run_metadata
71 rows where experiment.library_selection = "size fractionation" and tissue_curation = "Gonad"
This data as json, CSV (advanced)
| Link | rowid ▼ | run.accession | experiment.accession | sample.accession | study.accession | bioproject | study.title | study.alias | study.type | study.abstract | study.attributes | study.PMIDs | sample.description | sample.title | sample.alias | sample.centername | sample.attributes | GEOsample.title | GEOsample.dataprocessing | GEOsample.source | GEOsample.treatmentprotocol | GEOsample.extractprotocol | GEOsample.growthprotocol | GEOsample.characteristics | GEOsample.accession | experiment.title | experiment.alias | experiment.library_name | experiment.design_description | experiment.library_construction_protocol | experiment.attributes | experiment.library_strategy | experiment.library_source | experiment.library_selection | experiment.library_layout | experiment.platform | experiment.instrument_model | experiment.spot_descriptor | experiment.study_ref | run.title | run.attributes | run.filename | run.semantic_name | run.total_bases | run.total_spots | run.alias | run.read_lengths | run.base_counts | run.r1_length | run.r2_length | run.r3_length | run.r4_length | run.Acount | run.Ccount | run.Gcount | run.Tcount | run.Ncount | run.experiment | run.pool_member | submission.accession | submission.srasource | submission.bioprojectsource | seqdetective.n_mates | seqdetective.mapping_rate.mate1 | seqdetective.mapping_rate.mate2 | seqdetective.nofeature_rate.mate1 | seqdetective.nofeature_rate.mate2 | seqdetective.sparsity.mate1 | seqdetective.sparsity.mate2 | seqdetective.pos_strand_rate.mate1 | seqdetective.pos_strand_rate.mate2 | seqdetective.readlen.mate1 | seqdetective.readlen.mate2 | seqdetective.judgement.mate1 | seqdetective.judgement.mate2 | seqdetective.judgement.reason | platform_family | instrument_generation | read_bias | selection_class | prep_kit | sc_or_bulk | tech_class | technology | tech_variant | submission.bioprojectsource.country | earliest_date | devstage_curation | devstage_curation_coarse | tissue_curation | tissue_curation_coarse |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 29746 | 29746 | SRR27467679 | SRX23139227 | SRS20090270 | SRP482074 | PRJNA1061456 | tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development | PRJNA1061456 | Other | ovary BS R2 | strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:adult|collection date:2022|geo loc name:Austria|sex:female|tissue:ovary|treatment:BS|BioSampleModel:Model organism or animal | tRAM seq of zebrafish: ovary BS rep2 | EV02003 | EV02003 | RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers. | OTHER | TRANSCRIPTOMIC | size fractionation | PAIRED | ILLUMINA | NextSeq 500 | SRP482074 | EV02003.R1.fastq.gz EV02003.R2.fastq.gz | fastq fastq | 1031891720.0 | 3416860.0 | EV02003.R1.fastq.gz | 0:151 1:151 | A:264464363;C:153440613;G:408557241;T:205367487;N:62016 | 151 | 151 | 264464363 | 153440613 | 408557241 | 205367487 | 62016 | SRX23139227 | SRS20090270 | SRA1781872 | Medical University of Vienna|Cell and Developmental Biology | Medical University of Vienna | 2 | 0.0 | 0.00019 | 0.0 | 0.00015 | 1.0 | 0.99993 | 1.0 | 151 | 151 | T | T | mates < 9% mapping rate | illumina | nextseq | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Austria | 2024-01-09 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||||||
| 29755 | 29755 | SRR27467688 | SRX23139218 | SRS20090261 | SRP482074 | PRJNA1061456 | tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development | PRJNA1061456 | Other | ovary DM R2 | strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:adult|collection date:2022|geo loc name:Austria|sex:female|tissue:ovary|treatment:DM|BioSampleModel:Model organism or animal | tRAM seq of zebrafish: ovary DM rep2 | EV02002 | EV02002 | RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers. | OTHER | TRANSCRIPTOMIC | size fractionation | PAIRED | ILLUMINA | NextSeq 500 | SRP482074 | EV02002.R1.fastq.gz EV02002.R2.fastq.gz | fastq fastq | 861320308.0 | 2852054.0 | EV02002.R1.fastq.gz | 0:151 1:151 | A:205625519;C:162178974;G:334206312;T:159256900;N:52603 | 151 | 151 | 205625519 | 162178974 | 334206312 | 159256900 | 52603 | SRX23139218 | SRS20090261 | SRA1781872 | Medical University of Vienna|Cell and Developmental Biology | Medical University of Vienna | 2 | 2e-05 | 0.00049 | 0.0 | 0.00027 | 1.0 | 0.99947 | 0.44444 | 151 | 151 | T | T | mates < 9% mapping rate | illumina | nextseq | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Austria | 2024-01-09 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||||||
| 29756 | 29756 | SRR27467689 | SRX23139217 | SRS20090260 | SRP482074 | PRJNA1061456 | tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development | PRJNA1061456 | Other | ovary mock R2 | strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:adult|collection date:2022|geo loc name:Austria|sex:female|tissue:ovary|treatment:mock|BioSampleModel:Model organism or animal | tRAM seq of zebrafish: ovary mock rep2 | EV02001 | EV02001 | RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers. | OTHER | TRANSCRIPTOMIC | size fractionation | PAIRED | ILLUMINA | NextSeq 500 | SRP482074 | EV02001.R1.fastq.gz EV02001.R2.fastq.gz | fastq fastq | 520371066.0 | 1723083.0 | EV02001.R1.fastq.gz | 0:151 1:151 | A:116107273;C:90896560;G:218652568;T:94682244;N:32421 | 151 | 151 | 116107273 | 90896560 | 218652568 | 94682244 | 32421 | SRX23139217 | SRS20090260 | SRA1781872 | Medical University of Vienna|Cell and Developmental Biology | Medical University of Vienna | 2 | 2e-05 | 0.00086 | 0.0 | 0.00078 | 0.99995 | 0.99981 | 0.0 | 0.61538 | 151 | 151 | T | T | mates < 9% mapping rate | illumina | nextseq | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Austria | 2024-01-09 | Adult | Adult | Gonad | Reproductive System | ||||||||||||||||||||||
| 29765 | 29765 | SRR27437485 | SRX23109812 | SRS20064566 | SRP482074 | PRJNA1061456 | tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development | PRJNA1061456 | Other | ovary BS R3 | strain:TLAB fish|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|dev stage:adult|collection date:2022|geo loc name:Austria|sex:female|tissue:ovary|treatment:BS|BioSampleModel:Model organism or animal | tRAM seq of zebrafish: ovary BS rep3 | EV04017 | EV04017 | RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers. | OTHER | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 500 | SRP482074 | EV04017.R1.fastq.gz | fastq | 576584540.0 | 4118461.0 | EV04017.R1.fastq.gz | 0:140 | A:149516980;C:91163801;G:169046762;T:166831111;N:25886 | 140 | 149516980 | 91163801 | 169046762 | 166831111 | 25886 | SRX23109812 | SRS20064566 | SRA1780298 | Medical University of Vienna|Cell and Developmental Biology | Medical University of Vienna | 1 | 0.0 | 0.0 | 1.0 | 140 | T | under 1.2% mapping rate | illumina | nextseq | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Austria | 2024-01-06 | Adult | Adult | Gonad | Reproductive System | ||||||||||||||||||||||||||||||
| 29776 | 29776 | SRR27437496 | SRX23109801 | SRS20064555 | SRP482074 | PRJNA1061456 | tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development | PRJNA1061456 | Other | ovary DM R3 | strain:TLAB fish|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|dev stage:adult|collection date:2022|geo loc name:Austria|sex:female|tissue:ovary|treatment:DM|BioSampleModel:Model organism or animal | tRAM seq of zebrafish: ovary DM rep3 | EV04016 | EV04016 | RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers. | OTHER | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 500 | SRP482074 | EV04016.R1.fastq.gz | fastq | 635752880.0 | 4541092.0 | EV04016.R1.fastq.gz | 0:140 | A:160072248;C:143996869;G:189137330;T:142516059;N:30374 | 140 | 160072248 | 143996869 | 189137330 | 142516059 | 30374 | SRX23109801 | SRS20064555 | SRA1780298 | Medical University of Vienna|Cell and Developmental Biology | Medical University of Vienna | 1 | 1e-05 | 0.0 | 0.99997 | 1.0 | 140 | T | under 1.2% mapping rate | illumina | nextseq | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Austria | 2024-01-06 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||||||||||||
| 29777 | 29777 | SRR27437497 | SRX23109800 | SRS20064554 | SRP482074 | PRJNA1061456 | tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development | PRJNA1061456 | Other | ovary mock R3 | strain:TLAB fish|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|dev stage:adult|collection date:2022|geo loc name:Austria|sex:female|tissue:ovary|treatment:mock|BioSampleModel:Model organism or animal | tRAM seq of zebrafish: ovary mock rep3 | EV04015 | EV04015 | RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers. | OTHER | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 500 | SRP482074 | EV04015.R1.fastq.gz | fastq | 489700680.0 | 3497862.0 | EV04015.R1.fastq.gz | 0:140 | A:126641754;C:126582886;G:130564204;T:105889815;N:22021 | 140 | 126641754 | 126582886 | 130564204 | 105889815 | 22021 | SRX23109800 | SRS20064554 | SRA1780298 | Medical University of Vienna|Cell and Developmental Biology | Medical University of Vienna | 1 | 6e-05 | 0.0 | 0.99983 | 0.55555 | 140 | T | under 1.2% mapping rate | illumina | nextseq | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Austria | 2024-01-06 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||||||||||||
| 29786 | 29786 | SRR27435871 | SRX23108225 | SRS20063062 | SRP482074 | PRJNA1061456 | tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development | PRJNA1061456 | Other | ovary BS R4 | strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:adult|collection date:2022|geo loc name:Austria|sex:female|tissue:ovary|treatment:BS|BioSampleModel:Model organism or animal | tRAM seq of zebrafish: ovary BS rep4 | EV08003 | EV08003 | RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers. | OTHER | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 500 | SRP482074 | EV08003.R1.fastq.gz | fastq | 571689580.0 | 4083497.0 | EV08003.R1.fastq.gz | 0:140 | A:141414131;C:88722455;G:138790445;T:202723075;N:39474 | 140 | 141414131 | 88722455 | 138790445 | 202723075 | 39474 | SRX23108225 | SRS20063062 | SRA1780265 | Medical University of Vienna|Cell and Developmental Biology | Medical University of Vienna | 1 | 3e-05 | 0.0 | 0.99991 | 0.75 | 140 | T | under 1.2% mapping rate | illumina | nextseq | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Austria | 2024-01-05 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||||||||||||
| 29797 | 29797 | SRR27435882 | SRX23108214 | SRS20063050 | SRP482074 | PRJNA1061456 | tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development | PRJNA1061456 | Other | ovary DM R4 | strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:adult|collection date:2022|geo loc name:Austria|sex:female|tissue:ovary|treatment:DM|BioSampleModel:Model organism or animal | tRAM seq of zebrafish: ovary DM rep4 | EV08002 | EV08002 | RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers. | OTHER | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 500 | SRP482074 | EV08002.R1.fastq.gz | fastq | 668593800.0 | 4775670.0 | EV08002.R1.fastq.gz | 0:140 | A:164584224;C:175789134;G:175538168;T:152637106;N:45168 | 140 | 164584224 | 175789134 | 175538168 | 152637106 | 45168 | SRX23108214 | SRS20063050 | SRA1780265 | Medical University of Vienna|Cell and Developmental Biology | Medical University of Vienna | 1 | 0.00525 | 2e-05 | 0.99192 | 0.63501 | 140 | T | under 1.2% mapping rate | illumina | nextseq | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Austria | 2024-01-05 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||||||||||||
| 29798 | 29798 | SRR27435883 | SRX23108213 | SRS20063051 | SRP482074 | PRJNA1061456 | tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development | PRJNA1061456 | Other | ovary mock R4 | strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:adult|collection date:2022|geo loc name:Austria|sex:female|tissue:ovary|treatment:mock|BioSampleModel:Model organism or animal | tRAM seq of zebrafish: ovary mock rep4 | EV08001 | EV08001 | RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers. | OTHER | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 500 | SRP482074 | EV08001.R1.fastq.gz | fastq | 753247460.0 | 5380339.0 | EV08001.R1.fastq.gz | 0:140 | A:183862675;C:196453674;G:197604061;T:175275086;N:51964 | 140 | 183862675 | 196453674 | 197604061 | 175275086 | 51964 | SRX23108213 | SRS20063051 | SRA1780265 | Medical University of Vienna|Cell and Developmental Biology | Medical University of Vienna | 1 | 0.00754 | 4e-05 | 0.98957 | 0.51048 | 140 | T | under 1.2% mapping rate | illumina | nextseq | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Austria | 2024-01-05 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||||||||||||
| 36273 | 36273 | SRR298566 | SRX079844 | SRS212650 | SRP007331 | PRJNA141525 | Tdrd1 acts as a molecular scaffold for Piwi proteins and piRNA targets in zebrafish. | GSE29418 | Transcriptome Analysis | RNA libraries from immunoprecipitates of Tdrd1 Ziwi and Zili total testis RNA total RNA from 3 wpf wild type and tdrd1 mutant gonads. Overall design: Both size selected and non size selected libraries were made. Sequencing was performed using Illumina platform. | pubmed:21743441 | WTTESTIS | GSM727523 | tissue:adult testis extract|strain:TL | WTTESTIS | three prime adapter sequences were trimmed and inserts longer than 18 nt were mapped to the D. rerio genome Zv9. | adult testis extract | Tissue was homogenized in trizol and total RNA was isolated. RNAs ranging from 18 35 nucleotides were size selected from gel. For cDNA synthesis the RNA molecules in the immunoprecipitated fraction were first poly A tailed using polyApolymerase followed by ligation of synthetic RNA adapter to the five prime phosphate. First strand cDNA synthesis was then performed using an oligodT linker primer and M MLVRNase H reverse transcriptase. cDNA was PCR amplified with adapter specific primers and used in Illumina sequencing. | strain:TL | GSM727523 | GSM727523: WTTESTIS | GSM727523: WTTESTIS | GSM727523: WTTESTIS | 1 | GEO Accession:GSM727523 | RNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina Genome Analyzer II | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>36</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP007331 | read name barcode proc directive:ignore | WTTESTIS.fastq | fastq | 732997980.0 | 20361055.0 | GSM727523 1 | 0:36 | 36 | SRX079844 | SRS212650 | SRA039167 | GEO | European Research Institute for the Biology of Ageing, University Medical Center Groningen | 1 | 0.08155 | 0.07176 | 0.97851 | 0.52359 | 36 | B | usable mapping rate | illumina | early_illumina | unknown | size_fractionation | unknown | bulk | unknown | unknown | Netherlands | 2011-05-20 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||||||
| 36274 | 36274 | SRR298565 | SRX079843 | SRS212649 | SRP007331 | PRJNA141525 | Tdrd1 acts as a molecular scaffold for Piwi proteins and piRNA targets in zebrafish. | GSE29418 | Transcriptome Analysis | RNA libraries from immunoprecipitates of Tdrd1 Ziwi and Zili total testis RNA total RNA from 3 wpf wild type and tdrd1 mutant gonads. Overall design: Both size selected and non size selected libraries were made. Sequencing was performed using Illumina platform. | pubmed:21743441 | WT3WK | GSM727522 | tissue:3 wpf whole gonads|strain:TL | WT3WK | three prime adapter sequences were trimmed and inserts longer than 18 nt were mapped to the D. rerio genome Zv9. | 3 wpf whole gonads | Tissue was homogenized in trizol and total RNA was isolated. RNAs ranging from 18 35 nucleotides were size selected from gel. For cDNA synthesis the RNA molecules in the immunoprecipitated fraction were first poly A tailed using polyApolymerase followed by ligation of synthetic RNA adapter to the five prime phosphate. First strand cDNA synthesis was then performed using an oligodT linker primer and M MLVRNase H reverse transcriptase. cDNA was PCR amplified with adapter specific primers and used in Illumina sequencing. | strain:TL | GSM727522 | GSM727522: WT3WK | GSM727522: WT3WK | GSM727522: WT3WK | 1 | GEO Accession:GSM727522 | RNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina Genome Analyzer II | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>36</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP007331 | read name barcode proc directive:ignore | WT3WK.fastq | fastq | 365473116.0 | 10152031.0 | GSM727522 1 | 0:36 | 36 | SRX079843 | SRS212649 | SRA039167 | GEO | European Research Institute for the Biology of Ageing, University Medical Center Groningen | 1 | 0.09055 | 0.0603 | 0.97798 | 0.44571 | 36 | B | usable mapping rate | illumina | early_illumina | unknown | size_fractionation | unknown | bulk | unknown | unknown | Netherlands | 2011-05-20 | Larval | Larval | Gonad | Reproductive System | |||||||||||||||||||||||
| 36275 | 36275 | SRR298564 | SRX079842 | SRS212648 | SRP007331 | PRJNA141525 | Tdrd1 acts as a molecular scaffold for Piwi proteins and piRNA targets in zebrafish. | GSE29418 | Transcriptome Analysis | RNA libraries from immunoprecipitates of Tdrd1 Ziwi and Zili total testis RNA total RNA from 3 wpf wild type and tdrd1 mutant gonads. Overall design: Both size selected and non size selected libraries were made. Sequencing was performed using Illumina platform. | pubmed:21743441 | TDRD1WK3 | GSM727521 | tissue:3 wpf tdrd1 mutant gonads|strain:TL | TDRD1WK3 | three prime adapter sequences were trimmed and inserts longer than 18 nt were mapped to the D. rerio genome Zv9. | 3 wpf tdrd1 mutant gonads | Tissue was homogenized in trizol and total RNA was isolated. RNAs ranging from 18 35 nucleotides were size selected from gel. For cDNA synthesis the RNA molecules in the immunoprecipitated fraction were first poly A tailed using polyApolymerase followed by ligation of synthetic RNA adapter to the five prime phosphate. First strand cDNA synthesis was then performed using an oligodT linker primer and M MLVRNase H reverse transcriptase. cDNA was PCR amplified with adapter specific primers and used in Illumina sequencing. | strain:TL | GSM727521 | GSM727521: TDRD1WK3 | GSM727521: TDRD1WK3 | GSM727521: TDRD1WK3 | 1 | GEO Accession:GSM727521 | RNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina Genome Analyzer II | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>36</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP007331 | read name barcode proc directive:ignore | TDRD1WK3.fastq | fastq | 369931536.0 | 10275876.0 | GSM727521 1 | 0:36 | 36 | SRX079842 | SRS212648 | SRA039167 | GEO | European Research Institute for the Biology of Ageing, University Medical Center Groningen | 1 | 0.08303 | 0.04674 | 0.97938 | 0.35673 | 36 | B | usable mapping rate | illumina | early_illumina | unknown | size_fractionation | unknown | bulk | unknown | unknown | Netherlands | 2011-05-20 | Larval | Larval | Gonad | Reproductive System | |||||||||||||||||||||||
