run_metadata
16 rows where experiment.library_source = "TRANSCRIPTOMIC", experiment.library_strategy = "ncRNA-Seq" and technology = "bulk"
This data as json, CSV (advanced)
| Link | rowid ▼ | run.accession | experiment.accession | sample.accession | study.accession | bioproject | study.title | study.alias | study.type | study.abstract | study.attributes | study.PMIDs | sample.description | sample.title | sample.alias | sample.centername | sample.attributes | GEOsample.title | GEOsample.dataprocessing | GEOsample.source | GEOsample.treatmentprotocol | GEOsample.extractprotocol | GEOsample.growthprotocol | GEOsample.characteristics | GEOsample.accession | experiment.title | experiment.alias | experiment.library_name | experiment.design_description | experiment.library_construction_protocol | experiment.attributes | experiment.library_strategy | experiment.library_source | experiment.library_selection | experiment.library_layout | experiment.platform | experiment.instrument_model | experiment.spot_descriptor | experiment.study_ref | run.title | run.attributes | run.filename | run.semantic_name | run.total_bases | run.total_spots | run.alias | run.read_lengths | run.base_counts | run.r1_length | run.r2_length | run.r3_length | run.r4_length | run.Acount | run.Ccount | run.Gcount | run.Tcount | run.Ncount | run.experiment | run.pool_member | submission.accession | submission.srasource | submission.bioprojectsource | seqdetective.n_mates | seqdetective.mapping_rate.mate1 | seqdetective.mapping_rate.mate2 | seqdetective.nofeature_rate.mate1 | seqdetective.nofeature_rate.mate2 | seqdetective.sparsity.mate1 | seqdetective.sparsity.mate2 | seqdetective.pos_strand_rate.mate1 | seqdetective.pos_strand_rate.mate2 | seqdetective.readlen.mate1 | seqdetective.readlen.mate2 | seqdetective.judgement.mate1 | seqdetective.judgement.mate2 | seqdetective.judgement.reason | platform_family | instrument_generation | read_bias | selection_class | prep_kit | sc_or_bulk | tech_class | technology | tech_variant | submission.bioprojectsource.country | earliest_date | devstage_curation | devstage_curation_coarse | tissue_curation | tissue_curation_coarse |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 57067 | 57067 | SRR11214402 | SRX7826914 | SRS6238049 | SRP251256 | PRJNA609696 | Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] | GSE146200 | Transcriptome Analysis | Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. | parent bioproject:PRJNA609691 | pubmed:28962522 | JD18 [miRNA seq] | GSM4368082 | source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA | JD18 [miRNA seq] | The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. | 30 pooled larvae 5dpf triptolide for 6 h | 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | Zebrafish Danio rerio were maintained at 28.5 °C | strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA | GSM4368082 | GSM4368082: JD18 [miRNA seq]; Danio rerio; ncRNA Seq | GSM4368082 | 1 | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | GEO Accession:GSM4368082 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 550 | SRP251256 | small_JD18.combined.fastq.gz | fastq | 702201000.0 | 14044020.0 | GSM4368082 r1 | 0:50 1:0 | A:165610842;C:167169519;G:192886323;T:176528538;N:5778 | 50 | 0 | 165610842 | 167169519 | 192886323 | 176528538 | 5778 | SRX7826914 | SRS6238049 | SRA1049684 | GEO | Centre for Immunity, Infection and Evolution | 1 | 0.06331 | 0.00756 | 0.99153 | 0.5451 | 50 | B | usable mapping rate | illumina | nextseq | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2020-03-02 | Larval | Larval | Whole Organism | All anatomical structures | |||||||||||||||
