run_metadata
26 rows where experiment.library_source = "TRANSCRIPTOMIC", experiment.library_strategy = "RNA-Seq" and technology = "iclip"
This data as json, CSV (advanced)
| Link | rowid ▼ | run.accession | experiment.accession | sample.accession | study.accession | bioproject | study.title | study.alias | study.type | study.abstract | study.attributes | study.PMIDs | sample.description | sample.title | sample.alias | sample.centername | sample.attributes | GEOsample.title | GEOsample.dataprocessing | GEOsample.source | GEOsample.treatmentprotocol | GEOsample.extractprotocol | GEOsample.growthprotocol | GEOsample.characteristics | GEOsample.accession | experiment.title | experiment.alias | experiment.library_name | experiment.design_description | experiment.library_construction_protocol | experiment.attributes | experiment.library_strategy | experiment.library_source | experiment.library_selection | experiment.library_layout | experiment.platform | experiment.instrument_model | experiment.spot_descriptor | experiment.study_ref | run.title | run.attributes | run.filename | run.semantic_name | run.total_bases | run.total_spots | run.alias | run.read_lengths | run.base_counts | run.r1_length | run.r2_length | run.r3_length | run.r4_length | run.Acount | run.Ccount | run.Gcount | run.Tcount | run.Ncount | run.experiment | run.pool_member | submission.accession | submission.srasource | submission.bioprojectsource | seqdetective.n_mates | seqdetective.mapping_rate.mate1 | seqdetective.mapping_rate.mate2 | seqdetective.nofeature_rate.mate1 | seqdetective.nofeature_rate.mate2 | seqdetective.sparsity.mate1 | seqdetective.sparsity.mate2 | seqdetective.pos_strand_rate.mate1 | seqdetective.pos_strand_rate.mate2 | seqdetective.readlen.mate1 | seqdetective.readlen.mate2 | seqdetective.judgement.mate1 | seqdetective.judgement.mate2 | seqdetective.judgement.reason | platform_family | instrument_generation | read_bias | selection_class | prep_kit | sc_or_bulk | tech_class | technology | tech_variant | submission.bioprojectsource.country | earliest_date | devstage_curation | devstage_curation_coarse | tissue_curation | tissue_curation_coarse |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 41262 | 41262 | SRR4026154 | SRX2018187 | SRS1614128 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | FUS KO 6 | GSM2277123 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | FUS KO 6 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | GSM2277123 | GSM2277123: FUS KO 6; Danio rerio; RNA Seq | GSM2277123 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277123 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | Sample_imb_ketting_2014_13_FUS_KO_6_R1.fastq.gz Sample_imb_ketting_2014_13_FUS_KO_6_R2.fastq.gz | fastq fastq | 7975498532.0 | 39482666.0 | GSM2277123 r1 | 0:101 1:101 | A:2277361634;C:1708878425;G:1702517993;T:2283731854;N:3008626 | 101 | 101 | 2277361634 | 1708878425 | 1702517993 | 2283731854 | 3008626 | SRX2018187 | SRS1614128 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.92046 | 0.9235 | 0.18223 | 0.18163 | 0.68866 | 0.68927 | 0.48519 | 0.47059 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41263 | 41263 | SRR4026155 | SRX2018187 | SRS1614128 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | FUS KO 6 | GSM2277123 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | FUS KO 6 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | GSM2277123 | GSM2277123: FUS KO 6; Danio rerio; RNA Seq | GSM2277123 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277123 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | FUS_KO_6_R1.fastq.gz FUS_KO_6_R2.fastq.gz | fastq fastq | 7173346028.0 | 35511614.0 | GSM2277123 r2 | 0:101 1:101 | A:1991537753;C:1595400788;G:1586024536;T:1997441866;N:2941085 | 101 | 101 | 1991537753 | 1595400788 | 1586024536 | 1997441866 | 2941085 | SRX2018187 | SRS1614128 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.93379 | 0.93701 | 0.16593 | 0.1657 | 0.68517 | 0.68558 | 0.49349 | 0.49229 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41264 | 41264 | SRR4026152 | SRX2018186 | SRS1614129 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | FUS KO 5 | GSM2277122 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | FUS KO 5 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | GSM2277122 | GSM2277122: FUS KO 5; Danio rerio; RNA Seq | GSM2277122 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277122 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | Sample_imb_ketting_2014_13_FUS_KO_5_R1.fastq.gz Sample_imb_ketting_2014_13_FUS_KO_5_R2.fastq.gz | fastq fastq | 7478598328.0 | 37022764.0 | GSM2277122 r1 | 0:101 1:101 | A:2133855925;C:1603288158;G:1598612742;T:2140065375;N:2776128 | 101 | 101 | 2133855925 | 1603288158 | 1598612742 | 2140065375 | 2776128 | SRX2018186 | SRS1614129 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.9197 | 0.92307 | 0.17221 | 0.17171 | 0.68578 | 0.68586 | 0.49581 | 0.50519 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41265 | 41265 | SRR4026153 | SRX2018186 | SRS1614129 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | FUS KO 5 | GSM2277122 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | FUS KO 5 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | GSM2277122 | GSM2277122: FUS KO 5; Danio rerio; RNA Seq | GSM2277122 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277122 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | FUS_KO_5_R1.fastq.gz FUS_KO_5_R2.fastq.gz | fastq fastq | 6719087822.0 | 33262811.0 | GSM2277122 r2 | 0:101 1:101 | A:1785013612;C:1574089873;G:1572290158;T:1784978560;N:2715619 | 101 | 101 | 1785013612 | 1574089873 | 1572290158 | 1784978560 | 2715619 | SRX2018186 | SRS1614129 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.94652 | 0.94901 | 0.12756 | 0.12603 | 0.67834 | 0.6789 | 0.50281 | 0.50397 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41266 | 41266 | SRR4026151 | SRX2018185 | SRS1614126 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | FUS KO 3 | GSM2277121 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | FUS KO 3 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | GSM2277121 | GSM2277121: FUS KO 3; Danio rerio; RNA Seq | GSM2277121 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277121 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | Sample_imb_ketting_2014_13_FUS_KO_3_R1.fastq.gz Sample_imb_ketting_2014_13_FUS_KO_3_R2.fastq.gz | fastq fastq | 7443582840.0 | 36849420.0 | GSM2277121 r1 | 0:101 1:101 | A:2135476546;C:1584607182;G:1583492766;T:2137210756;N:2795590 | 101 | 101 | 2135476546 | 1584607182 | 1583492766 | 2137210756 | 2795590 | SRX2018185 | SRS1614126 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.91865 | 0.92202 | 0.16917 | 0.16765 | 0.69402 | 0.69424 | 0.49158 | 0.505 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41267 | 41267 | SRR4026149 | SRX2018184 | SRS1614127 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | FUS KO 2 | GSM2277120 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | FUS KO 2 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | GSM2277120 | GSM2277120: FUS KO 2; Danio rerio; RNA Seq | GSM2277120 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277120 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | Sample_imb_ketting_2014_13_FUS_KO_2_R1.fastq.gz Sample_imb_ketting_2014_13_FUS_KO_2_R2.fastq.gz | fastq fastq | 7538568694.0 | 37319647.0 | GSM2277120 r1 | 0:101 1:101 | A:2147431018;C:1618323797;G:1622221747;T:2147775519;N:2816613 | 101 | 101 | 2147431018 | 1618323797 | 1622221747 | 2147775519 | 2816613 | SRX2018184 | SRS1614127 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.92241 | 0.92545 | 0.17277 | 0.17289 | 0.6882 | 0.68878 | 0.50153 | 0.49587 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41268 | 41268 | SRR4026150 | SRX2018184 | SRS1614127 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | FUS KO 2 | GSM2277120 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | FUS KO 2 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | GSM2277120 | GSM2277120: FUS KO 2; Danio rerio; RNA Seq | GSM2277120 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277120 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | FUS_KO_2_R1.fastq.gz FUS_KO_2_R2.fastq.gz | fastq fastq | 6447010386.0 | 31915893.0 | GSM2277120 r2 | 0:101 1:101 | A:1836751010;C:1386222757;G:1379853653;T:1841581040;N:2601926 | 101 | 101 | 1836751010 | 1386222757 | 1379853653 | 1841581040 | 2601926 | SRX2018184 | SRS1614127 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.92533 | 0.92991 | 0.17619 | 0.17625 | 0.69031 | 0.69081 | 0.49983 | 0.50191 