| 36514 | 36514 | SRR578923 | SRX190981 | SRS366702 | SRP015982 | PRJNA176481 | Small RNA analysis of Tu And SJD zebrafish strain and their progeny | GSE41299 | Transcriptome Analysis | Small RNA libraries from total RNA isolated from adult ovaries Overall design: Small RNA libraries were derived from Ovaries of the Founder strain and their offspring and their reciprocal offspring. RNA from 5 individual ovaries was pooled . | pubmed:23335638 | SJD male | GSM1014087 | source name:Testes|sex:male|strain:SJD|development stage:Adult|tissue:Testes | SJD male | Barcode splitting and adapter trimming performed using custom scripts. Barcode is the first 4 bases of the reads except for libraries Tu Male Tu P0 SJD Male SJD P0 SJDxTuF1 TuxSJDF1 TuxSJDF2 and SJDxTuF2 which do not have a barcode. three prime adapter seqeunce starts with 'TCGTATG'. Reads were mapped to D.rerio genome assembly using megablast software. Genome build: Zv9 Supplementary files format and content: Text file with read counts | Testes | Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. five prime and three prime adaptors were ligated. RNA was not treated with any enzymes before ligation steps. | Animals were grown under standard conditioni | gender:male|strain:SJD|developmental stage:Adult|tissue:Testes | GSM1014087 | GSM1014087: SJD male; Danio rerio; RNA Seq | GSM1014087 1 | 1 | GEO Accession:GSM1014087 | RNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina Genome Analyzer IIx | SRP015982 | SJD_Male.fastq | fastq | 869956128.0 | 24165448.0 | GSM1014087 r1 | 0:36 | A:216078167;C:187750746;G:231408128;T:234642875;N:76212 | 36 | 216078167 | 187750746 | 231408128 | 234642875 | 76212 | SRX190981 | SRS366702 | SRA059229 | GEO | European Research Institute for the Biology of Ageing, University Medical Center Groningen | 1 | 0.27444 | 0.19385 | 0.92478 | 0.49214 | 36 | B | usable mapping rate | illumina | early_illumina | unknown | size_fractionation | unknown | bulk | unknown | unknown | Netherlands | 2012-10-03 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||
| 36515 | 36515 | SRR578922 | SRX190980 | SRS366701 | SRP015982 | PRJNA176481 | Small RNA analysis of Tu And SJD zebrafish strain and their progeny | GSE41299 | Transcriptome Analysis | Small RNA libraries from total RNA isolated from adult ovaries Overall design: Small RNA libraries were derived from Ovaries of the Founder strain and their offspring and their reciprocal offspring. RNA from 5 individual ovaries was pooled . | pubmed:23335638 | Tu Male | GSM1014086 | source name:Testes|sex:male|strain:Tu|development stage:Adult|tissue:Testes | Tu Male | Barcode splitting and adapter trimming performed using custom scripts. Barcode is the first 4 bases of the reads except for libraries Tu Male Tu P0 SJD Male SJD P0 SJDxTuF1 TuxSJDF1 TuxSJDF2 and SJDxTuF2 which do not have a barcode. three prime adapter seqeunce starts with 'TCGTATG'. Reads were mapped to D.rerio genome assembly using megablast software. Genome build: Zv9 Supplementary files format and content: Text file with read counts | Testes | Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. five prime and three prime adaptors were ligated. RNA was not treated with any enzymes before ligation steps. | Animals were grown under standard conditioni | gender:male|strain:Tu|developmental stage:Adult|tissue:Testes | GSM1014086 | GSM1014086: Tu Male; Danio rerio; RNA Seq | GSM1014086 1 | 1 | GEO Accession:GSM1014086 | RNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina Genome Analyzer IIx | SRP015982 | 908421696.0 | 25233936.0 | GSM1014086 r1 | 0:36 | A:222765185;C:198165182;G:240641436;T:246807325;N:42568 | 36 | 222765185 | 198165182 | 240641436 | 246807325 | 42568 | SRX190980 | SRS366701 | SRA059229 | GEO | European Research Institute for the Biology of Ageing, University Medical Center Groningen | 1 | 0.1451 | 0.10199 | 0.95128 | 0.45517 | 36 | B | usable mapping rate | illumina | early_illumina | unknown | size_fractionation | unknown | bulk | unknown | unknown | Netherlands | 2012-10-03 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||||
| 36516 | 36516 | SRR578921 | SRX190979 | SRS366700 | SRP015982 | PRJNA176481 | Small RNA analysis of Tu And SJD zebrafish strain and their progeny | GSE41299 | Transcriptome Analysis | Small RNA libraries from total RNA isolated from adult ovaries Overall design: Small RNA libraries were derived from Ovaries of the Founder strain and their offspring and their reciprocal offspring. RNA from 5 individual ovaries was pooled . | pubmed:23335638 | TuxSJDF2 Individual 2 | GSM1014085 | source name:Ovary|sex:female|strain:Hybrid SJD and Tu|development stage:Adult|tissue:Ovary | TuxSJDF2 Individual 2 | Barcode splitting and adapter trimming performed using custom scripts. Barcode is the first 4 bases of the reads except for libraries Tu Male Tu P0 SJD Male SJD P0 SJDxTuF1 TuxSJDF1 TuxSJDF2 and SJDxTuF2 which do not have a barcode. three prime adapter seqeunce starts with 'TCGTATG'. Reads were mapped to D.rerio genome assembly using megablast software. Genome build: Zv9 Supplementary files format and content: Text file with read counts | Ovary | Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. five prime and three prime adaptors were ligated. RNA was not treated with any enzymes before ligation steps. | Animals were grown under standard conditioni | gender:female|strain:Hybrid SJD and Tu|developmental stage:Adult|tissue:Ovary | GSM1014085 | GSM1014085: TuxSJDF2 Individual 2; Danio rerio; RNA Seq | GSM1014085 1 | 1 | GEO Accession:GSM1014085 | RNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina Genome Analyzer IIx | SRP015982 | 383509188.0 | 10653033.0 | GSM1014085 r1 | 0:36 | A:105355133;C:85084746;G:89408418;T:103592177;N:68714 | 36 | 105355133 | 85084746 | 89408418 | 103592177 | 68714 | SRX190979 | SRS366700 | SRA059229 | GEO | European Research Institute for the Biology of Ageing, University Medical Center Groningen | 1 | 0.14582 | 0.10997 | 0.96175 | 0.35151 | 36 | B | usable mapping rate | illumina | early_illumina | unknown | size_fractionation | unknown | bulk | unknown | unknown | Netherlands | 2012-10-03 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||||
| 36517 | 36517 | SRR578920 | SRX190978 | SRS366699 | SRP015982 | PRJNA176481 | Small RNA analysis of Tu And SJD zebrafish strain and their progeny | GSE41299 | Transcriptome Analysis | Small RNA libraries from total RNA isolated from adult ovaries Overall design: Small RNA libraries were derived from Ovaries of the Founder strain and their offspring and their reciprocal offspring. RNA from 5 individual ovaries was pooled . | pubmed:23335638 | TuxSJDF2 Individual 1 | GSM1014084 | source name:Ovary|sex:female|strain:Hybrid SJD and Tu|development stage:Adult|tissue:Ovary | TuxSJDF2 Individual 1 | Barcode splitting and adapter trimming performed using custom scripts. Barcode is the first 4 bases of the reads except for libraries Tu Male Tu P0 SJD Male SJD P0 SJDxTuF1 TuxSJDF1 TuxSJDF2 and SJDxTuF2 which do not have a barcode. three prime adapter seqeunce starts with 'TCGTATG'. Reads were mapped to D.rerio genome assembly using megablast software. Genome build: Zv9 Supplementary files format and content: Text file with read counts | Ovary | Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. five prime and three prime adaptors were ligated. RNA was not treated with any enzymes before ligation steps. | Animals were grown under standard conditioni | gender:female|strain:Hybrid SJD and Tu|developmental stage:Adult|tissue:Ovary | GSM1014084 | GSM1014084: TuxSJDF2 Individual 1; Danio rerio; RNA Seq | GSM1014084 1 | 1 | GEO Accession:GSM1014084 | RNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina Genome Analyzer IIx | SRP015982 | TuxSJDF1_Individual_1.fastq | fastq | 464899752.0 | 12913882.0 | GSM1014084 r1 | 0:36 | A:140830427;C:93401413;G:113254459;T:117332119;N:81334 | 36 | 140830427 | 93401413 | 113254459 | 117332119 | 81334 | SRX190978 | SRS366699 | SRA059229 | GEO | European Research Institute for the Biology of Ageing, University Medical Center Groningen | 1 | 0.43194 | 0.32 | 0.93154 | 0.3438 | 36 | B | usable mapping rate | illumina | early_illumina | unknown | size_fractionation | unknown | bulk | unknown | unknown | Netherlands | 2012-10-03 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||
| 36518 | 36518 | SRR578919 | SRX190977 | SRS366698 | SRP015982 | PRJNA176481 | Small RNA analysis of Tu And SJD zebrafish strain and their progeny | GSE41299 | Transcriptome Analysis | Small RNA libraries from total RNA isolated from adult ovaries Overall design: Small RNA libraries were derived from Ovaries of the Founder strain and their offspring and their reciprocal offspring. RNA from 5 individual ovaries was pooled . | pubmed:23335638 | TuxSJDF2 | GSM1014083 | source name:Ovary|sex:female|strain:Hybrid SJD and Tu|development stage:Adult|tissue:Ovary | TuxSJDF2 | Barcode splitting and adapter trimming performed using custom scripts. Barcode is the first 4 bases of the reads except for libraries Tu Male Tu P0 SJD Male SJD P0 SJDxTuF1 TuxSJDF1 TuxSJDF2 and SJDxTuF2 which do not have a barcode. three prime adapter seqeunce starts with 'TCGTATG'. Reads were mapped to D.rerio genome assembly using megablast software. Genome build: Zv9 Supplementary files format and content: Text file with read counts | Ovary | Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. five prime and three prime adaptors were ligated. RNA was not treated with any enzymes before ligation steps. | Animals were grown under standard conditioni | gender:female|strain:Hybrid SJD and Tu|developmental stage:Adult|tissue:Ovary | GSM1014083 | GSM1014083: TuxSJDF2; Danio rerio; RNA Seq | GSM1014083 1 | 1 | GEO Accession:GSM1014083 | RNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina Genome Analyzer IIx | SRP015982 | TuxSJDF2.fastq | fastq | 1036162620.0 | 28782295.0 | GSM1014083 r1 | 0:36 | A:268457303;C:215700792;G:273583173;T:278046713;N:374639 | 36 | 268457303 | 215700792 | 273583173 | 278046713 | 374639 | SRX190977 | SRS366698 | SRA059229 | GEO | European Research Institute for the Biology of Ageing, University Medical Center Groningen | 1 | 0.16399 | 0.12914 | 0.9517 | 0.52232 | 36 | B | usable mapping rate | illumina | early_illumina | unknown | size_fractionation | unknown | bulk | unknown | unknown | Netherlands | 2012-10-03 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||
| 36519 | 36519 | SRR578918 | SRX190976 | SRS366697 | SRP015982 | PRJNA176481 | Small RNA analysis of Tu And SJD zebrafish strain and their progeny | GSE41299 | Transcriptome Analysis | Small RNA libraries from total RNA isolated from adult ovaries Overall design: Small RNA libraries were derived from Ovaries of the Founder strain and their offspring and their reciprocal offspring. RNA from 5 individual ovaries was pooled . | pubmed:23335638 | TuxSJDF1 Individual 2 | GSM1014082 | source name:Ovary|sex:female|strain:Hybrid SJD and Tu|development stage:Adult|tissue:Ovary | TuxSJDF1 Individual 2 | Barcode splitting and adapter trimming performed using custom scripts. Barcode is the first 4 bases of the reads except for libraries Tu Male Tu P0 SJD Male SJD P0 SJDxTuF1 TuxSJDF1 TuxSJDF2 and SJDxTuF2 which do not have a barcode. three prime adapter seqeunce starts with 'TCGTATG'. Reads were mapped to D.rerio genome assembly using megablast software. Genome build: Zv9 Supplementary files format and content: Text file with read counts | Ovary | Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. five prime and three prime adaptors were ligated. RNA was not treated with any enzymes before ligation steps. | Animals were grown under standard conditioni | gender:female|strain:Hybrid SJD and Tu|developmental stage:Adult|tissue:Ovary | GSM1014082 | GSM1014082: TuxSJDF1 Individual 2; Danio rerio; RNA Seq | GSM1014082 1 | 1 | GEO Accession:GSM1014082 | RNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina Genome Analyzer IIx | SRP015982 | 344764980.0 | 9576805.0 | GSM1014082 r1 | 0:36 | A:90252809;C:80943703;G:83338280;T:90171695;N:58493 | 36 | 90252809 | 80943703 | 83338280 | 90171695 | 58493 | SRX190976 | SRS366697 | SRA059229 | GEO | European Research Institute for the Biology of Ageing, University Medical Center Groningen | 1 | 0.18861 | 0.14536 | 0.95335 | 0.54431 | 36 | B | usable mapping rate | illumina | early_illumina | unknown | size_fractionation | unknown | bulk | unknown | unknown | Netherlands | 2012-10-03 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||||
| 36520 | 36520 | SRR578917 | SRX190975 | SRS366696 | SRP015982 | PRJNA176481 | Small RNA analysis of Tu And SJD zebrafish strain and their progeny | GSE41299 | Transcriptome Analysis | Small RNA libraries from total RNA isolated from adult ovaries Overall design: Small RNA libraries were derived from Ovaries of the Founder strain and their offspring and their reciprocal offspring. RNA from 5 individual ovaries was pooled . | pubmed:23335638 | TuxSJDF1 Individual 1 | GSM1014081 | source name:Ovary|sex:female|strain:Hybrid SJD and Tu|development stage:Adult|tissue:Ovary | TuxSJDF1 Individual 1 | Barcode splitting and adapter trimming performed using custom scripts. Barcode is the first 4 bases of the reads except for libraries Tu Male Tu P0 SJD Male SJD P0 SJDxTuF1 TuxSJDF1 TuxSJDF2 and SJDxTuF2 which do not have a barcode. three prime adapter seqeunce starts with 'TCGTATG'. Reads were mapped to D.rerio genome assembly using megablast software. Genome build: Zv9 Supplementary files format and content: Text file with read counts | Ovary | Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. five prime and three prime adaptors were ligated. RNA was not treated with any enzymes before ligation steps. | Animals were grown under standard conditioni | gender:female|strain:Hybrid SJD and Tu|developmental stage:Adult|tissue:Ovary | GSM1014081 | GSM1014081: TuxSJDF1 Individual 1; Danio rerio; RNA Seq | GSM1014081 1 | 1 | GEO Accession:GSM1014081 | RNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina Genome Analyzer IIx | SRP015982 | TuxSJDF2_Individual_1.fastq | fastq | 373504320.0 | 10375120.0 | GSM1014081 r1 | 0:36 | A:96550943;C:89937876;G:87356943;T:99426239;N:232319 | 36 | 96550943 | 89937876 | 87356943 | 99426239 | 232319 | SRX190975 | SRS366696 | SRA059229 | GEO | European Research Institute for the Biology of Ageing, University Medical Center Groningen | 1 | 0.15362 | 0.12272 | 0.95943 | 0.56453 | 36 | B | usable mapping rate | illumina | early_illumina | unknown | size_fractionation | unknown | bulk | unknown | unknown | Netherlands | 2012-10-03 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||
| 36521 | 36521 | SRR578916 | SRX190974 | SRS366695 | SRP015982 | PRJNA176481 | Small RNA analysis of Tu And SJD zebrafish strain and their progeny | GSE41299 | Transcriptome Analysis | Small RNA libraries from total RNA isolated from adult ovaries Overall design: Small RNA libraries were derived from Ovaries of the Founder strain and their offspring and their reciprocal offspring. RNA from 5 individual ovaries was pooled . | pubmed:23335638 | TuxSJDF1 | GSM1014080 | source name:Ovary|sex:female|strain:Hybrid SJD and Tu|development stage:Adult|tissue:Ovary | TuxSJDF1 | Barcode splitting and adapter trimming performed using custom scripts. Barcode is the first 4 bases of the reads except for libraries Tu Male Tu P0 SJD Male SJD P0 SJDxTuF1 TuxSJDF1 TuxSJDF2 and SJDxTuF2 which do not have a barcode. three prime adapter seqeunce starts with 'TCGTATG'. Reads were mapped to D.rerio genome assembly using megablast software. Genome build: Zv9 Supplementary files format and content: Text file with read counts | Ovary | Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. five prime and three prime adaptors were ligated. RNA was not treated with any enzymes before ligation steps. | Animals were grown under standard conditioni | gender:female|strain:Hybrid SJD and Tu|developmental stage:Adult|tissue:Ovary | GSM1014080 | GSM1014080: TuxSJDF1; Danio rerio; RNA Seq | GSM1014080 1 | 1 | GEO Accession:GSM1014080 | RNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina Genome Analyzer IIx | SRP015982 | TuxSJDF1.fastq | fastq | 1031108904.0 | 28641914.0 | GSM1014080 r1 | 0:36 | A:270773113;C:213123466;G:267237418;T:279702377;N:272530 | 36 | 270773113 | 213123466 | 267237418 | 279702377 | 272530 | SRX190974 | SRS366695 | SRA059229 | GEO | European Research Institute for the Biology of Ageing, University Medical Center Groningen | 1 | 0.15469 | 0.12537 | 0.95457 | 0.48819 | 36 | B | usable mapping rate | illumina | early_illumina | unknown | size_fractionation | unknown | bulk | unknown | unknown | Netherlands | 2012-10-03 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||
| 36522 | 36522 | SRR578915 | SRX190973 | SRS366694 | SRP015982 | PRJNA176481 | Small RNA analysis of Tu And SJD zebrafish strain and their progeny | GSE41299 | Transcriptome Analysis | Small RNA libraries from total RNA isolated from adult ovaries Overall design: Small RNA libraries were derived from Ovaries of the Founder strain and their offspring and their reciprocal offspring. RNA from 5 individual ovaries was pooled . | pubmed:23335638 | Tu P0 Individual 2 | GSM1014079 | source name:Ovary|sex:female|strain:Tu|development stage:Adult|tissue:Ovary | Tu P0 Individual 2 | Barcode splitting and adapter trimming performed using custom scripts. Barcode is the first 4 bases of the reads except for libraries Tu Male Tu P0 SJD Male SJD P0 SJDxTuF1 TuxSJDF1 TuxSJDF2 and SJDxTuF2 which do not have a barcode. three prime adapter seqeunce starts with 'TCGTATG'. Reads were mapped to D.rerio genome assembly using megablast software. Genome build: Zv9 Supplementary files format and content: Text file with read counts | Ovary | Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. five prime and three prime adaptors were ligated. RNA was not treated with any enzymes before ligation steps. | Animals were grown under standard conditioni | gender:female|strain:Tu|developmental stage:Adult|tissue:Ovary | GSM1014079 | GSM1014079: Tu P0 Individual 2; Danio rerio; RNA Seq | GSM1014079 1 | 1 | GEO Accession:GSM1014079 | RNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina Genome Analyzer IIx | SRP015982 | 464586408.0 | 12905178.0 | GSM1014079 r1 | 0:36 | A:150621423;C:99131637;G:92380585;T:122374816;N:77947 | 36 | 150621423 | 99131637 | 92380585 | 122374816 | 77947 | SRX190973 | SRS366694 | SRA059229 | GEO | European Research Institute for the Biology of Ageing, University Medical Center Groningen | 1 | 0.0937 | 0.05289 | 0.96546 | 0.60026 | 36 | B | usable mapping rate | illumina | early_illumina | unknown | size_fractionation | unknown | bulk | unknown | unknown | Netherlands | 2012-10-03 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||||