| 57068 | 57068 | SRR11214401 | SRX7826913 | SRS6238048 | SRP251256 | PRJNA609696 | Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] | GSE146200 | Transcriptome Analysis | Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. | parent bioproject:PRJNA609691 | pubmed:28962522 | JD17 [miRNA seq] | GSM4368081 | source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA | JD17 [miRNA seq] | The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. | 30 pooled larvae 5dpf triptolide for 6 h | 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | Zebrafish Danio rerio were maintained at 28.5 °C | strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA | GSM4368081 | GSM4368081: JD17 [miRNA seq]; Danio rerio; ncRNA Seq | GSM4368081 | 1 | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | GEO Accession:GSM4368081 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 550 | SRP251256 | small_JD17.combined.fastq.gz | fastq | 429694400.0 | 8593888.0 | GSM4368081 r1 | 0:50 1:0 | A:105670449;C:101354858;G:115926173;T:106739304;N:3616 | 50 | 0 | 105670449 | 101354858 | 115926173 | 106739304 | 3616 | SRX7826913 | SRS6238048 | SRA1049684 | GEO | Centre for Immunity, Infection and Evolution | 1 | 0.04686 | 0.00437 | 0.99389 | 0.53154 | 50 | B | usable mapping rate | illumina | nextseq | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2020-03-02 | Larval | Larval | Whole Organism | All anatomical structures | |||||||||||||||
| 57069 | 57069 | SRR11214400 | SRX7826912 | SRS6238047 | SRP251256 | PRJNA609696 | Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] | GSE146200 | Transcriptome Analysis | Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. | parent bioproject:PRJNA609691 | pubmed:28962522 | JD16 [miRNA seq] | GSM4368080 | source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA | JD16 [miRNA seq] | The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. | 30 pooled larvae 5dpf triptolide for 6 h | 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | Zebrafish Danio rerio were maintained at 28.5 °C | strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA | GSM4368080 | GSM4368080: JD16 [miRNA seq]; Danio rerio; ncRNA Seq | GSM4368080 | 1 | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | GEO Accession:GSM4368080 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 550 | SRP251256 | small_JD16.combined.fastq.gz | fastq | 381826650.0 | 7636533.0 | GSM4368080 r1 | 0:50 1:0 | A:92578473;C:90665066;G:103254018;T:95325823;N:3270 | 50 | 0 | 92578473 | 90665066 | 103254018 | 95325823 | 3270 | SRX7826912 | SRS6238047 | SRA1049684 | GEO | Centre for Immunity, Infection and Evolution | 1 | 0.07185 | 0.00402 | 0.99419 | 0.49823 | 50 | B | usable mapping rate | illumina | nextseq | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2020-03-02 | Larval | Larval | Whole Organism | All anatomical structures | |||||||||||||||
| 57070 | 57070 | SRR11214399 | SRX7826911 | SRS6238046 | SRP251256 | PRJNA609696 | Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] | GSE146200 | Transcriptome Analysis | Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. | parent bioproject:PRJNA609691 | pubmed:28962522 | JD15 [miRNA seq] | GSM4368079 | source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA | JD15 [miRNA seq] | The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. | 30 pooled larvae 5dpf triptolide for 6 h | 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | Zebrafish Danio rerio were maintained at 28.5 °C | strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA | GSM4368079 | GSM4368079: JD15 [miRNA seq]; Danio rerio; ncRNA Seq | GSM4368079 | 1 | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | GEO Accession:GSM4368079 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 550 | SRP251256 | small_JD15.combined.fastq.gz | fastq | 285535900.0 | 5710718.0 | GSM4368079 r1 | 0:50 1:0 | A:68624024;C:67839672;G:77291276;T:71778522;N:2406 | 50 | 0 | 68624024 | 67839672 | 77291276 | 71778522 | 2406 | SRX7826911 | SRS6238046 | SRA1049684 | GEO | Centre for Immunity, Infection and Evolution | 1 | 0.07651 | 0.00425 | 0.99407 | 0.54635 | 50 | B | usable mapping rate | illumina | nextseq | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2020-03-02 | Larval | Larval | Whole Organism | All anatomical structures | |||||||||||||||