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41269 | 41269 | SRR4026148 | SRX2018183 | SRS1614125 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | FUS KO 1 | GSM2277119 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | FUS KO 1 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | GSM2277119 | GSM2277119: FUS KO 1; Danio rerio; RNA Seq | GSM2277119 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277119 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | FUS_KO_1_R1.fastq.gz FUS_KO_1_R2.fastq.gz | fastq fastq | 7395102840.0 | 36609420.0 | GSM2277119 r1 | 0:101 1:101 | A:2103771703;C:1595017984;G:1583980946;T:2109307704;N:3024503 | 101 | 101 | 2103771703 | 1595017984 | 1583980946 | 2109307704 | 3024503 | SRX2018183 | SRS1614125 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.9246 | 0.92781 | 0.17577 | 0.17518 | 0.69116 | 0.69232 | 0.50228 | 0.49896 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41270 | 41270 | SRR4026146 | SRX2018182 | SRS1614123 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | WT 6 | GSM2277118 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | WT 6 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | GSM2277118 | GSM2277118: WT 6; Danio rerio; RNA Seq | GSM2277118 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277118 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | Sample_imb_ketting_2014_13_WT_6_R1.fastq.gz Sample_imb_ketting_2014_13_WT_6_R2.fastq.gz | fastq fastq | 8334635544.0 | 41260572.0 | GSM2277118 r1 | 0:101 1:101 | A:2382306534;C:1783081151;G:1778919442;T:2387251408;N:3077009 | 101 | 101 | 2382306534 | 1783081151 | 1778919442 | 2387251408 | 3077009 | SRX2018182 | SRS1614123 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.91647 | 0.9192 | 0.1793 | 0.17873 | 0.69215 | 0.69262 | 0.50463 | 0.50038 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41271 | 41271 | SRR4026147 | SRX2018182 | SRS1614123 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | WT 6 | GSM2277118 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | WT 6 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | GSM2277118 | GSM2277118: WT 6; Danio rerio; RNA Seq | GSM2277118 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277118 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | WT_6_R1.fastq.gz WT_6_R2.fastq.gz | fastq fastq | 7239861396.0 | 35840898.0 | GSM2277118 r2 | 0:101 1:101 | A:1993396411;C:1626521001;G:1620190105;T:1996794482;N:2959397 | 101 | 101 | 1993396411 | 1626521001 | 1620190105 | 1996794482 | 2959397 | SRX2018182 | SRS1614123 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.93444 | 0.93758 | 0.15305 | 0.15223 | 0.68781 | 0.6885 | 0.5083 | 0.50745 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41272 | 41272 | SRR4026144 | SRX2018181 | SRS1614122 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | WT 4 | GSM2277117 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | WT 4 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | GSM2277117 | GSM2277117: WT 4; Danio rerio; RNA Seq | GSM2277117 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277117 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | Sample_imb_ketting_2014_13_WT_4_R1.fastq.gz Sample_imb_ketting_2014_13_WT_4_R2.fastq.gz | fastq fastq | 7425010556.0 | 36757478.0 | GSM2277117 r1 | 0:101 1:101 | A:2145596358;C:1565455511;G:1562345442;T:2148814299;N:2798946 | 101 | 101 | 2145596358 | 1565455511 | 1562345442 | 2148814299 | 2798946 | SRX2018181 | SRS1614122 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.91897 | 0.92157 | 0.17645 | 0.17633 | 0.6981 | 0.69948 | 0.51038 | 0.50544 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41273 | 41273 | SRR4026145 | SRX2018181 | SRS1614122 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | WT 4 | GSM2277117 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | WT 4 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | GSM2277117 | GSM2277117: WT 4; Danio rerio; RNA Seq | GSM2277117 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277117 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | WT_4_R1.fastq.gz WT_4_R2.fastq.gz | fastq fastq | 6322186910.0 | 31297955.0 | GSM2277117 r2 | 0:101 1:101 | A:1808695425;C:1352265448;G:1346884156;T:1811742728;N:2599153 | 101 | 101 | 1808695425 | 1352265448 | 1346884156 | 1811742728 | 2599153 | SRX2018181 | SRS1614122 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.927 | 0.92959 | 0.17323 | 0.17284 | 0.69562 | 0.69601 | 0.50522 | 0.50634 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41274 | 41274 | SRR4026142 | SRX2018180 | SRS1614124 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | WT 3 | GSM2277116 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | WT 3 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | GSM2277116 | GSM2277116: WT 3; Danio rerio; RNA Seq | GSM2277116 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277116 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | Sample_imb_ketting_2014_13_WT_3_R1.fastq.gz Sample_imb_ketting_2014_13_WT_3_R2.fastq.gz | fastq fastq | 7556697588.0 | 37409394.0 | GSM2277116 r1 | 0:101 1:101 | A:2168554402;C:1607788560;G:1605790339;T:2171752391;N:2811896 | 101 | 101 | 2168554402 | 1607788560 | 1605790339 | 2171752391 | 2811896 | SRX2018180 | SRS1614124 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.91892 | 0.92233 | 0.17858 | 0.17763 | 0.69589 | 0.69674 | 0.50649 | 0.50869 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41275 | 41275 | SRR4026143 | SRX2018180 | SRS1614124 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | WT 3 | GSM2277116 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | WT 3 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | GSM2277116 | GSM2277116: WT 3; Danio rerio; RNA Seq | GSM2277116 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277116 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | WT_3_R1.fastq.gz WT_3_R2.fastq.gz | fastq fastq | 7898912858.0 | 39103529.0 | GSM2277116 r2 | 0:101 1:101 | A:2243356257;C:1706636846;G:1702064968;T:2243634692;N:3220095 | 101 | 101 | 2243356257 | 1706636846 | 1702064968 | 2243634692 | 3220095 | SRX2018180 | SRS1614124 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.92701 | 0.93109 | 0.17113 | 0.17214 | 0.69591 | 0.69716 | 0.50649 | 0.51272 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41276 | 41276 | SRR4026140 | SRX2018179 | SRS1614121 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | WT 1 | GSM2277115 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | WT 1 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | GSM2277115 | GSM2277115: WT 1; Danio rerio; RNA Seq | GSM2277115 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277115 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | Sample_imb_ketting_2014_13_WT_1_R1.fastq.gz Sample_imb_ketting_2014_13_WT_1_R2.fastq.gz | fastq fastq | 7999392910.0 | 39600955.0 | GSM2277115 r1 | 0:101 1:101 | A:2287512350;C:1711532349;G:1705616114;T:2291731604;N:3000493 | 101 | 101 | 2287512350 | 1711532349 | 1705616114 | 2291731604 | 3000493 | SRX2018179 | SRS1614121 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.92291 | 0.92474 | 0.16701 | 0.16646 | 0.698 | 0.69814 | 0.51025 | 0.51024 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41277 | 41277 | SRR4026141 | SRX2018179 | SRS1614121 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | WT 1 | GSM2277115 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | WT 1 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | GSM2277115 | GSM2277115: WT 1; Danio rerio; RNA Seq | GSM2277115 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277115 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | WT_1_R1.fastq.gz WT_1_R2.fastq.gz | fastq fastq | 6187101026.0 | 30629213.0 | GSM2277115 r2 | 0:101 1:101 | A:1757769151;C:1333826875;G:1336928364;T:1756068161;N:2508475 | 101 | 101 | 1757769151 | 1333826875 | 1336928364 | 1756068161 | 2508475 | SRX2018179 | SRS1614121 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.9294 | 0.9334 | 0.16402 | 0.16355 | 0.69682 | 0.69741 | 0.49912 | 0.50428 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 49577 | 49577 | SRR7947926 | SRX4781875 | SRS3862067 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | elavl1a morphant 6h rna seq rep2 | GSM3409399 | source name:elavl1a morphant 6h rna seq rep2|strain:AB|tissue:zebrafish embryos|genotype/variation:elavl1a morphants zebrafish embryos cells|age:6hpf | elavl1a morphant 6h rna seq rep2 | trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | elavl1a morphant 6h rna seq rep2 | For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain:AB|tissue:zebrafish