| 36523 | 36523 | SRR578914 | SRX190972 | SRS366693 | SRP015982 | PRJNA176481 | Small RNA analysis of Tu And SJD zebrafish strain and their progeny | GSE41299 | Transcriptome Analysis | Small RNA libraries from total RNA isolated from adult ovaries Overall design: Small RNA libraries were derived from Ovaries of the Founder strain and their offspring and their reciprocal offspring. RNA from 5 individual ovaries was pooled . | pubmed:23335638 | Tu P0 Individual 1 | GSM1014078 | source name:Ovary|sex:female|strain:Tu|development stage:Adult|tissue:Ovary | Tu P0 Individual 1 | Barcode splitting and adapter trimming performed using custom scripts. Barcode is the first 4 bases of the reads except for libraries Tu Male Tu P0 SJD Male SJD P0 SJDxTuF1 TuxSJDF1 TuxSJDF2 and SJDxTuF2 which do not have a barcode. three prime adapter seqeunce starts with 'TCGTATG'. Reads were mapped to D.rerio genome assembly using megablast software. Genome build: Zv9 Supplementary files format and content: Text file with read counts | Ovary | Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. five prime and three prime adaptors were ligated. RNA was not treated with any enzymes before ligation steps. | Animals were grown under standard conditioni | gender:female|strain:Tu|developmental stage:Adult|tissue:Ovary | GSM1014078 | GSM1014078: Tu P0 Individual 1; Danio rerio; RNA Seq | GSM1014078 1 | 1 | GEO Accession:GSM1014078 | RNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina Genome Analyzer IIx | SRP015982 | 427172796.0 | 11865911.0 | GSM1014078 r1 | 0:36 | A:135500495;C:91385480;G:87823245;T:112202150;N:261426 | 36 | 135500495 | 91385480 | 87823245 | 112202150 | 261426 | SRX190972 | SRS366693 | SRA059229 | GEO | European Research Institute for the Biology of Ageing, University Medical Center Groningen | 1 | 0.1368 | 0.09652 | 0.95142 | 0.49555 | 36 | B | usable mapping rate | illumina | early_illumina | unknown | size_fractionation | unknown | bulk | unknown | unknown | Netherlands | 2012-10-03 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||||
| 36524 | 36524 | SRR578913 | SRX190971 | SRS366692 | SRP015982 | PRJNA176481 | Small RNA analysis of Tu And SJD zebrafish strain and their progeny | GSE41299 | Transcriptome Analysis | Small RNA libraries from total RNA isolated from adult ovaries Overall design: Small RNA libraries were derived from Ovaries of the Founder strain and their offspring and their reciprocal offspring. RNA from 5 individual ovaries was pooled . | pubmed:23335638 | Tu P0 | GSM1014077 | source name:Ovary|sex:female|strain:Tu|development stage:Adult|tissue:Ovary | Tu P0 | Barcode splitting and adapter trimming performed using custom scripts. Barcode is the first 4 bases of the reads except for libraries Tu Male Tu P0 SJD Male SJD P0 SJDxTuF1 TuxSJDF1 TuxSJDF2 and SJDxTuF2 which do not have a barcode. three prime adapter seqeunce starts with 'TCGTATG'. Reads were mapped to D.rerio genome assembly using megablast software. Genome build: Zv9 Supplementary files format and content: Text file with read counts | Ovary | Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. five prime and three prime adaptors were ligated. RNA was not treated with any enzymes before ligation steps. | Animals were grown under standard conditioni | gender:female|strain:Tu|developmental stage:Adult|tissue:Ovary | GSM1014077 | GSM1014077: Tu P0; Danio rerio; RNA Seq | GSM1014077 1 | 1 | GEO Accession:GSM1014077 | RNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina Genome Analyzer IIx | SRP015982 | 967772772.0 | 26882577.0 | GSM1014077 r1 | 0:36 | A:227085973;C:218180545;G:249458631;T:273002038;N:45585 | 36 | 227085973 | 218180545 | 249458631 | 273002038 | 45585 | SRX190971 | SRS366692 | SRA059229 | GEO | European Research Institute for the Biology of Ageing, University Medical Center Groningen | 1 | 0.14418 | 0.1135 | 0.95818 | 0.51074 | 36 | B | usable mapping rate | illumina | early_illumina | unknown | size_fractionation | unknown | bulk | unknown | unknown | Netherlands | 2012-10-03 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||||
| 36525 | 36525 | SRR578912 | SRX190970 | SRS366691 | SRP015982 | PRJNA176481 | Small RNA analysis of Tu And SJD zebrafish strain and their progeny | GSE41299 | Transcriptome Analysis | Small RNA libraries from total RNA isolated from adult ovaries Overall design: Small RNA libraries were derived from Ovaries of the Founder strain and their offspring and their reciprocal offspring. RNA from 5 individual ovaries was pooled . | pubmed:23335638 | SJDxTuF2 Individual 2 | GSM1014076 | source name:Ovary|sex:female|strain:Hybrid SJD and Tu|development stage:Adult|tissue:Ovary | SJDxTuF2 Individual 2 | Barcode splitting and adapter trimming performed using custom scripts. Barcode is the first 4 bases of the reads except for libraries Tu Male Tu P0 SJD Male SJD P0 SJDxTuF1 TuxSJDF1 TuxSJDF2 and SJDxTuF2 which do not have a barcode. three prime adapter seqeunce starts with 'TCGTATG'. Reads were mapped to D.rerio genome assembly using megablast software. Genome build: Zv9 Supplementary files format and content: Text file with read counts | Ovary | Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. five prime and three prime adaptors were ligated. RNA was not treated with any enzymes before ligation steps. | Animals were grown under standard conditioni | gender:female|strain:Hybrid SJD and Tu|developmental stage:Adult|tissue:Ovary | GSM1014076 | GSM1014076: SJDxTuF2 Individual 2; Danio rerio; RNA Seq | GSM1014076 1 | 1 | GEO Accession:GSM1014076 | RNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina Genome Analyzer IIx | SRP015982 | 347475024.0 | 9652084.0 | GSM1014076 r1 | 0:36 | A:91189258;C:81789488;G:84551251;T:89882775;N:62252 | 36 | 91189258 | 81789488 | 84551251 | 89882775 | 62252 | SRX190970 | SRS366691 | SRA059229 | GEO | European Research Institute for the Biology of Ageing, University Medical Center Groningen | 1 | 0.15872 | 0.12439 | 0.95848 | 0.56717 | 36 | B | usable mapping rate | illumina | early_illumina | unknown | size_fractionation | unknown | bulk | unknown | unknown | Netherlands | 2012-10-03 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||||
| 36526 | 36526 | SRR578911 | SRX190969 | SRS366690 | SRP015982 | PRJNA176481 | Small RNA analysis of Tu And SJD zebrafish strain and their progeny | GSE41299 | Transcriptome Analysis | Small RNA libraries from total RNA isolated from adult ovaries Overall design: Small RNA libraries were derived from Ovaries of the Founder strain and their offspring and their reciprocal offspring. RNA from 5 individual ovaries was pooled . | pubmed:23335638 | SJDxTuF2 Individual 1 | GSM1014075 | source name:Ovary|sex:female|strain:Hybrid SJD and Tu|development stage:Adult|tissue:Ovary | SJDxTuF2 Individual 1 | Barcode splitting and adapter trimming performed using custom scripts. Barcode is the first 4 bases of the reads except for libraries Tu Male Tu P0 SJD Male SJD P0 SJDxTuF1 TuxSJDF1 TuxSJDF2 and SJDxTuF2 which do not have a barcode. three prime adapter seqeunce starts with 'TCGTATG'. Reads were mapped to D.rerio genome assembly using megablast software. Genome build: Zv9 Supplementary files format and content: Text file with read counts | Ovary | Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. five prime and three prime adaptors were ligated. RNA was not treated with any enzymes before ligation steps. | Animals were grown under standard conditioni | gender:female|strain:Hybrid SJD and Tu|developmental stage:Adult|tissue:Ovary | GSM1014075 | GSM1014075: SJDxTuF2 Individual 1; Danio rerio; RNA Seq | GSM1014075 1 | 1 | GEO Accession:GSM1014075 | RNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina Genome Analyzer IIx | SRP015982 | 400137228.0 | 11114923.0 | GSM1014075 r1 | 0:36 | A:107143937;C:91495000;G:94706504;T:106722021;N:69766 | 36 | 107143937 | 91495000 | 94706504 | 106722021 | 69766 | SRX190969 | SRS366690 | SRA059229 | GEO | European Research Institute for the Biology of Ageing, University Medical Center Groningen | 1 | 0.15753 | 0.12463 | 0.95538 | 0.5649 | 36 | B | usable mapping rate | illumina | early_illumina | unknown | size_fractionation | unknown | bulk | unknown | unknown | Netherlands | 2012-10-03 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||||
| 36527 | 36527 | SRR578910 | SRX190968 | SRS366689 | SRP015982 | PRJNA176481 | Small RNA analysis of Tu And SJD zebrafish strain and their progeny | GSE41299 | Transcriptome Analysis | Small RNA libraries from total RNA isolated from adult ovaries Overall design: Small RNA libraries were derived from Ovaries of the Founder strain and their offspring and their reciprocal offspring. RNA from 5 individual ovaries was pooled . | pubmed:23335638 | SJDxTuF2 | GSM1014074 | source name:Ovary|sex:female|strain:Hybrid SJD and Tu|development stage:Adult|tissue:Ovary | SJDxTuF2 | Barcode splitting and adapter trimming performed using custom scripts. Barcode is the first 4 bases of the reads except for libraries Tu Male Tu P0 SJD Male SJD P0 SJDxTuF1 TuxSJDF1 TuxSJDF2 and SJDxTuF2 which do not have a barcode. three prime adapter seqeunce starts with 'TCGTATG'. Reads were mapped to D.rerio genome assembly using megablast software. Genome build: Zv9 Supplementary files format and content: Text file with read counts | Ovary | Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. five prime and three prime adaptors were ligated. RNA was not treated with any enzymes before ligation steps. | Animals were grown under standard conditioni | gender:female|strain:Hybrid SJD and Tu|developmental stage:Adult|tissue:Ovary | GSM1014074 | GSM1014074: SJDxTuF2; Danio rerio; RNA Seq | GSM1014074 1 | 1 | GEO Accession:GSM1014074 | RNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina Genome Analyzer IIx | SRP015982 | SJDxTuF2.fastq | fastq | 958492116.0 | 26624781.0 | GSM1014074 r1 | 0:36 | A:261275440;C:193944805;G:248348765;T:254793050;N:130056 | 36 | 261275440 | 193944805 | 248348765 | 254793050 | 130056 | SRX190968 | SRS366689 | SRA059229 | GEO | European Research Institute for the Biology of Ageing, University Medical Center Groningen | 1 | 0.20051 | 0.16387 | 0.94653 | 0.53263 | 36 | B | usable mapping rate | illumina | early_illumina | unknown | size_fractionation | unknown | bulk | unknown | unknown | Netherlands | 2012-10-03 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||
| 36528 | 36528 | SRR578909 | SRX190967 | SRS366688 | SRP015982 | PRJNA176481 | Small RNA analysis of Tu And SJD zebrafish strain and their progeny | GSE41299 | Transcriptome Analysis | Small RNA libraries from total RNA isolated from adult ovaries Overall design: Small RNA libraries were derived from Ovaries of the Founder strain and their offspring and their reciprocal offspring. RNA from 5 individual ovaries was pooled . | pubmed:23335638 | SJDxTuF1 Individual 2 | GSM1014073 | source name:Ovary|sex:female|strain:Hybrid SJD and Tu|development stage:Adult|tissue:Ovary | SJDxTuF1 Individual 2 | Barcode splitting and adapter trimming performed using custom scripts. Barcode is the first 4 bases of the reads except for libraries Tu Male Tu P0 SJD Male SJD P0 SJDxTuF1 TuxSJDF1 TuxSJDF2 and SJDxTuF2 which do not have a barcode. three prime adapter seqeunce starts with 'TCGTATG'. Reads were mapped to D.rerio genome assembly using megablast software. Genome build: Zv9 Supplementary files format and content: Text file with read counts | Ovary | Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. five prime and three prime adaptors were ligated. RNA was not treated with any enzymes before ligation steps. | Animals were grown under standard conditioni | gender:female|strain:Hybrid SJD and Tu|developmental stage:Adult|tissue:Ovary | GSM1014073 | GSM1014073: SJDxTuF1 Individual 2; Danio rerio; RNA Seq | GSM1014073 1 | 1 | GEO Accession:GSM1014073 | RNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina Genome Analyzer IIx | SRP015982 | 435761532.0 | 12104487.0 | GSM1014073 r1 | 0:36 | A:120580697;C:105605593;G:91379055;T:117787426;N:408761 | 36 | 120580697 | 105605593 | 91379055 | 117787426 | 408761 | SRX190967 | SRS366688 | SRA059229 | GEO | European Research Institute for the Biology of Ageing, University Medical Center Groningen | 1 | 0.07215 | 0.05695 | 0.97557 | 0.48838 | 36 | B | usable mapping rate | illumina | early_illumina | unknown | size_fractionation | unknown | bulk | unknown | unknown | Netherlands | 2012-10-03 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||||
| 36529 | 36529 | SRR578908 | SRX190966 | SRS366687 | SRP015982 | PRJNA176481 | Small RNA analysis of Tu And SJD zebrafish strain and their progeny | GSE41299 | Transcriptome Analysis | Small RNA libraries from total RNA isolated from adult ovaries Overall design: Small RNA libraries were derived from Ovaries of the Founder strain and their offspring and their reciprocal offspring. RNA from 5 individual ovaries was pooled . | pubmed:23335638 | SJDxTuF1 Individual 1 | GSM1014072 | source name:Ovary|sex:female|strain:Hybrid SJD and Tu|development stage:Adult|tissue:Ovary | SJDxTuF1 Individual 1 | Barcode splitting and adapter trimming performed using custom scripts. Barcode is the first 4 bases of the reads except for libraries Tu Male Tu P0 SJD Male SJD P0 SJDxTuF1 TuxSJDF1 TuxSJDF2 and SJDxTuF2 which do not have a barcode. three prime adapter seqeunce starts with 'TCGTATG'. Reads were mapped to D.rerio genome assembly using megablast software. Genome build: Zv9 Supplementary files format and content: Text file with read counts | Ovary | Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. five prime and three prime adaptors were ligated. RNA was not treated with any enzymes before ligation steps. | Animals were grown under standard conditioni | gender:female|strain:Hybrid SJD and Tu|developmental stage:Adult|tissue:Ovary | GSM1014072 | GSM1014072: SJDxTuF1 Individual 1; Danio rerio; RNA Seq | GSM1014072 1 | 1 | GEO Accession:GSM1014072 | RNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina Genome Analyzer IIx | SRP015982 | 378296532.0 | 10508237.0 | GSM1014072 r1 | 0:36 | A:109216358;C:76585213;G:90165899;T:102085771;N:243291 | 36 | 109216358 | 76585213 | 90165899 | 102085771 | 243291 | SRX190966 | SRS366687 | SRA059229 | GEO | European Research Institute for the Biology of Ageing, University Medical Center Groningen | 1 | 0.13684 | 0.10794 | 0.96335 | 0.49651 | 36 | B | usable mapping rate | illumina | early_illumina | unknown | size_fractionation | unknown | bulk | unknown | unknown | Netherlands | 2012-10-03 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||||
| 36530 | 36530 | SRR578907 | SRX190965 | SRS366686 | SRP015982 | PRJNA176481 | Small RNA analysis of Tu And SJD zebrafish strain and their progeny | GSE41299 | Transcriptome Analysis | Small RNA libraries from total RNA isolated from adult ovaries Overall design: Small RNA libraries were derived from Ovaries of the Founder strain and their offspring and their reciprocal offspring. RNA from 5 individual ovaries was pooled . | pubmed:23335638 | SJDxTuF1 | GSM1014071 | source name:Ovary|sex:female|strain:Hybrid SJD and Tu|development stage:Adult|tissue:Ovary | SJDxTuF1 | Barcode splitting and adapter trimming performed using custom scripts. Barcode is the first 4 bases of the reads except for libraries Tu Male Tu P0 SJD Male SJD P0 SJDxTuF1 TuxSJDF1 TuxSJDF2 and SJDxTuF2 which do not have a barcode. three prime adapter seqeunce starts with 'TCGTATG'. Reads were mapped to D.rerio genome assembly using megablast software. Genome build: Zv9 Supplementary files format and content: Text file with read counts | Ovary | Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. five prime and three prime adaptors were ligated. RNA was not treated with any enzymes before ligation steps. | Animals were grown under standard conditioni | gender:female|strain:Hybrid SJD and Tu|developmental stage:Adult|tissue:Ovary | GSM1014071 | GSM1014071: SJDxTuF1; Danio rerio; RNA Seq | GSM1014071 1 | 1 | GEO Accession:GSM1014071 | RNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina Genome Analyzer IIx | SRP015982 | 1047688380.0 | 29102455.0 | GSM1014071 r1 | 0:36 | A:277032474;C:213232299;G:269309034;T:288068877;N:45696 | 36 | 277032474 | 213232299 | 269309034 | 288068877 | 45696 | SRX190965 | SRS366686 | SRA059229 | GEO | European Research Institute for the Biology of Ageing, University Medical Center Groningen | 1 | 0.1858 | 0.15153 | 0.95006 | 0.51345 | 36 | B | usable mapping rate | illumina | early_illumina | unknown | size_fractionation | unknown | bulk | unknown | unknown | Netherlands | 2012-10-03 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||||
| 36531 | 36531 | SRR578906 | SRX190964 | SRS366685 | SRP015982 | PRJNA176481 | Small RNA analysis of Tu And SJD zebrafish strain and their progeny | GSE41299 | Transcriptome Analysis | Small RNA libraries from total RNA isolated from adult ovaries Overall design: Small RNA libraries were derived from Ovaries of the Founder strain and their offspring and their reciprocal offspring. RNA from 5 individual ovaries was pooled . | pubmed:23335638 | SJD P0 Individual 2 | GSM1014070 | source name:Ovary|sex:female|strain:SJD|development stage:Adult|tissue:Ovary | SJD P0 Individual 2 | Barcode splitting and adapter trimming performed using custom scripts. Barcode is the first 4 bases of the reads except for libraries Tu Male Tu P0 SJD Male SJD P0 SJDxTuF1 TuxSJDF1 TuxSJDF2 and SJDxTuF2 which do not have a barcode. three prime adapter seqeunce starts with 'TCGTATG'. Reads were mapped to D.rerio genome assembly using megablast software. Genome build: Zv9 Supplementary files format and content: Text file with read counts | Ovary | Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. five prime and three prime adaptors were ligated. RNA was not treated with any enzymes before ligation steps. | Animals were grown under standard conditioni | gender:female|strain:SJD|developmental stage:Adult|tissue:Ovary | GSM1014070 | GSM1014070: SJD P0 Individual 2; Danio rerio; RNA Seq | GSM1014070 1 | 1 | GEO Accession:GSM1014070 | RNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina Genome Analyzer IIx | SRP015982 | SJD_P0_Individual_2.fastq | fastq | 392951772.0 | 10915327.0 | GSM1014070 r1 | 0:36 | A:126709476;C:82393458;G:82997127;T:100597122;N:254589 | 36 | 126709476 | 82393458 | 82997127 | 100597122 | 254589 | SRX190964 | SRS366685 | SRA059229 | GEO | European Research Institute for the Biology of Ageing, University Medical Center Groningen | 1 | 0.12786 | 0.10199 | 0.95724 | 0.52026 | 36 | B | usable mapping rate | illumina | early_illumina | unknown | size_fractionation | unknown | bulk | unknown | unknown | Netherlands | 2012-10-03 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||