| 57071 | 57071 | SRR11214398 | SRX7826910 | SRS6238045 | SRP251256 | PRJNA609696 | Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] | GSE146200 | Transcriptome Analysis | Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. | parent bioproject:PRJNA609691 | pubmed:28962522 | JD14 [miRNA seq] | GSM4368078 | source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA | JD14 [miRNA seq] | The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. | 30 pooled larvae 5dpf triptolide for 6 h | 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | Zebrafish Danio rerio were maintained at 28.5 °C | strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA | GSM4368078 | GSM4368078: JD14 [miRNA seq]; Danio rerio; ncRNA Seq | GSM4368078 | 1 | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | GEO Accession:GSM4368078 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 550 | SRP251256 | small_JD14.combined.fastq.gz | fastq | 363231350.0 | 7264627.0 | GSM4368078 r1 | 0:50 1:0 | A:87298047;C:86511359;G:98123632;T:91295160;N:3152 | 50 | 0 | 87298047 | 86511359 | 98123632 | 91295160 | 3152 | SRX7826910 | SRS6238045 | SRA1049684 | GEO | Centre for Immunity, Infection and Evolution | 1 | 0.07156 | 0.00417 | 0.99314 | 0.49982 | 50 | B | usable mapping rate | illumina | nextseq | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2020-03-02 | Larval | Larval | Whole Organism | All anatomical structures | |||||||||||||||
| 57072 | 57072 | SRR11214397 | SRX7826909 | SRS6238044 | SRP251256 | PRJNA609696 | Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] | GSE146200 | Transcriptome Analysis | Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. | parent bioproject:PRJNA609691 | pubmed:28962522 | JD13 [miRNA seq] | GSM4368077 | source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA | JD13 [miRNA seq] | The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. | 30 pooled larvae 5dpf triptolide for 6 h | 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | Zebrafish Danio rerio were maintained at 28.5 °C | strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA | GSM4368077 | GSM4368077: JD13 [miRNA seq]; Danio rerio; ncRNA Seq | GSM4368077 | 1 | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | GEO Accession:GSM4368077 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 550 | SRP251256 | small_JD13.combined.fastq.gz | fastq | 280852650.0 | 5617053.0 | GSM4368077 r1 | 0:50 1:0 | A:66976453;C:66985314;G:76111707;T:70776819;N:2357 | 50 | 0 | 66976453 | 66985314 | 76111707 | 70776819 | 2357 | SRX7826909 | SRS6238044 | SRA1049684 | GEO | Centre for Immunity, Infection and Evolution | 1 | 0.0785 | 0.00403 | 0.99454 | 0.53818 | 50 | B | usable mapping rate | illumina | nextseq | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2020-03-02 | Larval | Larval | Whole Organism | All anatomical structures | |||||||||||||||
| 57073 | 57073 | SRR11214396 | SRX7826908 | SRS6238043 | SRP251256 | PRJNA609696 | Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] | GSE146200 | Transcriptome Analysis | Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. | parent bioproject:PRJNA609691 | pubmed:28962522 | JD12 [miRNA seq] | GSM4368076 | source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA | JD12 [miRNA seq] | The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. | 30 pooled larvae 5dpf triptolide for 6 h | 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | Zebrafish Danio rerio were maintained at 28.5 °C | strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA | GSM4368076 | GSM4368076: JD12 [miRNA seq]; Danio rerio; ncRNA Seq | GSM4368076 | 1 | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | GEO Accession:GSM4368076 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 550 | SRP251256 | small_JD12.combined.fastq.gz | fastq | 267278950.0 | 5345579.0 | GSM4368076 r1 | 0:50 1:0 | A:63524573;C:63700392;G:72574389;T:67477407;N:2189 | 50 | 0 | 63524573 | 63700392 | 72574389 | 67477407 | 2189 | SRX7826908 | SRS6238043 | SRA1049684 | GEO | Centre for Immunity, Infection and Evolution | 1 | 0.0867 | 0.00429 | 0.99403 | 0.53048 | 50 | B | usable mapping rate | illumina | nextseq | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2020-03-02 | Larval | Larval | Whole Organism | All anatomical structures | |||||||||||||||