embryos|genotype/variation:elavl1a morphants zebrafish embryos cells|age:6hpf | GSM3409399 | GSM3409399: elavl1a morphant 6h rna seq rep2; Danio rerio; RNA Seq | GSM3409399 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM3409399 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | HiSeq X Ten | SRP163087 | elavl1a_morphant_6h_rna-seq_rep2.R1.fastq.gz elavl1a_morphant_6h_rna-seq_rep2.R2.fastq.gz | fastq fastq | 19875464400.0 | 66251548.0 | GSM3409399 r1 | 0:150 1:150 | A:5352630990;C:4584661408;G:4726300804;T:5209787586;N:2083612 | 150 | 150 | 5352630990 | 4584661408 | 4726300804 | 5209787586 | 2083612 | SRX4781875 | SRS3862067 | SRA787572 | GEO | Life Science, Tsinghua University | 2 | 0.94901 | 0.95039 | 0.09074 | 0.08943 | 0.75866 | 0.76418 | 0.55609 | 0.56574 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2018-10-01 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||
| 49578 | 49578 | SRR7947925 | SRX4781874 | SRS3862066 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | elavl1a morphant 6h rna seq rep1 | GSM3409398 | source name:elavl1a morphant 6h rna seq rep1|strain:AB|tissue:zebrafish embryos|genotype/variation:elavl1a morphants zebrafish embryos cells|age:6hpf | elavl1a morphant 6h rna seq rep1 | trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | elavl1a morphant 6h rna seq rep1 | For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain:AB|tissue:zebrafish embryos|genotype/variation:elavl1a morphants zebrafish embryos cells|age:6hpf | GSM3409398 | GSM3409398: elavl1a morphant 6h rna seq rep1; Danio rerio; RNA Seq | GSM3409398 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM3409398 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | HiSeq X Ten | SRP163087 | elavl1a_morphant_6h_rna-seq_rep1.R2.fastq.gz elavl1a_morphant_6h_rna-seq_rep1.R1.fastq.gz | fastq fastq | 20202214200.0 | 67340714.0 | GSM3409398 r1 | 0:150 1:150 | A:5439747248;C:4667041902;G:4805911969;T:5287977733;N:1535348 | 150 | 150 | 5439747248 | 4667041902 | 4805911969 | 5287977733 | 1535348 | SRX4781874 | SRS3862066 | SRA787572 | GEO | Life Science, Tsinghua University | 2 | 0.94586 | 0.94757 | 0.09031 | 0.09016 | 0.76019 | 0.76493 | 0.55951 | 0.56185 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2018-10-01 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||
| 49579 | 49579 | SRR7947924 | SRX4781873 | SRS3862065 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | elavl1a morphant 4h rna seq rep2 | GSM3409397 | source name:elavl1a morphant 4h rna seq rep2|strain:AB|tissue:zebrafish embryos|genotype/variation:elavl1a morphants zebrafish embryos cells|age:4hpf | elavl1a morphant 4h rna seq rep2 | trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | elavl1a morphant 4h rna seq rep2 | For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain:AB|tissue:zebrafish embryos|genotype/variation:elavl1a morphants zebrafish embryos cells|age:4hpf | GSM3409397 | GSM3409397: elavl1a morphant 4h rna seq rep2; Danio rerio; RNA Seq | GSM3409397 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM3409397 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | HiSeq X Ten | SRP163087 | elavl1a_morphant_4h_rna-seq_rep2.R2.fastq.gz elavl1a_morphant_4h_rna-seq_rep2.R1.fastq.gz | fastq fastq | 38764196400.0 | 129213988.0 | GSM3409397 r1 | 0:150 1:150 | A:10980499317;C:8394995318;G:8739322914;T:10645637187;N:3741664 | 150 | 150 | 10980499317 | 8394995318 | 8739322914 | 10645637187 | 3741664 | SRX4781873 | SRS3862065 | SRA787572 | GEO | Life Science, Tsinghua University | 2 | 0.94567 | 0.94509 | 0.06713 | 0.06614 | 0.76191 | 0.76508 | 0.73283 | 0.74007 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2018-10-01 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||