| 36532 | 36532 | SRR578905 | SRX190963 | SRS366684 | SRP015982 | PRJNA176481 | Small RNA analysis of Tu And SJD zebrafish strain and their progeny | GSE41299 | Transcriptome Analysis | Small RNA libraries from total RNA isolated from adult ovaries Overall design: Small RNA libraries were derived from Ovaries of the Founder strain and their offspring and their reciprocal offspring. RNA from 5 individual ovaries was pooled . | pubmed:23335638 | SJD P0 Individual 1 | GSM1014069 | source name:Ovary|sex:female|strain:SJD|development stage:Adult|tissue:Ovary | SJD P0 Individual 1 | Barcode splitting and adapter trimming performed using custom scripts. Barcode is the first 4 bases of the reads except for libraries Tu Male Tu P0 SJD Male SJD P0 SJDxTuF1 TuxSJDF1 TuxSJDF2 and SJDxTuF2 which do not have a barcode. three prime adapter seqeunce starts with 'TCGTATG'. Reads were mapped to D.rerio genome assembly using megablast software. Genome build: Zv9 Supplementary files format and content: Text file with read counts | Ovary | Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. five prime and three prime adaptors were ligated. RNA was not treated with any enzymes before ligation steps. | Animals were grown under standard conditioni | gender:female|strain:SJD|developmental stage:Adult|tissue:Ovary | GSM1014069 | GSM1014069: SJD P0 Individual 1; Danio rerio; RNA Seq | GSM1014069 1 | 1 | GEO Accession:GSM1014069 | RNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina Genome Analyzer IIx | SRP015982 | SJD_P0_Individual_1.fastq | fastq | 379882512.0 | 10552292.0 | GSM1014069 r1 | 0:36 | A:122444116;C:80302064;G:76948943;T:99839311;N:348078 | 36 | 122444116 | 80302064 | 76948943 | 99839311 | 348078 | SRX190963 | SRS366684 | SRA059229 | GEO | European Research Institute for the Biology of Ageing, University Medical Center Groningen | 1 | 0.21364 | 0.16206 | 0.94268 | 0.45306 | 36 | B | usable mapping rate | illumina | early_illumina | unknown | size_fractionation | unknown | bulk | unknown | unknown | Netherlands | 2012-10-03 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||
| 36533 | 36533 | SRR578904 | SRX190962 | SRS366683 | SRP015982 | PRJNA176481 | Small RNA analysis of Tu And SJD zebrafish strain and their progeny | GSE41299 | Transcriptome Analysis | Small RNA libraries from total RNA isolated from adult ovaries Overall design: Small RNA libraries were derived from Ovaries of the Founder strain and their offspring and their reciprocal offspring. RNA from 5 individual ovaries was pooled . | pubmed:23335638 | SJD P0 | GSM1014068 | source name:Ovary|sex:female|strain:SJD|development stage:Adult|tissue:Ovary | SJD P0 | Barcode splitting and adapter trimming performed using custom scripts. Barcode is the first 4 bases of the reads except for libraries Tu Male Tu P0 SJD Male SJD P0 SJDxTuF1 TuxSJDF1 TuxSJDF2 and SJDxTuF2 which do not have a barcode. three prime adapter seqeunce starts with 'TCGTATG'. Reads were mapped to D.rerio genome assembly using megablast software. Genome build: Zv9 Supplementary files format and content: Text file with read counts | Ovary | Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. five prime and three prime adaptors were ligated. RNA was not treated with any enzymes before ligation steps. | Animals were grown under standard conditioni | gender:female|strain:SJD|developmental stage:Adult|tissue:Ovary | GSM1014068 | GSM1014068: SJD P0; Danio rerio; RNA Seq | GSM1014068 1 | 1 | GEO Accession:GSM1014068 | RNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina Genome Analyzer IIx | SRP015982 | SJD_P0.fastq | fastq | 837950832.0 | 23276412.0 | GSM1014068 r1 | 0:36 | A:217386642;C:179519865;G:217337232;T:223633685;N:73408 | 36 | 217386642 | 179519865 | 217337232 | 223633685 | 73408 | SRX190962 | SRS366683 | SRA059229 | GEO | European Research Institute for the Biology of Ageing, University Medical Center Groningen | 1 | 0.26607 | 0.21631 | 0.93789 | 0.46928 | 36 | B | usable mapping rate | illumina | early_illumina | unknown | size_fractionation | unknown | bulk | unknown | unknown | Netherlands | 2012-10-03 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||
| 37997 | 37997 | SRR1265760 | SRX529154 | SRS598851 | SRP041544 | PRJNA245824 | Deep sequencing of small RNA facilitates tissue and sex associated microRNA discovery in zebrafish | GSE57169 | Transcriptome Analysis | The role of microRNAs in gene regulation has been well established. The extent of miRNA regulation also increases with increasing genome complexity. Though the number of genes appear to be equal between human and zebrafish substantially less microRNAs have been discovered in zebrafish compared to human Release 19. It appears that most of the miRNAs in zebrafish are yet to be discovered. We sequenced small RNAs from brain gut liver ovary testis eye heart and embryo of zebrafish. In brain gut and liver sequencing was done in male and female separately. Majority of the sequenced reads 16 62% mapped to known miRNAs with the exception of ovary 5.7% and testis 7.8%. Using the miRNA discovery tool miRDeep2 we discovered novel miRNAs from the un annotated reads that ranged from 7.6 to 23.0% with exceptions of ovary 51.4% and testis 55.2%. The prediction tool identified a total of 459 novel pre miRNAs. We compared expression of miRNAs between different tissues and between males and females to identify tissue associated and sex associated miRNAs respectively. These miRNAs could serve as putative biomarkers for these tissues. The brain and liver had highest number of tissue associated 22 and sex associated 34 miRNAs respectively. This study comprehensively identifies tissue and sex associated miRNAs in zebrafish. Further we have discovered 459 novel pre miRNAs 30% seed homology to human miRNA as a genomic resource which can facilitate further investigations to understand miRNA mRNA gene regulatory networks in zebrafish which will have implications in understanding the function of human homologs. Overall design: Known miRNA profiling novel miRNA discovery and identification of tissue associated and sex associated miRNAs from sRNA deep sequencing data of different tissues and embryo of zebrafish in triplicate was carried out using the Illumina HiSeq 2000 platform. | pubmed:26574018 | Testis Replicate 3 sRNAseq | GSM1376643 | source name:Testis|gender:male|tissue:Testis|genetic background:Wild type Singapore strain | Testis Replicate 3 sRNAseq | Illumina Casava 1.8.2 software used for basecalling. The sequenced reads were first subjected to adapter removal through the cutadapt program Martin 2011. The trimmed reads were then collapsed to remove redundancy and to obtain a unique sequence fasta file through the mapper module of miRDeep2 package Friedländer et al. 2012. The unique reads fasta file was then put through an elimination pipeline module Vaz et al. 2010 comprising of a series of sequence similarity searches with the annotated databases. At each step the reads were matched to an annotated database with a maximum of two mismatches. The matched reads were removed and the unmatched ones were further matched to another annotated database finally culminating into an un annotated pool of reads that served as a source of novel miRNAs and novel sRNAs. The known miRNA expression profile was generated by using the quantifier module of the miRDeep2 package that gives the read counts for the known miRNAs. The quantifier.pl command line used: perl quantifier.pl p <zebrafish precursor miRNA fasta file> m <zebrafish mature miRNA fasta file> r <unique reads fasta file> t Zebrafish The raw reads expression profile generated for all the replicates of the samples were subjected to Trimmed Mean of M values TMM normalisation using the Bioconductor package edgeR Robinson et al. 2010. Genome build: ZV9 Supplementary files format and content: 1. 'Danio rerio known miRNA Rel19 profile Raw.txt': Tab delimited text file that includes the raw counts for the known mature miRNA miRBase Release 19. Supplementary files format and content: 2. 'Danio rerio known miRNA Rel19 profile Normalised.txt': Tab delimited text file that includes the Trimmed Mean of M values TMM normalised counts for the known mature miRNA miRBase Release 19. One of the replicate of Heart MZH008 failed to cluster with the other two replicates on basis of its known miRNA expression profile and hence was not used for further analysis. | Testis | N/A | Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing. | Fishes were purchased from a local supplier and acclimatized before tissue extraction. | gender:Male|tissue:Testis|genetic background:Wild type Singapore strain | GSM1376643 | GSM1376643: Testis Replicate 3 sRNAseq; Danio rerio; miRNA Seq | GSM1376643 | 1 | Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing. | GEO Accession:GSM1376643 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP041544 | MZT004_GCCAAT_L004_R1.fastq.gz | fastq | 1096387628.0 | 14426153.0 | GSM1376643 r1 | 0:76 | A:268706118;C:286539627;G:262643519;T:278353167;N:145197 | 76 | 268706118 | 286539627 | 262643519 | 278353167 | 145197 | SRX529154 | SRS598851 | SRA160430 | GEO | Expression and Signaling in Mesenchymal and Hematopoietic Stem Cells, Genome and Gene Expression Data Analysis Division, Bioinformatics Institute, A*STAR, Singapore | 1 | 0.00659 | 0.00333 | 0.99845 | 0.7331 | 76 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | unknown | unknown | Singapore | 2014-04-29 | Undetermined | Embryo | Gonad | Reproductive System | |||||||||||||||||
| 37998 | 37998 | SRR1265759 | SRX529153 | SRS598850 | SRP041544 | PRJNA245824 | Deep sequencing of small RNA facilitates tissue and sex associated microRNA discovery in zebrafish | GSE57169 | Transcriptome Analysis | The role of microRNAs in gene regulation has been well established. The extent of miRNA regulation also increases with increasing genome complexity. Though the number of genes appear to be equal between human and zebrafish substantially less microRNAs have been discovered in zebrafish compared to human Release 19. It appears that most of the miRNAs in zebrafish are yet to be discovered. We sequenced small RNAs from brain gut liver ovary testis eye heart and embryo of zebrafish. In brain gut and liver sequencing was done in male and female separately. Majority of the sequenced reads 16 62% mapped to known miRNAs with the exception of ovary 5.7% and testis 7.8%. Using the miRNA discovery tool miRDeep2 we discovered novel miRNAs from the un annotated reads that ranged from 7.6 to 23.0% with exceptions of ovary 51.4% and testis 55.2%. The prediction tool identified a total of 459 novel pre miRNAs. We compared expression of miRNAs between different tissues and between males and females to identify tissue associated and sex associated miRNAs respectively. These miRNAs could serve as putative biomarkers for these tissues. The brain and liver had highest number of tissue associated 22 and sex associated 34 miRNAs respectively. This study comprehensively identifies tissue and sex associated miRNAs in zebrafish. Further we have discovered 459 novel pre miRNAs 30% seed homology to human miRNA as a genomic resource which can facilitate further investigations to understand miRNA mRNA gene regulatory networks in zebrafish which will have implications in understanding the function of human homologs. Overall design: Known miRNA profiling novel miRNA discovery and identification of tissue associated and sex associated miRNAs from sRNA deep sequencing data of different tissues and embryo of zebrafish in triplicate was carried out using the Illumina HiSeq 2000 platform. | pubmed:26574018 | Testis Replicate 2 sRNAseq | GSM1376642 | source name:Testis|gender:male|tissue:Testis|genetic background:Wild type Singapore strain | Testis Replicate 2 sRNAseq | Illumina Casava 1.8.2 software used for basecalling. The sequenced reads were first subjected to adapter removal through the cutadapt program Martin 2011. The trimmed reads were then collapsed to remove redundancy and to obtain a unique sequence fasta file through the mapper module of miRDeep2 package Friedländer et al. 2012. The unique reads fasta file was then put through an elimination pipeline module Vaz et al. 2010 comprising of a series of sequence similarity searches with the annotated databases. At each step the reads were matched to an annotated database with a maximum of two mismatches. The matched reads were removed and the unmatched ones were further matched to another annotated database finally culminating into an un annotated pool of reads that served as a source of novel miRNAs and novel sRNAs. The known miRNA expression profile was generated by using the quantifier module of the miRDeep2 package that gives the read counts for the known miRNAs. The quantifier.pl command line used: perl quantifier.pl p <zebrafish precursor miRNA fasta file> m <zebrafish mature miRNA fasta file> r <unique reads fasta file> t Zebrafish The raw reads expression profile generated for all the replicates of the samples were subjected to Trimmed Mean of M values TMM normalisation using the Bioconductor package edgeR Robinson et al. 2010. Genome build: ZV9 Supplementary files format and content: 1. 'Danio rerio known miRNA Rel19 profile Raw.txt': Tab delimited text file that includes the raw counts for the known mature miRNA miRBase Release 19. Supplementary files format and content: 2. 'Danio rerio known miRNA Rel19 profile Normalised.txt': Tab delimited text file that includes the Trimmed Mean of M values TMM normalised counts for the known mature miRNA miRBase Release 19. One of the replicate of Heart MZH008 failed to cluster with the other two replicates on basis of its known miRNA expression profile and hence was not used for further analysis. | Testis | N/A | Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing. | Fishes were purchased from a local supplier and acclimatized before tissue extraction. | gender:Male|tissue:Testis|genetic background:Wild type Singapore strain | GSM1376642 | GSM1376642: Testis Replicate 2 sRNAseq; Danio rerio; miRNA Seq | GSM1376642 | 1 | Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing. | GEO Accession:GSM1376642 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP041544 | MZT003_ACAGTG_L004_R1.fastq.gz | fastq | 1562745896.0 | 20562446.0 | GSM1376642 r1 | 0:76 | A:381752411;C:387452090;G:395892335;T:397438930;N:210130 | 76 | 381752411 | 387452090 | 395892335 | 397438930 | 210130 | SRX529153 | SRS598850 | SRA160430 | GEO | Expression and Signaling in Mesenchymal and Hematopoietic Stem Cells, Genome and Gene Expression Data Analysis Division, Bioinformatics Institute, A*STAR, Singapore | 1 | 0.01222 | 0.00651 | 0.99788 | 0.69591 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | unknown | unknown | Singapore | 2014-04-29 | Undetermined | Embryo | Gonad | Reproductive System | |||||||||||||||||
| 37999 | 37999 | SRR1265758 | SRX529152 | SRS598849 | SRP041544 | PRJNA245824 | Deep sequencing of small RNA facilitates tissue and sex associated microRNA discovery in zebrafish | GSE57169 | Transcriptome Analysis | The role of microRNAs in gene regulation has been well established. The extent of miRNA regulation also increases with increasing genome complexity. Though the number of genes appear to be equal between human and zebrafish substantially less microRNAs have been discovered in zebrafish compared to human Release 19. It appears that most of the miRNAs in zebrafish are yet to be discovered. We sequenced small RNAs from brain gut liver ovary testis eye heart and embryo of zebrafish. In brain gut and liver sequencing was done in male and female separately. Majority of the sequenced reads 16 62% mapped to known miRNAs with the exception of ovary 5.7% and testis 7.8%. Using the miRNA discovery tool miRDeep2 we discovered novel miRNAs from the un annotated reads that ranged from 7.6 to 23.0% with exceptions of ovary 51.4% and testis 55.2%. The prediction tool identified a total of 459 novel pre miRNAs. We compared expression of miRNAs between different tissues and between males and females to identify tissue associated and sex associated miRNAs respectively. These miRNAs could serve as putative biomarkers for these tissues. The brain and liver had highest number of tissue associated 22 and sex associated 34 miRNAs respectively. This study comprehensively identifies tissue and sex associated miRNAs in zebrafish. Further we have discovered 459 novel pre miRNAs 30% seed homology to human miRNA as a genomic resource which can facilitate further investigations to understand miRNA mRNA gene regulatory networks in zebrafish which will have implications in understanding the function of human homologs. Overall design: Known miRNA profiling novel miRNA discovery and identification of tissue associated and sex associated miRNAs from sRNA deep sequencing data of different tissues and embryo of zebrafish in triplicate was carried out using the Illumina HiSeq 2000 platform. | pubmed:26574018 | Testis Replicate 1 sRNAseq | GSM1376641 | source name:Testis|gender:male|tissue:Testis|genetic background:Wild type Singapore strain | Testis Replicate 1 sRNAseq | Illumina Casava 1.8.2 software used for basecalling. The sequenced reads were first subjected to adapter removal through the cutadapt program Martin 2011. The trimmed reads were then collapsed to remove redundancy and to obtain a unique sequence fasta file through the mapper module of miRDeep2 package Friedländer et al. 2012. The unique reads fasta file was then put through an elimination pipeline module Vaz et al. 2010 comprising of a series of sequence similarity searches with the annotated databases. At each step the reads were matched to an annotated database with a maximum of two mismatches. The matched reads were removed and the unmatched ones were further matched to another annotated database finally culminating into an un annotated pool of reads that served as a source of novel miRNAs and novel sRNAs. The known miRNA expression profile was generated by using the quantifier module of the miRDeep2 package that gives the read counts for the known miRNAs. The quantifier.pl command line used: perl quantifier.pl p <zebrafish precursor miRNA fasta file> m <zebrafish mature miRNA fasta file> r <unique reads fasta file> t Zebrafish The raw reads expression profile generated for all the replicates of the samples were subjected to Trimmed Mean of M values TMM normalisation using the Bioconductor package edgeR Robinson et al. 2010. Genome build: ZV9 Supplementary files format and content: 1. 'Danio rerio known miRNA Rel19 profile Raw.txt': Tab delimited text file that includes the raw counts for the known mature miRNA miRBase Release 19. Supplementary files format and content: 2. 'Danio rerio known miRNA Rel19 profile Normalised.txt': Tab delimited text file that includes the Trimmed Mean of M values TMM normalised counts for the known mature miRNA miRBase Release 19. One of the replicate of Heart MZH008 failed to cluster with the other two replicates on basis of its known miRNA expression profile and hence was not used for further analysis. | Testis | N/A | Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing. | Fishes were purchased from a local supplier and acclimatized before tissue extraction. | gender:Male|tissue:Testis|genetic background:Wild type Singapore strain | GSM1376641 | GSM1376641: Testis Replicate 1 sRNAseq; Danio rerio; miRNA Seq | GSM1376641 | 1 | Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing. | GEO Accession:GSM1376641 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP041544 | MZT001_TGACCA_L004_R1.fastq.gz | fastq | 1368892316.0 | 18011741.0 | GSM1376641 r1 | 0:76 | A:335715713;C:358829703;G:326742789;T:347419137;N:184974 | 76 | 335715713 | 358829703 | 326742789 | 347419137 | 184974 | SRX529152 | SRS598849 | SRA160430 | GEO | Expression and Signaling in Mesenchymal and Hematopoietic Stem Cells, Genome and Gene Expression Data Analysis Division, Bioinformatics Institute, A*STAR, Singapore | 1 | 0.00032 | 3e-05 | 0.99943 | 0.69387 | 76 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | unknown | unknown | Singapore | 2014-04-29 | Undetermined | Embryo | Gonad | Reproductive System | |||||||||||||||||
