridine at the first position or for adenine at the 10th position. our results unequivocally demonstrate a conserved role for MitoPLD in the piRNA biogenesis pathway.				3PLD6 3	strain:AB\|isolate:replicate3\|ecotype:pld6 / \|age:post fertilization day 22\|dev stage:juvenile\|sex:missing\|tissue:Gonad\|BioSampleModel:Model organism or animal									pld6 3 S3 L003 R1	005	005	Zebrafish larvae were anesthetized in 0.2 mg/mL MS 222 and disected to isolate gonads under a microscope. Three wildtype or mutant gonads were mixed into one repeat and three repeats were performed for samll RNA sequencing.			ncRNA-Seq	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	HiSeq X Ten	SRP359829	pld6-3_S3_L003_R1_001.fastq.gz pld6-3_S3_L003_R2_001.fastq.gz	fastq fastq	816686700.0	2722289.0	pld6 3 S3 L003 R1 001.fastq.gz	0:150 1:150	A:145681738;C:137123477;G:401610833;T:132256312;N:14340	150	150	145681738	137123477	401610833	132256312	14340	SRX14182298	SRS12005939	SRA1372890	Huazhong agricultural university\|School of Life Science and Technology	Huazhong agricultural university	2	0.78314	0.73942	0.07641	0.09097	0.91603	0.91545	0.6312	0.64467	150	150	B	B	biological fallback assumption	illumina	hiseq_era	unknown	small_rna	unknown	bulk	unknown	unknown	China	2022-02-14	Multi-stage	Multi-stage	Gonad	Reproductive System
68560	68560	SRR18028175	SRX14182297	SRS12005938	SRP359829	PRJNA807002	samll RNA seq of zebrafish gonads of wildtype and pld6 / at 22 dpf	PRJNA807002	Other	In this study we generated zebrafish pld6 knockouts and found that the pld6 null mutants developed as infertile males with testes containing no germ cells. Pld6 is considered to be a candidate ribonuclease participating in primary piRNA biogenesis which is essential for the survival of germ cells. We deep sequenced 20 33 nt total small RNAs obtained from 22 dpf wildtype and pld6 / gonad with three repetition. In pld6 / gonad small RNAs mapped to the known piRNA clusters were almost absent. Moreover piRNA clusters in pld6 / gonad lost the enrichment for uridine at the first position or for adenine at the 10th position. our results unequivocally demonstrate a conserved role for MitoPLD in the piRNA biogenesis pathway.				2PLD6 2	strain:AB\|isolate:replicate2\|ecotype:pld6 / \|age:post fertilization day 22\|dev stage:juvenile\|sex:missing\|tissue:Gonad\|BioSampleModel:Model organism or animal									pld6 2 S2 L003 R1	003	003	Zebrafish larvae were anesthetized in 0.2 mg/mL MS 222 and disected to isolate gonads under a microscope. Three wildtype or mutant gonads were mixed into one repeat and three repeats were performed for samll RNA sequencing.			ncRNA-Seq	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	HiSeq X Ten	SRP359829	pld6-2_S2_L003_R1_001.fastq.gz pld6-2_S2_L003_R2_001.fastq.gz	fastq fastq	6546276900.0	21820923.0	pld6 2 S2 L003 R1 001.fastq.gz	0:150 1:150	A:1161502458;C:1095580994;G:3226725392;T:1062358099;N:109957	150	150	1161502458	1095580994	3226725392	1062358099	109957	SRX14182297	SRS12005938	SRA1372890	Huazhong agricultural university\|School of Life Science and Technology	Huazhong agricultural university	2	0.6471	0.593	0.07935	0.09168	0.92058	0.92005	0.53626	0.65284	150	150	B	B	biological fallback assumption	illumina	hiseq_era	unknown	small_rna	unknown	bulk	unknown	unknown	China	2022-02-14	Multi-stage	Multi-stage	Gonad	Reproductive System
68561	68561	SRR18028176	SRX14182296	SRS12005937	SRP359829	PRJNA807002	samll RNA seq of zebrafish gonads of wildtype and pld6 / at 22 dpf	PRJNA807002	Other	In this study we generated zebrafish pld6 knockouts and found that the pld6 null mutants developed as infertile males with testes containing no germ cells. Pld6 is considered to be a candidate ribonuclease participating in primary piRNA biogenesis which is essential for the survival of germ cells. We deep sequenced 20 33 nt total small RNAs obtained from 22 dpf wildtype and pld6 / gonad with three repetition. In pld6 / gonad small RNAs mapped to the known piRNA clusters were almost absent. Moreover piRNA clusters in pld6 / gonad lost the enrichment for uridine at the first position or for adenine at the 10th position. our results unequivocally demonstrate a conserved role for MitoPLD in the piRNA biogenesis pathway.				1PLD6 1	strain:AB\|isolate:replicate1\|ecotype:pld6 / \|age:post fertilization day 22\|dev stage:juvenile\|sex:missing\|tissue:Gonad\|BioSampleModel:Model organism or animal									pld6 1 S1 L003 R1	001	001	Zebrafish larvae were anesthetized in 0.2 mg/mL MS 222 and disected to isolate gonads under a microscope. Three wildtype or mutant gonads were mixed into one repeat and three repeats were performed for samll RNA sequencing.			ncRNA-Seq	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	HiSeq X Ten	SRP359829	pld6-1_S1_L003_R1_001.fastq.gz pld6-1_S1_L003_R2_001.fastq.gz	fastq fastq	5535130200.0	18450434.0	pld6 1 S1 L003 R1 001.fastq.gz	0:150 1:150	A:1014761790;C:833992394;G:2813863824;T:872418512;N:93680	150	150	1014761790	833992394	2813863824	872418512	93680	SRX14182296	SRS12005937	SRA1372890	Huazhong agricultural university\|School of Life Science and Technology	Huazhong agricultural university	2	0.70358	0.73288	0.08649	0.09366	0.91066	0.90914	0.6197	0.6207	150	150	B	B	biological fallback assumption	illumina	hiseq_era	unknown	small_rna	unknown	bulk	unknown	unknown	China	2022-02-14	Multi-stage	Multi-stage	Gonad	Reproductive System

Advanced export

JSON shape: default, array, newline-delimited

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;