| 49580 | 49580 | SRR7947923 | SRX4781872 | SRS3862064 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | elavl1a morphant 4h rna seq rep1 | GSM3409396 | source name:elavl1a morphant 4h rna seq rep1|strain:AB|tissue:zebrafish embryos|genotype/variation:elavl1a morphants zebrafish embryos cells|age:4hpf | elavl1a morphant 4h rna seq rep1 | trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | elavl1a morphant 4h rna seq rep1 | For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain:AB|tissue:zebrafish embryos|genotype/variation:elavl1a morphants zebrafish embryos cells|age:4hpf | GSM3409396 | GSM3409396: elavl1a morphant 4h rna seq rep1; Danio rerio; RNA Seq | GSM3409396 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM3409396 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | HiSeq X Ten | SRP163087 | elavl1a_morphant_4h_rna-seq_rep1.R1.fastq.gz elavl1a_morphant_4h_rna-seq_rep1.R2.fastq.gz | fastq fastq | 34417602600.0 | 114725342.0 | GSM3409396 r1 | 0:150 1:150 | A:9798364920;C:7402367067;G:7677976380;T:9534399996;N:4494237 | 150 | 150 | 9798364920 | 7402367067 | 7677976380 | 9534399996 | 4494237 | SRX4781872 | SRS3862064 | SRA787572 | GEO | Life Science, Tsinghua University | 2 | 0.94663 | 0.94701 | 0.06442 | 0.06367 | 0.76264 | 0.7655 | 0.73483 | 0.74221 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2018-10-01 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||
| 49581 | 49581 | SRR7947922 | SRX4781871 | SRS3862063 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | control 6h rna seq rep2 | GSM3409395 | source name:control 6h rna seq rep2|strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:6hpf | control 6h rna seq rep2 | trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | control 6h rna seq rep2 | For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:6hpf | GSM3409395 | GSM3409395: control 6h rna seq rep2; Danio rerio; RNA Seq | GSM3409395 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM3409395 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | HiSeq X Ten | SRP163087 | control_6h_rna-seq_rep2.R1.fastq.gz control_6h_rna-seq_rep2.R2.fastq.gz | fastq fastq | 39198242400.0 | 130660808.0 | GSM3409395 r1 | 0:150 1:150 | A:11268897172;C:8355243125;G:8663182840;T:10907160510;N:3758753 | 150 | 150 | 11268897172 | 8355243125 | 8663182840 | 10907160510 | 3758753 | SRX4781871 | SRS3862063 | SRA787572 | GEO | Life Science, Tsinghua University | 2 | 0.94553 | 0.94591 | 0.09312 | 0.09248 | 0.78098 | 0.78397 | 0.73432 | 0.73781 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2018-10-01 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||
| 49582 | 49582 | SRR7947921 | SRX4781870 | SRS3862062 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | control 6h rna seq rep1 | GSM3409394 | source name:control 6h rna seq rep1|strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:6hpf | control 6h rna seq rep1 | trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | control 6h rna seq rep1 | For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:6hpf | GSM3409394 | GSM3409394: control 6h rna seq rep1; Danio rerio; RNA Seq | GSM3409394 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM3409394 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | HiSeq X Ten | SRP163087 | control_6h_rna-seq_rep1.R1.fastq.gz control_6h_rna-seq_rep1.R2.fastq.gz | fastq fastq | 49781358600.0 | 165937862.0 | GSM3409394 r1 | 0:150 1:150 | A:14340306167;C:10572507738;G:11006666686;T:13855405563;N:6472446 | 150 | 150 | 14340306167 | 10572507738 | 11006666686 | 13855405563 | 6472446 | SRX4781870 | SRS3862062 | SRA787572 | GEO | Life Science, Tsinghua University | 2 | 0.94466 | 0.94506 | 0.09485 | 0.09402 | 0.77782 | 0.78303 | 0.72367 | 0.72791 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2018-10-01 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||
| 49583 | 49583 | SRR7947920 | SRX4781869 | SRS3862061 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | control 4h rna seq rep2 | GSM3409393 | source name:control 4h rna seq rep2|strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:4hpf | control 4h rna seq rep2 | trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | control 4h rna seq rep2 | For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:4hpf | GSM3409393 | GSM3409393: control 4h rna seq rep2; Danio rerio; RNA Seq | GSM3409393 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM3409393 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | HiSeq X Ten | SRP163087 | control_4h_rna-seq_rep2.R1.fastq.gz control_4h_rna-seq_rep2.R2.fastq.gz | fastq fastq | 33462197400.0 | 111540658.0 | GSM3409393 r1 | 0:150 1:150 | A:9246596683;C:7497270682;G:7798285753;T:8916810951;N:3233331 | 150 | 150 | 9246596683 | 7497270682 | 7798285753 | 8916810951 | 3233331 | SRX4781869 | SRS3862061 | SRA787572 | GEO | Life Science, Tsinghua University | 2 | 0.94792 | 0.94861 | 0.0862 | 0.08529 | 0.76084 | 0.76309 | 0.73536 | 0.73703 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2018-10-01 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||