| 38000 | 38000 | SRR1265757 | SRX529151 | SRS598848 | SRP041544 | PRJNA245824 | Deep sequencing of small RNA facilitates tissue and sex associated microRNA discovery in zebrafish | GSE57169 | Transcriptome Analysis | The role of microRNAs in gene regulation has been well established. The extent of miRNA regulation also increases with increasing genome complexity. Though the number of genes appear to be equal between human and zebrafish substantially less microRNAs have been discovered in zebrafish compared to human Release 19. It appears that most of the miRNAs in zebrafish are yet to be discovered. We sequenced small RNAs from brain gut liver ovary testis eye heart and embryo of zebrafish. In brain gut and liver sequencing was done in male and female separately. Majority of the sequenced reads 16 62% mapped to known miRNAs with the exception of ovary 5.7% and testis 7.8%. Using the miRNA discovery tool miRDeep2 we discovered novel miRNAs from the un annotated reads that ranged from 7.6 to 23.0% with exceptions of ovary 51.4% and testis 55.2%. The prediction tool identified a total of 459 novel pre miRNAs. We compared expression of miRNAs between different tissues and between males and females to identify tissue associated and sex associated miRNAs respectively. These miRNAs could serve as putative biomarkers for these tissues. The brain and liver had highest number of tissue associated 22 and sex associated 34 miRNAs respectively. This study comprehensively identifies tissue and sex associated miRNAs in zebrafish. Further we have discovered 459 novel pre miRNAs 30% seed homology to human miRNA as a genomic resource which can facilitate further investigations to understand miRNA mRNA gene regulatory networks in zebrafish which will have implications in understanding the function of human homologs. Overall design: Known miRNA profiling novel miRNA discovery and identification of tissue associated and sex associated miRNAs from sRNA deep sequencing data of different tissues and embryo of zebrafish in triplicate was carried out using the Illumina HiSeq 2000 platform. | pubmed:26574018 | Ovary Replicate 3 sRNAseq | GSM1376640 | source name:Ovary|gender:female|tissue:Ovary|genetic background:Wild type Singapore strain | Ovary Replicate 3 sRNAseq | Illumina Casava 1.8.2 software used for basecalling. The sequenced reads were first subjected to adapter removal through the cutadapt program Martin 2011. The trimmed reads were then collapsed to remove redundancy and to obtain a unique sequence fasta file through the mapper module of miRDeep2 package Friedländer et al. 2012. The unique reads fasta file was then put through an elimination pipeline module Vaz et al. 2010 comprising of a series of sequence similarity searches with the annotated databases. At each step the reads were matched to an annotated database with a maximum of two mismatches. The matched reads were removed and the unmatched ones were further matched to another annotated database finally culminating into an un annotated pool of reads that served as a source of novel miRNAs and novel sRNAs. The known miRNA expression profile was generated by using the quantifier module of the miRDeep2 package that gives the read counts for the known miRNAs. The quantifier.pl command line used: perl quantifier.pl p <zebrafish precursor miRNA fasta file> m <zebrafish mature miRNA fasta file> r <unique reads fasta file> t Zebrafish The raw reads expression profile generated for all the replicates of the samples were subjected to Trimmed Mean of M values TMM normalisation using the Bioconductor package edgeR Robinson et al. 2010. Genome build: ZV9 Supplementary files format and content: 1. 'Danio rerio known miRNA Rel19 profile Raw.txt': Tab delimited text file that includes the raw counts for the known mature miRNA miRBase Release 19. Supplementary files format and content: 2. 'Danio rerio known miRNA Rel19 profile Normalised.txt': Tab delimited text file that includes the Trimmed Mean of M values TMM normalised counts for the known mature miRNA miRBase Release 19. One of the replicate of Heart MZH008 failed to cluster with the other two replicates on basis of its known miRNA expression profile and hence was not used for further analysis. | Ovary | N/A | Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing. | Fishes were purchased from a local supplier and acclimatized before tissue extraction. | gender:Female|tissue:Ovary|genetic background:Wild type Singapore strain | GSM1376640 | GSM1376640: Ovary Replicate 3 sRNAseq; Danio rerio; miRNA Seq | GSM1376640 | 1 | Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing. | GEO Accession:GSM1376640 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP041544 | MZO006_GATCAG_L008_R1.fastq.gz | fastq | 1411005984.0 | 27666784.0 | GSM1376640 r1 | 0:51 | A:326542153;C:314421825;G:411019622;T:358847379;N:175005 | 51 | 326542153 | 314421825 | 411019622 | 358847379 | 175005 | SRX529151 | SRS598848 | SRA160430 | GEO | Expression and Signaling in Mesenchymal and Hematopoietic Stem Cells, Genome and Gene Expression Data Analysis Division, Bioinformatics Institute, A*STAR, Singapore | 1 | 0.00638 | 0.00068 | 0.99513 | 0.75483 | 51 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | unknown | unknown | Singapore | 2014-04-29 | Undetermined | Embryo | Gonad | Reproductive System | |||||||||||||||||
| 38001 | 38001 | SRR1265756 | SRX529150 | SRS598847 | SRP041544 | PRJNA245824 | Deep sequencing of small RNA facilitates tissue and sex associated microRNA discovery in zebrafish | GSE57169 | Transcriptome Analysis | The role of microRNAs in gene regulation has been well established. The extent of miRNA regulation also increases with increasing genome complexity. Though the number of genes appear to be equal between human and zebrafish substantially less microRNAs have been discovered in zebrafish compared to human Release 19. It appears that most of the miRNAs in zebrafish are yet to be discovered. We sequenced small RNAs from brain gut liver ovary testis eye heart and embryo of zebrafish. In brain gut and liver sequencing was done in male and female separately. Majority of the sequenced reads 16 62% mapped to known miRNAs with the exception of ovary 5.7% and testis 7.8%. Using the miRNA discovery tool miRDeep2 we discovered novel miRNAs from the un annotated reads that ranged from 7.6 to 23.0% with exceptions of ovary 51.4% and testis 55.2%. The prediction tool identified a total of 459 novel pre miRNAs. We compared expression of miRNAs between different tissues and between males and females to identify tissue associated and sex associated miRNAs respectively. These miRNAs could serve as putative biomarkers for these tissues. The brain and liver had highest number of tissue associated 22 and sex associated 34 miRNAs respectively. This study comprehensively identifies tissue and sex associated miRNAs in zebrafish. Further we have discovered 459 novel pre miRNAs 30% seed homology to human miRNA as a genomic resource which can facilitate further investigations to understand miRNA mRNA gene regulatory networks in zebrafish which will have implications in understanding the function of human homologs. Overall design: Known miRNA profiling novel miRNA discovery and identification of tissue associated and sex associated miRNAs from sRNA deep sequencing data of different tissues and embryo of zebrafish in triplicate was carried out using the Illumina HiSeq 2000 platform. | pubmed:26574018 | Ovary Replicate 2 sRNAseq | GSM1376639 | source name:Ovary|gender:female|tissue:Ovary|genetic background:Wild type Singapore strain | Ovary Replicate 2 sRNAseq | Illumina Casava 1.8.2 software used for basecalling. The sequenced reads were first subjected to adapter removal through the cutadapt program Martin 2011. The trimmed reads were then collapsed to remove redundancy and to obtain a unique sequence fasta file through the mapper module of miRDeep2 package Friedländer et al. 2012. The unique reads fasta file was then put through an elimination pipeline module Vaz et al. 2010 comprising of a series of sequence similarity searches with the annotated databases. At each step the reads were matched to an annotated database with a maximum of two mismatches. The matched reads were removed and the unmatched ones were further matched to another annotated database finally culminating into an un annotated pool of reads that served as a source of novel miRNAs and novel sRNAs. The known miRNA expression profile was generated by using the quantifier module of the miRDeep2 package that gives the read counts for the known miRNAs. The quantifier.pl command line used: perl quantifier.pl p <zebrafish precursor miRNA fasta file> m <zebrafish mature miRNA fasta file> r <unique reads fasta file> t Zebrafish The raw reads expression profile generated for all the replicates of the samples were subjected to Trimmed Mean of M values TMM normalisation using the Bioconductor package edgeR Robinson et al. 2010. Genome build: ZV9 Supplementary files format and content: 1. 'Danio rerio known miRNA Rel19 profile Raw.txt': Tab delimited text file that includes the raw counts for the known mature miRNA miRBase Release 19. Supplementary files format and content: 2. 'Danio rerio known miRNA Rel19 profile Normalised.txt': Tab delimited text file that includes the Trimmed Mean of M values TMM normalised counts for the known mature miRNA miRBase Release 19. One of the replicate of Heart MZH008 failed to cluster with the other two replicates on basis of its known miRNA expression profile and hence was not used for further analysis. | Ovary | N/A | Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing. | Fishes were purchased from a local supplier and acclimatized before tissue extraction. | gender:Female|tissue:Ovary|genetic background:Wild type Singapore strain | GSM1376639 | GSM1376639: Ovary Replicate 2 sRNAseq; Danio rerio; miRNA Seq | GSM1376639 | 1 | Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing. | GEO Accession:GSM1376639 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP041544 | MZO005_ACTTGA_L008_R1.fastq.gz | fastq | 765419424.0 | 15008224.0 | GSM1376639 r1 | 0:51 | A:179455664;C:170237021;G:221342071;T:194287721;N:96947 | 51 | 179455664 | 170237021 | 221342071 | 194287721 | 96947 | SRX529150 | SRS598847 | SRA160430 | GEO | Expression and Signaling in Mesenchymal and Hematopoietic Stem Cells, Genome and Gene Expression Data Analysis Division, Bioinformatics Institute, A*STAR, Singapore | 1 | 0.02512 | 0.00355 | 0.98212 | 0.67744 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | unknown | unknown | Singapore | 2014-04-29 | Undetermined | Embryo | Gonad | Reproductive System | |||||||||||||||||
| 38002 | 38002 | SRR1265755 | SRX529149 | SRS598846 | SRP041544 | PRJNA245824 | Deep sequencing of small RNA facilitates tissue and sex associated microRNA discovery in zebrafish | GSE57169 | Transcriptome Analysis | The role of microRNAs in gene regulation has been well established. The extent of miRNA regulation also increases with increasing genome complexity. Though the number of genes appear to be equal between human and zebrafish substantially less microRNAs have been discovered in zebrafish compared to human Release 19. It appears that most of the miRNAs in zebrafish are yet to be discovered. We sequenced small RNAs from brain gut liver ovary testis eye heart and embryo of zebrafish. In brain gut and liver sequencing was done in male and female separately. Majority of the sequenced reads 16 62% mapped to known miRNAs with the exception of ovary 5.7% and testis 7.8%. Using the miRNA discovery tool miRDeep2 we discovered novel miRNAs from the un annotated reads that ranged from 7.6 to 23.0% with exceptions of ovary 51.4% and testis 55.2%. The prediction tool identified a total of 459 novel pre miRNAs. We compared expression of miRNAs between different tissues and between males and females to identify tissue associated and sex associated miRNAs respectively. These miRNAs could serve as putative biomarkers for these tissues. The brain and liver had highest number of tissue associated 22 and sex associated 34 miRNAs respectively. This study comprehensively identifies tissue and sex associated miRNAs in zebrafish. Further we have discovered 459 novel pre miRNAs 30% seed homology to human miRNA as a genomic resource which can facilitate further investigations to understand miRNA mRNA gene regulatory networks in zebrafish which will have implications in understanding the function of human homologs. Overall design: Known miRNA profiling novel miRNA discovery and identification of tissue associated and sex associated miRNAs from sRNA deep sequencing data of different tissues and embryo of zebrafish in triplicate was carried out using the Illumina HiSeq 2000 platform. | pubmed:26574018 | Ovary Replicate 1 sRNAseq | GSM1376638 | source name:Ovary|gender:female|tissue:Ovary|genetic background:Wild type Singapore strain | Ovary Replicate 1 sRNAseq | Illumina Casava 1.8.2 software used for basecalling. The sequenced reads were first subjected to adapter removal through the cutadapt program Martin 2011. The trimmed reads were then collapsed to remove redundancy and to obtain a unique sequence fasta file through the mapper module of miRDeep2 package Friedländer et al. 2012. The unique reads fasta file was then put through an elimination pipeline module Vaz et al. 2010 comprising of a series of sequence similarity searches with the annotated databases. At each step the reads were matched to an annotated database with a maximum of two mismatches. The matched reads were removed and the unmatched ones were further matched to another annotated database finally culminating into an un annotated pool of reads that served as a source of novel miRNAs and novel sRNAs. The known miRNA expression profile was generated by using the quantifier module of the miRDeep2 package that gives the read counts for the known miRNAs. The quantifier.pl command line used: perl quantifier.pl p <zebrafish precursor miRNA fasta file> m <zebrafish mature miRNA fasta file> r <unique reads fasta file> t Zebrafish The raw reads expression profile generated for all the replicates of the samples were subjected to Trimmed Mean of M values TMM normalisation using the Bioconductor package edgeR Robinson et al. 2010. Genome build: ZV9 Supplementary files format and content: 1. 'Danio rerio known miRNA Rel19 profile Raw.txt': Tab delimited text file that includes the raw counts for the known mature miRNA miRBase Release 19. Supplementary files format and content: 2. 'Danio rerio known miRNA Rel19 profile Normalised.txt': Tab delimited text file that includes the Trimmed Mean of M values TMM normalised counts for the known mature miRNA miRBase Release 19. One of the replicate of Heart MZH008 failed to cluster with the other two replicates on basis of its known miRNA expression profile and hence was not used for further analysis. | Ovary | N/A | Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing. | Fishes were purchased from a local supplier and acclimatized before tissue extraction. | gender:Female|tissue:Ovary|genetic background:Wild type Singapore strain | GSM1376638 | GSM1376638: Ovary Replicate 1 sRNAseq; Danio rerio; miRNA Seq | GSM1376638 | 1 | Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing. | GEO Accession:GSM1376638 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP041544 | MZO004_CAGATC_L008_R1.fastq.gz | fastq | 487558674.0 | 9559974.0 | GSM1376638 r1 | 0:51 | A:114833813;C:108951811;G:140408702;T:123302557;N:61791 | 51 | 114833813 | 108951811 | 140408702 | 123302557 | 61791 | SRX529149 | SRS598846 | SRA160430 | GEO | Expression and Signaling in Mesenchymal and Hematopoietic Stem Cells, Genome and Gene Expression Data Analysis Division, Bioinformatics Institute, A*STAR, Singapore | 1 | 0.00298 | 0.0004 | 0.99644 | 0.84584 | 51 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | unknown | unknown | Singapore | 2014-04-29 | Undetermined | Embryo | Gonad | Reproductive System | |||||||||||||||||
| 41150 | 41150 | SRR3744678 | SRX1898686 | SRS1541536 | SRP077941 | PRJNA327880 | Analysis of piRNA production in meioc moto mutant zebrafish testis | GSE84060 | Transcriptome Analysis | We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals. | pubmed:39605693 | moto homozygous 5 | GSM2226636 | tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / | moto homozygous 5 | Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type. | testis | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / | GSM2226636 | GSM2226636: moto homozygous 5; Danio rerio; ncRNA Seq | GSM2226636 | 1 | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | GEO Accession:GSM2226636 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP077941 | 2118467988.0 | 41538588.0 | GSM2226636 r1 | 0:51 | A:616161510;C:469529175;G:576120961;T:456560109;N:96233 | 51 | 616161510 | 469529175 | 576120961 | 456560109 | 96233 | SRX1898686 | SRS1541536 | SRA438045 | GEO | Bioinformatics Core Facility, Institute of Molecular Biology | 1 | 0.52011 | 0.38818 | 0.90193 | 0.51677 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Germany | 2016-07-05 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||||