| 57074 | 57074 | SRR11214395 | SRX7826907 | SRS6238042 | SRP251256 | PRJNA609696 | Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] | GSE146200 | Transcriptome Analysis | Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. | parent bioproject:PRJNA609691 | pubmed:28962522 | JD11 [miRNA seq] | GSM4368075 | source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA | JD11 [miRNA seq] | The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. | 30 pooled larvae 5dpf triptolide for 6 h | 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | Zebrafish Danio rerio were maintained at 28.5 °C | strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA | GSM4368075 | GSM4368075: JD11 [miRNA seq]; Danio rerio; ncRNA Seq | GSM4368075 | 1 | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | GEO Accession:GSM4368075 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 550 | SRP251256 | small_JD11.combined.fastq.gz | fastq | 323802250.0 | 6476045.0 | GSM4368075 r1 | 0:50 1:0 | A:78153815;C:77052322;G:87557986;T:81035226;N:2901 | 50 | 0 | 78153815 | 77052322 | 87557986 | 81035226 | 2901 | SRX7826907 | SRS6238042 | SRA1049684 | GEO | Centre for Immunity, Infection and Evolution | 1 | 0.06809 | 0.00424 | 0.99368 | 0.52229 | 50 | B | usable mapping rate | illumina | nextseq | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2020-03-02 | Larval | Larval | Whole Organism | All anatomical structures | |||||||||||||||
| 57075 | 57075 | SRR11214394 | SRX7826906 | SRS6238041 | SRP251256 | PRJNA609696 | Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] | GSE146200 | Transcriptome Analysis | Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. | parent bioproject:PRJNA609691 | pubmed:28962522 | JD08 [miRNA seq] | GSM4368074 | source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA | JD08 [miRNA seq] | The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. | 30 pooled larvae 5dpf vehicle | 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | Zebrafish Danio rerio were maintained at 28.5 °C | strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA | GSM4368074 | GSM4368074: JD08 [miRNA seq]; Danio rerio; ncRNA Seq | GSM4368074 | 1 | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | GEO Accession:GSM4368074 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 550 | SRP251256 | small_JD08.combined.fastq.gz | fastq | 375132100.0 | 7502642.0 | GSM4368074 r1 | 0:50 1:0 | A:89764502;C:89300619;G:101501695;T:94562105;N:3179 | 50 | 0 | 89764502 | 89300619 | 101501695 | 94562105 | 3179 | SRX7826906 | SRS6238041 | SRA1049684 | GEO | Centre for Immunity, Infection and Evolution | 1 | 0.07787 | 0.0042 | 0.99338 | 0.52599 | 50 | B | usable mapping rate | illumina | nextseq | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2020-03-02 | Larval | Larval | Whole Organism | All anatomical structures | |||||||||||||||
| 57076 | 57076 | SRR11214393 | SRX7826905 | SRS6238040 | SRP251256 | PRJNA609696 | Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] | GSE146200 | Transcriptome Analysis | Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. | parent bioproject:PRJNA609691 | pubmed:28962522 | JD07 [miRNA seq] | GSM4368073 | source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA | JD07 [miRNA seq] | The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. | 30 pooled larvae 5dpf vehicle | 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | Zebrafish Danio rerio were maintained at 28.5 °C | strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA | GSM4368073 | GSM4368073: JD07 [miRNA seq]; Danio rerio; ncRNA Seq | GSM4368073 | 1 | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | GEO Accession:GSM4368073 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 550 | SRP251256 | small_JD07.combined.fastq.gz | fastq | 317528050.0 | 6350561.0 | GSM4368073 r1 | 0:50 1:0 | A:75643339;C:75642242;G:86133220;T:80106532;N:2717 | 50 | 0 | 75643339 | 75642242 | 86133220 | 80106532 | 2717 | SRX7826905 | SRS6238040 | SRA1049684 | GEO | Centre for Immunity, Infection and Evolution | 1 | 0.07711 | 0.00424 | 0.9934 | 0.53196 | 50 | B | usable mapping rate | illumina | nextseq | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2020-03-02 | Larval | Larval | Whole Organism | All anatomical structures | |||||||||||||||