| 49584 | 49584 | SRR7947919 | SRX4781868 | SRS3862060 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | control 4h rna seq rep1 | GSM3409392 | source name:control 4h rna seq rep1|strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:4hpf | control 4h rna seq rep1 | trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | control 4h rna seq rep1 | For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:4hpf | GSM3409392 | GSM3409392: control 4h rna seq rep1; Danio rerio; RNA Seq | GSM3409392 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM3409392 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | HiSeq X Ten | SRP163087 | control_4h_rna-seq_rep1.R1.fastq.gz control_4h_rna-seq_rep1.R2.fastq.gz | fastq fastq | 38719753500.0 | 129065845.0 | GSM3409392 r1 | 0:150 1:150 | A:10763970685;C:8606443742;G:8961006857;T:10383272808;N:5059408 | 150 | 150 | 10763970685 | 8606443742 | 8961006857 | 10383272808 | 5059408 | SRX4781868 | SRS3862060 | SRA787572 | GEO | Life Science, Tsinghua University | 2 | 0.94748 | 0.948 | 0.08608 | 0.08505 | 0.76023 | 0.76357 | 0.72873 | 0.73242 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2018-10-01 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||
| 49585 | 49585 | SRR7947918 | SRX4781867 | SRS3862059 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | control 2h rna seq rep2 | GSM3409391 | source name:control 2h rna seq rep2|strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:2hpf | control 2h rna seq rep2 | trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | control 2h rna seq rep2 | For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:2hpf | GSM3409391 | GSM3409391: control 2h rna seq rep2; Danio rerio; RNA Seq | GSM3409391 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM3409391 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | HiSeq X Ten | SRP163087 | control_2h_rna-seq_rep2.R1.fastq.gz control_2h_rna-seq_rep2.R2.fastq.gz | fastq fastq | 39017750100.0 | 130059167.0 | GSM3409391 r1 | 0:150 1:150 | A:10979134932;C:8549683633;G:8854910977;T:10629254366;N:4766192 | 150 | 150 | 10979134932 | 8549683633 | 8854910977 | 10629254366 | 4766192 | SRX4781867 | SRS3862059 | SRA787572 | GEO | Life Science, Tsinghua University | 2 | 0.94685 | 0.94869 | 0.03416 | 0.03311 | 0.76536 | 0.76731 | 0.65079 | 0.65387 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2018-10-01 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||
| 49586 | 49586 | SRR7947917 | SRX4781866 | SRS3862058 | SRP163087 | PRJNA494251 | Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis | GSE120724 | Other | We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates. | pubmed:32423473 | control 2h rna seq rep1 | GSM3409390 | source name:control 2h rna seq rep1|strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:2hpf | control 2h rna seq rep1 | trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM. | control 2h rna seq rep1 | For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol. | Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions. | strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:2hpf | GSM3409390 | GSM3409390: control 2h rna seq rep1; Danio rerio; RNA Seq | GSM3409390 | 1 | The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq, Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol. | GEO Accession:GSM3409390 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | HiSeq X Ten | SRP163087 | control_2h_rna-seq_rep1.R1.fastq.gz control_2h_rna-seq_rep1.R2.fastq.gz | fastq fastq | 33999089400.0 | 113330298.0 | GSM3409390 r1 | 0:150 1:150 | A:9602786363;C:7418727808;G:7667052932;T:9305137704;N:5384593 | 150 | 150 | 9602786363 | 7418727808 | 7667052932 | 9305137704 | 5384593 | SRX4781866 | SRS3862058 | SRA787572 | GEO | Life Science, Tsinghua University | 2 | 0.94874 | 0.95121 | 0.03388 | 0.03264 | 0.76524 | 0.76662 | 0.65127 | 0.65427 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | unknown | bulk | clip | iclip | China | 2018-10-01 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures |
Advanced export
JSON shape: default, array, newline-delimited
CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;