| 41151 | 41151 | SRR3744677 | SRX1898685 | SRS1541535 | SRP077941 | PRJNA327880 | Analysis of piRNA production in meioc moto mutant zebrafish testis | GSE84060 | Transcriptome Analysis | We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals. | pubmed:39605693 | moto homozygous 4 | GSM2226635 | tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / | moto homozygous 4 | Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type. | testis | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / | GSM2226635 | GSM2226635: moto homozygous 4; Danio rerio; ncRNA Seq | GSM2226635 | 1 | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | GEO Accession:GSM2226635 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP077941 | 1771929771.0 | 34743721.0 | GSM2226635 r1 | 0:51 | A:524609276;C:393148247;G:436902442;T:417188575;N:81231 | 51 | 524609276 | 393148247 | 436902442 | 417188575 | 81231 | SRX1898685 | SRS1541535 | SRA438045 | GEO | Bioinformatics Core Facility, Institute of Molecular Biology | 1 | 0.62874 | 0.45148 | 0.89008 | 0.52837 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Germany | 2016-07-05 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||||
| 41152 | 41152 | SRR3744676 | SRX1898684 | SRS1541534 | SRP077941 | PRJNA327880 | Analysis of piRNA production in meioc moto mutant zebrafish testis | GSE84060 | Transcriptome Analysis | We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals. | pubmed:39605693 | moto homozygous 3 | GSM2226634 | tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / | moto homozygous 3 | Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type. | testis | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / | GSM2226634 | GSM2226634: moto homozygous 3; Danio rerio; ncRNA Seq | GSM2226634 | 1 | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | GEO Accession:GSM2226634 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP077941 | 1849849917.0 | 36271567.0 | GSM2226634 r1 | 0:51 | A:554317433;C:408404232;G:459010543;T:428033928;N:83781 | 51 | 554317433 | 408404232 | 459010543 | 428033928 | 83781 | SRX1898684 | SRS1541534 | SRA438045 | GEO | Bioinformatics Core Facility, Institute of Molecular Biology | 1 | 0.69752 | 0.51829 | 0.89027 | 0.53775 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Germany | 2016-07-05 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||||
| 41153 | 41153 | SRR3744675 | SRX1898683 | SRS1541533 | SRP077941 | PRJNA327880 | Analysis of piRNA production in meioc moto mutant zebrafish testis | GSE84060 | Transcriptome Analysis | We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals. | pubmed:39605693 | moto homozygous 2 | GSM2226633 | tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / | moto homozygous 2 | Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type. | testis | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / | GSM2226633 | GSM2226633: moto homozygous 2; Danio rerio; ncRNA Seq | GSM2226633 | 1 | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | GEO Accession:GSM2226633 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP077941 | 1863615327.0 | 36541477.0 | GSM2226633 r1 | 0:51 | A:554370010;C:414418365;G:465346091;T:429394630;N:86231 | 51 | 554370010 | 414418365 | 465346091 | 429394630 | 86231 | SRX1898683 | SRS1541533 | SRA438045 | GEO | Bioinformatics Core Facility, Institute of Molecular Biology | 1 | 0.74326 | 0.52319 | 0.87361 | 0.53081 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Germany | 2016-07-05 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||||
| 41154 | 41154 | SRR3744674 | SRX1898682 | SRS1541532 | SRP077941 | PRJNA327880 | Analysis of piRNA production in meioc moto mutant zebrafish testis | GSE84060 | Transcriptome Analysis | We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals. | pubmed:39605693 | moto homozygous 1 | GSM2226632 | tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / | moto homozygous 1 | Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type. | testis | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / | GSM2226632 | GSM2226632: moto homozygous 1; Danio rerio; ncRNA Seq | GSM2226632 | 1 | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | GEO Accession:GSM2226632 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP077941 | 1453145193.0 | 28493043.0 | GSM2226632 r1 | 0:51 | A:435644830;C:320413861;G:361678589;T:335340817;N:67096 | 51 | 435644830 | 320413861 | 361678589 | 335340817 | 67096 | SRX1898682 | SRS1541532 | SRA438045 | GEO | Bioinformatics Core Facility, Institute of Molecular Biology | 1 | 0.66367 | 0.47841 | 0.88262 | 0.50114 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Germany | 2016-07-05 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||||
| 41155 | 41155 | SRR3744673 | SRX1898681 | SRS1541531 | SRP077941 | PRJNA327880 | Analysis of piRNA production in meioc moto mutant zebrafish testis | GSE84060 | Transcriptome Analysis | We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals. | pubmed:39605693 | moto heterozygous 6 | GSM2226631 | tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ | moto heterozygous 6 | Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type. | testis | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ | GSM2226631 | GSM2226631: moto heterozygous 6; Danio rerio; ncRNA Seq | GSM2226631 | 1 | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | GEO Accession:GSM2226631 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP077941 | 2009800248.0 | 39407848.0 | GSM2226631 r1 | 0:51 | A:586066305;C:443066820;G:503291347;T:477284226;N:91550 | 51 | 586066305 | 443066820 | 503291347 | 477284226 | 91550 | SRX1898681 | SRS1541531 | SRA438045 | GEO | Bioinformatics Core Facility, Institute of Molecular Biology | 1 | 0.69598 | 0.49191 | 0.8828 | 0.51759 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Germany | 2016-07-05 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||||
| 41156 | 41156 | SRR3744672 | SRX1898680 | SRS1541530 | SRP077941 | PRJNA327880 | Analysis of piRNA production in meioc moto mutant zebrafish testis | GSE84060 | Transcriptome Analysis | We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals. | pubmed:39605693 | moto heterozygous 5 | GSM2226630 | tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ | moto heterozygous 5 | Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type. | testis | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ | GSM2226630 | GSM2226630: moto heterozygous 5; Danio rerio; ncRNA Seq | GSM2226630 | 1 | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | GEO Accession:GSM2226630 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP077941 | 1833618504.0 | 35953304.0 | GSM2226630 r1 | 0:51 | A:510624241;C:446979639;G:473431335;T:402499572;N:83717 | 51 | 510624241 | 446979639 | 473431335 | 402499572 | 83717 | SRX1898680 | SRS1541530 | SRA438045 | GEO | Bioinformatics Core Facility, Institute of Molecular Biology | 1 | 0.73675 | 0.50008 | 0.87957 | 0.53243 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Germany | 2016-07-05 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||||
| 41157 | 41157 | SRR3744671 | SRX1898679 | SRS1541529 | SRP077941 | PRJNA327880 | Analysis of piRNA production in meioc moto mutant zebrafish testis | GSE84060 | Transcriptome Analysis | We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals. | pubmed:39605693 | moto heterozygous 4 | GSM2226629 | tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ | moto heterozygous 4 | Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type. | testis | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ | GSM2226629 | GSM2226629: moto heterozygous 4; Danio rerio; ncRNA Seq | GSM2226629 | 1 | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | GEO Accession:GSM2226629 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP077941 | 2011846776.0 | 39447976.0 | GSM2226629 r1 | 0:51 | A:566935163;C:480777294;G:518987229;T:445055757;N:91333 | 51 | 566935163 | 480777294 | 518987229 | 445055757 | 91333 | SRX1898679 | SRS1541529 | SRA438045 | GEO | Bioinformatics Core Facility, Institute of Molecular Biology | 1 | 0.7246 | 0.49021 | 0.88051 | 0.5202 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Germany | 2016-07-05 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||||
| 41158 | 41158 | SRR3744670 | SRX1898678 | SRS1541528 | SRP077941 | PRJNA327880 | Analysis of piRNA production in meioc moto mutant zebrafish testis | GSE84060 | Transcriptome Analysis | We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals. | pubmed:39605693 | moto heterozygous 3 | GSM2226628 | tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ | moto heterozygous 3 | Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type. | testis | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ | GSM2226628 | GSM2226628: moto heterozygous 3; Danio rerio; ncRNA Seq | GSM2226628 | 1 | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | GEO Accession:GSM2226628 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP077941 | 1618368312.0 | 31732712.0 | GSM2226628 r1 | 0:51 | A:476792369;C:353703619;G:406141931;T:381656601;N:73792 | 51 | 476792369 | 353703619 | 406141931 | 381656601 | 73792 | SRX1898678 | SRS1541528 | SRA438045 | GEO | Bioinformatics Core Facility, Institute of Molecular Biology | 1 | 0.67806 | 0.48273 | 0.88363 | 0.53518 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Germany | 2016-07-05 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||||
| 41159 | 41159 | SRR3744669 | SRX1898677 | SRS1541527 | SRP077941 | PRJNA327880 | Analysis of piRNA production in meioc moto mutant zebrafish testis | GSE84060 | Transcriptome Analysis | We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals. | pubmed:39605693 | moto heterozygous 2 | GSM2226627 | tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ | moto heterozygous 2 | Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type. | testis | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ | GSM2226627 | GSM2226627: moto heterozygous 2; Danio rerio; ncRNA Seq | GSM2226627 | 1 | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | GEO Accession:GSM2226627 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP077941 | 1825076565.0 | 35785815.0 | GSM2226627 r1 | 0:51 | A:543891854;C:404479103;G:451780092;T:424842227;N:83289 | 51 | 543891854 | 404479103 | 451780092 | 424842227 | 83289 | SRX1898677 | SRS1541527 | SRA438045 | GEO | Bioinformatics Core Facility, Institute of Molecular Biology | 1 | 0.53478 | 0.39486 | 0.89899 | 0.52282 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Germany | 2016-07-05 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||||
| 41160 | 41160 | SRR3744668 | SRX1898676 | SRS1541526 | SRP077941 | PRJNA327880 | Analysis of piRNA production in meioc moto mutant zebrafish testis | GSE84060 | Transcriptome Analysis | We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals. | pubmed:39605693 | moto heterozygous 1 | GSM2226626 | tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ | moto heterozygous 1 | Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type. | testis | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ | GSM2226626 | GSM2226626: moto heterozygous 1; Danio rerio; ncRNA Seq | GSM2226626 | 1 | Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. | GEO Accession:GSM2226626 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP077941 | 1358381226.0 | 26634926.0 | GSM2226626 r1 | 0:51 | A:402110510;C:300618987;G:340178435;T:315410530;N:62764 | 51 | 402110510 | 300618987 | 340178435 | 315410530 | 62764 | SRX1898676 | SRS1541526 | SRA438045 | GEO | Bioinformatics Core Facility, Institute of Molecular Biology | 1 | 0.68106 | 0.46812 | 0.87596 | 0.53427 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Germany | 2016-07-05 | Adult | Adult | Gonad | Reproductive System | |||||||||||||||||||||
| 41693 | 41693 | SRR5122167 | SRX2437316 | SRS1872014 | SRP095411 | PRJNA358209 | Identification of a specific 13 miRNA expression signature during follicle activation in Zebrafish | GSE92639 | Transcriptome Analysis | Purpose: We aimed to investigate important miRNA events and to define specific miRNA expression signature underlying the follicle activation of zebrafish. Methods: By using small and regular RNA sequencing we performed transcriptomic analyses of PG primary growth stage I; inactive and PV pre vitellogenic stage II; activated follicles to decipher important miRNA and gene events underlying follicle activation of zebrafish. We identified differentially expressed miRNAs for subsequent qPCR validation and miRNA::target gene prediction. Interaction of candidate miRNA:: target gene pairs were further validated by luciferase reporter assay. Global gene networks involved during PG to PV transition were also assessed by Gene Ontology as well as KEGG pathway analyses. Results and Conclusion: Our expression results indicated that PG follicles can be well differentiated from PV follicles by simply using a specific 13 miRNA expression signature let 7a 7b 7c 5p 7d 5p 7h 7i; miR 21 23a 27c 3p 107a 3p 125b 5p 145 3p 202 5p. Besides we validated interactions of let 7i::atg4a miR 202 5p::c23h20orf24 and miR 144::ybx1 by luciferase reporter assay. Purpose: we aimed to investigate important miRNA events and to define specific miRNA expression signature underlying the follicle activation of zebrafish Overall design: To identify differentially expressed miRNAs and its potential downstream targets during follicle activation of zebrafish we carried out transcriptomic profiling by both small and regular RNA sequencing. By intersecting gene lists of the online predicted targets and RNA seq derived differentially expressed transcripts with a reciprocal expression pattern of miRNAs we shortlisted 6 pairs of miRNA::target gene for validation using luciferase reporter assay. | pubmed:29228146 | PG small RNA seq 2 | GSM2433869 | tissue:Ovarian follicle|strain:AB|cell type:Pre vitellogenic follicle|age:from ovary of 3 month zebrafish | PG small RNA seq 2 | For the RNA seq data all the pair end reads were mapped to the zebrafish genome using TopHat version 2.0.11. Genome annotation files with GTF format for known genes were downloaded from Ensembl. FPKM and RPKM values were calculated for each miRNA and gene respectively using Cufflinks software version 2.2.1 with default parameters. Genome build: Zv9 Ensembl release 79 Supplementary files format and content: tab delimited text files include FFKM for each mRNA transcript; tab delimited text files include RFKM for each miRNA. | Ovarian follicle | Ovaries from 3 mpf adult zebrafish were dissected in 60% medium of Leibovitz L 15 and follicles PG PV were sorted out according to the size and morphology. | RNA was extracted with miRNeasy and RNAeasy extraction kits Qiagen RNA Seq libraries were constructed according to Illumima TrueSeq and small RNA seq protocol and sequenced with the Illumina Hiseq 2000 Single end sequencing and pair end sequencing were used for small RNA seq library and RNA seq library respectively | AB fish was housed under a stable flow through condition at 28°C on a 14L:10D photoperiod with the light on at 0800 and off at 2200. Fish were fed regularly twice a day with live brine shrimp with supplement of commercial tropical fish food at a fixed time basis. | strain:AB|cell type:Pre vitellogenic follicle|age:from ovary of 3 month zebrafish | GSM2433869 | GSM2433869: PG small RNA seq 2; Danio rerio; ncRNA Seq | GSM2433869 | 1 | RNA was extracted with miRNeasy and RNAeasy extraction kits Qiagen RNA Seq libraries were constructed according to Illumima TrueSeq and small RNA seq protocol and sequenced with the Illumina Hiseq 2000 Single end sequencing and pair end sequencing were used for small RNA seq library and RNA seq library respectively | GEO Accession:GSM2433869 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP095411 | Ctrl_PV_1.fq.gz | fastq | 532189753.0 | 19043107.0 | GSM2433869 r1 | 0:27.95 1:0 | A:138460901;C:107807428;G:115489810;T:170431567;N:47 | 27 | 0 | 138460901 | 107807428 | 115489810 | 170431567 | 47 | SRX2437316 | SRS1872014 | SRA505873 | GEO | Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institute of Health | 1 | 0.86612 | 0.65562 | 0.84486 | 0.53167 | 26 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | unknown | unknown | United States | 2016-12-20 | Adult | Adult | Gonad | Reproductive System | ||||||||||||||||