| 57077 | 57077 | SRR11214392 | SRX7826904 | SRS6238039 | SRP251256 | PRJNA609696 | Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] | GSE146200 | Transcriptome Analysis | Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. | parent bioproject:PRJNA609691 | pubmed:28962522 | JD06 [miRNA seq] | GSM4368072 | source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA | JD06 [miRNA seq] | The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. | 30 pooled larvae 5dpf vehicle | 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | Zebrafish Danio rerio were maintained at 28.5 °C | strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA | GSM4368072 | GSM4368072: JD06 [miRNA seq]; Danio rerio; ncRNA Seq | GSM4368072 | 1 | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | GEO Accession:GSM4368072 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 550 | SRP251256 | small_JD06.combined.fastq.gz | fastq | 313235150.0 | 6264703.0 | GSM4368072 r1 | 0:50 1:0 | A:74970317;C:74745173;G:84767516;T:78749342;N:2802 | 50 | 0 | 74970317 | 74745173 | 84767516 | 78749342 | 2802 | SRX7826904 | SRS6238039 | SRA1049684 | GEO | Centre for Immunity, Infection and Evolution | 1 | 0.07206 | 0.00403 | 0.99312 | 0.52846 | 50 | B | usable mapping rate | illumina | nextseq | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2020-03-02 | Larval | Larval | Whole Organism | All anatomical structures | |||||||||||||||
| 57078 | 57078 | SRR11214391 | SRX7826903 | SRS6238038 | SRP251256 | PRJNA609696 | Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] | GSE146200 | Transcriptome Analysis | Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. | parent bioproject:PRJNA609691 | pubmed:28962522 | JD05 [miRNA seq] | GSM4368071 | source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA | JD05 [miRNA seq] | The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. | 30 pooled larvae 5dpf vehicle | 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | Zebrafish Danio rerio were maintained at 28.5 °C | strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA | GSM4368071 | GSM4368071: JD05 [miRNA seq]; Danio rerio; ncRNA Seq | GSM4368071 | 1 | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | GEO Accession:GSM4368071 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 550 | SRP251256 | small_JD05.combined.fastq.gz | fastq | 282608400.0 | 5652168.0 | GSM4368071 r1 | 0:50 1:0 | A:67639670;C:67139768;G:76678815;T:71147790;N:2357 | 50 | 0 | 67639670 | 67139768 | 76678815 | 71147790 | 2357 | SRX7826903 | SRS6238038 | SRA1049684 | GEO | Centre for Immunity, Infection and Evolution | 1 | 0.07587 | 0.00384 | 0.99299 | 0.5434 | 50 | B | usable mapping rate | illumina | nextseq | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2020-03-02 | Larval | Larval | Whole Organism | All anatomical structures | |||||||||||||||
| 57079 | 57079 | SRR11214390 | SRX7826902 | SRS6238037 | SRP251256 | PRJNA609696 | Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] | GSE146200 | Transcriptome Analysis | Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. | parent bioproject:PRJNA609691 | pubmed:28962522 | JD04 [miRNA seq] | GSM4368070 | source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA | JD04 [miRNA seq] | The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. | 30 pooled larvae 5dpf vehicle | 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | Zebrafish Danio rerio were maintained at 28.5 °C | strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA | GSM4368070 | GSM4368070: JD04 [miRNA seq]; Danio rerio; ncRNA Seq | GSM4368070 | 1 | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | GEO Accession:GSM4368070 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 550 | SRP251256 | small_JD04.combined.fastq.gz | fastq | 289767100.0 | 5795342.0 | GSM4368070 r1 | 0:50 1:0 | A:69580978;C:68900579;G:78340509;T:72942639;N:2395 | 50 | 0 | 69580978 | 68900579 | 78340509 | 72942639 | 2395 | SRX7826902 | SRS6238037 | SRA1049684 | GEO | Centre for Immunity, Infection and Evolution | 1 | 0.07492 | 0.00373 | 0.99295 | 0.52294 | 50 | B | usable mapping rate | illumina | nextseq | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2020-03-02 | Larval | Larval | Whole Organism | All anatomical structures | |||||||||||||||