| 41694 | 41694 | SRR5122166 | SRX2437315 | SRS1872013 | SRP095411 | PRJNA358209 | Identification of a specific 13 miRNA expression signature during follicle activation in Zebrafish | GSE92639 | Transcriptome Analysis | Purpose: We aimed to investigate important miRNA events and to define specific miRNA expression signature underlying the follicle activation of zebrafish. Methods: By using small and regular RNA sequencing we performed transcriptomic analyses of PG primary growth stage I; inactive and PV pre vitellogenic stage II; activated follicles to decipher important miRNA and gene events underlying follicle activation of zebrafish. We identified differentially expressed miRNAs for subsequent qPCR validation and miRNA::target gene prediction. Interaction of candidate miRNA:: target gene pairs were further validated by luciferase reporter assay. Global gene networks involved during PG to PV transition were also assessed by Gene Ontology as well as KEGG pathway analyses. Results and Conclusion: Our expression results indicated that PG follicles can be well differentiated from PV follicles by simply using a specific 13 miRNA expression signature let 7a 7b 7c 5p 7d 5p 7h 7i; miR 21 23a 27c 3p 107a 3p 125b 5p 145 3p 202 5p. Besides we validated interactions of let 7i::atg4a miR 202 5p::c23h20orf24 and miR 144::ybx1 by luciferase reporter assay. Purpose: we aimed to investigate important miRNA events and to define specific miRNA expression signature underlying the follicle activation of zebrafish Overall design: To identify differentially expressed miRNAs and its potential downstream targets during follicle activation of zebrafish we carried out transcriptomic profiling by both small and regular RNA sequencing. By intersecting gene lists of the online predicted targets and RNA seq derived differentially expressed transcripts with a reciprocal expression pattern of miRNAs we shortlisted 6 pairs of miRNA::target gene for validation using luciferase reporter assay. | pubmed:29228146 | PG small RNA seq 1 | GSM2433868 | tissue:Ovarian follicle|strain:AB|cell type:Primary growth follicle|age:from ovary of 3 month zebrafish | PG small RNA seq 1 | For the RNA seq data all the pair end reads were mapped to the zebrafish genome using TopHat version 2.0.11. Genome annotation files with GTF format for known genes were downloaded from Ensembl. FPKM and RPKM values were calculated for each miRNA and gene respectively using Cufflinks software version 2.2.1 with default parameters. Genome build: Zv9 Ensembl release 79 Supplementary files format and content: tab delimited text files include FFKM for each mRNA transcript; tab delimited text files include RFKM for each miRNA. | Ovarian follicle | Ovaries from 3 mpf adult zebrafish were dissected in 60% medium of Leibovitz L 15 and follicles PG PV were sorted out according to the size and morphology. | RNA was extracted with miRNeasy and RNAeasy extraction kits Qiagen RNA Seq libraries were constructed according to Illumima TrueSeq and small RNA seq protocol and sequenced with the Illumina Hiseq 2000 Single end sequencing and pair end sequencing were used for small RNA seq library and RNA seq library respectively | AB fish was housed under a stable flow through condition at 28°C on a 14L:10D photoperiod with the light on at 0800 and off at 2200. Fish were fed regularly twice a day with live brine shrimp with supplement of commercial tropical fish food at a fixed time basis. | strain:AB|cell type:Primary growth follicle|age:from ovary of 3 month zebrafish | GSM2433868 | GSM2433868: PG small RNA seq 1; Danio rerio; ncRNA Seq | GSM2433868 | 1 | RNA was extracted with miRNeasy and RNAeasy extraction kits Qiagen RNA Seq libraries were constructed according to Illumima TrueSeq and small RNA seq protocol and sequenced with the Illumina Hiseq 2000 Single end sequencing and pair end sequencing were used for small RNA seq library and RNA seq library respectively | GEO Accession:GSM2433868 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP095411 | Ctrl_PG_1.fq.gz | fastq | 368945203.0 | 13147324.0 | GSM2433868 r1 | 0:28.06 1:0 | A:96466912;C:75527992;G:78177838;T:118772423;N:38 | 28 | 0 | 96466912 | 75527992 | 78177838 | 118772423 | 38 | SRX2437315 | SRS1872013 | SRA505873 | GEO | Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institute of Health | 1 | 0.8524 | 0.67638 | 0.86074 | 0.48958 | 27 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | unknown | unknown | United States | 2016-12-20 | Adult | Adult | Gonad | Reproductive System | ||||||||||||||||
| 44967 | 44967 | SRR6345660 | SRX3442976 | SRS2733636 | SRP126106 | PRJNA421016 | Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA] | GSE107682 | Transcriptome Analysis | Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish. | parent bioproject:PRJNA315403 | pubmed:30086300 | smRNA seq library of ovary from tdrd6a mut fish | GSM2875719 | source name:Ovary from tdrd6a mut fish|tissue:whole ovary|genotype:tdrd6a mutant | smRNA seq library of ovary from tdrd6a mut fish | 1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15 6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities. 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to. Supplementary files format and content: Files ending in .bw are bigwig tracks. | Ovary from tdrd6a mut fish | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | tissue:whole ovary|genotype:tdrd6a mutant | GSM2875719 | GSM2875719: smRNA seq library of ovary from tdrd6a mut fish; Danio rerio; ncRNA Seq | GSM2875719 | 1 | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | GEO Accession:GSM2875719 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP126106 | Tdrd6a-mut-ovary-input-Adult.fastq.gz | fastq | 817885062.0 | 16036962.0 | GSM2875719 r1 | 0:51 | A:212456064;C:163491733;G:233627239;T:208262707;N:47319 | 51 | 212456064 | 163491733 | 233627239 | 208262707 | 47319 | SRX3442976 | SRS2733636 | SRA636010 | GEO | Rene Ketting, RNA silencing, IMB | 1 | 0.46308 | 0.13668 | 0.83587 | 0.79104 | 51 | B | usable mapping rate | illumina | hiseq_era | 5prime | size_fractionation | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2017-12-04 | Undetermined | Undetermined | Gonad | Reproductive System | ||||||||||||||||||
| 44968 | 44968 | SRR6345659 | SRX3442975 | SRS2733637 | SRP126106 | PRJNA421016 | Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA] | GSE107682 | Transcriptome Analysis | Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish. | parent bioproject:PRJNA315403 | pubmed:30086300 | smRNA seq library of ovary from tdrd6a het fish | GSM2875718 | source name:Ovary from tdrd6a het fish|tissue:whole ovary|genotype:tdrd6a heterozygous | smRNA seq library of ovary from tdrd6a het fish | 1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15 6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities. 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to. Supplementary files format and content: Files ending in .bw are bigwig tracks. | Ovary from tdrd6a het fish | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | tissue:whole ovary|genotype:tdrd6a heterozygous | GSM2875718 | GSM2875718: smRNA seq library of ovary from tdrd6a het fish; Danio rerio; ncRNA Seq | GSM2875718 | 1 | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | GEO Accession:GSM2875718 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP126106 | Tdrd6a-het-ovary-input-Adult.fastq.gz | fastq | 1452353571.0 | 28477521.0 | GSM2875718 r1 | 0:51 | A:397993735;C:284194126;G:396142390;T:373939235;N:84085 | 51 | 397993735 | 284194126 | 396142390 | 373939235 | 84085 | SRX3442975 | SRS2733637 | SRA636010 | GEO | Rene Ketting, RNA silencing, IMB | 1 | 0.3869 | 0.1369 | 0.86397 | 0.77165 | 51 | B | usable mapping rate | illumina | hiseq_era | 5prime | size_fractionation | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2017-12-04 | Undetermined | Undetermined | Gonad | Reproductive System | ||||||||||||||||||
| 52326 | 52326 | SRR9119512 | SRX5893495 | SRS4815090 | SRP199448 | PRJNA544696 | Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells | GSE131759 | Transcriptome Analysis | MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expr… | pubmed:31417497 | IIIb 3 | GSM3816534 | source name:stage IIIb follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIb | IIIb 3 | LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample | stage IIIb follicular cells | Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols | tissue:ovary|cell type:follicular cells|developmental stage:IIIb | GSM3816534 | GSM3816534: IIIb 3; Danio rerio; miRNA Seq | GSM3816534 | 1 | Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols | GEO Accession:GSM3816534 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP199448 | HI.2030.005.RPI10.IIIb_3_R1.fastq.gz | fastq | 1449340900.0 | 28986818.0 | GSM3816534 r1 | 0:50 1:0 | A:351029701;C:324452324;G:401722902;T:371889768;N:246205 | 50 | 0 | 351029701 | 324452324 | 401722902 | 371889768 | 246205 | SRX5893495 | SRS4815090 | SRA890399 | GEO | Biology, YorkU | 1 | 0.08662 | 0.01333 | 0.96213 | 0.83838 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | unknown | bulk | unknown | unknown | Canada | 2019-05-24 | Undetermined | Undetermined | Gonad | Reproductive System | ||||||||||||||||||
| 52327 | 52327 | SRR9119513 | SRX5893495 | SRS4815090 | SRP199448 | PRJNA544696 | Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells | GSE131759 | Transcriptome Analysis | MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expr… | pubmed:31417497 | IIIb 3 | GSM3816534 | source name:stage IIIb follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIb | IIIb 3 | LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample | stage IIIb follicular cells | Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols | tissue:ovary|cell type:follicular cells|developmental stage:IIIb | GSM3816534 | GSM3816534: IIIb 3; Danio rerio; miRNA Seq | GSM3816534 | 1 | Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols | GEO Accession:GSM3816534 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP199448 | HI.2030.006.RPI10.IIIb_3_R1.fastq | fastq | 1447621100.0 | 28952422.0 | GSM3816534 r2 | 0:50 1:0 | A:350650304;C:324162528;G:401055729;T:371582418;N:170121 | 50 | 0 | 350650304 | 324162528 | 401055729 | 371582418 | 170121 | SRX5893495 | SRS4815090 | SRA890399 | GEO | Biology, YorkU | 1 | 0.08676 | 0.01312 | 0.96282 | 0.84604 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | unknown | bulk | unknown | unknown | Canada | 2019-05-24 | Undetermined | Undetermined | Gonad | Reproductive System | ||||||||||||||||||
| 52328 | 52328 | SRR9119510 | SRX5893494 | SRS4815089 | SRP199448 | PRJNA544696 | Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells | GSE131759 | Transcriptome Analysis | MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expr… | pubmed:31417497 | IIIb 2 | GSM3816533 | source name:stage IIIb follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIb | IIIb 2 | LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample | stage IIIb follicular cells | Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols | tissue:ovary|cell type:follicular cells|developmental stage:IIIb | GSM3816533 | GSM3816533: IIIb 2; Danio rerio; miRNA Seq | GSM3816533 | 1 | Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols | GEO Accession:GSM3816533 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP199448 | HI.2030.005.RPI9.IIIb_2_R1.fastq.gz | fastq | 1012538750.0 | 20250775.0 | GSM3816533 r1 | 0:50 1:0 | A:242873339;C:228078637;G:287889366;T:253526026;N:171382 | 50 | 0 | 242873339 | 228078637 | 287889366 | 253526026 | 171382 | SRX5893494 | SRS4815089 | SRA890399 | GEO | Biology, YorkU | 1 | 0.04745 | 0.00802 | 0.968 | 0.75298 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | unknown | bulk | unknown | unknown | Canada | 2019-05-24 | Undetermined | Undetermined | Gonad | Reproductive System | ||||||||||||||||||
| 52329 | 52329 | SRR9119511 | SRX5893494 | SRS4815089 | SRP199448 | PRJNA544696 | Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells | GSE131759 | Transcriptome Analysis | MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expr… | pubmed:31417497 | IIIb 2 | GSM3816533 | source name:stage IIIb follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIb | IIIb 2 | LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample | stage IIIb follicular cells | Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols | tissue:ovary|cell type:follicular cells|developmental stage:IIIb | GSM3816533 | GSM3816533: IIIb 2; Danio rerio; miRNA Seq | GSM3816533 | 1 | Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols | GEO Accession:GSM3816533 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP199448 | HI.2030.006.RPI9.IIIb_2_R1.fastq | fastq | 1010559400.0 | 20211188.0 | GSM3816533 r2 | 0:50 1:0 | A:242471282;C:227664296;G:287157957;T:253147388;N:118477 | 50 | 0 | 242471282 | 227664296 | 287157957 | 253147388 | 118477 | SRX5893494 | SRS4815089 | SRA890399 | GEO | Biology, YorkU | 1 | 0.04679 | 0.008 | 0.96946 | 0.71268 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | unknown | bulk | unknown | unknown | Canada | 2019-05-24 | Undetermined | Undetermined | Gonad | Reproductive System | ||||||||||||||||||
| 52330 | 52330 | SRR9119508 | SRX5893493 | SRS4815088 | SRP199448 | PRJNA544696 | Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells | GSE131759 | Transcriptome Analysis | MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expr… | pubmed:31417497 | IIIb 1 | GSM3816532 | source name:stage IIIb follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIb | IIIb 1 | LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample | stage IIIb follicular cells | Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols | tissue:ovary|cell type:follicular cells|developmental stage:IIIb | GSM3816532 | GSM3816532: IIIb 1; Danio rerio; miRNA Seq | GSM3816532 | 1 | Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols | GEO Accession:GSM3816532 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP199448 | HI.2030.005.RPI8.IIIb_1_R1.fastq.gz | fastq | 1443846950.0 | 28876939.0 | GSM3816532 r1 | 0:50 1:0 | A:350805103;C:319766230;G:407583206;T:365448522;N:243889 | 50 | 0 | 350805103 | 319766230 | 407583206 | 365448522 | 243889 | SRX5893493 | SRS4815088 | SRA890399 | GEO | Biology, YorkU | 1 | 0.02559 | 0.00389 | 0.98407 | 0.82023 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | unknown | bulk | unknown | unknown | Canada | 2019-05-24 | Undetermined | Undetermined | Gonad | Reproductive System | ||||||||||||||||||
| 52331 | 52331 | SRR9119509 | SRX5893493 | SRS4815088 | SRP199448 | PRJNA544696 | Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells | GSE131759 | Transcriptome Analysis | MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expr… | pubmed:31417497 | IIIb 1 | GSM3816532 | source name:stage IIIb follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIb | IIIb 1 | LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample | stage IIIb follicular cells | Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols | tissue:ovary|cell type:follicular cells|developmental stage:IIIb | GSM3816532 | GSM3816532: IIIb 1; Danio rerio; miRNA Seq | GSM3816532 | 1 | Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols | GEO Accession:GSM3816532 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP199448 | HI.2030.006.RPI8.IIIb_1_R1.fastq | fastq | 1442694250.0 | 28853885.0 | GSM3816532 r2 | 0:50 1:0 | A:350607715;C:319569609;G:407049947;T:365297986;N:168993 | 50 | 0 | 350607715 | 319569609 | 407049947 | 365297986 | 168993 | SRX5893493 | SRS4815088 | SRA890399 | GEO | Biology, YorkU | 1 | 0.02565 | 0.00409 | 0.98417 | 0.81633 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | unknown | bulk | unknown | unknown | Canada | 2019-05-24 | Undetermined | Undetermined | Gonad | Reproductive System | ||||||||||||||||||
| 52332 | 52332 | SRR9119506 | SRX5893492 | SRS4815087 | SRP199448 | PRJNA544696 | Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells | GSE131759 | Transcriptome Analysis | MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expr… | pubmed:31417497 | IIIa 3 | GSM3816531 | source name:stage IIIa follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIa | IIIa 3 | LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample | stage IIIa follicular cells | Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols | tissue:ovary|cell type:follicular cells|developmental stage:IIIa | GSM3816531 | GSM3816531: IIIa 3; Danio rerio; miRNA Seq | GSM3816531 | 1 | Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols | GEO Accession:GSM3816531 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP199448 | HI.2030.005.RPI4.IIIa_3_R1.fastq.gz | fastq | 1324489100.0 | 26489782.0 | GSM3816531 r1 | 0:50 1:0 | A:333465386;C:289207984;G:364882545;T:336711699;N:221486 | 50 | 0 | 333465386 | 289207984 | 364882545 | 336711699 | 221486 | SRX5893492 | SRS4815087 | SRA890399 | GEO | Biology, YorkU | 1 | 0.02703 | 0.00432 | 0.98313 | 0.75385 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | unknown | bulk | unknown | unknown | Canada | 2019-05-24 | Undetermined | Undetermined | Gonad | Reproductive System | ||||||||||||||||||
| 52333 | 52333 | SRR9119507 | SRX5893492 | SRS4815087 | SRP199448 | PRJNA544696 | Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells | GSE131759 | Transcriptome Analysis | MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expr… | pubmed:31417497 | IIIa 3 | GSM3816531 | source name:stage IIIa follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIa | IIIa 3 | LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample | stage IIIa follicular cells | Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols | tissue:ovary|cell type:follicular cells|developmental stage:IIIa | GSM3816531 | GSM3816531: IIIa 3; Danio rerio; miRNA Seq | GSM3816531 | 1 | Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols | GEO Accession:GSM3816531 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP199448 | HI.2030.006.RPI4.IIIa_3_R1.fastq | fastq | 1322554650.0 | 26451093.0 | GSM3816531 r2 | 0:50 1:0 | A:333031673;C:288843797;G:364209143;T:336315522;N:154515 | 50 | 0 | 333031673 | 288843797 | 364209143 | 336315522 | 154515 | SRX5893492 | SRS4815087 | SRA890399 | GEO | Biology, YorkU | 1 | 0.02671 | 0.00422 | 0.98283 | 0.76748 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | unknown | bulk | unknown | unknown | Canada | 2019-05-24 | Undetermined | Undetermined | Gonad | Reproductive System | ||||||||||||||||||
| 52334 | 52334 | SRR9119504 | SRX5893491 | SRS4815086 | SRP199448 | PRJNA544696 | Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells | GSE131759 | Transcriptome Analysis | MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expr… | pubmed:31417497 | IIIa 2 | GSM3816530 | source name:stage IIIa follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIa | IIIa 2 | LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample | stage IIIa follicular cells | Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols | tissue:ovary|cell type:follicular cells|developmental stage:IIIa | GSM3816530 | GSM3816530: IIIa 2; Danio rerio; miRNA Seq | GSM3816530 | 1 | Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols | GEO Accession:GSM3816530 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP199448 | HI.2030.005.RPI3.IIIa_2_R1.fastq.gz | fastq | 1382308600.0 | 27646172.0 | GSM3816530 r1 | 0:50 1:0 | A:342206537;C:301597185;G:385756857;T:352517232;N:230789 | 50 | 0 | 342206537 | 301597185 | 385756857 | 352517232 | 230789 | SRX5893491 | SRS4815086 | SRA890399 | GEO | Biology, YorkU | 1 | 0.05315 | 0.00892 | 0.9643 | 0.79967 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | unknown | bulk | unknown | unknown | Canada | 2019-05-24 | Undetermined | Undetermined | Gonad | Reproductive System | ||||||||||||||||||
| 52335 | 52335 | SRR9119505 | SRX5893491 | SRS4815086 | SRP199448 | PRJNA544696 | Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells | GSE131759 | Transcriptome Analysis | MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expr… | pubmed:31417497 | IIIa 2 | GSM3816530 | source name:stage IIIa follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIa | IIIa 2 | LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample | stage IIIa follicular cells | Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols | tissue:ovary|cell type:follicular cells|developmental stage:IIIa | GSM3816530 | GSM3816530: IIIa 2; Danio rerio; miRNA Seq | GSM3816530 | 1 | Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols | GEO Accession:GSM3816530 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP199448 | HI.2030.006.RPI3.IIIa_2_R1.fastq | fastq | 1383050750.0 | 27661015.0 | GSM3816530 r2 | 0:50 1:0 | A:342441286;C:301828080;G:385820344;T:352800933;N:160107 | 50 | 0 | 342441286 | 301828080 | 385820344 | 352800933 | 160107 | SRX5893491 | SRS4815086 | SRA890399 | GEO | Biology, YorkU | 1 | 0.0533 | 0.00892 | 0.96323 | 0.81292 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | unknown | bulk | unknown | unknown | Canada | 2019-05-24 | Undetermined | Undetermined | Gonad | Reproductive System | ||||||||||||||||||
| 52336 | 52336 | SRR9119502 | SRX5893490 | SRS4815085 | SRP199448 | PRJNA544696 | Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells | GSE131759 | Transcriptome Analysis | MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expr… | pubmed:31417497 | IIIa 1 | GSM3816529 | source name:stage IIIa follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIa | IIIa 1 | LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample | stage IIIa follicular cells | Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols | tissue:ovary|cell type:follicular cells|developmental stage:IIIa | GSM3816529 | GSM3816529: IIIa 1; Danio rerio; miRNA Seq | GSM3816529 | 1 | Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols | GEO Accession:GSM3816529 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP199448 | HI.2030.005.RPI2.IIIa_1_R1.fastq.gz | fastq | 1333818450.0 | 26676369.0 | GSM3816529 r1 | 0:50 1:0 | A:320039883;C:296663387;G:380656068;T:336233800;N:225312 | 50 | 0 | 320039883 | 296663387 | 380656068 | 336233800 | 225312 | SRX5893490 | SRS4815085 | SRA890399 | GEO | Biology, YorkU | 1 | 0.0976 | 0.019 | 0.93718 | 0.75404 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | unknown | bulk | unknown | unknown | Canada | 2019-05-24 | Undetermined | Undetermined | Gonad | Reproductive System | ||||||||||||||||||
| 52337 | 52337 | SRR9119503 | SRX5893490 | SRS4815085 | SRP199448 | PRJNA544696 | Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells | GSE131759 | Transcriptome Analysis | MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expr… | pubmed:31417497 | IIIa 1 | GSM3816529 | source name:stage IIIa follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIa | IIIa 1 | LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample | stage IIIa follicular cells | Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols | tissue:ovary|cell type:follicular cells|developmental stage:IIIa | GSM3816529 | GSM3816529: IIIa 1; Danio rerio; miRNA Seq | GSM3816529 | 1 | Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols | GEO Accession:GSM3816529 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP199448 | HI.2030.006.RPI2.IIIa_1_R1.fastq | fastq | 1334152750.0 | 26683055.0 | GSM3816529 r2 | 0:50 1:0 | A:320194547;C:296827909;G:380547854;T:336424243;N:158197 | 50 | 0 | 320194547 | 296827909 | 380547854 | 336424243 | 158197 | SRX5893490 | SRS4815085 | SRA890399 | GEO | Biology, YorkU | 1 | 0.09727 | 0.01947 | 0.93866 | 0.76527 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | unknown | bulk | unknown | unknown | Canada | 2019-05-24 | Undetermined | Undetermined | Gonad | Reproductive System | ||||||||||||||||||
| 60887 | 60887 | SRR12628234 | SRX9110497 | SRS7353480 | SRP282187 | PRJNA663091 | Characterization of small RNAs in early zebrafish PGCs | GSE157865 | Transcriptome Analysis | Microscale small RNA high throughput sequencing was used to study small RNA distribution in early zebrafish PGCs primordial germ cells. We find that early zebrafish PGCs have large quantities of piRNAs and small quantities of miRNAs. Among the miRNAs detected miR 430 accounted for the majority which has been proved to play diverse roles in zebrafish development. In addition miR 92a 3p and miR 26a 5p have high expression and previous studies show that these two miRNAs can influence cell proliferation in cancer cells. More experiments should be performed in the future to explore whether miR 92a 3p and miR 26a 5p can influence the number of zebrafish PGCs. Overall design: Small RNA profiles at 6 hpf shield stage 11 hpf 3 somite stage and 24 hpf prim 5 stage of zebrafish PGCs | pubmed:33506864 | h24 2: PGCs 24hpf repeat2 | GSM4777194 | source name:PGCs|cell type:primordial germ cells|strain:AB|tissue:gonad | h24 2: PGCs 24hpf repeat2 | Raw reads were pre processed by FASTX Toolkit version 0.0.14 1 Reads were mapped to danRer11 using bowtie version 1.0.0 5 miRNAs were quantified based on miRBase version 22.0 piRNAs were quantified using proTRAC version 2.2.0 Genome build: danRer11 Supplementary files format and content: tab delimited text file includes read number and RPM of miRNA expression for each sample … | PGCs | PGCs were picked out by green fluoresence small RNA seq library was constructed by microscale small RNA high throughput sequencing method. | cell type:primordial germ cells|strain:AB|tissue:gonad | GSM4777194 | GSM4777194: h24 2: PGCs 24hpf repeat2; Danio rerio; miRNA Seq | GSM4777194 | 1 | PGCs were picked out by green fluoresence small RNA seq library was constructed by microscale small RNA high throughput sequencing method. | GEO Accession:GSM4777194 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | HiSeq X Ten | SRP282187 | h24_2.fastq | fastq | 4024398750.0 | 26829325.0 | GSM4777194 r1 | 0:150 1:0 | A:1030703487;C:1025857271;G:1004392553;T:963376583;N:68856 | 150 | 0 | 1030703487 | 1025857271 | 1004392553 | 963376583 | 68856 | SRX9110497 | SRS7353480 | SRA1124474 | GEO | Shanghai Institute of Biochemistry and Cell Biology,CAS | 1 | 0.00025 | 0.0 | 0.99997 | 1.0 | 150 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | unknown | bulk | unknown | unknown | China | 2020-09-12 | Pharyngula | Embryo | Gonad | Reproductive System | ||||||||||||||||||
| 60888 | 60888 | SRR12628233 | SRX9110496 | SRS7353479 | SRP282187 | PRJNA663091 | Characterization of small RNAs in early zebrafish PGCs | GSE157865 | Transcriptome Analysis | Microscale small RNA high throughput sequencing was used to study small RNA distribution in early zebrafish PGCs primordial germ cells. We find that early zebrafish PGCs have large quantities of piRNAs and small quantities of miRNAs. Among the miRNAs detected miR 430 accounted for the majority which has been proved to play diverse roles in zebrafish development. In addition miR 92a 3p and miR 26a 5p have high expression and previous studies show that these two miRNAs can influence cell proliferation in cancer cells. More experiments should be performed in the future to explore whether miR 92a 3p and miR 26a 5p can influence the number of zebrafish PGCs. Overall design: Small RNA profiles at 6 hpf shield stage 11 hpf 3 somite stage and 24 hpf prim 5 stage of zebrafish PGCs | pubmed:33506864 | h24 1: PGCs 24hpf repeat1 | GSM4777193 | source name:PGCs|cell type:primordial germ cells|strain:AB|tissue:gonad | h24 1: PGCs 24hpf repeat1 | Raw reads were pre processed by FASTX Toolkit version 0.0.14 1 Reads were mapped to danRer11 using bowtie version 1.0.0 5 miRNAs were quantified based on miRBase version 22.0 piRNAs were quantified using proTRAC version 2.2.0 Genome build: danRer11 Supplementary files format and content: tab delimited text file includes read number and RPM of miRNA expression for each sample … | PGCs | PGCs were picked out by green fluoresence small RNA seq library was constructed by microscale small RNA high throughput sequencing method. | cell type:primordial germ cells|strain:AB|tissue:gonad | GSM4777193 | GSM4777193: h24 1: PGCs 24hpf repeat1; Danio rerio; miRNA Seq | GSM4777193 | 1 | PGCs were picked out by green fluoresence small RNA seq library was constructed by microscale small RNA high throughput sequencing method. | GEO Accession:GSM4777193 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | HiSeq X Ten | SRP282187 | h24_1.fastq | fastq | 2223111450.0 | 14820743.0 | GSM4777193 r1 | 0:150 1:0 | A:510125618;C:561938103;G:577742482;T:573267493;N:37754 | 150 | 0 | 510125618 | 561938103 | 577742482 | 573267493 | 37754 | SRX9110496 | SRS7353479 | SRA1124474 | GEO | Shanghai Institute of Biochemistry and Cell Biology,CAS | 1 | 0.0004 | 0.0 | 0.99993 | 1.0 | 150 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | unknown | bulk | unknown | unknown | China | 2020-09-12 | Pharyngula | Embryo | Gonad | Reproductive System | ||||||||||||||||||
| 60889 | 60889 | SRR12628232 | SRX9110495 | SRS7353478 | SRP282187 | PRJNA663091 | Characterization of small RNAs in early zebrafish PGCs | GSE157865 | Transcriptome Analysis | Microscale small RNA high throughput sequencing was used to study small RNA distribution in early zebrafish PGCs primordial germ cells. We find that early zebrafish PGCs have large quantities of piRNAs and small quantities of miRNAs. Among the miRNAs detected miR 430 accounted for the majority which has been proved to play diverse roles in zebrafish development. In addition miR 92a 3p and miR 26a 5p have high expression and previous studies show that these two miRNAs can influence cell proliferation in cancer cells. More experiments should be performed in the future to explore whether miR 92a 3p and miR 26a 5p can influence the number of zebrafish PGCs. Overall design: Small RNA profiles at 6 hpf shield stage 11 hpf 3 somite stage and 24 hpf prim 5 stage of zebrafish PGCs | pubmed:33506864 | h11 2: PGCs 11hpf repeat2 | GSM4777192 | source name:PGCs|cell type:primordial germ cells|strain:AB|tissue:gonad | h11 2: PGCs 11hpf repeat2 | Raw reads were pre processed by FASTX Toolkit version 0.0.14 1 Reads were mapped to danRer11 using bowtie version 1.0.0 5 miRNAs were quantified based on miRBase version 22.0 piRNAs were quantified using proTRAC version 2.2.0 Genome build: danRer11 Supplementary files format and content: tab delimited text file includes read number and RPM of miRNA expression for each sample … | PGCs | PGCs were picked out by green fluoresence small RNA seq library was constructed by microscale small RNA high throughput sequencing method. | cell type:primordial germ cells|strain:AB|tissue:gonad | GSM4777192 | GSM4777192: h11 2: PGCs 11hpf repeat2; Danio rerio; miRNA Seq | GSM4777192 | 1 | PGCs were picked out by green fluoresence small RNA seq library was constructed by microscale small RNA high throughput sequencing method. | GEO Accession:GSM4777192 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | HiSeq X Ten | SRP282187 | h11_2.fastq | fastq | 1725506100.0 | 11503374.0 | GSM4777192 r1 | 0:150 1:0 | A:419294958;C:415643261;G:432730446;T:457808038;N:29397 | 150 | 0 | 419294958 | 415643261 | 432730446 | 457808038 | 29397 | SRX9110495 | SRS7353478 | SRA1124474 | GEO | Shanghai Institute of Biochemistry and Cell Biology,CAS | 1 | 0.00062 | 0.0 | 0.99991 | 1.0 | 150 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | unknown | bulk | unknown | unknown | China | 2020-09-12 | Segmentation | Embryo | Gonad | Reproductive System | ||||||||||||||||||
| 60890 | 60890 | SRR12628231 | SRX9110494 | SRS7353477 | SRP282187 | PRJNA663091 | Characterization of small RNAs in early zebrafish PGCs | GSE157865 | Transcriptome Analysis | Microscale small RNA high throughput sequencing was used to study small RNA distribution in early zebrafish PGCs primordial germ cells. We find that early zebrafish PGCs have large quantities of piRNAs and small quantities of miRNAs. Among the miRNAs detected miR 430 accounted for the majority which has been proved to play diverse roles in zebrafish development. In addition miR 92a 3p and miR 26a 5p have high expression and previous studies show that these two miRNAs can influence cell proliferation in cancer cells. More experiments should be performed in the future to explore whether miR 92a 3p and miR 26a 5p can influence the number of zebrafish PGCs. Overall design: Small RNA profiles at 6 hpf shield stage 11 hpf 3 somite stage and 24 hpf prim 5 stage of zebrafish PGCs | pubmed:33506864 | h11 1: PGCs 11hpf repeat1 | GSM4777191 | source name:PGCs|cell type:primordial germ cells|strain:AB|tissue:gonad | h11 1: PGCs 11hpf repeat1 | Raw reads were pre processed by FASTX Toolkit version 0.0.14 1 Reads were mapped to danRer11 using bowtie version 1.0.0 5 miRNAs were quantified based on miRBase version 22.0 piRNAs were quantified using proTRAC version 2.2.0 Genome build: danRer11 Supplementary files format and content: tab delimited text file includes read number and RPM of miRNA expression for each sample … | PGCs | PGCs were picked out by green fluoresence small RNA seq library was constructed by microscale small RNA high throughput sequencing method. | cell type:primordial germ cells|strain:AB|tissue:gonad | GSM4777191 | GSM4777191: h11 1: PGCs 11hpf repeat1; Danio rerio; miRNA Seq | GSM4777191 | 1 | PGCs were picked out by green fluoresence small RNA seq library was constructed by microscale small RNA high throughput sequencing method. | GEO Accession:GSM4777191 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | HiSeq X Ten | SRP282187 | h11_1.fastq | fastq | 2690366550.0 | 17935777.0 | GSM4777191 r1 | 0:150 1:0 | A:722881530;C:687611993;G:633563837;T:646263376;N:45814 | 150 | 0 | 722881530 | 687611993 | 633563837 | 646263376 | 45814 | SRX9110494 | SRS7353477 | SRA1124474 | GEO | Shanghai Institute of Biochemistry and Cell Biology,CAS | 1 | 0.0006 | 0.0 | 0.99991 | 1.0 | 150 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | unknown | bulk | unknown | unknown | China | 2020-09-12 | Segmentation | Embryo | Gonad | Reproductive System | ||||||||||||||||||
| 60891 | 60891 | SRR12628230 | SRX9110493 | SRS7353476 | SRP282187 | PRJNA663091 | Characterization of small RNAs in early zebrafish PGCs | GSE157865 | Transcriptome Analysis | Microscale small RNA high throughput sequencing was used to study small RNA distribution in early zebrafish PGCs primordial germ cells. We find that early zebrafish PGCs have large quantities of piRNAs and small quantities of miRNAs. Among the miRNAs detected miR 430 accounted for the majority which has been proved to play diverse roles in zebrafish development. In addition miR 92a 3p and miR 26a 5p have high expression and previous studies show that these two miRNAs can influence cell proliferation in cancer cells. More experiments should be performed in the future to explore whether miR 92a 3p and miR 26a 5p can influence the number of zebrafish PGCs. Overall design: Small RNA profiles at 6 hpf shield stage 11 hpf 3 somite stage and 24 hpf prim 5 stage of zebrafish PGCs | pubmed:33506864 | h6 2: PGCs 6hpf repeat2 | GSM4777190 | source name:PGCs|cell type:primordial germ cells|strain:AB|tissue:gonad | h6 2: PGCs 6hpf repeat2 | Raw reads were pre processed by FASTX Toolkit version 0.0.14 1 Reads were mapped to danRer11 using bowtie version 1.0.0 5 miRNAs were quantified based on miRBase version 22.0 piRNAs were quantified using proTRAC version 2.2.0 Genome build: danRer11 Supplementary files format and content: tab delimited text file includes read number and RPM of miRNA expression for each sample … | PGCs | PGCs were picked out by green fluoresence small RNA seq library was constructed by microscale small RNA high throughput sequencing method. | cell type:primordial germ cells|strain:AB|tissue:gonad | GSM4777190 | GSM4777190: h6 2: PGCs 6hpf repeat2; Danio rerio; miRNA Seq | GSM4777190 | 1 | PGCs were picked out by green fluoresence small RNA seq library was constructed by microscale small RNA high throughput sequencing method. | GEO Accession:GSM4777190 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | HiSeq X Ten | SRP282187 | h6_2.fastq | fastq | 2330922150.0 | 15539481.0 | GSM4777190 r1 | 0:150 1:0 | A:563758043;C:619336180;G:552040747;T:595747277;N:39903 | 150 | 0 | 563758043 | 619336180 | 552040747 | 595747277 | 39903 | SRX9110493 | SRS7353476 | SRA1124474 | GEO | Shanghai Institute of Biochemistry and Cell Biology,CAS | 1 | 0.00014 | 0.0 | 0.99997 | 1.0 | 150 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | unknown | bulk | unknown | unknown | China | 2020-09-12 | Gastrula | Embryo | Gonad | Reproductive System | ||||||||||||||||||
| 60892 | 60892 | SRR12628229 | SRX9110492 | SRS7353475 | SRP282187 | PRJNA663091 | Characterization of small RNAs in early zebrafish PGCs | GSE157865 | Transcriptome Analysis | Microscale small RNA high throughput sequencing was used to study small RNA distribution in early zebrafish PGCs primordial germ cells. We find that early zebrafish PGCs have large quantities of piRNAs and small quantities of miRNAs. Among the miRNAs detected miR 430 accounted for the majority which has been proved to play diverse roles in zebrafish development. In addition miR 92a 3p and miR 26a 5p have high expression and previous studies show that these two miRNAs can influence cell proliferation in cancer cells. More experiments should be performed in the future to explore whether miR 92a 3p and miR 26a 5p can influence the number of zebrafish PGCs. Overall design: Small RNA profiles at 6 hpf shield stage 11 hpf 3 somite stage and 24 hpf prim 5 stage of zebrafish PGCs | pubmed:33506864 | h6 1: PGCs 6hpf repeat1 | GSM4777189 | source name:PGCs|cell type:primordial germ cells|strain:AB|tissue:gonad | h6 1: PGCs 6hpf repeat1 | Raw reads were pre processed by FASTX Toolkit version 0.0.14 1 Reads were mapped to danRer11 using bowtie version 1.0.0 5 miRNAs were quantified based on miRBase version 22.0 piRNAs were quantified using proTRAC version 2.2.0 Genome build: danRer11 Supplementary files format and content: tab delimited text file includes read number and RPM of miRNA expression for each sample … | PGCs | PGCs were picked out by green fluoresence small RNA seq library was constructed by microscale small RNA high throughput sequencing method. | cell type:primordial germ cells|strain:AB|tissue:gonad | GSM4777189 | GSM4777189: h6 1: PGCs 6hpf repeat1; Danio rerio; miRNA Seq | GSM4777189 | 1 | PGCs were picked out by green fluoresence small RNA seq library was constructed by microscale small RNA high throughput sequencing method. | GEO Accession:GSM4777189 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | HiSeq X Ten | SRP282187 | h6_1.fastq | fastq | 1979588400.0 | 13197256.0 | GSM4777189 r1 | 0:150 1:0 | A:453046525;C:471873747;G:495904656;T:558729697;N:33775 | 150 | 0 | 453046525 | 471873747 | 495904656 | 558729697 | 33775 | SRX9110492 | SRS7353475 | SRA1124474 | GEO | Shanghai Institute of Biochemistry and Cell Biology,CAS | 1 | 0.00028 | 0.0 | 0.99997 | 1.0 | 150 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | unknown | bulk | unknown | unknown | China | 2020-09-12 | Gastrula | Embryo | Gonad | Reproductive System |
Advanced export
JSON shape: default, array, newline-delimited
CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;