| 57080 | 57080 | SRR11214389 | SRX7826901 | SRS6238036 | SRP251256 | PRJNA609696 | Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] | GSE146200 | Transcriptome Analysis | Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. | parent bioproject:PRJNA609691 | pubmed:28962522 | JD03 [miRNA seq] | GSM4368069 | source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA | JD03 [miRNA seq] | The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. | 30 pooled larvae 5dpf vehicle | 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | Zebrafish Danio rerio were maintained at 28.5 °C | strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA | GSM4368069 | GSM4368069: JD03 [miRNA seq]; Danio rerio; ncRNA Seq | GSM4368069 | 1 | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | GEO Accession:GSM4368069 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 550 | SRP251256 | small_JD03.combined.fastq.gz | fastq | 230982600.0 | 4619652.0 | GSM4368069 r1 | 0:50 1:0 | A:55200177;C:55003182;G:62615802;T:58161510;N:1929 | 50 | 0 | 55200177 | 55003182 | 62615802 | 58161510 | 1929 | SRX7826901 | SRS6238036 | SRA1049684 | GEO | Centre for Immunity, Infection and Evolution | 1 | 0.07179 | 0.00361 | 0.99336 | 0.47352 | 50 | B | usable mapping rate | illumina | nextseq | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2020-03-02 | Larval | Larval | Whole Organism | All anatomical structures | |||||||||||||||
| 57081 | 57081 | SRR11214388 | SRX7826900 | SRS6238035 | SRP251256 | PRJNA609696 | Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] | GSE146200 | Transcriptome Analysis | Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. | parent bioproject:PRJNA609691 | pubmed:28962522 | JD02 [miRNA seq] | GSM4368068 | source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA | JD02 [miRNA seq] | The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. | 30 pooled larvae 5dpf vehicle | 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | Zebrafish Danio rerio were maintained at 28.5 °C | strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA | GSM4368068 | GSM4368068: JD02 [miRNA seq]; Danio rerio; ncRNA Seq | GSM4368068 | 1 | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | GEO Accession:GSM4368068 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 550 | SRP251256 | small_JD02.combined.fastq.gz | fastq | 367984500.0 | 7359690.0 | GSM4368068 r1 | 0:50 1:0 | A:87859797;C:87548819;G:99752643;T:92820007;N:3234 | 50 | 0 | 87859797 | 87548819 | 99752643 | 92820007 | 3234 | SRX7826900 | SRS6238035 | SRA1049684 | GEO | Centre for Immunity, Infection and Evolution | 1 | 0.07619 | 0.00398 | 0.99403 | 0.53717 | 50 | B | usable mapping rate | illumina | nextseq | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2020-03-02 | Larval | Larval | Whole Organism | All anatomical structures | |||||||||||||||
| 57082 | 57082 | SRR11214387 | SRX7826899 | SRS6238034 | SRP251256 | PRJNA609696 | Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] | GSE146200 | Transcriptome Analysis | Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. | parent bioproject:PRJNA609691 | pubmed:28962522 | JD01 [miRNA seq] | GSM4368067 | source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA | JD01 [miRNA seq] | The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. | 30 pooled larvae 5dpf vehicle | 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | Zebrafish Danio rerio were maintained at 28.5 °C | strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA | GSM4368067 | GSM4368067: JD01 [miRNA seq]; Danio rerio; ncRNA Seq | GSM4368067 | 1 | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | GEO Accession:GSM4368067 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 550 | SRP251256 | small_JD01.combined.fastq.gz | fastq | 374941900.0 | 7498838.0 | GSM4368067 r1 | 0:50 1:0 | A:90013932;C:89307034;G:101275933;T:94341753;N:3248 | 50 | 0 | 90013932 | 89307034 | 101275933 | 94341753 | 3248 | SRX7826899 | SRS6238034 | SRA1049684 | GEO | Centre for Immunity, Infection and Evolution | 1 | 0.07456 | 0.00386 | 0.99399 | 0.52664 | 50 | B | usable mapping rate | illumina | nextseq | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2020-03-02 | Larval | Larval | Whole Organism | All anatomical structures |
Advanced export
JSON shape: default, array, newline-delimited
CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;